Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC35E2	9906	broad.mit.edu	37	1	1669760	1669760	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1669760C>A	uc001aib.1	-	4	1002	c.586G>T	c.(586-588)GGA>TGA	p.G196*	SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Missense_Mutation_p.G196W|SLC35E2_uc001ahy.2_Nonsense_Mutation_p.G196*|SLC35E2_uc001ahz.2_Nonsense_Mutation_p.G196*	NM_182838	NP_878258	P0CK97	S35E2_HUMAN	solute carrier family 35, member E2	196						integral to membrane				pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGGGCCTCACCTGTGTACTCC	0.647													4	11	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7724195	7724195	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7724195A>T	uc001aoi.2	+	9	1795	c.1588A>T	c.(1588-1590)AAG>TAG	p.K530*		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	530					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CGTCCTCACCAAGGAGATCAA	0.637													5	59	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9790454	9790454	+	3'UTR	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9790454T>G	uc001aqh.2	-	19					CLSTN1_uc001aqi.2_3'UTR|CLSTN1_uc010oag.1_3'UTR|CLSTN1_uc001aqf.2_3'UTR	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1						homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGGAGGGGTCTGCACACCT	0.617													5	11	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21221934	21221934	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21221934T>C	uc001bec.2	-	12	2148	c.1892A>G	c.(1891-1893)GAC>GGC	p.D631G	EIF4G3_uc010odi.1_Missense_Mutation_p.D235G|EIF4G3_uc010odj.1_Missense_Mutation_p.D630G|EIF4G3_uc009vpz.2_Missense_Mutation_p.D351G|EIF4G3_uc001bed.2_Missense_Mutation_p.D631G|EIF4G3_uc001bef.2_Missense_Mutation_p.D630G|EIF4G3_uc001bee.2_Missense_Mutation_p.D637G	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	631					interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GAACTGGAAGTCCAGCAGAAA	0.463													7	72	---	---	---	---	PASS
EXTL1	2134	broad.mit.edu	37	1	26349162	26349162	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26349162T>G	uc001blf.2	+	1	892	c.25T>G	c.(25-27)TCC>GCC	p.S9A		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	9	Cytoplasmic (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		GAGAAGAAAGTCCCTGTGGCT	0.667													4	63	---	---	---	---	PASS
PIGV	55650	broad.mit.edu	37	1	27124373	27124373	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27124373C>T	uc001bmz.2	+	4					PIGV_uc001bmy.2_3'UTR|PIGV_uc009vso.2_Silent_p.N500N|PIGV_uc010ofg.1_3'UTR|PIGV_uc001bna.2_3'UTR	NM_017837	NP_060307	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan class V						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	glycolipid mannosyltransferase activity			ovary(1)	1		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		GCCAACTTAACCCAGGGGTCT	0.473													3	33	---	---	---	---	PASS
IQCC	55721	broad.mit.edu	37	1	32673403	32673403	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32673403T>A	uc001bum.2	+	5	1168	c.1121T>A	c.(1120-1122)TTG>TAG	p.L374*	IQCC_uc009vua.2_Nonsense_Mutation_p.L454*|IQCC_uc010ogz.1_Nonsense_Mutation_p.L274*|DCDC2B_uc001bun.2_5'Flank	NM_018134	NP_060604	Q4KMZ1	IQCC_HUMAN	IQ motif containing C isoform 2	374										ovary(4)	4		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACACAAGAGTTGGGCCTCTCA	0.532													13	120	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32690056	32690056	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32690056G>C	uc001bur.3	+	5	763	c.230G>C	c.(229-231)CGT>CCT	p.R77P	C1orf91_uc001buo.3_5'Flank|C1orf91_uc001bup.3_5'Flank|C1orf91_uc009vub.1_5'Flank|C1orf91_uc010oha.1_5'Flank|C1orf91_uc001buq.3_5'Flank|EIF3I_uc009vuc.2_Missense_Mutation_p.R77P|EIF3I_uc001bus.2_Missense_Mutation_p.R29P	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,	77	WD 2.					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				AACAGCTGTCGTCTCTGGGAC	0.473													4	50	---	---	---	---	PASS
MAP7D1	55700	broad.mit.edu	37	1	36636690	36636690	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36636690G>T	uc001bzz.2	+	2	381	c.165G>T	c.(163-165)ATG>ATT	p.M55I	MAP7D1_uc001caa.2_Missense_Mutation_p.M55I|MAP7D1_uc001cab.2_Missense_Mutation_p.M55I|MAP7D1_uc001cac.2_5'Flank	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	55	Pro-rich.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				CTCCTGCCATGAAGAATGCCA	0.652													9	88	---	---	---	---	PASS
SLC6A9	6536	broad.mit.edu	37	1	44466560	44466560	+	Intron	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44466560C>T	uc001cll.2	-						SLC6A9_uc009vxe.2_Intron|SLC6A9_uc010okm.1_Silent_p.L501L|SLC6A9_uc001clm.2_Intron|SLC6A9_uc009vxd.2_Intron|SLC6A9_uc010okn.1_Intron|SLC6A9_uc001cln.2_Intron|SLC6A9_uc010oko.1_Intron|SLC6A9_uc010okp.1_Intron	NM_201649	NP_964012	P48067	SC6A9_HUMAN	solute carrier family 6 member 9 isoform 2							integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity				0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GGGGGGTCAGCAGACCCGCAG	0.622													3	35	---	---	---	---	PASS
KTI12	112970	broad.mit.edu	37	1	52499087	52499087	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52499087C>T	uc001ctj.1	-	1	386	c.347G>A	c.(346-348)GGA>GAA	p.G116E	TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated	116							ATP binding			central_nervous_system(2)	2						CACCTGAGGTCCCGCGATCGG	0.701													5	65	---	---	---	---	PASS
SCP2	6342	broad.mit.edu	37	1	53504595	53504595	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53504595G>A	uc001cur.1	+	14	1466	c.1345G>A	c.(1345-1347)GAA>AAA	p.E449K	SCP2_uc001cus.1_RNA|SCP2_uc010ono.1_Missense_Mutation_p.E368K|SCP2_uc010onp.1_Missense_Mutation_p.E425K|SCP2_uc009vzi.1_Missense_Mutation_p.E405K|SCP2_uc010onq.1_Missense_Mutation_p.E45K|SCP2_uc001cut.1_Missense_Mutation_p.E42K|SCP2_uc001cuu.1_Intron	NM_002979	NP_002970	P22307	NLTP_HUMAN	sterol carrier protein 2 isoform 1 proprotein	449	SCP2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|lipid transport	mitochondrion|nucleus|peroxisomal matrix	propanoyl-CoA C-acyltransferase activity|propionyl-CoA C2-trimethyltridecanoyltransferase activity|protein binding|sterol binding			breast(1)	1						CCAGGAAGGGGAACAGTTTGT	0.423													10	110	---	---	---	---	PASS
SSBP3	23648	broad.mit.edu	37	1	54707879	54707879	+	Silent	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54707879C>A	uc001cxe.2	-	11	1021	c.723G>T	c.(721-723)CCG>CCT	p.P241P	SSBP3_uc001cxf.2_Silent_p.P221P|SSBP3_uc001cxg.2_Silent_p.P214P	NM_145716	NP_663768	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3 isoform a	241	Gly-rich.|Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0						TGCCAGCTCCCGGGCCCCTGA	0.587													8	166	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78098166	78098166	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78098166C>A	uc001dhq.2	-	5	1350	c.874G>T	c.(874-876)GTT>TTT	p.V292F	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.V292F|ZZZ3_uc001dhp.2_Missense_Mutation_p.V292F	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	292					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						AGCTGATTAACATGTTCCACA	0.468													3	86	---	---	---	---	PASS
C1orf146	388649	broad.mit.edu	37	1	92709803	92709803	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92709803G>A	uc001doq.2	+	4	262	c.190G>A	c.(190-192)GAA>AAA	p.E64K	C1orf146_uc010ote.1_Missense_Mutation_p.E5K	NM_001012425	NP_001012425	Q5VVC0	CA146_HUMAN	hypothetical protein LOC388649	64										ovary(1)	1		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)		GGATACTAAGGAATGTCTTCT	0.299													6	42	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93683394	93683394	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93683394C>A	uc001dpq.2	+	14	2452	c.2284C>A	c.(2284-2286)CAG>AAG	p.Q762K	CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	643	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCACTTGGAACAGCATAAAGA	0.303													4	42	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107937933	107937933	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107937933G>C	uc001dvh.3	+	4	1763	c.1045G>C	c.(1045-1047)GGC>CGC	p.G349R	NTNG1_uc001dvf.3_Missense_Mutation_p.G349R|NTNG1_uc010out.1_Missense_Mutation_p.G349R|NTNG1_uc001dvc.3_Missense_Mutation_p.G349R|NTNG1_uc001dvi.2_5'UTR|NTNG1_uc001dve.2_RNA|NTNG1_uc009wek.2_RNA|NTNG1_uc001dvg.2_RNA|NTNG1_uc009wem.2_Missense_Mutation_p.R21T|NTNG1_uc001dvd.1_Missense_Mutation_p.G349R	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	349	Laminin EGF-like 1.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CATCCCCAAAGGCACTGCAAA	0.453													6	94	---	---	---	---	PASS
STXBP3	6814	broad.mit.edu	37	1	109342863	109342863	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109342863G>A	uc001dvy.2	+	17	1546	c.1471G>A	c.(1471-1473)GAT>AAT	p.D491N	STXBP3_uc001dvz.2_RNA	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3	491					negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TAATAGATTAGATTCAAAAGA	0.338													9	42	---	---	---	---	PASS
MAGI3	260425	broad.mit.edu	37	1	114201796	114201796	+	Silent	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114201796G>C	uc001edk.2	+	16	2905	c.2724G>C	c.(2722-2724)GGG>GGC	p.G908G	MAGI3_uc001edh.3_Silent_p.G933G|MAGI3_uc001edi.3_Silent_p.G908G|MAGI3_uc010owm.1_Silent_p.G933G|MAGI3_uc001edj.2_Silent_p.G629G	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	933	Interaction with LPAR2 and GRIN2B.|PDZ 5.				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGTGAATGGGCAGTCCATTG	0.453													11	93	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116569600	116569600	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116569600A>G	uc001egb.3	+	5	815	c.685A>G	c.(685-687)ATT>GTT	p.I229V	SLC22A15_uc001ega.2_Missense_Mutation_p.I229V	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	229	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GACCCTAGCCATTCTGGTTAA	0.433													8	105	---	---	---	---	PASS
GATAD2B	57459	broad.mit.edu	37	1	153792155	153792155	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153792155T>C	uc001fdb.3	-	3	636	c.392A>G	c.(391-393)AAT>AGT	p.N131S		NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	131						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAAGCCTCATTGTCAGACAA	0.398													13	90	---	---	---	---	PASS
TPM3	7170	broad.mit.edu	37	1	154130224	154130224	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154130224C>T	uc001fdz.1	-	8					TPM3_uc001fdx.1_Intron|TPM3_uc010pei.1_Intron|TPM3_uc001fdy.1_Intron|TPM3_uc001fea.1_Intron|TPM3_uc001feb.1_3'UTR|TPM3_uc010pej.1_Intron|TPM3_uc009wor.2_Intron|NUP210L_uc001fdw.2_5'Flank|NUP210L_uc010peh.1_5'Flank	NM_001043353	NP_001036818	P06753	TPM3_HUMAN	tropomyosin 3 isoform 5						cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					AGAGAAGTTACAAGAACTAGA	0.468			T	NTRK1|ALK	papillary thyroid|ALCL								5	58	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155449667	155449667	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155449667C>G	uc009wqq.2	-	3	3474	c.2994G>C	c.(2992-2994)TTG>TTC	p.L998F	ASH1L_uc001fkt.2_Missense_Mutation_p.L998F|ASH1L_uc009wqr.1_Missense_Mutation_p.L998F	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	998					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GAATCTGATTCAACAGTTTCT	0.313													5	75	---	---	---	---	PASS
APOA1BP	128240	broad.mit.edu	37	1	156563828	156563828	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156563828G>A	uc001fph.2	+	6	858	c.819G>A	c.(817-819)CTG>CTA	p.L273L	APOA1BP_uc001fpg.2_3'UTR|APOA1BP_uc001fpi.2_Missense_Mutation_p.E255K|APOA1BP_uc001fpj.2_Silent_p.L190L|APOA1BP_uc001fpk.2_Silent_p.L170L|APOA1BP_uc010php.1_Silent_p.L170L	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor	273	YjeF N-terminal.					extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGTACCAGCTGAACCTGCCAC	0.547													7	106	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161018826	161018826	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018826T>C	uc001fxl.2	-	12	2331	c.1985A>G	c.(1984-1986)CAG>CGG	p.Q662R	ARHGAP30_uc001fxk.2_Missense_Mutation_p.Q662R|ARHGAP30_uc001fxm.2_Missense_Mutation_p.Q508R|ARHGAP30_uc009wtx.2_Missense_Mutation_p.Q335R|ARHGAP30_uc001fxn.1_Missense_Mutation_p.Q508R	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	662	Glu-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			AGGCTCAGCCTGCTTGTCCTC	0.617													26	145	---	---	---	---	PASS
FMO4	2329	broad.mit.edu	37	1	171303803	171303803	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171303803G>C	uc001gho.2	+	8	1298	c.1081G>C	c.(1081-1083)GAG>CAG	p.E361Q		NM_002022	NP_002013	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	361					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			kidney(2)|skin(1)	3	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CTTAAACCTAGAGAGAGCGAC	0.403													10	92	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186159026	186159026	+	3'UTR	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186159026C>A	uc001grq.1	+	107					HMCN1_uc001grs.1_3'UTR	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TCTCCAAAGCCTATTCCACAT	0.428													12	98	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186329966	186329966	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186329966C>G	uc001grv.2	-	10	1327	c.1030G>C	c.(1030-1032)GAG>CAG	p.E344Q	TPR_uc010pop.1_Missense_Mutation_p.E420Q	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	344	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCTATTTTCTCAAGCATTTCT	0.348			T	NTRK1	papillary thyroid								3	51	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186330823	186330823	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186330823C>G	uc001grv.2	-	9	1186	c.889G>C	c.(889-891)GAA>CAA	p.E297Q	TPR_uc010pop.1_Missense_Mutation_p.E373Q	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	297	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTCTTTGCTTCTGAGTCATCA	0.373			T	NTRK1	papillary thyroid								7	78	---	---	---	---	PASS
MYBPH	4608	broad.mit.edu	37	1	203139485	203139485	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203139485C>T	uc001gzh.1	-	7	1086	c.1027G>A	c.(1027-1029)GAA>AAA	p.E343K	FMOD_uc010pqi.1_Intron	NM_004997	NP_004988	Q13203	MYBPH_HUMAN	myosin binding protein H	343	Fibronectin type-III 2.				cell adhesion|regulation of striated muscle contraction	myosin filament	structural constituent of muscle				0			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		CACAGGTTTTCTGAGAAGACC	0.597													3	48	---	---	---	---	PASS
LAX1	54900	broad.mit.edu	37	1	203743363	203743363	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203743363G>A	uc001haa.2	+	5	1161	c.751G>A	c.(751-753)GAC>AAC	p.D251N	LAX1_uc010pql.1_Missense_Mutation_p.D235N|LAX1_uc001hab.2_Missense_Mutation_p.D175N	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a	251	Cytoplasmic (Potential).				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGGAGCTGAGGACAGTGATTC	0.488													5	40	---	---	---	---	PASS
SLC26A9	115019	broad.mit.edu	37	1	205902176	205902176	+	Silent	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205902176C>A	uc001hdq.2	-	3	276	c.162G>T	c.(160-162)GGG>GGT	p.G54G	SLC26A9_uc001hdp.2_Silent_p.G54G	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	54	Helical; (Potential).					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			CAGGCAGCAGCCCAAACACCA	0.547													6	42	---	---	---	---	PASS
SLC26A9	115019	broad.mit.edu	37	1	205902177	205902177	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205902177C>T	uc001hdq.2	-	3	275	c.161G>A	c.(160-162)GGG>GAG	p.G54E	SLC26A9_uc001hdp.2_Missense_Mutation_p.G54E	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	54	Helical; (Potential).					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGCAGCAGCCCAAACACCAC	0.547													7	44	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214656164	214656164	+	Intron	SNP	A	G	G	rs58782956		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656164A>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TTAAAAGAGGACAGGTTTGGC	0.388													3	43	---	---	---	---	PASS
RRP15	51018	broad.mit.edu	37	1	218504452	218504452	+	3'UTR	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218504452A>G	uc001hlj.2	+	5					RRP15_uc001hlk.2_RNA	NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog							mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		AGGAAATACAATTGCAGTCGT	0.378													3	21	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227174193	227174193	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227174193G>T	uc001hqm.1	+	20	5118	c.1699G>T	c.(1699-1701)GGG>TGG	p.G567W	CABC1_uc001hqn.1_Missense_Mutation_p.G567W|CABC1_uc009xeq.1_Missense_Mutation_p.G515W|CABC1_uc010pvq.1_Missense_Mutation_p.G288W|CABC1_uc010pvr.1_Missense_Mutation_p.G241W|CABC1_uc001hqo.1_Missense_Mutation_p.G288W|CABC1_uc009xer.1_Missense_Mutation_p.G83W	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	567					cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CCTCATCCTGGGGGAGGCCTT	0.587													8	56	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227227863	227227863	+	Silent	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227227863C>G	uc001hqr.2	-	23	4006	c.3063G>C	c.(3061-3063)GTG>GTC	p.V1021V	CDC42BPA_uc001hqq.2_Silent_p.V320V|CDC42BPA_uc001hqs.2_Silent_p.V940V|CDC42BPA_uc009xes.2_Silent_p.V993V|CDC42BPA_uc010pvs.1_Silent_p.V1001V|CDC42BPA_uc001hqp.2_Silent_p.V177V|CDC42BPA_uc001hqu.1_Silent_p.V228V	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	1034	Phorbol-ester/DAG-type.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TTATTAAACCCACCATCAAGG	0.343													8	58	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235972029	235972029	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235972029G>A	uc001hxj.2	-	5	2264	c.2089C>T	c.(2089-2091)CAG>TAG	p.Q697*	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Nonsense_Mutation_p.Q697*	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	697	WD 1.				defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ACAAAGTTCTGATAAGCCTTT	0.368									Chediak-Higashi_syndrome				6	52	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237756804	237756804	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237756804G>A	uc001hyl.1	+	33	4424	c.4304G>A	c.(4303-4305)GGA>GAA	p.G1435E		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1435	Cytoplasmic (By similarity).|B30.2/SPRY 3.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCTTTCCTGGACAAGAACCT	0.393													6	49	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247053295	247053295	+	Missense_Mutation	SNP	C	T	T	rs140782802	byFrequency	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247053295C>T	uc001ibu.1	-	16	2124	c.2117G>A	c.(2116-2118)CGT>CAT	p.R706H	AHCTF1_uc001ibv.1_Missense_Mutation_p.R715H|AHCTF1_uc009xgs.1_5'UTR	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	706	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTCTGTCGACGACTGGTGTA	0.343													21	113	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228278	21228278	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228278G>C	uc002red.2	-	26	11590	c.11462C>G	c.(11461-11463)ACT>AGT	p.T3821S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3821					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGGGACACAGTTAACTGAGA	0.423													4	167	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21249677	21249677	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21249677C>T	uc002red.2	-	15	2355	c.2227G>A	c.(2227-2229)GAT>AAT	p.D743N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	743					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGTTTATCATCTTTGGTATAG	0.393													7	93	---	---	---	---	PASS
C2orf63	130162	broad.mit.edu	37	2	55402848	55402848	+	3'UTR	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55402848G>C	uc002ryi.2	-	13					C2orf63_uc002ryh.2_3'UTR|C2orf63_uc002ryj.2_3'UTR	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1								binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			TTATAAGTTAGTTACGTTAAA	0.303													5	12	---	---	---	---	PASS
SMYD1	150572	broad.mit.edu	37	2	88387407	88387407	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88387407T>G	uc002ssr.2	+	3	343	c.341T>G	c.(340-342)GTG>GGG	p.V114G	SMYD1_uc002ssq.1_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	114					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						ATGTGGCGGGTGGAGAGAGAA	0.542													3	3	---	---	---	---	PASS
LOC150776	150776	broad.mit.edu	37	2	132276730	132276730	+	5'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132276730C>T	uc002tsz.3	+	1					LOC150776_uc002tsy.3_RNA					Homo sapiens cDNA FLJ41352 fis, clone BRAWH2014645.												0						CATGGCTGGGCTTTAGCTCCA	0.597													8	50	---	---	---	---	PASS
DARS	1615	broad.mit.edu	37	2	136673932	136673932	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136673932C>T	uc002tux.1	-	11	1154	c.970G>A	c.(970-972)GAA>AAA	p.E324K	DARS_uc010fnj.1_Missense_Mutation_p.E224K	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	324					aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	GTTTGAATTTCAGTCTGAAAC	0.348													7	87	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138320875	138320875	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138320875G>C	uc002tva.1	+	15	3136	c.3136G>C	c.(3136-3138)GAG>CAG	p.E1046Q	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AATCAACAATGAGCTGAGGTC	0.453													4	24	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145147516	145147516	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145147516G>A	uc002tvu.2	-	10	3627	c.3147C>T	c.(3145-3147)CAC>CAT	p.H1049H	ZEB2_uc002tvv.2_Silent_p.H1043H|ZEB2_uc010zbm.1_Silent_p.H1020H|ZEB2_uc010fnp.2_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	1049	C2H2-type 6.					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTCGCCCGAGTGAAGCCTTG	0.478													8	49	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163236421	163236421	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163236421C>G	uc002uch.1	-	14	3285	c.3073G>C	c.(3073-3075)GAC>CAC	p.D1025H		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	1025	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TAGGTGAGGTCGCTTTCGGTT	0.517													12	154	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167141017	167141017	+	Silent	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167141017G>T	uc010fpl.2	-	12	2261	c.1920C>A	c.(1918-1920)CCC>CCA	p.P640P	uc002udp.2_Intron|SCN9A_uc002udr.1_Silent_p.P511P|SCN9A_uc002uds.1_Silent_p.P511P|SCN9A_uc002udt.1_Silent_p.P511P	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	640						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	GCTGTCCATTGGGGAGCATGA	0.547													3	27	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170009322	170009322	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170009322C>A	uc002ues.2	-	67	12661	c.12448G>T	c.(12448-12450)GAC>TAC	p.D4150Y		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4150	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CCAACCCAGTCCACTGCTATT	0.478													13	137	---	---	---	---	PASS
HNRNPA3	220988	broad.mit.edu	37	2	178082493	178082493	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178082493C>T	uc002ulb.1	+	8	987	c.881C>T	c.(880-882)CCA>CTA	p.P294L	HNRNPA3_uc002ulc.1_Missense_Mutation_p.P294L|HNRNPA3_uc002uld.2_Missense_Mutation_p.P272L|HNRNPA3_uc002ule.2_Missense_Mutation_p.P71L	NM_194247	NP_919223	P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	294	Gly-rich.					catalytic step 2 spliceosome|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(2)	2						GGTGGTGGACCAGGATATGGA	0.438													10	120	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202131238	202131238	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202131238T>C	uc002uxr.1	+	3	238	c.29T>C	c.(28-30)ATT>ACT	p.I10T	CASP8_uc010ftc.1_Missense_Mutation_p.I10T|CASP8_uc002uxo.1_Missense_Mutation_p.I10T|CASP8_uc002uxp.1_Missense_Mutation_p.I10T|CASP8_uc002uxq.1_Missense_Mutation_p.I10T|CASP8_uc002uxs.1_Missense_Mutation_p.I10T|CASP8_uc002uxt.1_Missense_Mutation_p.I69T|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_Intron|CASP8_uc002uxv.1_Missense_Mutation_p.I10T|CASP8_uc002uxw.1_Missense_Mutation_p.I10T|CASP8_uc002uxy.1_Missense_Mutation_p.I10T|CASP8_uc002uxx.1_Missense_Mutation_p.I10T|CASP8_uc010ftf.2_Missense_Mutation_p.I10T	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	10	DED 1.				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						CTTTATGATATTGGGGAACAA	0.408										HNSCC(4;0.00038)			6	60	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220154823	220154823	+	3'UTR	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220154823C>G	uc002vkz.2	-	23					PTPRN_uc010zlc.1_3'UTR|PTPRN_uc002vla.2_3'UTR	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N						response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CTTCCTGACTCTTCTAGGAAG	0.642													3	10	---	---	---	---	PASS
SCLY	51540	broad.mit.edu	37	2	238999877	238999877	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238999877G>A	uc010fyv.2	+	8	967	c.903G>A	c.(901-903)ATG>ATA	p.M301I	SCLY_uc002vxm.3_Missense_Mutation_p.M268I|SCLY_uc002vxn.2_Missense_Mutation_p.M301I|SCLY_uc010znq.1_Intron|SCLY_uc010znr.1_Missense_Mutation_p.M207I	NM_016510	NP_057594	Q96I15	SCLY_HUMAN	selenocysteine lyase	301					cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		ACACCCCAATGATTGCTGGCC	0.463													10	111	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10370803	10370803	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10370803C>T	uc003bvt.2	-	23	3866	c.3427G>A	c.(3427-3429)GTC>ATC	p.V1143I	ATP2B2_uc003bvv.2_Missense_Mutation_p.V1098I|ATP2B2_uc003bvw.2_Missense_Mutation_p.V1098I|ATP2B2_uc003bvs.2_RNA|ATP2B2_uc010hdo.2_Missense_Mutation_p.V848I|hsa-mir-378b|MI0014154_5'Flank	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	1143	Calmodulin-binding subdomain B (By similarity).|Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GCCTTCACGACGCGGATCTGC	0.582													4	57	---	---	---	---	PASS
TRIM71	131405	broad.mit.edu	37	3	32927521	32927521	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32927521G>A	uc003cff.2	+	3	1179	c.1116G>A	c.(1114-1116)AAG>AAA	p.K372K		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	372					multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						CGAGGCATAAGAAAGCCCTGG	0.617													5	39	---	---	---	---	PASS
CCR4	1233	broad.mit.edu	37	3	32996003	32996003	+	3'UTR	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32996003T>C	uc003cfg.1	+	2						NM_005508	NP_005499	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4						chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response	integral to plasma membrane				lung(1)	1						TGTAGAAAAATGAAATGGTGA	0.428													3	34	---	---	---	---	PASS
SLC22A13	9390	broad.mit.edu	37	3	38318947	38318947	+	Silent	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38318947A>G	uc003chz.3	+	10	1701	c.1647A>G	c.(1645-1647)ACA>ACG	p.T549T		NM_004256	NP_004247	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion	549	Cytoplasmic (Potential).					integral to plasma membrane	organic cation transmembrane transporter activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TGAGCAGCACATACTTCTGAT	0.562													6	67	---	---	---	---	PASS
CCDC36	339834	broad.mit.edu	37	3	49294677	49294677	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49294677G>A	uc003cwk.2	+	10	2134	c.1747G>A	c.(1747-1749)GAC>AAC	p.D583N	CCDC36_uc011bck.1_Missense_Mutation_p.D583N	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	583										ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		TTTGCTCTATGACCTGGGTTT	0.488													13	118	---	---	---	---	PASS
HSPBAP1	79663	broad.mit.edu	37	3	122459659	122459659	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122459659C>T	uc003efu.1	-	8	1123	c.1000G>A	c.(1000-1002)GAT>AAT	p.D334N	HSPBAP1_uc003eft.1_Missense_Mutation_p.D45N	NM_024610	NP_078886	Q96EW2	HBAP1_HUMAN	Hspb associated protein 1	334						cytoplasm				ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.0531)		CTGCAGCGATCAAAAAATGCA	0.403													11	131	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	156234066	156234066	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156234066C>T	uc003far.2	+	11	937	c.873C>T	c.(871-873)GGC>GGT	p.G291G	KCNAB1_uc011bon.1_Silent_p.G262G|KCNAB1_uc003fas.2_Silent_p.G280G|KCNAB1_uc003fat.2_Silent_p.G273G|KCNAB1_uc010hvt.1_Silent_p.G244G|KCNAB1_uc011boo.1_Silent_p.G167G	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	291						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TAGGTGTTGGCGCAATGACAT	0.453													5	45	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169896709	169896709	+	5'UTR	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169896709G>A	uc010hws.1	-	2					PHC3_uc003fgl.2_Missense_Mutation_p.T11I|PHC3_uc011bpq.1_Missense_Mutation_p.T11I|PHC3_uc011bpr.1_Missense_Mutation_p.T11I|PHC3_uc003fgm.2_Missense_Mutation_p.T11I|PHC3_uc003fgo.1_5'UTR|PHC3_uc003fgp.3_Missense_Mutation_p.T11I|PHC3_uc003fgq.3_Missense_Mutation_p.T11I|PHC3_uc003fgr.1_RNA	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ATCCATAGCTGTACTATGGTC	0.343													12	208	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			6	38	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2950082	2950082	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2950082C>G	uc003ggj.1	-	9	1408	c.1336G>C	c.(1336-1338)GAG>CAG	p.E446Q	C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Missense_Mutation_p.E192Q|NOP14_uc003ggk.3_Missense_Mutation_p.E446Q|NOP14_uc003ggl.2_Missense_Mutation_p.E446Q	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14	446					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						AAAAGCTGCTCTTCCATCGAT	0.413													10	88	---	---	---	---	PASS
UGDH	7358	broad.mit.edu	37	4	39523129	39523129	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39523129A>G	uc003guk.1	-	2	320	c.4T>C	c.(4-6)TTT>CTT	p.F2L	UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Missense_Mutation_p.F2L	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase	2					glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	TTAATTTCAAACATGATTGTA	0.333													3	58	---	---	---	---	PASS
SLC30A9	10463	broad.mit.edu	37	4	42069148	42069148	+	Silent	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42069148T>C	uc003gwl.2	+	14	1337	c.1191T>C	c.(1189-1191)GAT>GAC	p.D397D	SLC30A9_uc011byx.1_Silent_p.D157D	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),	397	Helical; (Potential).				nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						TATTGGAGGATACTGCTGCAG	0.353													5	110	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68928744	68928744	+	Intron	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68928744A>G	uc003hdt.1	-						LOC550112_uc003hdl.3_RNA|uc011cak.1_RNA|SYT14L_uc010ihn.2_RNA	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TGACACGCTCATTTGGGAGTC	0.418													14	84	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69692212	69692212	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69692212C>T	uc003hee.2	+	4	1109	c.1084C>T	c.(1084-1086)CTA>TTA	p.L362L	UGT2B10_uc011cam.1_Silent_p.L278L	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	362					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GAATGACCTTCTAGGTAACAC	0.378													5	63	---	---	---	---	PASS
HSD17B13	345275	broad.mit.edu	37	4	88239530	88239530	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88239530T>C	uc003hqo.2	-	2	332	c.269A>G	c.(268-270)TAT>TGT	p.Y90C	HSD17B13_uc010ikk.2_Intron	NM_178135	NP_835236	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	90						extracellular region	binding|oxidoreductase activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		GTCTACCACATACGCATGCGC	0.458													6	62	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113468478	113468478	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113468478C>G	uc003iau.2	-	24	5772	c.5561G>C	c.(5560-5562)GGA>GCA	p.G1854A	C4orf21_uc003iav.2_RNA|C4orf21_uc003iat.2_Missense_Mutation_p.G312A	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	676						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTGTTCCAATCCATTTTCATG	0.373													3	31	---	---	---	---	PASS
SH3D19	152503	broad.mit.edu	37	4	152065152	152065152	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152065152C>G	uc010ipl.1	-	13	2452	c.1362G>C	c.(1360-1362)GAG>GAC	p.E454D	SH3D19_uc003imb.2_Missense_Mutation_p.E209D|SH3D19_uc003imc.2_Missense_Mutation_p.E395D|SH3D19_uc003ime.2_Missense_Mutation_p.E431D|SH3D19_uc010ipm.2_Missense_Mutation_p.E431D	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a	454	SH3 1.				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCTTTTGGCACTCCAAGTAAT	0.398													4	55	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247366	153247366	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247366C>G	uc003ims.2	-	10	1585	c.1436G>C	c.(1435-1437)CGA>CCA	p.R479P	FBXW7_uc011cii.1_Missense_Mutation_p.R479P|FBXW7_uc003imt.2_Missense_Mutation_p.R479P|FBXW7_uc011cih.1_Missense_Mutation_p.R303P|FBXW7_uc003imq.2_Missense_Mutation_p.R399P|FBXW7_uc003imr.2_Missense_Mutation_p.R361P	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	479	WD 3.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R479Q(31)|p.R479L(7)|p.R479G(3)|p.R399Q(2)|p.R240L(1)|p.R399L(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGTGGCATCTCGAGAACCGCT	0.403			Mis|N|D|F		colorectal|endometrial|T-ALL								5	59	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156715077	156715077	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156715077G>C	uc003ipc.2	+	6	732	c.565G>C	c.(565-567)GAG>CAG	p.E189Q	GUCY1B3_uc011cio.1_Missense_Mutation_p.E211Q|GUCY1B3_uc011cip.1_Missense_Mutation_p.E169Q|GUCY1B3_uc003ipd.2_Missense_Mutation_p.E117Q|GUCY1B3_uc010iqf.2_Missense_Mutation_p.E189Q|GUCY1B3_uc010iqg.2_Missense_Mutation_p.E117Q|GUCY1B3_uc011ciq.1_Missense_Mutation_p.E117Q	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	189					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GTCAAAAGAAGAGGATTTTTA	0.333													5	53	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187541654	187541654	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187541654G>T	uc003izf.2	-	10	6274	c.6086C>A	c.(6085-6087)TCA>TAA	p.S2029*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2029	Extracellular (Potential).|Cadherin 18.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CAGAACTCCTGAAGTGCGGCT	0.463										HNSCC(5;0.00058)			23	219	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33624410	33624410	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33624410C>T	uc003jia.1	-	14	2232	c.2069G>A	c.(2068-2070)CGC>CAC	p.R690H	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	690	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CACACCGCAGCGATCCTCGGT	0.502										HNSCC(64;0.19)			5	49	---	---	---	---	PASS
ITGA1	3672	broad.mit.edu	37	5	52201583	52201583	+	Intron	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52201583C>T	uc003jou.2	+						ITGA1_uc003jov.2_Intron|ITGA1_uc003jow.2_5'UTR	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor						axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TGGAATCTTTCTTTTGTTAGG	0.368													7	74	---	---	---	---	PASS
GTF2H2	2966	broad.mit.edu	37	5	70351252	70351252	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70351252T>C	uc003kav.3	-	8	607	c.397A>G	c.(397-399)AAA>GAA	p.K133E	NAIP_uc003kat.1_Intron|GTF2H2_uc003kau.3_Missense_Mutation_p.K133E|GTF2H2_uc011crt.1_Missense_Mutation_p.K76E|GTF2H2_uc003kay.1_Missense_Mutation_p.K133E	NM_001515	NP_001506	Q13888	TF2H2_HUMAN	general transcription factor IIH, polypeptide 2,	133	VWFA.				G-protein coupled receptor internalization|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|response to UV|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein N-terminus binding|sequence-specific DNA binding transcription factor activity|translation factor activity, nucleic acid binding|zinc ion binding				0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCCACAGCTTTCTTCAAAGAC	0.289								NER					3	60	---	---	---	---	PASS
JMY	133746	broad.mit.edu	37	5	78610358	78610358	+	Silent	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78610358T>G	uc003kfx.3	+	9	2863	c.2343T>G	c.(2341-2343)CCT>CCG	p.P781P	JMY_uc003kfw.1_Silent_p.P427P	NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	781	Pro-rich.				'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CTGAACTGCCTCCCACTATAT	0.403													6	103	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80390805	80390805	+	Silent	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80390805C>A	uc003kha.1	+	12	1749	c.1749C>A	c.(1747-1749)ATC>ATA	p.I583I	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	583	PH 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TGAGTGACATCAGTCAGGTAA	0.393													6	37	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114499268	114499268	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114499268C>T	uc003kqs.2	-	2	754	c.245G>A	c.(244-246)CGA>CAA	p.R82Q	TRIM36_uc011cwc.1_Missense_Mutation_p.R70Q|TRIM36_uc003kqt.2_Intron	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	82	RING-type; degenerate.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		GAGCCGAAGTCGAGGACTGCT	0.448													5	63	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127484463	127484463	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127484463C>T	uc003kus.2	+	12	2063	c.1899C>T	c.(1897-1899)AAC>AAT	p.N633N	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Silent_p.N633N	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	633	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GTAAGGACAACATCTACCCAG	0.328													10	112	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137756428	137756428	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137756428A>G	uc003lcy.1	+	15	3949	c.3749A>G	c.(3748-3750)GAG>GGG	p.E1250G	KDM3B_uc010jew.1_Missense_Mutation_p.E906G|KDM3B_uc011cys.1_Missense_Mutation_p.E282G	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1250					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						CTCAATAAAGAGTCTCATTCA	0.483													10	66	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140475832	140475832	+	Silent	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475832C>G	uc003lil.2	+	1	1596	c.1458C>G	c.(1456-1458)GCC>GCG	p.A486A	PCDHB2_uc003lim.1_Silent_p.A147A	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	486	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACCAACGCCCAGGTCACCT	0.662													6	111	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153174194	153174194	+	Intron	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153174194C>A	uc003lva.3	+						GRIA1_uc003luy.3_Missense_Mutation_p.L762M|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Missense_Mutation_p.L682M|GRIA1_uc011dcx.1_Missense_Mutation_p.L693M|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Missense_Mutation_p.L772M	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCCAGTAAACCTGGCAGTGTT	0.468													3	41	---	---	---	---	PASS
C5orf58	133874	broad.mit.edu	37	5	169661182	169661182	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169661182G>A	uc010jjn.2	+	2	126	c.43G>A	c.(43-45)GAG>AAG	p.E15K	C5orf58_uc003mal.2_RNA	NM_001102609	NP_001096079	C9J3I9	CE058_HUMAN	hypothetical protein LOC133874	15											0						GGAAAAGGTAGAGGCAAGGAT	0.393													3	28	---	---	---	---	PASS
ZNF346	23567	broad.mit.edu	37	5	176468221	176468221	+	Silent	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176468221A>T	uc003mfi.2	+	2	313	c.270A>T	c.(268-270)GCA>GCT	p.A90A	ZNF346_uc011dfr.1_Silent_p.A90A|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Silent_p.A115A|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411	Q9UL40	ZN346_HUMAN	zinc finger protein 346	90	Matrin-type 1.					cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAAGCTGGCACATTACCAGG	0.458													12	110	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12125108	12125108	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12125108C>T	uc003nac.2	+	4	5259	c.5080C>T	c.(5080-5082)CAG>TAG	p.Q1694*	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1694					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AAAAGGTCATCAGAATGCTTT	0.393													16	93	---	---	---	---	PASS
GPLD1	2822	broad.mit.edu	37	6	24472819	24472819	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24472819G>A	uc003ned.1	-	7	647	c.536C>T	c.(535-537)GCA>GTA	p.A179V	GPLD1_uc010jpr.1_Intron|GPLD1_uc010jps.1_Missense_Mutation_p.A179V	NM_001503	NP_001494	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific	179						extracellular region	glycosylphosphatidylinositol phospholipase D activity			ovary(2)|kidney(1)	3						CCAGCGTCGTGCAAGGTAATT	0.338													9	78	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34003916	34003916	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34003916G>C	uc003oir.3	-	8	2141	c.1971C>G	c.(1969-1971)ATC>ATG	p.I657M	GRM4_uc011dsn.1_Missense_Mutation_p.I610M|GRM4_uc010jvh.2_Missense_Mutation_p.I657M|GRM4_uc010jvi.2_Missense_Mutation_p.I349M|GRM4_uc003oio.2_Missense_Mutation_p.I349M|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.I517M|GRM4_uc003oiq.2_Missense_Mutation_p.I524M|GRM4_uc011dsm.1_Missense_Mutation_p.I488M	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	657	Helical; Name=3; (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GTCCCAGGAAGATTCGGCGCA	0.602													5	43	---	---	---	---	PASS
TEAD3	7005	broad.mit.edu	37	6	35454253	35454253	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35454253C>G	uc003oku.3	-	2	423	c.187G>C	c.(187-189)GAG>CAG	p.E63Q	TEAD3_uc010jvx.2_Silent_p.T45T	NM_003214	NP_003205	Q99594	TEAD3_HUMAN	TEA domain family member 3	63	TEA.				female pregnancy|hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATCTTGCCCTCGTCTGACAGG	0.697													5	40	---	---	---	---	PASS
BRPF3	27154	broad.mit.edu	37	6	36168658	36168658	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36168658C>T	uc003olv.3	+	2	783	c.559C>T	c.(559-561)CTG>TTG	p.L187L	BRPF3_uc010jwb.2_Silent_p.L187L|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Silent_p.L187L	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	187					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						CTTTGAGCTGCTGGTAGACCG	0.527													4	55	---	---	---	---	PASS
PRPH2	5961	broad.mit.edu	37	6	42672298	42672298	+	Silent	SNP	G	A	A	rs61755799		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42672298G>A	uc003osk.2	-	2	919	c.633C>T	c.(631-633)TTC>TTT	p.F211F		NM_000322	NP_000313	P23942	PRPH2_HUMAN	peripherin 2	211	Lumenal (Potential).		F -> L (in RP7).		cell adhesion|visual perception	integral to membrane				ovary(4)|central_nervous_system(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			TGCAGCAGCTGAAAGGGACGC	0.562													5	51	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46849233	46849233	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46849233G>A	uc003oyo.3	-	8	1062	c.773C>T	c.(772-774)ACC>ATC	p.T258I	GPR116_uc003oyp.3_Missense_Mutation_p.T258I|GPR116_uc003oyq.3_Missense_Mutation_p.T258I|GPR116_uc010jzi.1_5'Flank|GPR116_uc003oyr.2_Missense_Mutation_p.T258I	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	258	SEA.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			CATTTTGTAGGTCTGATTGAG	0.368													5	66	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56401661	56401661	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56401661C>T	uc003pdf.2	-	56	10357	c.10329G>A	c.(10327-10329)CAG>CAA	p.Q3443Q	DST_uc003pcz.3_Silent_p.Q3265Q|DST_uc011dxj.1_Silent_p.Q3294Q|DST_uc011dxk.1_Silent_p.Q3305Q|DST_uc003pcy.3_Silent_p.Q2939Q	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5351	Spectrin 7.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGGCAGCACTCTGAATAAGGC	0.433													5	62	---	---	---	---	PASS
LYRM2	57226	broad.mit.edu	37	6	90348209	90348209	+	Intron	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90348209C>T	uc003pnm.2	-						LYRM2_uc010kce.1_5'Flank|LYRM2_uc003png.2_Intron|LYRM2_uc010kcf.1_RNA|LYRM2_uc010kcg.2_RNA|LYRM2_uc003pnl.3_RNA	NM_020466	NP_065199	Q9NU23	LYRM2_HUMAN	LYR motif containing 2												0		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		ACCAAGGAAGCAGCCAGTGCC	0.662													5	18	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109996891	109996891	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109996891C>T	uc003ptn.2	-	2	135	c.58G>A	c.(58-60)GAA>AAA	p.E20K	AKD1_uc003ptr.3_Missense_Mutation_p.E20K|AKD1_uc003pts.1_RNA	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	20					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						CTTTCAGTTTCATCTTCATCA	0.289													4	27	---	---	---	---	PASS
TSPYL1	7259	broad.mit.edu	37	6	116600201	116600201	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116600201G>C	uc003pwp.3	-	1	1080	c.793C>G	c.(793-795)CTG>GTG	p.L265V	DSE_uc011ebf.1_Intron|DSE_uc003pwq.1_5'Flank|DSE_uc003pwr.2_5'Flank|DSE_uc003pws.2_5'Flank	NM_003309	NP_003300	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	265					nucleosome assembly	nucleolus					0		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		CTCCGCTCCAGGTAGTGTCGA	0.562													8	84	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136904781	136904781	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136904781G>A	uc003qhc.2	-	24	3684	c.3323C>T	c.(3322-3324)ACC>ATC	p.T1108I	MAP3K5_uc011edj.1_Missense_Mutation_p.T355I|MAP3K5_uc011edk.1_Missense_Mutation_p.T954I	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	1108					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TGACAGTGTGGTGGCTATGAT	0.463													8	67	---	---	---	---	PASS
TCP1	6950	broad.mit.edu	37	6	160199685	160199685	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199685C>T	uc003qsr.2	-	12					ACAT2_uc010kjy.2_Intron|ACAT2_uc011efw.1_Intron|TCP1_uc003qss.2_3'UTR|TCP1_uc010kjz.2_3'UTR|TCP1_uc003qst.2_3'UTR	NM_030752	NP_110379	P17987	TCPA_HUMAN	T-complex protein 1 isoform a						'de novo' posttranslational protein folding|tubulin complex assembly	cell junction|Golgi apparatus	ATP binding|unfolded protein binding			breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTTTCTCCCCCGTTAGGTCAA	0.418													5	57	---	---	---	---	PASS
GET4	51608	broad.mit.edu	37	7	926266	926266	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:926266G>A	uc003sjl.1	+	3	387	c.295G>A	c.(295-297)GAG>AAG	p.E99K	GET4_uc003sjj.1_RNA	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608	99					tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						GGCGGAAGTGGAGGTGGCTGA	0.597													15	67	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1513805	1513805	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1513805A>G	uc003skn.2	-	41	5929	c.5828T>C	c.(5827-5829)CTG>CCG	p.L1943P	INTS1_uc003skm.1_Missense_Mutation_p.L80P	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1943					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		AGCACACACCAGCAGCAGGCG	0.706											OREG0017827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	13	---	---	---	---	PASS
CHN2	1124	broad.mit.edu	37	7	29539546	29539546	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29539546T>C	uc003szz.2	+	9	1240	c.803T>C	c.(802-804)CTC>CCC	p.L268P	CHN2_uc011jzs.1_Missense_Mutation_p.L343P|CHN2_uc010kva.2_Missense_Mutation_p.L38P|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Missense_Mutation_p.L233P|CHN2_uc011jzt.1_Missense_Mutation_p.L281P|CHN2_uc010kvd.2_Missense_Mutation_p.L124P|CHN2_uc011jzu.1_Missense_Mutation_p.L253P|CHN2_uc010kvg.2_Missense_Mutation_p.L132P|CHN2_uc010kvh.2_Intron|CHN2_uc010kvi.2_Missense_Mutation_p.L132P|CHN2_uc010kve.2_Missense_Mutation_p.L132P|CHN2_uc003taa.2_Missense_Mutation_p.L132P|CHN2_uc010kvf.2_Intron|CHN2_uc010kvj.2_Missense_Mutation_p.L87P|CHN2_uc010kvk.2_Intron|CHN2_uc010kvl.2_RNA|CHN2_uc010kvm.2_Missense_Mutation_p.L87P|CHN2_uc011jzv.1_Missense_Mutation_p.L61P	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	268					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						CAACCTGATCTCAAGAGGATC	0.468													12	46	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36571798	36571798	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36571798G>A	uc003tfh.3	-	18	1781	c.1380C>T	c.(1378-1380)CAC>CAT	p.H460H	AOAH_uc010kxf.2_Silent_p.H460H|AOAH_uc011kba.1_Silent_p.H428H	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	460					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						ACATCCAGCCGTGGCAGGGGC	0.512													7	61	---	---	---	---	PASS
PMS2L11	441263	broad.mit.edu	37	7	76669180	76669180	+	Intron	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669180G>A	uc011kgn.1	+						LOC100132832_uc003ufy.2_RNA					Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						TAAACTATTTGCAGTGTTGAG	0.289													11	26	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101845239	101845239	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101845239C>G	uc003uyx.3	+	18	2700	c.2662C>G	c.(2662-2664)CCA>GCA	p.P888A	CUX1_uc003uys.3_Missense_Mutation_p.P899A|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	888					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CGCTGAGTCCCCATACTCCCA	0.672													12	61	---	---	---	---	PASS
CAV1	857	broad.mit.edu	37	7	116166725	116166725	+	Silent	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116166725C>G	uc003vif.1	+	2	455	c.177C>G	c.(175-177)CTC>CTG	p.L59L	CAV1_uc010lkd.1_Silent_p.L28L|CAV1_uc010lke.1_Silent_p.L28L|CAV1_uc003vig.1_RNA|CAV1_uc003vih.2_Silent_p.L28L|CAV1_uc010lkf.1_Silent_p.L28L	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1	59	Cytoplasmic (Potential).				blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			CTAAACACCTCAACGATGACG	0.577											OREG0018273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	45	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9413396	9413396	+	5'Flank	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9413396G>C	uc003wss.2	+						TNKS_uc011kwv.1_5'Flank|uc003wsr.1_RNA	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		AGTCGGAAGTGAGGGCGGGCG	0.607													6	27	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37732221	37732221	+	Silent	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37732221C>G	uc003xkm.1	-	3	1478	c.1434G>C	c.(1432-1434)GGG>GGC	p.G478G	RAB11FIP1_uc010lvz.1_Silent_p.G326G|RAB11FIP1_uc003xkn.1_Silent_p.G478G|RAB11FIP1_uc003xkl.1_5'Flank|RAB11FIP1_uc003xko.1_5'Flank|RAB11FIP1_uc003xkp.1_Silent_p.G326G	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	478					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CTTCAGCAGGCCCCGATGCGT	0.557													3	134	---	---	---	---	PASS
FNTA	2339	broad.mit.edu	37	8	42939973	42939973	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42939973G>A	uc003xps.2	+	8	1014	c.966G>A	c.(964-966)ATG>ATA	p.M322I	FNTA_uc003xpt.2_Missense_Mutation_p.M231I|FNTA_uc003xpu.2_Missense_Mutation_p.M255I|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	322					cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			ATGAAGACATGCTAGAAAATC	0.358													4	71	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89198769	89198769	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89198769G>A	uc003yeb.3	-	3	622	c.340C>T	c.(340-342)CAT>TAT	p.H114Y	MMP16_uc003yec.2_Missense_Mutation_p.H114Y	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	114					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						CGACGAATATGAAATTTGGAG	0.413													9	154	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110457514	110457514	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110457514C>T	uc003yne.2	+	38	5520	c.5416C>T	c.(5416-5418)CCA>TCA	p.P1806S		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1806	Extracellular (Potential).|IPT/TIG 10.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GACTCCTCTCCCAGTTGGACA	0.468										HNSCC(38;0.096)			7	67	---	---	---	---	PASS
ANXA13	312	broad.mit.edu	37	8	124748098	124748098	+	Intron	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124748098G>A	uc003yqu.2	-						ANXA13_uc003yqt.2_Missense_Mutation_p.S12L	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a						cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			ACTGCCTTCTGAGAGGGTGTA	0.517													4	58	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	434792	434792	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:434792G>A	uc003zgf.2	+	39	5008	c.4896G>A	c.(4894-4896)AAG>AAA	p.K1632K	DOCK8_uc010mgu.2_Silent_p.K934K|DOCK8_uc010mgv.2_Silent_p.K1532K|DOCK8_uc003zgk.2_Silent_p.K1090K	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1632	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAATTGCCAAGAGTTACCAGG	0.478													5	41	---	---	---	---	PASS
PTENP1	11191	broad.mit.edu	37	9	33676580	33676580	+	5'UTR	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33676580C>A	uc003zth.3	-	1						NR_023917				SubName: Full=Phosphatase and tensin homolog 2; Flags: Fragment;												0						TAGGTCAAGTCTAAGTCGAAT	0.393													18	75	---	---	---	---	PASS
RUSC2	9853	broad.mit.edu	37	9	35547473	35547473	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35547473G>A	uc003zww.2	+	2	1210	c.955G>A	c.(955-957)GCC>ACC	p.A319T	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.A319T	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	319						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AGACCCTGGCGCCTTCTATCT	0.567													7	61	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43625185	43625185	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43625185G>A	uc011lrb.1	-	4	3531	c.3502C>T	c.(3502-3504)CAG>TAG	p.Q1168*		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	1168						integral to membrane					0						AAAATCCACTGAAAAAATTGC	0.428													9	186	---	---	---	---	PASS
C9orf3	84909	broad.mit.edu	37	9	97767884	97767884	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97767884G>C	uc004ava.2	+	12	2236	c.2101G>C	c.(2101-2103)GAG>CAG	p.E701Q	C9orf3_uc004auy.2_Missense_Mutation_p.E602Q|C9orf3_uc004auz.1_Missense_Mutation_p.E602Q|C9orf3_uc004avc.2_Missense_Mutation_p.E156Q|C9orf3_uc011luj.1_Missense_Mutation_p.E63Q|C9orf3_uc011luk.1_Missense_Mutation_p.E42Q|C9orf3_uc004avd.2_Missense_Mutation_p.E63Q|C9orf3_uc004ave.1_RNA	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O	701					leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GGAGAAGGAAGAGGTGTTTGA	0.522													8	59	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100249560	100249560	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100249560C>T	uc004axj.2	+	16	3247	c.3022C>T	c.(3022-3024)CTA>TTA	p.L1008L	TDRD7_uc011lux.1_Silent_p.L934L|TDRD7_uc011luy.1_Silent_p.L328L	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	1008	Interacts with CDK17 (By similarity).|Interacts with CABLES1 (By similarity).				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				AGTACAGCCCCTAGTGGACAT	0.433													8	78	---	---	---	---	PASS
C9orf9	11092	broad.mit.edu	37	9	135765272	135765272	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135765272C>T	uc004cbx.1	+	4					C9orf9_uc004cby.1_Intron|C9orf9_uc004cbz.1_3'UTR	NM_018956	NP_061829	Q96E40	CI009_HUMAN	Rsb-66 protein									p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		GAACCCCAAACATTGTAAAAT	0.473													22	214	---	---	---	---	PASS
EGFL7	51162	broad.mit.edu	37	9	139563050	139563050	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139563050C>G	uc004cid.2	+	4	1033	c.122C>G	c.(121-123)TCC>TGC	p.S41C	EGFL7_uc004cif.2_Missense_Mutation_p.S41C|EGFL7_uc004cig.2_RNA|EGFL7_uc010nbp.2_Missense_Mutation_p.S41C|EGFL7_uc004cie.2_Missense_Mutation_p.S41C|EGFL7_uc004cih.2_Missense_Mutation_p.S41C|MIR126_hsa-mir-126|MI0000471_5'Flank	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	41	EMI.				angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GACCCTGTCTCCGAGTCGTTC	0.677													11	97	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5762896	5762896	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5762896C>G	uc001iij.2	+	6	734	c.109C>G	c.(109-111)CTT>GTT	p.L37V		NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	37										ovary(1)|central_nervous_system(1)	2						TGATATAGCTCTTTGGTCCAC	0.333													11	71	---	---	---	---	PASS
SEC61A2	55176	broad.mit.edu	37	10	12204226	12204226	+	Silent	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12204226G>T	uc001ile.2	+	11	1329	c.1182G>T	c.(1180-1182)CTG>CTT	p.L394L	SEC61A2_uc010qbq.1_Silent_p.L372L|SEC61A2_uc001ilf.3_RNA|SEC61A2_uc001ilh.3_RNA|SEC61A2_uc001ilg.3_Silent_p.L394L	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a	394	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				CTAAACAGCTGAAAGAACAGC	0.458													14	193	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50732248	50732248	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50732248C>T	uc001jhs.3	-	5	1382	c.1228G>A	c.(1228-1230)GGC>AGC	p.G410S	PGBD3_uc001jht.2_5'UTR|PGBD3_uc009xoe.2_Missense_Mutation_p.G410S|PGBD3_uc001jhu.2_Missense_Mutation_p.G410S	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	410					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						CGTTTCCCGCCCTTGGGCAGA	0.393								Direct_reversal_of_damage|NER					3	69	---	---	---	---	PASS
ARID5B	84159	broad.mit.edu	37	10	63829550	63829550	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63829550A>G	uc001jlt.1	+	8	1219	c.1193A>G	c.(1192-1194)TAT>TGT	p.Y398C	ARID5B_uc001jlu.1_Missense_Mutation_p.Y155C	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	398	ARID.				liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					CGCAGACATTATGAAAGGTAA	0.418													4	31	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71075755	71075755	+	5'Flank	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71075755G>A	uc001jpl.3	+						HK1_uc009xqc.1_Intron|HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_Silent_p.E15E|HK1_uc009xqd.2_5'Flank	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						GAGGTGCTGAGGCCTGGGAGA	0.463													9	102	---	---	---	---	PASS
ACTA2	59	broad.mit.edu	37	10	90701132	90701132	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90701132G>A	uc001kfp.2	-	6	586	c.470C>T	c.(469-471)TCT>TTT	p.S157F	STAMBPL1_uc010qmx.1_Intron|ACTA2_uc010qmy.1_Missense_Mutation_p.S112F|ACTA2_uc001kfq.2_Missense_Mutation_p.S157F	NM_001613	NP_001604	P62736	ACTA_HUMAN	alpha 2 actin	157					response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		ACCATCTCCAGAGTCCAGCAC	0.562													4	50	---	---	---	---	PASS
C10orf4	118924	broad.mit.edu	37	10	95454653	95454653	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95454653G>A	uc001kiz.1	-	5	459	c.261C>T	c.(259-261)TAC>TAT	p.Y87Y	C10orf4_uc001kiv.1_RNA|C10orf4_uc001kja.1_Silent_p.Y87Y|C10orf4_uc001kjb.1_Silent_p.Y87Y|C10orf4_uc009xuh.1_Silent_p.Y88Y	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein	87						nucleus	protein binding				0		Colorectal(252;0.122)				TGCCACCATAGTATAAAATAT	0.338													16	194	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105182763	105182763	+	Missense_Mutation	SNP	C	T	T	rs142899352		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105182763C>T	uc001kwy.1	+	18	2603	c.2516C>T	c.(2515-2517)ACG>ATG	p.T839M		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	839					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TTGATCCAGACGCTGGCCGAG	0.527													3	49	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105953694	105953694	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105953694C>T	uc001kxw.2	-	11	1488	c.1372G>A	c.(1372-1374)GTA>ATA	p.V458I	C10orf79_uc001kxx.3_Missense_Mutation_p.V459I|C10orf79_uc001kxy.1_Missense_Mutation_p.V459I	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	458	WD 7.										0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TTATCATATACGCTGATGAAG	0.552													11	58	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106982877	106982877	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106982877C>A	uc001kyi.1	+	20	2965	c.2738C>A	c.(2737-2739)CCT>CAT	p.P913H	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	913	PKD.|Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCCTTAGGTCCTGTGGAGCAT	0.428													10	83	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117704277	117704277	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117704277G>A	uc001lcg.2	+	29	4513	c.4127G>A	c.(4126-4128)GGA>GAA	p.G1376E	ATRNL1_uc010qsm.1_Missense_Mutation_p.G505E|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1376	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACACGTCAAGGAACTTGTGTC	0.413													14	91	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121563770	121563770	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121563770C>T	uc001leo.2	+	10	1368	c.1202C>T	c.(1201-1203)TCA>TTA	p.S401L		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	401	SAC.						phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TTCAACAACTCACACCTCACT	0.418													10	108	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134896169	134896169	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134896169G>T	uc001llw.2	+	6	1255	c.1255G>T	c.(1255-1257)GGC>TGC	p.G419C				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	Error:Variant_position_missing_in_Q86SQ6_after_alignment						integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CCACGGCCTTGGCCTGAGGTG	0.617													3	32	---	---	---	---	PASS
DUSP8	1850	broad.mit.edu	37	11	1579411	1579411	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1579411G>A	uc001lts.2	-	5	756	c.628C>T	c.(628-630)CGG>TGG	p.R210W		NM_004420	NP_004411	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	210	Tyrosine-protein phosphatase.				inactivation of MAPK activity	cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		ATGGGGACCCGCATGAAGCGG	0.582													4	104	---	---	---	---	PASS
TNNI2	7136	broad.mit.edu	37	11	1861878	1861878	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1861878G>A	uc010qxe.1	+	3	200	c.178G>A	c.(178-180)GAA>AAA	p.E60K	TNNI2_uc010qxc.1_Missense_Mutation_p.E58K|TNNI2_uc010qxd.1_Missense_Mutation_p.E58K	NM_001145841	NP_001139313	P48788	TNNI2_HUMAN	fast-twitch skeletal muscle troponin I isoform	60					muscle filament sliding|positive regulation of transcription, DNA-dependent|skeletal muscle contraction	cytosol|nucleus|troponin complex	actin binding|troponin T binding				0		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTCCATGTCTGAAGTGCAGGT	0.667													4	32	---	---	---	---	PASS
OR51S1	119692	broad.mit.edu	37	11	4869937	4869937	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4869937G>A	uc010qyo.1	-	1	502	c.502C>T	c.(502-504)CCA>TCA	p.P168S		NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S,	168	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCAGGAATGGCAGGGGCAGA	0.552													5	92	---	---	---	---	PASS
SMPD1	6609	broad.mit.edu	37	11	6415196	6415196	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6415196G>A	uc001mcw.2	+	5	1585	c.1411G>A	c.(1411-1413)GAA>AAA	p.E471K	SMPD1_uc001mcv.1_RNA|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.E427K|SMPD1_uc009yew.2_Missense_Mutation_p.E470K	NM_000543	NP_000534	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid	469					cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Desipramine(DB01151)	CTTCTATGATGAAGAGACTCT	0.527													7	65	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10821761	10821761	+	Silent	SNP	T	C	C	rs140144694		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10821761T>C	uc001mjc.2	-	18	2412	c.1995A>G	c.(1993-1995)CTA>CTG	p.L665L	EIF4G2_uc001mjb.2_Silent_p.L459L|EIF4G2_uc009ygf.2_Silent_p.L459L|EIF4G2_uc001mjd.2_Silent_p.L627L	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	665	MI.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGCCACTTTCTAGTGGTTGAG	0.423													11	49	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12265655	12265655	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12265655G>A	uc001mjz.2	+	21	3068	c.2780G>A	c.(2779-2781)AGA>AAA	p.R927K	MICAL2_uc010rch.1_Intron|MICAL2_uc001mka.2_Missense_Mutation_p.R927K|MICAL2_uc010rci.1_Missense_Mutation_p.R927K|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron|MICAL2_uc001mkd.2_Intron|MICAL2_uc010rcj.1_Intron|MICAL2_uc001mkf.2_RNA	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	927						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		TCTCCTGCCAGAAAGGTAGTT	0.502													14	187	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17474774	17474774	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17474774G>A	uc001mnc.2	-	7	1194	c.1068C>T	c.(1066-1068)TAC>TAT	p.Y356Y	ABCC8_uc010rcy.1_Silent_p.Y355Y	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	356	Helical; Name=7; (By similarity).|ABC transmembrane type-1 1.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CAGCTAAGACGTAGGCATTGG	0.458													4	70	---	---	---	---	PASS
LMO2	4005	broad.mit.edu	37	11	33886306	33886306	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33886306G>T	uc001mve.2	-	2	538	c.99C>A	c.(97-99)TGC>TGA	p.C33*	LMO2_uc001mvc.2_Nonsense_Mutation_p.C26*|LMO2_uc001mvd.2_Nonsense_Mutation_p.C26*|LMO2_uc010rel.1_Nonsense_Mutation_p.C33*|LMO2_uc010rem.1_Nonsense_Mutation_p.C102*	NM_001142316	NP_001135788	P25791	RBTN2_HUMAN	LIM domain only 2 isoform 2	33	LIM zinc-binding 1.				multicellular organismal development	nucleus	protein binding|zinc ion binding			lung(1)	1						TGTTCTGCTGGCAGCCGCCGC	0.627			T	TRD@	T-ALL								6	48	---	---	---	---	PASS
TM7SF2	7108	broad.mit.edu	37	11	64883439	64883439	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64883439G>C	uc001oct.2	+	10	1318	c.1171G>C	c.(1171-1173)GAG>CAG	p.E391Q	TM7SF2_uc010rny.1_Missense_Mutation_p.E275Q|TM7SF2_uc001ocu.2_Missense_Mutation_p.E364Q|TM7SF2_uc001ocv.2_Missense_Mutation_p.E412Q|uc009yqb.1_5'Flank	NM_003273	NP_003264	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	391					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane	delta14-sterol reductase activity			ovary(1)	1						GGCCCGGGATGAGCGGCAGTG	0.622													4	36	---	---	---	---	PASS
MOGAT2	80168	broad.mit.edu	37	11	75439097	75439097	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75439097G>A	uc010rru.1	+	4	558	c.558G>A	c.(556-558)GGG>GGA	p.G186G	MOGAT2_uc001oww.1_Silent_p.G186G|MOGAT2_uc010rrv.1_Silent_p.G104G	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	186					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					TCATTGTAGGGGGTGCCCAGG	0.562													3	38	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82877725	82877725	+	Silent	SNP	A	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82877725A>C	uc001ozx.3	+	5	2131	c.1786A>C	c.(1786-1788)AGA>CGA	p.R596R	PCF11_uc010rsu.1_Silent_p.R596R	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	596					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						GTCTGCCAAAAGATGGAAATC	0.348													4	75	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92087450	92087450	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087450T>G	uc001pdj.3	+	1	2189	c.2172T>G	c.(2170-2172)TAT>TAG	p.Y724*		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	724	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGGACCATATTTTGACAAGT	0.403										TCGA Ovarian(4;0.039)			18	155	---	---	---	---	PASS
CCDC67	159989	broad.mit.edu	37	11	93103298	93103298	+	Silent	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93103298G>C	uc001pdq.2	+	6	592	c.492G>C	c.(490-492)CTG>CTC	p.L164L	CCDC67_uc001pdo.1_Silent_p.L164L|CCDC67_uc001pdp.2_Silent_p.L164L	NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67	164	Potential.									ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				AGACTCATCTGATTTCTTTAG	0.289													5	14	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104868181	104868181	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104868181A>C	uc010rva.1	-	8	1167	c.1135T>G	c.(1135-1137)TTC>GTC	p.F379V	CASP5_uc010ruz.1_Missense_Mutation_p.F392V|CASP5_uc010rvb.1_Missense_Mutation_p.F321V|CASP5_uc010rvc.1_Missense_Mutation_p.F237V|CASP5_uc009yxh.2_Missense_Mutation_p.F161V|CASP5_uc010rvd.1_Missense_Mutation_p.F161V	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	379					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TCCGTAATGAAGATGGAGCCC	0.408													6	39	---	---	---	---	PASS
ARCN1	372	broad.mit.edu	37	11	118452000	118452000	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118452000G>A	uc001ptq.2	+	2	204	c.43G>A	c.(43-45)GCT>ACT	p.A15T	ARCN1_uc009zah.2_Missense_Mutation_p.A15T|ARCN1_uc010ryg.1_Intron|ARCN1_uc009zag.2_Missense_Mutation_p.A56T	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1	15					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AGCAGGAAAGGCTATTGTTTC	0.428													12	109	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133794727	133794727	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133794727C>T	uc001qgx.3	-	15	2338	c.2107G>A	c.(2107-2109)GTC>ATC	p.V703I	IGSF9B_uc001qgy.1_Missense_Mutation_p.V545I	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	703	Fibronectin type-III 2.|Extracellular (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTGCTGGAGACGCCGGCGATG	0.562													4	94	---	---	---	---	PASS
SCNN1A	6337	broad.mit.edu	37	12	6483849	6483849	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6483849T>C	uc001qnx.2	-	2	390	c.101A>G	c.(100-102)GAA>GGA	p.E34G	SCNN1A_uc001qnw.2_Missense_Mutation_p.E93G|SCNN1A_uc010sfb.1_Missense_Mutation_p.E57G|LTBR_uc010sfc.1_5'Flank	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	34	Cytoplasmic (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)	CGCCGCAGGTTCGGGGCCCAG	0.642													3	34	---	---	---	---	PASS
CLEC1B	51266	broad.mit.edu	37	12	10149501	10149501	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10149501G>A	uc001qwu.2	-	4	582	c.382C>T	c.(382-384)CAG>TAG	p.Q128*	CLEC1B_uc009zhd.2_Nonsense_Mutation_p.Q95*	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform	128	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0						GTGCAGTACTGCTTACTCTCT	0.423													6	127	---	---	---	---	PASS
ETV6	2120	broad.mit.edu	37	12	12037408	12037408	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12037408C>T	uc001qzz.2	+	6	1313	c.1039C>T	c.(1039-1041)CAG>TAG	p.Q347*	ETV6_uc001raa.1_Intron	NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6	347	ETS.					cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TTACGTCTATCAGTTGCTTTC	0.443			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								14	136	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12334021	12334021	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12334021C>A	uc001rah.3	-	6	1471	c.1329G>T	c.(1327-1329)GAG>GAT	p.E443D	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.E443D	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	443	Extracellular (Potential).|LDL-receptor class B 7.|Beta-propeller 2.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				CCTCTAAGTCCTCTGAAATCA	0.448													3	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31353379	31353379	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31353379G>A	uc010sjy.1	-	3	351	c.351C>T	c.(349-351)CCC>CCT	p.P117P						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		GCTTGTAGGTGGGTTTATCAG	0.413													3	22	---	---	---	---	PASS
AMN1	196394	broad.mit.edu	37	12	31850769	31850769	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31850769C>T	uc001rkq.3	-	4	605	c.439G>A	c.(439-441)GAT>AAT	p.D147N	AMN1_uc001rko.3_Missense_Mutation_p.D129N|AMN1_uc010skc.1_Missense_Mutation_p.D129N|AMN1_uc001rkp.3_Missense_Mutation_p.D129N|AMN1_uc009zjs.2_RNA|AMN1_uc009zjt.1_RNA	NM_001113402	NP_001106873	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog	147											0	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			CCACCTAAATCGATGATCTTT	0.418													4	75	---	---	---	---	PASS
AMIGO2	347902	broad.mit.edu	37	12	47472350	47472350	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47472350G>T	uc001rpm.2	-	3	1091	c.436C>A	c.(436-438)CTT>ATT	p.L146I	FAM113B_uc001rpn.2_5'Flank|AMIGO2_uc001rpk.2_Missense_Mutation_p.L146I|AMIGO2_uc001rpl.2_Missense_Mutation_p.L146I	NM_001143668	NP_001137140	Q86SJ2	AMGO2_HUMAN	adhesion molecule with Ig-like domain 2	146	Extracellular (Potential).|LRR 4.				heterophilic cell-cell adhesion|homophilic cell adhesion	integral to membrane|nucleus|plasma membrane				ovary(1)|skin(1)	2	Renal(347;0.138)|Lung SC(27;0.192)					TAAAGCAGAAGCACTTCCAGA	0.408													8	107	---	---	---	---	PASS
ACCN2	41	broad.mit.edu	37	12	50453726	50453726	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50453726G>A	uc001rvw.2	+	3	776	c.547G>A	c.(547-549)GAC>AAC	p.D183N	ACCN2_uc001rvv.2_Missense_Mutation_p.D183N|ACCN2_uc009zln.2_5'UTR|ACCN2_uc009zlo.2_Missense_Mutation_p.D183N	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal	183	Extracellular (By similarity).				calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	CAGCGCTGAAGACTTCAAGGT	0.617													5	39	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51890800	51890800	+	Silent	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51890800C>G	uc001rys.1	+	22	3151	c.2973C>G	c.(2971-2973)GTC>GTG	p.V991V	SLC4A8_uc001rym.2_Silent_p.V938V|SLC4A8_uc001ryn.2_Silent_p.V938V|SLC4A8_uc001ryo.2_Silent_p.V938V|SLC4A8_uc010snj.1_Silent_p.V1018V|SLC4A8_uc001ryr.2_Silent_p.V991V	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	991	Cytoplasmic (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TCAGGAAAGTCATGGATCTCT	0.398													5	75	---	---	---	---	PASS
RARG	5916	broad.mit.edu	37	12	53607445	53607445	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53607445T>C	uc001sce.2	-	8	1338	c.853A>G	c.(853-855)ACC>GCC	p.T285A	RARG_uc001scd.2_Missense_Mutation_p.T274A|RARG_uc010sob.1_Missense_Mutation_p.T263A|RARG_uc001scf.2_Missense_Mutation_p.T285A|RARG_uc001scg.2_Missense_Mutation_p.T213A|RARG_uc010soc.1_Missense_Mutation_p.T164A|RARG_uc010sod.1_Missense_Mutation_p.T322A	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	285	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	AAGGTCATGGTGTCCTGCTCT	0.597											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	57	---	---	---	---	PASS
ZNF385A	25946	broad.mit.edu	37	12	54765456	54765456	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54765456C>T	uc001sfw.1	-	4	588	c.405G>A	c.(403-405)GAG>GAA	p.E135E	ZNF385A_uc001sfv.1_Silent_p.E116E|ZNF385A_uc009zno.1_Intron|ZNF385A_uc010sov.1_Intron|ZNF385A_uc001sfx.1_Silent_p.E135E|ZNF385A_uc001sfy.3_Silent_p.E155E|ZNF385A_uc001sfz.3_Intron	NM_015481	NP_056296	Q96PM9	Z385A_HUMAN	zinc finger protein 385A isoform c	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1						CAGGCTGTTTCTCTGGGGATC	0.602													13	63	---	---	---	---	PASS
RNF41	10193	broad.mit.edu	37	12	56600547	56600547	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56600547C>T	uc001skf.1	-	7	1007	c.638G>A	c.(637-639)CGC>CAC	p.R213H	RNF41_uc001ske.1_Missense_Mutation_p.R142H|RNF41_uc001skg.1_Missense_Mutation_p.R213H|RNF41_uc010sqg.1_Missense_Mutation_p.R148H|RNF41_uc010sqh.1_Missense_Mutation_p.R142H	NM_005785	NP_005776	Q9H4P4	RNF41_HUMAN	ring finger protein 41 isoform 1	213					apoptosis|induction of apoptosis|protein polyubiquitination|regulation of reactive oxygen species metabolic process		protein binding|protein tag|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						CCCTCCCCAGCGGGTCACTCT	0.537											OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	31	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71977788	71977788	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71977788G>A	uc001swl.2	+	18	2046	c.1998G>A	c.(1996-1998)GTG>GTA	p.V666V	LGR5_uc001swm.2_Silent_p.V642V|LGR5_uc001swn.1_Intron	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	666	Cytoplasmic (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						GGTTCTCTGTGAAATATTCTG	0.463													13	142	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73046177	73046177	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73046177A>G	uc001sxa.2	+	16	2646	c.2616A>G	c.(2614-2616)ATA>ATG	p.I872M		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	872	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GGGAATTCATATGGATGAAAT	0.398													6	74	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104336352	104336352	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104336352G>A	uc001tkb.1	+	12	1527	c.1422G>A	c.(1420-1422)AAG>AAA	p.K474K	HSP90B1_uc010swg.1_Silent_p.K139K|HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	474					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	TGATCAAGAAGATTGCTGATG	0.363													4	54	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104336359	104336359	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104336359G>T	uc001tkb.1	+	12	1534	c.1429G>T	c.(1429-1431)GAT>TAT	p.D477Y	HSP90B1_uc010swg.1_Missense_Mutation_p.D142Y|HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	477					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	GAAGATTGCTGATGATAAATA	0.363													4	59	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104336567	104336567	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104336567G>C	uc001tkb.1	+	12	1742	c.1637G>C	c.(1636-1638)AGA>ACA	p.R546T	HSP90B1_uc010swg.1_Missense_Mutation_p.R211T|HSP90B1_uc009zui.1_Intron	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	546					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	GGGTCCAGCAGAAAAGAGGTG	0.418													6	71	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120159203	120159203	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120159203G>A	uc001txi.1	-	28	3570	c.3517C>T	c.(3517-3519)CTG>TTG	p.L1173L	CIT_uc001txh.1_Silent_p.L707L|CIT_uc001txj.1_Silent_p.L1215L	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1173	Potential.|Interaction with Rho/Rac.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CCTTGAGTCAGACGGAAAATG	0.468													11	62	---	---	---	---	PASS
ABCB9	23457	broad.mit.edu	37	12	123429086	123429086	+	Intron	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123429086G>A	uc001udm.3	-						ABCB9_uc010tai.1_Missense_Mutation_p.S18F|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Intron|ABCB9_uc010taj.1_Intron|ABCB9_uc001udp.2_Intron|ABCB9_uc001udq.2_Intron|ABCB9_uc001udr.2_Intron	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),						positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		AGGGAGAGGGGATGTGGGTCG	0.622													9	65	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129373237	129373237	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129373237G>A	uc010tbh.1	+	3	247	c.238G>A	c.(238-240)GCC>ACC	p.A80T	GLT1D1_uc001uhx.1_Missense_Mutation_p.A91T|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	91					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		AAATGAAGATGCCAACCAGGC	0.438													4	23	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133374950	133374950	+	Silent	SNP	G	T	T	rs139706790		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133374950G>T	uc001ukz.1	-	9	2473	c.1914C>A	c.(1912-1914)ATC>ATA	p.I638I	GOLGA3_uc001ula.1_Silent_p.I638I|GOLGA3_uc001ulb.2_Silent_p.I638I	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	638	Gln-rich.|Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTGTGCCGCGATGCGCCCCT	0.587													7	87	---	---	---	---	PASS
TNFRSF19	55504	broad.mit.edu	37	13	24243107	24243107	+	Silent	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24243107T>C	uc001uov.1	+	9	1180	c.1116T>C	c.(1114-1116)GCT>GCC	p.A372A	TNFRSF19_uc001uot.2_Silent_p.A372A|TNFRSF19_uc010tcu.1_Silent_p.A240A|TNFRSF19_uc001uow.2_Silent_p.A372A	NM_018647	NP_061117	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily,	372	Cytoplasmic (Potential).				apoptosis|induction of apoptosis|JNK cascade	integral to membrane|mitochondrion	tumor necrosis factor receptor activity			kidney(1)|skin(1)	2		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		TTACAGCAGCTACTGATTTAT	0.428													3	86	---	---	---	---	PASS
FAM123A	219287	broad.mit.edu	37	13	25744014	25744014	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25744014A>T	uc001uqb.2	-	1	1844	c.1744T>A	c.(1744-1746)TCC>ACC	p.S582T	FAM123A_uc001uqa.2_Missense_Mutation_p.S463T|FAM123A_uc001uqc.2_Missense_Mutation_p.S463T	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	582										ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTTAACCGGGACAGGGAGGAC	0.567													3	70	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42385394	42385394	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42385394A>C	uc001uyj.2	-	17	2100	c.2030T>G	c.(2029-2031)CTT>CGT	p.L677R	KIAA0564_uc001uyk.2_Missense_Mutation_p.L677R	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	677						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		AGCACTGTGAAGATTTTCATT	0.383													6	53	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39819487	39819487	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39819487C>T	uc001wvg.3	+	24					CTAGE5_uc001wuz.3_3'UTR|CTAGE5_uc001wuy.3_3'UTR|CTAGE5_uc001wvb.3_3'UTR|CTAGE5_uc001wvc.3_3'UTR|CTAGE5_uc001wva.3_3'UTR|CTAGE5_uc001wvh.3_3'UTR|CTAGE5_uc001wvf.3_3'UTR|CTAGE5_uc001wvi.3_3'UTR|CTAGE5_uc010amz.2_3'UTR|CTAGE5_uc001wvj.3_3'UTR	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1								enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TTGCTCTCTTCAAAAGTAATT	0.353													10	64	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52481073	52481073	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52481073T>C	uc001wzo.2	-	16	3586	c.3352A>G	c.(3352-3354)ATT>GTT	p.I1118V	NID2_uc010tqs.1_Missense_Mutation_p.I1070V|NID2_uc010tqt.1_Missense_Mutation_p.I1118V|NID2_uc001wzp.2_Missense_Mutation_p.I1118V	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	1118						basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					AAGTAGCCAATCTGCTGGCCC	0.592											OREG0022678	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	40	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	74973930	74973930	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74973930G>C	uc001xqa.2	-	26	4246	c.3859C>G	c.(3859-3861)CTG>GTG	p.L1287V		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1287	EGF-like 14; calcium-binding (Potential).|Cys-rich.				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGCAGCCCAGAACACAGCGG	0.567													6	57	---	---	---	---	PASS
BDKRB1	623	broad.mit.edu	37	14	96730151	96730151	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96730151C>G	uc001yfh.2	+	3	340	c.132C>G	c.(130-132)ATC>ATG	p.I44M	BDKRB1_uc010avn.2_Missense_Mutation_p.I44M	NM_000710	NP_000701	P46663	BKRB1_HUMAN	bradykinin receptor B1	44	Helical; Name=1; (Potential).				elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		CAACATTTATCATCTCCATCT	0.542													4	51	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105408255	105408255	+	Silent	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105408255G>T	uc010axc.1	-	7	13653	c.13533C>A	c.(13531-13533)CTC>CTA	p.L4511L	AHNAK2_uc001ypx.2_Silent_p.L4411L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4511						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTGAATGCGGAGGTCAGTGG	0.622													27	154	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105408514	105408514	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105408514G>A	uc010axc.1	-	7	13394	c.13274C>T	c.(13273-13275)TCT>TTT	p.S4425F	AHNAK2_uc001ypx.2_Missense_Mutation_p.S4325F	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4425						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGGGCAGAGACACGTCCAG	0.622													14	145	---	---	---	---	PASS
CORO2B	10391	broad.mit.edu	37	15	68937670	68937670	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68937670G>A	uc002arj.3	+	2	216	c.187G>A	c.(187-189)GGC>AGC	p.G63S	CORO2B_uc010bic.2_Missense_Mutation_p.G58S	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	63					actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						CGCAGGGGGCGGCTCCTTCCT	0.622													4	68	---	---	---	---	PASS
CORO2B	10391	broad.mit.edu	37	15	68937671	68937671	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68937671G>T	uc002arj.3	+	2	217	c.188G>T	c.(187-189)GGC>GTC	p.G63V	CORO2B_uc010bic.2_Missense_Mutation_p.G58V	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	63					actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						GCAGGGGGCGGCTCCTTCCTC	0.622													4	68	---	---	---	---	PASS
TSPAN3	10099	broad.mit.edu	37	15	77345133	77345133	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77345133C>A	uc002bcj.2	-	5	788	c.571G>T	c.(571-573)GAC>TAC	p.D191Y	TSPAN3_uc002bck.2_Missense_Mutation_p.D166Y|TSPAN3_uc010ump.1_Missense_Mutation_p.D127Y|TSPAN3_uc010bkx.2_Missense_Mutation_p.D102Y	NM_005724	NP_005715	O60637	TSN3_HUMAN	transmembrane 4 superfamily member 8 isoform 1	191	Extracellular (Potential).					integral to membrane					0				all cancers(203;1.14e-19)		GCATAGAGGTCGGAAGGGTGG	0.478													5	25	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77472430	77472430	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77472430C>T	uc002bcm.2	-	3	2147	c.1839G>A	c.(1837-1839)GAG>GAA	p.E613E	SGK269_uc002bcn.2_Silent_p.E613E	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	613					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		CATAAGTTGGCTCGTCATGAA	0.348													11	142	---	---	---	---	PASS
TMC3	342125	broad.mit.edu	37	15	81625521	81625521	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81625521C>T	uc002bgo.1	-	22	2542	c.2542G>A	c.(2542-2544)GAA>AAA	p.E848K	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	848	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						TGTACATCTTCGATGTGCGTT	0.527													9	93	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89074506	89074506	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89074506C>A	uc002bmr.2	-	2	583	c.431G>T	c.(430-432)TGT>TTT	p.C144F	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Missense_Mutation_p.C155F	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	144						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GAAGAGACTACACTCCCGGTT	0.537													5	25	---	---	---	---	PASS
NR2F2	7026	broad.mit.edu	37	15	96880592	96880592	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96880592C>T	uc010uri.1	+	3	2210	c.986C>T	c.(985-987)TCT>TTT	p.S329F	NR2F2_uc002btp.2_Missense_Mutation_p.S196F|NR2F2_uc010urj.1_Missense_Mutation_p.S176F|NR2F2_uc010urk.1_Missense_Mutation_p.S176F	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	329	Interaction with ZFPM2 (By similarity).|Ligand-binding (By similarity).				lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TGTGGTCTCTCTGATGTAGCC	0.353													6	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102294771	102294771	+	5'Flank	SNP	A	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102294771A>C	uc002bxo.2	-						uc002bxq.2_5'Flank|uc002bxr.2_5'Flank|uc010usk.1_5'Flank|uc002bxs.2_5'Flank|uc002bxu.1_5'Flank|uc002bxv.1_5'Flank|uc002bxw.1_5'Flank|uc002bxy.1_5'Flank|uc002byb.1_5'Flank|uc002byd.2_RNA|uc002byc.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank|uc002bys.2_5'Flank|uc002byv.2_5'Flank|uc002byx.3_5'Flank|uc002bza.2_5'Flank|uc002bzb.2_5'Flank|uc002bzc.1_5'Flank|uc002bzd.2_5'Flank|uc002bze.2_5'Flank|uc002bzg.2_5'Flank|uc002bzi.1_5'Flank|uc002bzj.2_5'Flank|uc002bzl.2_5'Flank|uc002bzm.2_5'Flank|uc002bzo.2_5'Flank|uc002bzp.2_5'Flank|uc002bzq.2_5'Flank|uc002bzr.2_5'Flank					DQ593630																		TGGGAACGAGAAGACACTCGT	0.577													2	3	---	---	---	---	PASS
TBL3	10607	broad.mit.edu	37	16	2026180	2026180	+	Intron	SNP	A	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2026180A>C	uc002cnu.1	+						TBL3_uc002cnv.1_Intron|TBL3_uc010bsb.1_Intron|TBL3_uc010bsc.1_Intron|TBL3_uc010uvt.1_5'UTR|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444	Q12788	TBL3_HUMAN	transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0						AGGCCCATGGACCAGCCTCTC	0.637													11	25	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3339743	3339743	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3339743G>T	uc002cuq.2	+	6	1569	c.1237G>T	c.(1237-1239)GAA>TAA	p.E413*	ZNF263_uc010uww.1_Nonsense_Mutation_p.E61*|ZNF263_uc002cur.2_Nonsense_Mutation_p.E61*	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	413					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						GGACTGCACTGAAATCTTTGG	0.473													9	91	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3340603	3340603	+	3'UTR	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3340603G>C	uc002cuq.2	+	6					ZNF263_uc010uww.1_3'UTR|ZNF263_uc002cur.2_Intron	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						GGCATATTCAGAGGAGCCTGT	0.527													3	23	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3817750	3817750	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3817750G>C	uc002cvv.2	-	16	3425	c.3221C>G	c.(3220-3222)TCA>TGA	p.S1074*	CREBBP_uc002cvw.2_Nonsense_Mutation_p.S1036*	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1074					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGGAGATGTTGACTGAGAGGC	0.428			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				11	138	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4466517	4466517	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4466517C>T	uc002cwh.3	-	1	123	c.3G>A	c.(1-3)ATG>ATA	p.M1I	CORO7_uc002cwf.2_Missense_Mutation_p.M1I|CORO7_uc002cwg.3_5'Flank|CORO7_uc010uxh.1_Missense_Mutation_p.M1I|CORO7_uc010uxi.1_Missense_Mutation_p.M1I|CORO7_uc010uxj.1_RNA|CORO7_uc010btp.1_5'UTR|CORO7_uc010btr.1_RNA	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	1						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						TGAAGCGGTTCATGGCGACGG	0.756													4	23	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18859259	18859259	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18859259G>A	uc002dfm.2	-	37	6083	c.5720C>T	c.(5719-5721)TCT>TTT	p.S1907F	SMG1_uc010bwb.2_Missense_Mutation_p.S1767F|SMG1_uc010bwa.2_Missense_Mutation_p.S638F|SMG1_uc002dfo.3_Missense_Mutation_p.S205F	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1907	Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						GCTATCCTGAGATGCAGGAGG	0.398													13	63	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20997001	20997001	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20997001C>G	uc010vbe.1	-	48	7063	c.7063G>C	c.(7063-7065)GAT>CAT	p.D2355H	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2355					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATGTTATCATCGACTATCTTT	0.458													11	108	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	32077616	32077616	+	RNA	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32077616C>A	uc010vfu.1	+	1		c.58C>A								Homo sapiens mRNA for immunoglobulin heavy chain, VHDJH rearrangement : VHLI26.																		ACGCCAAGAACTCACTGTATC	0.502													22	385	---	---	---	---	PASS
THAP11	57215	broad.mit.edu	37	16	67876802	67876802	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67876802G>A	uc002euo.2	+	1	590	c.345G>A	c.(343-345)CAG>CAA	p.Q115Q	CENPT_uc002eun.3_Intron	NM_020457	NP_065190	Q96EK4	THA11_HUMAN	THAP domain containing 11	115	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		agcaacagcagcaacagcagc	0.303													3	64	---	---	---	---	PASS
SLC12A4	6560	broad.mit.edu	37	16	67979985	67979985	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67979985C>G	uc002euz.2	-	20	2749	c.2608G>C	c.(2608-2610)GTC>CTC	p.V870L	LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.2_Missense_Mutation_p.V864L|SLC12A4_uc010vkh.1_Missense_Mutation_p.V839L|SLC12A4_uc010vki.1_Missense_Mutation_p.V870L|SLC12A4_uc010vkj.1_Missense_Mutation_p.V872L|SLC12A4_uc002eva.2_Missense_Mutation_p.V870L|SLC12A4_uc010cev.1_RNA	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	870	Cytoplasmic (Potential).				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TTCCTCCAGACCTGAGGCAAG	0.592													3	39	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72992721	72992721	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72992721C>T	uc002fck.2	-	2	1997	c.1324G>A	c.(1324-1326)GAG>AAG	p.E442K	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	442					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TCCTGCTTCTCTCCTTCTGCC	0.463													13	111	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512501	75512501	+	3'UTR	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512501C>A	uc002fef.2	-	3					CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_3'UTR	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)						keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CATGCACTCTCCTCCCGGGCC	0.627													5	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90160926	90160926	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90160926G>A	uc002fqp.2	+	2	877	c.399G>A	c.(397-399)CCG>CCA	p.P133P	uc002fqq.2_Intron					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATGCCCTCCCGCCCCACGCAG	0.726													5	44	---	---	---	---	PASS
FAM57A	79850	broad.mit.edu	37	17	641131	641131	+	Missense_Mutation	SNP	G	A	A	rs143392294	byFrequency	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:641131G>A	uc002frp.2	+	3	293	c.252G>A	c.(250-252)ATG>ATA	p.M84I	FAM57A_uc002frq.2_Missense_Mutation_p.M84I|FAM57A_uc002frr.2_5'UTR	NM_024792	NP_079068	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	84	TLC.|Helical; (Potential).					integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		TTCCATACATGATCTATGACT	0.483													14	155	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	4015972	4015972	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4015972C>G	uc002fxe.2	-	5	1061	c.997G>C	c.(997-999)GAT>CAT	p.D333H	ZZEF1_uc002fxk.1_Missense_Mutation_p.D333H	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	333	DOC.						calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ATGTGCACATCTCGGACTTCC	0.542													4	34	---	---	---	---	PASS
C17orf81	23587	broad.mit.edu	37	17	7162203	7162203	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7162203C>T	uc002gfg.1	+	8	901	c.794C>T	c.(793-795)GCC>GTC	p.A265V	C17orf81_uc002gfj.2_3'UTR|C17orf81_uc010cmb.2_3'UTR|C17orf81_uc002gfh.1_Missense_Mutation_p.A265V|C17orf81_uc002gfi.1_Missense_Mutation_p.A265V|C17orf81_uc002gfl.1_Intron	NM_203415	NP_981960	Q8TE02	DERP6_HUMAN	S-phase 2 protein isoform 4	265					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding				0						GAGAGAGAAGCCAGAGATAGC	0.517													10	55	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577103	7577103	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577103C>G	uc002gim.2	-	8	1029	c.835G>C	c.(835-837)GGG>CGG	p.G279R	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.G279R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G147R|TP53_uc010cng.1_Missense_Mutation_p.G147R|TP53_uc002gii.1_Missense_Mutation_p.G147R|TP53_uc010cnh.1_Missense_Mutation_p.G279R|TP53_uc010cni.1_Missense_Mutation_p.G279R|TP53_uc002gij.2_Missense_Mutation_p.G279R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	279	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> W (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G279E(31)|p.G279R(7)|p.0?(7)|p.R280fs*65(6)|p.G279V(4)|p.G279G(3)|p.G279W(2)|p.?(2)|p.G279fs*65(2)|p.G279fs*27(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.G279_R280delGR(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.P278_G279insXXXXX(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.G279fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGTCTCTCCCAGGACAGGCA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			3	30	---	---	---	---	PASS
KRBA2	124751	broad.mit.edu	37	17	8273001	8273001	+	Silent	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8273001T>C	uc002glf.1	-	2	936	c.930A>G	c.(928-930)TTA>TTG	p.L310L	KRBA2_uc002glg.1_Silent_p.L227L	NM_213597	NP_998762	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	310	Integrase catalytic.				DNA integration|regulation of transcription, DNA-dependent	intracellular	DNA binding				0						TGAAAATATCTAACAAGACAC	0.418													6	44	---	---	---	---	PASS
ATPAF2	91647	broad.mit.edu	37	17	17921970	17921970	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17921970G>A	uc002gse.1	-	8	916	c.763C>T	c.(763-765)CAT>TAT	p.H255Y	ATPAF2_uc002gsd.1_Intron|ATPAF2_uc002gsf.1_RNA	NM_145691	NP_663729	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly	255					proton-transporting ATP synthase complex assembly	mitochondrion|nuclear speck	protein binding				0	all_neural(463;0.228)					TCATAGTCATGGGCCCACTCA	0.607													7	114	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27069026	27069026	+	3'UTR	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27069026G>C	uc002hcp.2	+	15					TRAF4_uc002hcq.1_5'Flank|TRAF4_uc002hcs.2_5'Flank	NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8							cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					TTCACCTCTGGACCACCCTGA	0.567													10	58	---	---	---	---	PASS
GIT1	28964	broad.mit.edu	37	17	27909741	27909741	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27909741C>T	uc002hef.2	-	4	594	c.380G>A	c.(379-381)GGA>GAA	p.G127E	GIT1_uc002heg.2_Missense_Mutation_p.G127E|GIT1_uc010wbg.1_Missense_Mutation_p.G127E|GIT1_uc010csb.1_Missense_Mutation_p.G127E	NM_014030	NP_054749	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interactor 1	127					regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|focal adhesion	ARF GTPase activator activity|protein binding|zinc ion binding				0				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		GGCGGTGACTCCATCATCGTC	0.577													3	30	---	---	---	---	PASS
PIP4K2B	8396	broad.mit.edu	37	17	36925874	36925874	+	3'UTR	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36925874C>A	uc002hqs.2	-	10					PIP4K2B_uc010cvp.2_5'Flank	NM_003559	NP_003550	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type						cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1						CCCAAATACACCCTTCTCCCT	0.532													5	64	---	---	---	---	PASS
STH	246744	broad.mit.edu	37	17	44076786	44076786	+	Silent	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44076786C>A	uc002ijy.2	+	1	171	c.141C>A	c.(139-141)ACC>ACA	p.T47T	MAPT_uc010dau.2_Intron|MAPT_uc002ijr.3_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_001007532	NP_001007533	Q8IWL8	STH_HUMAN	saitohin	47						cytoplasm|nucleus					0						GAGACAGAACCCTCAGCTTAG	0.413													5	42	---	---	---	---	PASS
SP2	6668	broad.mit.edu	37	17	46000404	46000404	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46000404C>T	uc002imk.2	+	4	1273	c.1136C>T	c.(1135-1137)ACC>ATC	p.T379I	SP2_uc002iml.2_Missense_Mutation_p.T372I	NM_003110	NP_003101	Q02086	SP2_HUMAN	Sp2 transcription factor	379					immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|zinc ion binding				0						GCTGCAGCCACCTCTAACACC	0.587													13	69	---	---	---	---	PASS
HOXB6	3216	broad.mit.edu	37	17	46673766	46673766	+	3'UTR	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46673766C>T	uc002ins.1	-	4					HOXB5_uc002inr.2_5'Flank|HOXB6_uc010dbh.1_3'UTR|HOXB6_uc002int.1_3'UTR	NM_018952	NP_061825	P17509	HXB6_HUMAN	homeobox B6						anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCCTCCCTTTCCAGCACCTTC	0.622													30	123	---	---	---	---	PASS
DLX3	1747	broad.mit.edu	37	17	48072068	48072068	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48072068G>A	uc002ipy.2	-	1	521	c.295C>T	c.(295-297)CGG>TGG	p.R99W		NM_005220	NP_005211	O60479	DLX3_HUMAN	distal-less homeobox 3	99						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGCTGCTCCCGATACGCCCCG	0.627													8	29	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56738056	56738056	+	Intron	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56738056T>C	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Missense_Mutation_p.Q302R	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTGATCTTCCTGTTGCTGAGT	0.483													28	374	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59934548	59934548	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59934548A>T	uc002izk.1	-	4	391	c.250T>A	c.(250-252)TTG>ATG	p.L84M		NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	84	Helicase ATP-binding.				DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						CAACATGACAATTGTACTTCA	0.343			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				13	72	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61623123	61623123	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61623123C>G	uc002jay.2	+	14	2925	c.2845C>G	c.(2845-2847)CTA>GTA	p.L949V	KCNH6_uc010wpl.1_Missense_Mutation_p.L790V|KCNH6_uc010wpm.1_Missense_Mutation_p.L913V|KCNH6_uc002jaz.1_Missense_Mutation_p.L860V	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	949	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	AGCCTCACCTCTACATCCCCT	0.587													9	99	---	---	---	---	PASS
FTSJ3	117246	broad.mit.edu	37	17	61897650	61897650	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61897650T>C	uc002jbz.2	-	18	2299	c.2221A>G	c.(2221-2223)AAG>GAG	p.K741E	FTSJ3_uc002jca.2_Missense_Mutation_p.K741E	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3	741					RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						TCAGCCACCTTCTTGATGGGA	0.562													8	105	---	---	---	---	PASS
AMZ2P1	201283	broad.mit.edu	37	17	62964433	62964433	+	RNA	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62964433C>G	uc002jez.3	-	5		c.746G>C			AMZ2P1_uc002jfa.3_RNA|AMZ2P1_uc002jfb.3_RNA|AMZ2P1_uc010del.2_RNA					Homo sapiens cDNA FLJ32065 fis, clone OCBBF1000086, weakly similar to Archeobacterial metalloproteinase-like protein 2 (EC 3.-.-.-).												0						CCATTATCCTCACGACTGTGT	0.438													11	44	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66937049	66937049	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66937049G>A	uc002jhp.2	-	3	330	c.151C>T	c.(151-153)CAT>TAT	p.H51Y	ABCA8_uc002jhq.2_Missense_Mutation_p.H51Y|ABCA8_uc010wqq.1_Missense_Mutation_p.H51Y|ABCA8_uc010wqr.1_5'UTR|ABCA8_uc002jhr.2_Missense_Mutation_p.H51Y|ABCA8_uc002jhs.2_Missense_Mutation_p.H51Y|ABCA8_uc002jht.2_Missense_Mutation_p.H51Y	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	51						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					TTTACTTGATGACTATGAGGA	0.323													3	30	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67045523	67045523	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67045523C>T	uc002jhu.2	-	3	348	c.205G>A	c.(205-207)GAT>AAT	p.D69N	ABCA9_uc010dez.2_Missense_Mutation_p.D69N|ABCA9_uc002jhv.2_Missense_Mutation_p.D69N	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	69					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TTAAAACTATCTACACGTCCC	0.363													14	85	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67189995	67189995	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67189995G>T	uc010dfa.1	-	14	2360	c.1481C>A	c.(1480-1482)GCT>GAT	p.A494D	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.A95D	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	494	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TTTTATTTTAGCAAATACCCT	0.328													9	101	---	---	---	---	PASS
FOXK2	3607	broad.mit.edu	37	17	80529635	80529635	+	Silent	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80529635G>C	uc002kfn.2	+	4	969	c.798G>C	c.(796-798)CTG>CTC	p.L266L	FOXK2_uc002kfm.1_Silent_p.L266L|FOXK2_uc010diu.2_Silent_p.L266L	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2	266	Fork-head.				embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ACGCGCAGCTGATAGTTCAGG	0.398													7	52	---	---	---	---	PASS
KIAA1012	22878	broad.mit.edu	37	18	29511315	29511315	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29511315C>T	uc002kxc.3	-	2	693	c.329G>A	c.(328-330)GGA>GAA	p.G110E	KIAA1012_uc002kxb.3_Missense_Mutation_p.G56E|KIAA1012_uc002kxd.3_RNA|KIAA1012_uc002kxe.2_Missense_Mutation_p.G110E	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	110					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						GTCATAATCTCCTGCTGTAAT	0.408													10	94	---	---	---	---	PASS
WBP11P1	441818	broad.mit.edu	37	18	30092341	30092341	+	RNA	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30092341C>G	uc010dmc.2	+	1		c.716C>G				NR_003558				Homo sapiens cDNA clone IMAGE:5265376, partial cds.												0						ACCTCCAACTCAGGCAGTTTC	0.537													4	26	---	---	---	---	PASS
RIT2	6014	broad.mit.edu	37	18	40323522	40323522	+	Missense_Mutation	SNP	C	G	G	rs77976328		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40323522C>G	uc002lav.2	-	5	763	c.590G>C	c.(589-591)AGA>ACA	p.R197T	RIT2_uc010dnf.2_3'UTR	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	197					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1						GCTGTCTTTTCTCTTCAGTTT	0.413													23	152	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5772930	5772930	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5772930C>A	uc002mda.2	+	20	1956	c.1895C>A	c.(1894-1896)ACC>AAC	p.T632N		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	632	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CAGAACTGGACCACCATGATA	0.567													3	40	---	---	---	---	PASS
CCDC151	115948	broad.mit.edu	37	19	11545894	11545894	+	5'UTR	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11545894C>G	uc002mrs.2	-	1					CCDC151_uc010dxz.2_5'UTR|PRKCSH_uc002mrt.2_5'Flank|PRKCSH_uc002mru.2_5'Flank|PRKCSH_uc010xlz.1_5'Flank|PRKCSH_uc010dya.2_5'Flank|PRKCSH_uc002mrv.1_5'Flank|PRKCSH_uc010dyb.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151											ovary(1)	1						GAGTCAGTCGCCCCTGTCAGG	0.612											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	17	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17263473	17263473	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17263473C>G	uc010eak.2	+	4	1107	c.955C>G	c.(955-957)CTG>GTG	p.L319V	MYO9B_uc002nfi.2_Missense_Mutation_p.L319V|MYO9B_uc002nfj.1_Missense_Mutation_p.L319V	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	319	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						CGAGAAATATCTGCTTGAAAA	0.368													4	35	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039753	31039753	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039753C>G	uc002nsu.1	+	4	3365	c.3227C>G	c.(3226-3228)TCT>TGT	p.S1076C	ZNF536_uc010edd.1_Missense_Mutation_p.S1076C	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1076					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GACTCTGCTTCTGAGAAGATG	0.552													8	61	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34832940	34832940	+	Missense_Mutation	SNP	C	T	T	rs144261536		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34832940C>T	uc002nvd.3	+	10	2960	c.2101C>T	c.(2101-2103)CGG>TGG	p.R701W		NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	701										ovary(1)	1	Esophageal squamous(110;0.162)					CCCTCCACCACGGGCACCCCA	0.612													8	94	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39037100	39037100	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39037100G>T	uc002oit.2	+	88	12158	c.12028G>T	c.(12028-12030)GAG>TAG	p.E4010*	RYR1_uc002oiu.2_Nonsense_Mutation_p.E4005*|RYR1_uc002oiv.1_Nonsense_Mutation_p.E919*	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4010					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AAGCCAGATCGAGCTGCTGAA	0.567													3	38	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40433743	40433743	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40433743C>A	uc002omp.3	-	2	534	c.526G>T	c.(526-528)GGG>TGG	p.G176W		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	176	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTCACTGACCCCTTCAGCGTG	0.567													4	90	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42793047	42793047	+	Silent	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42793047T>C	uc002otf.1	+	7	979	c.939T>C	c.(937-939)TCT>TCC	p.S313S		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	313					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				CAGTGTCCTCTGAGCTCCTGT	0.562			T	DUX4	soft tissue sarcoma								5	42	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42793049	42793049	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42793049A>T	uc002otf.1	+	7	981	c.941A>T	c.(940-942)GAG>GTG	p.E314V		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				GTGTCCTCTGAGCTCCTGTCC	0.557			T	DUX4	soft tissue sarcoma								4	44	---	---	---	---	PASS
XRCC1	7515	broad.mit.edu	37	19	44079154	44079154	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44079154T>C	uc002owt.2	-	2	172	c.52A>G	c.(52-54)ACT>GCT	p.T18A	XRCC1_uc010xwp.1_Intron|uc010xwq.1_5'Flank	NM_006297	NP_006288	P18887	XRCC1_HUMAN	X-ray repair cross complementing protein 1	18					base-excision repair|single strand break repair	nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(2)|large_intestine(1)|prostate(1)|breast(1)	7		Prostate(69;0.0153)				GCACAGTGAGTCTGGAAACAA	0.527								Other_BER_factors					6	26	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44352248	44352248	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44352248G>T	uc002oxr.3	+	7	1763	c.1495G>T	c.(1495-1497)GGG>TGG	p.G499W	ZNF283_uc002oxp.3_Missense_Mutation_p.G360W	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	499	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				CTTTTGTAGTGGGTATCAACT	0.413													21	101	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44352249	44352249	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44352249G>C	uc002oxr.3	+	7	1764	c.1496G>C	c.(1495-1497)GGG>GCG	p.G499A	ZNF283_uc002oxp.3_Missense_Mutation_p.G360A	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	499	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TTTTGTAGTGGGTATCAACTT	0.408													20	102	---	---	---	---	PASS
ZNF296	162979	broad.mit.edu	37	19	45575216	45575216	+	Silent	SNP	C	A	A	rs141004234	byFrequency	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45575216C>A	uc002pao.2	-	3	1128	c.1071G>T	c.(1069-1071)ACG>ACT	p.T357T		NM_145288	NP_660331	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	357					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCTTTGTTCCGTGGTGATGG	0.652													4	163	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45855835	45855835	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45855835G>A	uc002pbj.2	-	21	2022	c.1975C>T	c.(1975-1977)CAC>TAC	p.H659Y	ERCC2_uc002pbh.2_Missense_Mutation_p.H222Y|ERCC2_uc002pbi.2_Missense_Mutation_p.H352Y|ERCC2_uc010ejz.2_Missense_Mutation_p.H581Y|ERCC2_uc002pbk.2_Missense_Mutation_p.H635Y	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	659					cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		TGGGCCGCGTGGCGCATGGCA	0.612			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				19	57	---	---	---	---	PASS
PTGIR	5739	broad.mit.edu	37	19	47124901	47124901	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47124901G>C	uc002pex.2	-	3	910	c.797C>G	c.(796-798)CCT>CGT	p.P266R		NM_000960	NP_000951	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	266	Extracellular (Potential).				cell-cell signaling|G-protein signaling, coupled to cyclic nucleotide second messenger|platelet activation	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity				0		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Epoprostenol(DB01240)|Iloprost(DB01088)|Misoprostol(DB00929)	GCTGCTGTCAGGGGCGACAGC	0.642													10	32	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49967904	49967904	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49967904C>T	uc002pnt.2	+	12	1569	c.1453C>T	c.(1453-1455)CTG>TTG	p.L485L	ALDH16A1_uc010yar.1_Silent_p.L434L|ALDH16A1_uc010yas.1_Silent_p.L320L|ALDH16A1_uc010yat.1_Silent_p.L322L	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	485							oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		GTATGAGTATCTGCGGCCCTC	0.662													9	137	---	---	---	---	PASS
ZNF468	90333	broad.mit.edu	37	19	53352431	53352431	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53352431G>A	uc002qaf.2	-	3	202	c.51C>T	c.(49-51)TTC>TTT	p.F17F	ZNF468_uc002qae.2_5'UTR	NM_001008801	NP_001008801	Q5VIY5	ZN468_HUMAN	zinc finger protein ZNF468 isoform 2	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0358)		CCTCCTGAGAGAATTCTATGG	0.443													7	158	---	---	---	---	PASS
ZNF160	90338	broad.mit.edu	37	19	53573254	53573254	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53573254T>C	uc010eqk.2	-	7	949	c.533A>G	c.(532-534)AAC>AGC	p.N178S	ZNF160_uc002qaq.3_Missense_Mutation_p.N178S|ZNF160_uc002qar.3_Missense_Mutation_p.N178S	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	178					hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(134;0.02)		AAGCTGATTGTTCATAAGCTT	0.413													5	146	---	---	---	---	PASS
CACNG6	59285	broad.mit.edu	37	19	54502980	54502980	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54502980G>A	uc002qct.2	+	3	1089	c.499G>A	c.(499-501)GCA>ACA	p.A167T	CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN	voltage-dependent calcium channel gamma-6	167						voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(2)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CAGTAAAGGTGCAGAGTTCCT	0.592													6	178	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54632680	54632680	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54632680G>C	uc002qdh.2	+	13	1705	c.1309G>C	c.(1309-1311)GGG>CGG	p.G437R	PRPF31_uc010yek.1_Missense_Mutation_p.R414P	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	437					assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CGTATATGGCGGGAAGTCCAC	0.622											OREG0003636	type=REGULATORY REGION|Gene=AK091105|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	11	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54632681	54632681	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54632681G>C	uc002qdh.2	+	13	1706	c.1310G>C	c.(1309-1311)GGG>GCG	p.G437A	PRPF31_uc010yek.1_Silent_p.R414R	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	437					assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GTATATGGCGGGAAGTCCACC	0.617											OREG0003636	type=REGULATORY REGION|Gene=AK091105|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	11	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55696892	55696892	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55696892C>T	uc002qjq.2	-	18	3113	c.3040G>A	c.(3040-3042)GGC>AGC	p.G1014S	PTPRH_uc010esv.2_Missense_Mutation_p.G836S	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1014	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGGGTGGGCCTCCCTCCATG	0.632													3	18	---	---	---	---	PASS
HSPBP1	23640	broad.mit.edu	37	19	55776711	55776711	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55776711C>A	uc002qjx.2	-	6	1188	c.1078G>T	c.(1078-1080)GAA>TAA	p.E360*	HSPBP1_uc002qjy.2_Nonsense_Mutation_p.E314*|HSPBP1_uc002qkb.2_Missense_Mutation_p.G310V|HSPBP1_uc002qka.2_Nonsense_Mutation_p.E314*|HSPBP1_uc002qkd.2_Nonsense_Mutation_p.E314*|HSPBP1_uc002qkc.2_Nonsense_Mutation_p.E314*|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	317					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		AGGCCCAGTTCCGGCTCCCGA	0.647													7	93	---	---	---	---	PASS
PDYN	5173	broad.mit.edu	37	20	1961214	1961214	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1961214G>A	uc010gaj.2	-	3	762	c.520C>T	c.(520-522)CGC>TGC	p.R174C	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.R174C|PDYN_uc010zpt.1_Missense_Mutation_p.R19C	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	174					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CCCCCATAGCGTTTGACCTGC	0.582													6	81	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													3	18	---	---	---	---	PASS
ZHX3	23051	broad.mit.edu	37	20	39832810	39832810	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39832810G>T	uc002xjs.1	-	3	1125	c.747C>A	c.(745-747)AAC>AAA	p.N249K	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.N249K|ZHX3_uc002xjt.1_Missense_Mutation_p.N249K|ZHX3_uc002xju.1_Missense_Mutation_p.N249K|ZHX3_uc002xjv.1_Missense_Mutation_p.N249K|ZHX3_uc002xjw.1_Missense_Mutation_p.N249K|ZHX3_uc010ggg.1_Missense_Mutation_p.N249K	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	249	Required for homodimerization and interaction with NFYA.				negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				CGGCATGGGGGTTTTTTGCAG	0.587													6	68	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51870547	51870547	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51870547C>T	uc002xwo.2	+	2	1506	c.550C>T	c.(550-552)CGG>TGG	p.R184W		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	184					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CTTGCCTTCTCGGTCCGTCTC	0.552													4	41	---	---	---	---	PASS
RPS21	6227	broad.mit.edu	37	20	60963011	60963011	+	Intron	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60963011C>T	uc002ycr.2	+						RPS21_uc002ycs.2_Intron|RPS21_uc002yct.2_Missense_Mutation_p.S76L|RPS21_uc002ycu.2_Intron	NM_001024	NP_001015	P63220	RS21_HUMAN	ribosomal protein S21						endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein N-terminus binding|structural constituent of ribosome				0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TTCGGGACATCGTGGACTTTA	0.542													3	30	---	---	---	---	PASS
IL10RB	3588	broad.mit.edu	37	21	34648997	34648997	+	Silent	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34648997G>A	uc002yrk.1	+	3	369	c.270G>A	c.(268-270)AGG>AGA	p.R90R	IL10RB_uc002yrh.1_Silent_p.R160R|IL10RB_uc002yri.1_Silent_p.R43R|IL10RB_uc002yrl.1_Silent_p.R92R	NM_000628	NP_000619	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta precursor	90	Extracellular (Potential).				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0						TGAGAGTCAGGGCTGAATTTG	0.398													11	148	---	---	---	---	PASS
KCNJ15	3772	broad.mit.edu	37	21	39671406	39671406	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39671406G>A	uc002ywv.2	+	4	525	c.223G>A	c.(223-225)GTG>ATG	p.V75M	KCNJ15_uc002yww.2_Missense_Mutation_p.V75M|KCNJ15_uc002ywx.2_Missense_Mutation_p.V75M	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15	75	Helical; Name=M1; (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						TGCCACTTTTGTGATGACCTG	0.473													7	88	---	---	---	---	PASS
ERG	2078	broad.mit.edu	37	21	39755633	39755633	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39755633T>C	uc010gnw.2	-	12	1448	c.1153A>G	c.(1153-1155)ATG>GTG	p.M385V	ERG_uc002yxa.2_Missense_Mutation_p.M378V|ERG_uc011aek.1_Missense_Mutation_p.M286V|ERG_uc010gnv.2_Missense_Mutation_p.M262V|ERG_uc010gnx.2_Missense_Mutation_p.M361V|ERG_uc011ael.1_Missense_Mutation_p.M385V|ERG_uc002yxb.2_Missense_Mutation_p.M361V	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	385	ETS.				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				ACCTTGGTCATGATGTTCTTG	0.592													10	85	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17447085	17447085	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17447085G>C	uc002zlw.2	-	6	1301	c.1193C>G	c.(1192-1194)TCC>TGC	p.S398C	GAB4_uc010gqs.1_3'UTR	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	398										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TGTGAGTGGGGAGCCAAGCAG	0.592													8	57	---	---	---	---	PASS
ZNF74	7625	broad.mit.edu	37	22	20749694	20749694	+	Missense_Mutation	SNP	G	A	A	rs139227842	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20749694G>A	uc010gsm.2	+	3	318	c.106G>A	c.(106-108)GAA>AAA	p.E36K	ZNF74_uc002zsg.2_5'UTR|ZNF74_uc002zsh.2_Missense_Mutation_p.E36K|ZNF74_uc002zsi.2_Intron|ZNF74_uc010gsn.2_5'UTR	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	36					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GGGTCTTCCCGAAGCCAGGTC	0.532													4	57	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22556409	22556409	+	Intron	SNP	T	G	G			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22556409T>G	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CTACTCAGACTCAGACAAGCA	0.542											OREG0026354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	73	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29695597	29695597	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29695597C>T	uc003aet.2	+	16	2015	c.1687C>T	c.(1687-1689)CGT>TGT	p.R563C	EWSR1_uc003aev.2_Missense_Mutation_p.R568C|EWSR1_uc003aew.2_Missense_Mutation_p.R507C|EWSR1_uc003aex.2_Missense_Mutation_p.R562C|EWSR1_uc003aey.2_Missense_Mutation_p.R358C|EWSR1_uc003aez.2_Missense_Mutation_p.R224C	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	563	Arg/Gly/Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						AGGTGGTGATCGTGGCAGAGG	0.607			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								3	33	---	---	---	---	PASS
NF2	4771	broad.mit.edu	37	22	30057255	30057255	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30057255C>T	uc003age.3	+	8	1180	c.737C>T	c.(736-738)CCT>CTT	p.P246L	NF2_uc003afy.3_Missense_Mutation_p.P246L|NF2_uc003afz.3_Missense_Mutation_p.P163L|NF2_uc003agf.3_Missense_Mutation_p.P246L|NF2_uc003agb.3_Missense_Mutation_p.P169L|NF2_uc003agc.3_Missense_Mutation_p.P208L|NF2_uc003agd.3_RNA|NF2_uc003agg.3_Missense_Mutation_p.P246L|NF2_uc003aga.3_Missense_Mutation_p.P204L|NF2_uc003agh.3_Missense_Mutation_p.P205L|NF2_uc003agi.3_Missense_Mutation_p.P163L|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Missense_Mutation_p.P208L	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1	246	FERM.				actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.P246fs*5(2)|p.?(1)|p.N226_E270del(1)|p.D245fs*31(1)|p.L127_D382del(1)|p.L140_P252del(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						ATTTATGACCCTGAGAACAGA	0.502			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				11	114	---	---	---	---	PASS
APOL1	8542	broad.mit.edu	37	22	36661781	36661781	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36661781C>T	uc003apf.2	+	6	1067	c.899C>T	c.(898-900)TCA>TTA	p.S300L	APOL1_uc011amn.1_Missense_Mutation_p.S177L|APOL1_uc003apc.2_RNA|APOL1_uc003ape.2_Missense_Mutation_p.S316L|APOL1_uc011amo.1_Missense_Mutation_p.S177L|APOL1_uc011amp.1_Missense_Mutation_p.S300L|APOL1_uc011amq.1_Missense_Mutation_p.S282L|APOL1_uc010gwx.2_Missense_Mutation_p.S177L	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor	300					cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						CCGCATGCCTCAGCCTCACGC	0.557													7	60	---	---	---	---	PASS
FAM83F	113828	broad.mit.edu	37	22	40415261	40415261	+	Silent	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40415261C>T	uc003ayk.1	+	2	673	c.579C>T	c.(577-579)TAC>TAT	p.Y193Y		NM_138435	NP_612444	Q8NEG4	FA83F_HUMAN	hypothetical protein LOC113828	193										breast(1)	1						TCCCAGTGTACATCATCCTGG	0.542													12	50	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42609633	42609633	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42609633G>A	uc003bcj.1	-	1	1813	c.1679C>T	c.(1678-1680)CCG>CTG	p.P560L	TCF20_uc003bck.1_Missense_Mutation_p.P560L|TCF20_uc003bnt.2_Missense_Mutation_p.P560L	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						ACCTTGTGCCGGTGAGGAGCC	0.577													18	82	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46759909	46759909	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46759909C>T	uc003bhw.1	-	34	9019	c.9019G>A	c.(9019-9021)GAT>AAT	p.D3007N		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	3007	Cytoplasmic (Potential).				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCGGAGCCATCGGCCTGGGCG	0.672													7	14	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50718479	50718479	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50718479C>A	uc003bkv.3	-	26	4303	c.4197G>T	c.(4195-4197)AGG>AGT	p.R1399S	PLXNB2_uc003bkt.1_Missense_Mutation_p.R191S|PLXNB2_uc003bku.1_Missense_Mutation_p.R384S	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1399	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGACAGCATCCTCTCCACCA	0.612													5	38	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65486316	65486316	+	Silent	SNP	G	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65486316G>T	uc011moz.1	+	21	3348	c.3288G>T	c.(3286-3288)GTG>GTT	p.V1096V	HEPH_uc004dwn.2_Silent_p.V1095V|HEPH_uc004dwo.2_Silent_p.V826V|HEPH_uc010nkr.2_Silent_p.V904V|HEPH_uc011mpa.1_Silent_p.V1096V	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	1093	Extracellular (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						AAGGCAATGTGAAGATGCTGG	0.463													3	32	---	---	---	---	PASS
IL1RAPL2	26280	broad.mit.edu	37	X	104478538	104478538	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104478538G>C	uc004elz.1	+	4	1149	c.393G>C	c.(391-393)TTG>TTC	p.L131F		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	131	Ig-like C2-type 1.|Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						CAATGTCCTTGACTGTTGCAG	0.393													9	71	---	---	---	---	PASS
RIPPLY1	92129	broad.mit.edu	37	X	106144121	106144121	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106144121G>A	uc004emr.1	-	4	358	c.314C>T	c.(313-315)TCC>TTC	p.S105F	MORC4_uc004emp.3_Intron|CLDN2_uc004emq.1_Intron|RIPPLY1_uc004ems.1_Missense_Mutation_p.S58F	NM_138382	NP_612391	Q0D2K3	RIPP1_HUMAN	ripply1 homolog	105	Ripply homology domain.				negative regulation of transcription, DNA-dependent|somite rostral/caudal axis specification|somite specification|transcription, DNA-dependent	nucleus					0						GAAGGAGCGGGATTTAGGCCA	0.512													5	6	---	---	---	---	PASS
CLDN2	9075	broad.mit.edu	37	X	106171926	106171926	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106171926G>A	uc004emq.1	+	2	987	c.468G>A	c.(466-468)ATG>ATA	p.M156I	MORC4_uc004emp.3_Intron|CLDN2_uc004emt.1_Missense_Mutation_p.M156I	NM_020384	NP_065117	P57739	CLD2_HUMAN	claudin 2	156	Extracellular (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1						CTGACAGCATGAAATTTGAGA	0.478													14	63	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119694330	119694330	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119694330C>T	uc004esw.2	-	3	655	c.218G>A	c.(217-219)AGA>AAA	p.R73K	CUL4B_uc004esv.2_Missense_Mutation_p.R55K	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	73	Ser-rich.				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						AAAGTCTTCTCTCTCGTTAct	0.438													5	15	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123805551	123805551	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123805551C>T	uc004euj.2	-	6	1214	c.1150G>A	c.(1150-1152)GAT>AAT	p.D384N	ODZ1_uc011muj.1_Missense_Mutation_p.D383N|ODZ1_uc010nqy.2_Missense_Mutation_p.D384N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	384	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TCTGATTTATCAGAAACTTTT	0.398													9	55	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130219951	130219951	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130219951A>T	uc004evz.2	+	9	1514	c.1169A>T	c.(1168-1170)AAA>ATA	p.K390I	ARHGAP36_uc004ewa.2_Missense_Mutation_p.K378I|ARHGAP36_uc004ewb.2_Missense_Mutation_p.K359I|ARHGAP36_uc004ewc.2_Missense_Mutation_p.K254I	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	390	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						CTCCTGAAAAAAGGAAAGTTT	0.468													7	120	---	---	---	---	PASS
HCFC1	3054	broad.mit.edu	37	X	153225574	153225574	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153225574C>T	uc004fjp.2	-	8	1651	c.1123G>A	c.(1123-1125)GCC>ACC	p.A375T		NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	375					cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTGGTGTTGGCGCGTACCAGT	0.617													3	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2628	2628	+	5'Flank	SNP	T	C	C			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2628T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		aatagggacctgtatgaatgg	0.184													2	1	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12568745	12568746	+	Intron	INS	-	A	A	rs80004428		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12568745_12568746insA	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron|VPS13D_uc010obd.1_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		gactccgtctcaaaaaaaaaaa	0.168													5	3	---	---	---	---	
EPHA2	1969	broad.mit.edu	37	1	16458076	16458077	+	Intron	INS	-	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16458076_16458077insA	uc001aya.1	-							NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor						activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	actccgtctccaaaaaaaaaaa	0.198													6	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													2	4	---	---	---	---	
TPO	7173	broad.mit.edu	37	2	1484545	1484546	+	Intron	INS	-	CTG	CTG	rs112763492		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1484545_1484546insCTG	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCTCCCTCCTCCTGCATCCGTC	0.589													4	2	---	---	---	---	
CAPN13	92291	broad.mit.edu	37	2	30974059	30974059	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30974059delG	uc002rnn.2	-	11	1322	c.1146delC	c.(1144-1146)ACCfs	p.T382fs	CAPN13_uc002rnp.1_Frame_Shift_Del_p.T382fs	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	382					proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CGACAACATTGGTGCCTTCCA	0.468													46	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	44293377	44293377	+	IGR	DEL	G	-	-	rs61062797		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44293377delG								LRPPRC (70233 upstream) : PPM1B (102623 downstream)																							TTTTTGTTTTGTTTTTTTTTT	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91899626	91899626	+	IGR	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91899626delA								LOC654342 (51651 upstream) : GGT8P (63742 downstream)																							CCAGAGGCTCAAAAAAAAAAA	0.289													5	5	---	---	---	---	
SCTR	6344	broad.mit.edu	37	2	120219288	120219289	+	Intron	DEL	AA	-	-	rs67695587		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120219288_120219289delAA	uc002tma.2	-						SCTR_uc002tlz.2_Intron	NM_002980	NP_002971	P47872	SCTR_HUMAN	secretin receptor precursor						digestion|excretion	integral to plasma membrane	secretin receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3					Secretin(DB00021)	actccaactcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ITGA6	3655	broad.mit.edu	37	2	173368989	173368990	+	3'UTR	INS	-	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368989_173368990insA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGCGGGGGCCTAAAAAAAAAAA	0.376													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54420721	54420722	+	Intron	INS	-	TTT	TTT	rs79160483		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54420721_54420722insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		GCTGTCTTCTGTTTTTTTTTTT	0.381													4	4	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AAAGACTTCTCTGTGAGCTTTG	0.381													6	3	---	---	---	---	
CD38	952	broad.mit.edu	37	4	15826305	15826306	+	Intron	DEL	AC	-	-	rs3832313		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15826305_15826306delAC	uc011bxc.1	+						CD38_uc003goj.1_Intron|CD38_uc003gol.1_Intron	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen						B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						gtgacctagaacacacacacac	0.045													5	3	---	---	---	---	
CORIN	10699	broad.mit.edu	37	4	47746258	47746260	+	Intron	DEL	TGT	-	-	rs150197652		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47746258_47746260delTGT	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Intron|CORIN_uc011bzi.1_Intron|CORIN_uc003gxn.3_Intron	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						tttctggggatgttgttaatatt	0.000													5	4	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	74010556	74010556	+	Intron	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74010556delA	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron|ANKRD17_uc011cbd.1_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTCCTGTTTAAAAAAAAAAA	0.313													29	7	---	---	---	---	
USP38	84640	broad.mit.edu	37	4	144130643	144130643	+	Intron	DEL	A	-	-	rs111830994		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144130643delA	uc003ijb.2	+						USP38_uc003ija.3_Intron|USP38_uc003ijc.2_Intron	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					actctgtctcaaaaaaaaaaa	0.114													5	4	---	---	---	---	
KIAA0947	23379	broad.mit.edu	37	5	5457380	5457380	+	Intron	DEL	T	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5457380delT	uc003jdm.3	+							NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379											ovary(1)|central_nervous_system(1)	2						TCTTTCTTTCTTTTTTTTTTT	0.323													4	3	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	39002484	39002485	+	Intron	INS	-	TG	TG			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39002484_39002485insTG	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					tgttacttggttgtgtgtgtgt	0.040													11	5	---	---	---	---	
PURA	5813	broad.mit.edu	37	5	139494755	139494756	+	3'UTR	DEL	CA	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139494755_139494756delCA	uc003lfa.2	+	1						NM_005859	NP_005850	Q00577	PURA_HUMAN	purine-rich element binding protein A						DNA unwinding involved in replication|DNA-dependent DNA replication initiation	DNA replication factor A complex	double-stranded telomeric DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|single-stranded DNA binding|transcription factor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAAACCCCcacacacacaca	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180699086	180699087	+	RNA	INS	-	A	A	rs11381664		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180699086_180699087insA	uc003mnq.2	+	3		c.450_451insA								Homo sapiens cDNA clone IMAGE:3910094, partial cds.																		CTTTCCATCAGAAAAAAAAAAA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16063918	16063919	+	IGR	INS	-	AAGA	AAGA			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16063918_16063919insAAGA								DTNBP1 (400647 upstream) : MYLIP (65398 downstream)																							aggaaggaaggaagaaaggaag	0.079													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6966408	6966408	+	IGR	DEL	G	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6966408delG								C7orf28B (100547 upstream) : C1GALT1 (255838 downstream)																							TTCTGGGAAAGGGATCCCTCC	0.647													4	3	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20697950	20697951	+	Intron	INS	-	T	T	rs10643091		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20697950_20697951insT	uc003suw.3	+						ABCB5_uc010kuh.2_Intron|ABCB5_uc003suv.3_Intron|ABCB5_uc011jyi.1_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						TCTTTGGGCTCTTTTTTTTTTT	0.282													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33977125	33977126	+	Intron	INS	-	GTGT	GTGT			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977125_33977126insGTGT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GGAGAAGTAGGgtgtgtgtgtg	0.391													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33977149	33977150	+	Intron	DEL	TA	-	-	rs59695815	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977149_33977150delTA	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						tgtgtgtgtgtatgtgtgtgtt	0.366													4	2	---	---	---	---	
BAZ1B	9031	broad.mit.edu	37	7	72877570	72877570	+	Intron	DEL	T	-	-	rs72371247		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72877570delT	uc003tyc.2	-							NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B						ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				ttcttttttcttttttttttt	0.129													10	6	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105459892	105459892	+	Intron	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105459892delA	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						TTTGGGatttaaaaaaaaaaa	0.398													6	4	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113871341	113871341	+	Intron	DEL	T	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113871341delT	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGATTATGACTTTTTTTTTAA	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			71	13	---	---	---	---	
ANXA13	312	broad.mit.edu	37	8	124706232	124706232	+	Intron	DEL	T	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124706232delT	uc003yqu.2	-						ANXA13_uc003yqt.2_Intron	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a						cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			TGGTTTTGCCTTTTTTTTTTT	0.483													4	3	---	---	---	---	
VAX1	11023	broad.mit.edu	37	10	118897632	118897632	+	5'UTR	DEL	C	-	-	rs56950787		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897632delC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		GGGGGGGGGGCGGAGAAGGAA	0.438													5	3	---	---	---	---	
FRG2B	441581	broad.mit.edu	37	10	135439939	135439940	+	Intron	INS	-	A	A			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135439939_135439940insA	uc010qvg.1	-							NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B							nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ACACATTTCTCAAGTCCCCTGA	0.480													2	4	---	---	---	---	
CHORDC1	26973	broad.mit.edu	37	11	89943548	89943549	+	Intron	INS	-	CAGA	CAGA	rs150562845	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89943548_89943549insCAGA	uc001pdg.2	-						CHORDC1_uc009yvz.2_Intron	NM_012124	NP_036256	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain-containing						chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				ATGATGCTACTCAgagtctctt	0.104													4	2	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31255056	31255056	+	Intron	DEL	C	-	-	rs145143657		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255056delC	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron|DDX11_uc009zjo.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGAGGATTTCCCCCAAAGTC	0.607										Multiple Myeloma(12;0.14)			5	3	---	---	---	---	
ATP2B1	490	broad.mit.edu	37	12	90010464	90010464	+	Intron	DEL	A	-	-	rs113951213		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90010464delA	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc001tbf.2_Intron	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GTTCACACAGAAAAAAAAAAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81229767	81229767	+	IGR	DEL	G	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81229767delG								SPRY2 (314681 upstream) : None (None downstream)																							TATCCTCCCTGCTTTATCAGA	0.478													4	2	---	---	---	---	
KIAA0317	9870	broad.mit.edu	37	14	75137986	75137987	+	Intron	INS	-	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75137986_75137987insT	uc001xqb.2	-						KIAA0317_uc010tut.1_Intron|KIAA0317_uc001xqc.2_Intron	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		AAAAACCTAGGTTTTTTTTTTT	0.386													4	2	---	---	---	---	
TUBGCP5	114791	broad.mit.edu	37	15	22845637	22845638	+	Intron	INS	-	TATTTTTAAA	TATTTTTAAA	rs144200387	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22845637_22845638insTATTTTTAAA	uc001yur.3	+						TUBGCP5_uc001yuq.2_Intron	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		TACATAAATGTTAGGTAGCTGT	0.203													5	3	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4938713	4938714	+	Intron	INS	-	TTT	TTT	rs34143557		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4938713_4938714insTTT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						tttatcctgcattttttttttt	0.000													6	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18897123	18897123	+	Intron	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18897123delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						AGTTTTAGTTAAAAAAAAAAA	0.149													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32077916	32077917	+	IGR	INS	-	TTT	TTT	rs139112308	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32077916_32077917insTTT								ZNF267 (149290 upstream) : HERC2P4 (84693 downstream)																							ATGGAAAACGGTTATTTTTTTG	0.421													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33942128	33942129	+	IGR	INS	-	T	T	rs76660512	by1000genomes	TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33942128_33942129insT								None (None upstream) : MIR1826 (23379 downstream)																							TGGAAAAAATACCACTTGTTAC	0.267													4	2	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67183864	67183864	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67183864delC	uc010dfa.1	-	20	3167	c.2288delG	c.(2287-2289)CGCfs	p.R763fs	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Frame_Shift_Del_p.R364fs	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	763					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CTTTAAGAAGCGAAGTGTTGC	0.378													118	7	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29973144	29973144	+	Intron	DEL	T	-	-	rs10708225		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29973144delT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTCTGAATTGttttttttttt	0.308													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21817605	21817605	+	IGR	DEL	G	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817605delG								ZNF429 (78537 upstream) : ZNF100 (89239 downstream)																							aaaaaaaaaagaaaaaaacaa	0.104													4	2	---	---	---	---	
ZNF254	9534	broad.mit.edu	37	19	24227658	24227659	+	Intron	DEL	TG	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24227658_24227659delTG	uc010xrk.1	+						uc002nrr.1_Intron|uc002nrs.1_Intron	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				CATTCAGGGATGTGGTCATAGA	0.356													6	5	---	---	---	---	
C19orf41	126123	broad.mit.edu	37	19	50665879	50665879	+	Intron	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50665879delA	uc002prp.1	-							NM_152358	NP_689571	Q6UXV1	IZUM2_HUMAN	hypothetical protein LOC126123 precursor							integral to membrane					0		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00364)|OV - Ovarian serous cystadenocarcinoma(262;0.0052)		cttaaaaaagaaaaaaaaaaG	0.234													9	4	---	---	---	---	
FPR3	2359	broad.mit.edu	37	19	52328113	52328113	+	3'UTR	DEL	A	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52328113delA	uc002pxt.1	+	2						NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2						cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						CGTTAAGCGGAAAAAAaaaat	0.259													4	2	---	---	---	---	
CDC25B	994	broad.mit.edu	37	20	3786464	3786473	+	3'UTR	DEL	GTGGATGGCC	-	-			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3786464_3786473delGTGGATGGCC	uc002wjn.2	+	16					CDC25B_uc010zqk.1_3'UTR|CDC25B_uc010zql.1_3'UTR|CDC25B_uc010zqm.1_3'UTR|CDC25B_uc002wjl.2_3'UTR|CDC25B_uc002wjm.2_3'UTR|CDC25B_uc002wjo.2_3'UTR|CDC25B_uc002wjp.2_3'UTR|CDC25B_uc002wjq.2_3'UTR|CDC25B_uc010gbc.2_3'UTR|uc002wjr.2_5'Flank	NM_021873	NP_068659	P30305	MPIP2_HUMAN	cell division cycle 25B isoform 1						cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|ovary(2)	5						ggatggatgggtggatggccgtggatggcc	0.414													97	11	---	---	---	---	
LAMA5	3911	broad.mit.edu	37	20	60904422	60904426	+	Intron	DEL	CAGCC	-	-	rs3065756		TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60904422_60904426delCAGCC	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGGCAGCAGcagcccagcccagcc	0.600													5	3	---	---	---	---	
NFAM1	150372	broad.mit.edu	37	22	42828309	42828310	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BT-A20O-01	TCGA-BT-A20O-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42828309_42828310insT	uc003bcn.3	-	1	92_93	c.54_55insA	c.(52-57)CCTGGGfs	p.P18fs		NM_145912	NP_666017	Q8NET5	NFAM1_HUMAN	NFAT activation molecule 1 precursor	18_19					B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity				0						GCGGGGAGCCCAGGAGGGCGTG	0.663													4	2	---	---	---	---	
