Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ZBTB48	3104	broad.mit.edu	37	1	6645946	6645946	+	Intron	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6645946C>G	uc009vmc.1	+						ZBTB48_uc001anx.2_Intron|ZBTB48_uc009vmd.1_Intron|ZBTB48_uc001any.1_5'UTR	NM_005341	NP_005332	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		GAAACCCTCTCAGCCCCCCCA	0.577													23	23	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11561646	11561646	+	Silent	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11561646G>C	uc001ash.3	+	2	735	c.597G>C	c.(595-597)CGG>CGC	p.R199R	PTCHD2_uc001asi.1_Silent_p.R199R	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	199	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CAGCCAATCGGAGCGGGCGAC	0.687													7	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	21751341	21751341	+	RNA	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21751341C>T	uc001bep.1	-	5		c.317G>A								Homo sapiens cDNA FLJ25572 fis, clone JTH05111.																		CTGCTTCCATCAGCACCTCGT	0.458													42	61	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38197144	38197144	+	Silent	SNP	C	T	T	rs77925917	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38197144C>T	uc009vvi.2	-	7	1688	c.1602G>A	c.(1600-1602)CCG>CCA	p.P534P	EPHA10_uc009vvh.1_RNA|EPHA10_uc001cbu.2_RNA|EPHA10_uc001cbv.1_RNA	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	534	Fibronectin type-III 2.|Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGGATGGCCCCGGGGAAGCGG	0.597													30	63	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39818703	39818703	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39818703G>C	uc010oiu.1	+	8	6675	c.6544G>C	c.(6544-6546)GAG>CAG	p.E2182Q	MACF1_uc010ois.1_Missense_Mutation_p.E1680Q|MACF1_uc001cda.1_Missense_Mutation_p.E1588Q|MACF1_uc001cdc.1_Missense_Mutation_p.E767Q|MACF1_uc001cdb.1_Missense_Mutation_p.E767Q	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3747					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGAACTGGCAGAGAACAAGAA	0.473													12	23	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39818900	39818900	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39818900G>A	uc010oiu.1	+	8	6872	c.6741G>A	c.(6739-6741)ATG>ATA	p.M2247I	MACF1_uc010ois.1_Missense_Mutation_p.M1745I|MACF1_uc001cda.1_Missense_Mutation_p.M1653I|MACF1_uc001cdc.1_Missense_Mutation_p.M832I|MACF1_uc001cdb.1_Missense_Mutation_p.M832I	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3812					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGAGATGATGAAGGTAAGGG	0.299													9	11	---	---	---	---	PASS
RNF220	55182	broad.mit.edu	37	1	45101242	45101242	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45101242G>A	uc001clv.1	+	7	1335	c.975G>A	c.(973-975)AGG>AGA	p.R325R	RNF220_uc001clw.1_Silent_p.R325R|RNF220_uc010okx.1_Silent_p.R86R|RNF220_uc010oky.1_Silent_p.R86R|RNF220_uc010okz.1_Silent_p.R41R|RNF220_uc001clx.1_Silent_p.R41R|RNF220_uc001cly.1_Silent_p.R4R|RNF220_uc001clz.1_Silent_p.R4R|RNF220_uc001cma.1_Silent_p.R4R|TMEM53_uc001cmb.1_3'UTR	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220	325					protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TGAAACGGAGGAAGCAAGATG	0.567													17	26	---	---	---	---	PASS
YIPF1	54432	broad.mit.edu	37	1	54332522	54332522	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54332522C>G	uc001cvu.2	-	8	894	c.557G>C	c.(556-558)AGA>ACA	p.R186T	YIPF1_uc001cvv.2_RNA|YIPF1_uc001cvw.2_RNA|YIPF1_uc001cvx.2_RNA|YIPF1_uc001cvy.2_RNA	NM_018982	NP_061855	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	186	Cytoplasmic (Potential).					integral to membrane|transport vesicle				large_intestine(1)|ovary(1)	2						TTTGCTGTTTCTCCACATGAG	0.458													23	28	---	---	---	---	PASS
RAVER2	55225	broad.mit.edu	37	1	65247172	65247172	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65247172G>A	uc001dbs.1	+	4	974	c.896G>A	c.(895-897)GGC>GAC	p.G299D	RAVER2_uc001dbt.1_Missense_Mutation_p.G178D|RAVER2_uc010opb.1_Missense_Mutation_p.G178D	NM_018211	NP_060681	Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	299	RRM 3.					cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)	1						ACCATCAAGGGCAGCAAAGTC	0.517													35	49	---	---	---	---	PASS
VAV3	10451	broad.mit.edu	37	1	108145726	108145726	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108145726C>A	uc001dvk.1	-	23	2129	c.2075G>T	c.(2074-2076)AGT>ATT	p.S692I	VAV3_uc010ouu.1_Missense_Mutation_p.S96I|VAV3_uc001dvj.1_Missense_Mutation_p.S132I|VAV3_uc010ouv.1_Missense_Mutation_p.S96I|VAV3_uc010ouw.1_Missense_Mutation_p.S692I	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	692	SH2.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AAGGTAAGTACTATTTACCCT	0.353													4	96	---	---	---	---	PASS
CSF1	1435	broad.mit.edu	37	1	110466096	110466096	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110466096G>A	uc001dyu.2	+	6	1266	c.853G>A	c.(853-855)GGG>AGG	p.G285R	CSF1_uc001dyt.2_Missense_Mutation_p.G285R|CSF1_uc001dyv.3_Intron|CSF1_uc001dyw.3_Missense_Mutation_p.G285R	NM_172212	NP_757351	P09603	CSF1_HUMAN	colony stimulating factor 1 isoform a precursor	285	Lumenal (Potential).				cell proliferation|developmental process involved in reproduction|macrophage differentiation|monocyte activation|osteoclast differentiation|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of cellular protein metabolic process|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of monocyte differentiation|positive regulation of mononuclear cell proliferation|positive regulation of protein kinase activity	extracellular space|integral to membrane|perinuclear region of cytoplasm|plasma membrane|receptor complex	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding|protein homodimerization activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCCCTCTGTCGGGGCCTTCAA	0.612											OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	28	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	159021525	159021525	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159021525G>A	uc001ftg.2	+	9	1844	c.1554G>A	c.(1552-1554)CAG>CAA	p.Q518Q	IFI16_uc010pis.1_Silent_p.Q518Q|IFI16_uc001fth.2_Silent_p.Q61Q|IFI16_uc010pit.1_Silent_p.Q117Q	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					ACAGTGCCCAGAGTGACCTCA	0.418													44	56	---	---	---	---	PASS
PRDX6	9588	broad.mit.edu	37	1	173454533	173454533	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173454533G>T	uc001giy.1	+	3	337	c.286G>T	c.(286-288)GAA>TAA	p.E96*		NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6	96	Thioredoxin.				cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						AGAGCCCACAGAAAAGTTACC	0.438													30	35	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200967639	200967639	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200967639G>A	uc001gvs.1	-	14	2267	c.1950C>T	c.(1948-1950)ATC>ATT	p.I650I	KIF21B_uc001gvr.1_Silent_p.I650I|KIF21B_uc009wzl.1_Silent_p.I650I|KIF21B_uc010ppn.1_Silent_p.I650I	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	650	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						CCAGCTCGTCGATCAGCTTCT	0.562													32	62	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220162081	220162081	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220162081G>A	uc001hly.1	-	19	2896	c.2626C>T	c.(2626-2628)CAG>TAG	p.Q876*	EPRS_uc010puf.1_Nonsense_Mutation_p.Q627*|EPRS_uc001hlz.1_Nonsense_Mutation_p.Q883*	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	876	WHEP-TRS 2.|3 X 57 AA approximate repeats.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AATGGGGGCTGACCAGGTATG	0.403													66	62	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220331158	220331158	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220331158G>C	uc010puk.1	-	30	3486	c.3322C>G	c.(3322-3324)CAG>GAG	p.Q1108E	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.Q688E|RAB3GAP2_uc001hmh.2_Missense_Mutation_p.Q52E	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	1108					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ATTAAGATCTGAAGAAGATCC	0.363													16	17	---	---	---	---	PASS
FAM36A	116228	broad.mit.edu	37	1	245006464	245006464	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245006464A>G	uc001iar.2	+	4	721	c.343A>G	c.(343-345)AGC>GGC	p.S115G	FAM36A_uc001ias.2_RNA|FAM36A_uc001iat.2_RNA|NCRNA00201_uc001iav.2_RNA	NM_198076	NP_932342	Q5RI15	FA36A_HUMAN	hypothetical protein LOC116228	115						integral to membrane					0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			ACACAACGGCAGCAGCAGCAA	0.363													19	31	---	---	---	---	PASS
PDIA6	10130	broad.mit.edu	37	2	10924320	10924320	+	3'UTR	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10924320C>T	uc002rau.2	-	13					ATP6V1C2_uc002ras.2_3'UTR|ATP6V1C2_uc002rat.2_3'UTR|PDIA6_uc010yjg.1_3'UTR|PDIA6_uc002rav.2_3'UTR|PDIA6_uc010yjh.1_3'UTR|PDIA6_uc002raw.2_3'UTR	NM_005742	NP_005733	Q15084	PDIA6_HUMAN	protein disulfide isomerase A6 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		AATGTCCCTTCACTGCTGGAA	0.433													3	6	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71748031	71748031	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71748031G>A	uc002sie.2	+	11	1426	c.1050G>A	c.(1048-1050)GCG>GCA	p.A350A	DYSF_uc010feg.2_Silent_p.A381A|DYSF_uc010feh.2_Silent_p.A350A|DYSF_uc002sig.3_Silent_p.A350A|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.A350A|DYSF_uc010fef.2_Silent_p.A381A|DYSF_uc010fei.2_Silent_p.A381A|DYSF_uc010fek.2_Silent_p.A382A|DYSF_uc010fej.2_Silent_p.A351A|DYSF_uc010fel.2_Silent_p.A351A|DYSF_uc010feo.2_Silent_p.A382A|DYSF_uc010fem.2_Silent_p.A351A|DYSF_uc010fen.2_Silent_p.A382A|DYSF_uc002sif.2_Silent_p.A351A	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	350	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GGGACGAAGCGCCTGTGAGTA	0.532													17	28	---	---	---	---	PASS
SLC5A7	60482	broad.mit.edu	37	2	108626805	108626805	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108626805G>C	uc002tdv.2	+	9	1507	c.1231G>C	c.(1231-1233)GAC>CAC	p.D411H	SLC5A7_uc010ywm.1_Missense_Mutation_p.D164H|SLC5A7_uc010fjj.2_Missense_Mutation_p.D411H|SLC5A7_uc010ywn.1_Missense_Mutation_p.D298H	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	411	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CCTCAGTTCTGACCTTGTTTA	0.488													32	40	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141457909	141457909	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141457909C>G	uc002tvj.1	-	41	7681	c.6709G>C	c.(6709-6711)GGT>CGT	p.G2237R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2237	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGGTTGGTACCTTTTCTTCTT	0.348										TSP Lung(27;0.18)			42	55	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179650718	179650718	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179650718C>T	uc010zfg.1	-	14	2451	c.2227G>A	c.(2227-2229)GCC>ACC	p.A743T	TTN_uc010zfh.1_Missense_Mutation_p.A697T|TTN_uc010zfi.1_Missense_Mutation_p.A697T|TTN_uc010zfj.1_Missense_Mutation_p.A697T|TTN_uc002unb.2_Missense_Mutation_p.A743T|TTN_uc010frg.1_Missense_Mutation_p.A325T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	743							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTTGCGGCGGAAATGCGT	0.547													24	33	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187694567	187694567	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187694567G>T	uc002upu.1	-	8	1022	c.982C>A	c.(982-984)CTC>ATC	p.L328I		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	328					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			ATCAGTTGGAGAGGCAGTGAT	0.393													42	64	---	---	---	---	PASS
ECEL1	9427	broad.mit.edu	37	2	233345140	233345140	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233345140G>A	uc002vsv.2	-	17	2402	c.2197C>T	c.(2197-2199)CTG>TTG	p.L733L	ECEL1_uc010fya.1_Silent_p.L731L|ECEL1_uc010fyb.1_Silent_p.L440L	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	733	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TTGTCAGTCAGCACCTGCAGG	0.637													16	28	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5248946	5248946	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5248946C>A	uc003bqi.2	+	7	1458	c.1326C>A	c.(1324-1326)TTC>TTA	p.F442L	EDEM1_uc011asz.1_Missense_Mutation_p.F220L|EDEM1_uc003bqh.2_Missense_Mutation_p.F442L	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	442	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		AGGCCTTTTTCCCTGGACTGC	0.458													42	49	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5251877	5251877	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5251877C>G	uc003bqi.2	+	9	1659	c.1527C>G	c.(1525-1527)TTC>TTG	p.F509L	EDEM1_uc003bqh.2_Missense_Mutation_p.F509L	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	509	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		AGAATCCCTTCTACCTCCATG	0.448													31	50	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7721860	7721860	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7721860G>A	uc003bqm.2	+	9	2850	c.2576G>A	c.(2575-2577)CGG>CAG	p.R859Q	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.R859Q|GRM7_uc003bql.2_Missense_Mutation_p.R859Q|GRM7_uc003bqn.1_Missense_Mutation_p.R442Q	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	859	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	GTCCAGAAACGGAAGCGAAGC	0.517													22	26	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49929005	49929005	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49929005C>A	uc003cxy.3	-	16	3625	c.3361G>T	c.(3361-3363)GAG>TAG	p.E1121*	MST1R_uc011bdc.1_5'UTR	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	1121	Cytoplasmic (Potential).|Protein kinase.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TGCTGCATCTCTGTGATGCCT	0.582													32	32	---	---	---	---	PASS
PPM1M	132160	broad.mit.edu	37	3	52283681	52283681	+	3'UTR	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52283681C>G	uc003ddf.3	+	9					PPM1M_uc011bed.1_Intron|PPM1M_uc010hmd.2_Intron|PPM1M_uc003ddg.3_Intron|PPM1M_uc003ddh.3_Intron			Q96MI6	PPM1M_HUMAN	RecName: Full=Protein phosphatase 1M;          EC=3.1.3.16; AltName: Full=Protein phosphatase 2C isoform eta;          Short=PP2C-eta;          Short=PP2CE;						protein dephosphorylation	nucleus	CTD phosphatase activity|manganese ion binding				0				BRCA - Breast invasive adenocarcinoma(193;2.4e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)		GGATGGTCTTCACAGGTTCTC	0.542													12	16	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101085458	101085458	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101085458C>G	uc003dut.2	-	9	1245	c.1134G>C	c.(1132-1134)TTG>TTC	p.L378F	SENP7_uc003duu.2_Missense_Mutation_p.L313F|SENP7_uc003duv.2_Missense_Mutation_p.L345F|SENP7_uc003duw.2_Missense_Mutation_p.L312F|SENP7_uc003dux.2_Missense_Mutation_p.L214F	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	378					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						TGGCATTACTCAAAGTCAACT	0.403													34	41	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101370486	101370486	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101370486C>T	uc003dve.3	-	11	2916	c.2686G>A	c.(2686-2688)GCT>ACT	p.A896T		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	896	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CGGGCATCAGCCCAAGCTACT	0.418													34	37	---	---	---	---	PASS
TERC	7012	broad.mit.edu	37	3	169482464	169482464	+	RNA	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169482464C>A	uc003ffr.1	-	1		c.385G>T				NR_001566				Homo sapiens cDNA clone IMAGE:40002477.												0						CGCGGGGACTCGCTCCGTTCC	0.672									Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				14	8	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184295484	184295484	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184295484C>T	uc003foz.2	+	7	1955	c.1518C>T	c.(1516-1518)AAC>AAT	p.N506N		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	506	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GCCAGATGAACTCCGTGCAGC	0.657													37	42	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1746708	1746708	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1746708G>A	uc003gdo.2	+	16	2593	c.2485G>A	c.(2485-2487)GAC>AAC	p.D829N	TACC3_uc003gdp.2_Missense_Mutation_p.D469N|TACC3_uc010ica.2_Missense_Mutation_p.D250N	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	829	Potential.					centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CAGGATCTGCGACGACCTCAT	0.597													80	5	---	---	---	---	PASS
STBD1	8987	broad.mit.edu	37	4	77230916	77230916	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77230916C>T	uc003hka.2	+	2	1086	c.840C>T	c.(838-840)TTC>TTT	p.F280F	STBD1_uc003hjy.2_3'UTR|STBD1_uc011cbv.1_3'UTR|STBD1_uc011cbw.1_Silent_p.F131F	NM_003943	NP_003934	O95210	STBD1_HUMAN	starch binding domain 1	280	CBM20.|Cytoplasmic (Potential).				carbohydrate metabolic process|muscle contraction	integral to plasma membrane|membrane fraction	carbohydrate binding|catalytic activity|protein binding			ovary(1)	1			Lung(101;0.196)			ATGTGCAATTCATTGCAGTAA	0.473													21	25	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119644544	119644544	+	3'UTR	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119644544C>T	uc003ici.3	-	23					SEC24D_uc003ich.3_RNA|SEC24D_uc003icj.3_3'UTR	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						AATGCCATCTCTTCCTGGAAA	0.368													7	9	---	---	---	---	PASS
CCRN4L	25819	broad.mit.edu	37	4	139964521	139964521	+	Intron	SNP	C	G	G	rs77480680	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964521C>G	uc003ihl.2	+						CCRN4L_uc003ihk.1_Missense_Mutation_p.L162V	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					TTTTGTGCCTCTGCAGTCAAG	0.507													32	36	---	---	---	---	PASS
HMGB2	3148	broad.mit.edu	37	4	174254073	174254073	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174254073C>G	uc011ckc.1	-	3	490	c.370G>C	c.(370-372)GAT>CAT	p.D124H	HMGB2_uc003ita.3_Missense_Mutation_p.D124H|HMGB2_uc003itb.2_Missense_Mutation_p.D124H|HMGB2_uc003itc.2_3'UTR	NM_001130689	NP_001124161	P26583	HMGB2_HUMAN	high-mobility group box 2	124	HMG box 2.				base-excision repair, DNA ligation|cell chemotaxis|cellular response to lipopolysaccharide|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|negative regulation of transcription, DNA-dependent|nucleosome assembly|phosphatidylinositol-mediated signaling|positive regulation of DNA binding|positive regulation of endothelial cell proliferation|positive regulation of erythrocyte differentiation|positive regulation of megakaryocyte differentiation|positive regulation of nuclease activity|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	condensed chromosome|extracellular space|nucleolus|nucleoplasm|perinuclear region of cytoplasm|protein complex	chemoattractant activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding|transcription regulatory region DNA binding				0		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		TTTGCAGTATCCCCAATGGAT	0.408													76	104	---	---	---	---	PASS
GLRX	2745	broad.mit.edu	37	5	95158370	95158370	+	5'UTR	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95158370G>A	uc003klo.3	-	1					GLRX_uc003kln.3_5'UTR	NM_001118890	NP_001112362	P35754	GLRX1_HUMAN	glutaredoxin (thioltransferase)						cell redox homeostasis|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|transport	cytosol	electron carrier activity|glutathione disulfide oxidoreductase activity|protein disulfide oxidoreductase activity|protein N-terminus binding				0		all_cancers(142;3.38e-06)|all_epithelial(76;5.66e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;2.62e-16)	Glutathione(DB00143)	GAGCCATGCCGATGGGCTGCG	0.557													18	21	---	---	---	---	PASS
PPIC	5480	broad.mit.edu	37	5	122359598	122359598	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122359598G>A	uc003kth.2	-	5	716	c.611C>T	c.(610-612)CCT>CTT	p.P204L		NM_000943	NP_000934	P45877	PPIC_HUMAN	peptidylprolyl isomerase C	204					protein folding|signal transduction	cytoplasm	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding			ovary(1)	1		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	AACCACAAAAGGCGTTTTCAC	0.413													134	76	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132100049	132100049	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132100049C>T	uc003kxr.2	-	3	452	c.214G>A	c.(214-216)GAG>AAG	p.E72K	SEPT8_uc003kxs.1_Missense_Mutation_p.E72K|SEPT8_uc003kxu.2_Missense_Mutation_p.E72K|SEPT8_uc011cxi.1_Missense_Mutation_p.E72K|SEPT8_uc003kxv.2_Missense_Mutation_p.E72K|SEPT8_uc003kxt.2_Missense_Mutation_p.E12K	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a	72					cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGGCTTCCTCAGTCTCGAAG	0.582													21	11	---	---	---	---	PASS
FBXL21	26223	broad.mit.edu	37	5	135273129	135273129	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135273129G>C	uc010jec.1	+	3	403	c.382G>C	c.(382-384)GAG>CAG	p.E128Q	FBXL21_uc003lbc.2_RNA	NM_012159	NP_036291	Q9UKT6	FXL21_HUMAN	F-box and leucine-rich repeat protein 21	128					rhythmic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGTAGCGCTGAGTCAGCAGA	0.378													12	38	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140306671	140306671	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140306671A>G	uc003lih.2	+	1	370	c.194A>G	c.(193-195)TAC>TGC	p.Y65C	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.Y65C	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	65	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGAGCTCTACTTCGGGGTG	0.637													29	12	---	---	---	---	PASS
HIST1H2BA	255626	broad.mit.edu	37	6	25727255	25727255	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25727255C>G	uc003nfd.2	+	1	119	c.119C>G	c.(118-120)TCT>TGT	p.S40C	HIST1H2AA_uc003nfc.2_5'Flank	NM_170610	NP_733759	Q96A08	H2B1A_HUMAN	histone cluster 1, H2ba	40					nucleosome assembly	nucleosome|nucleus	DNA binding			kidney(1)	1						GAGAGTTATTCTATTTACATC	0.428													38	20	---	---	---	---	PASS
OR2H2	7932	broad.mit.edu	37	6	29556637	29556637	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29556637G>C	uc003nmr.1	+	1	955	c.916G>C	c.(916-918)GAA>CAA	p.E306Q	GABBR1_uc003nmp.3_Intron	NM_007160	NP_009091	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H,	306	Cytoplasmic (Potential).				defense response|mating|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTGGGGAAGGAAATGGGGCT	0.478													18	27	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29913231	29913231	+	Nonstop_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29913231G>T	uc003nol.2	+	8	1097	c.1097G>T	c.(1096-1098)TGA>TTA	p.*366L	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc003non.2_Nonstop_Mutation_p.*372L|HLA-A_uc003noo.2_Nonsense_Mutation_p.E367*|HLA-A_uc010jrr.2_Nonstop_Mutation_p.*300L|HLA-A_uc003nom.2_Nonsense_Mutation_p.E244*|HLA-A_uc011dmc.1_Nonstop_Mutation_p.*245L|HLA-A_uc011dmd.1_3'UTR	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	366					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TCTATAGTGTGAGACAGCTGC	0.448									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			14	37	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31597445	31597445	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31597445C>A	uc003nvb.3	+	14	2326	c.2077C>A	c.(2077-2079)CCA>ACA	p.P693T	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.P693T	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	693	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						TGTGCCAGCTCCACAGGCTCC	0.572													25	41	---	---	---	---	PASS
GSTA2	2939	broad.mit.edu	37	6	52615381	52615381	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52615381C>A	uc003pay.2	-	7	813	c.663G>T	c.(661-663)AGG>AGT	p.R221S		NM_000846	NP_000837	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	221					glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)	TTTATTAAAACCTGAAAATCT	0.413													7	84	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75884895	75884895	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75884895G>T	uc003phs.2	-	13	2735	c.2569C>A	c.(2569-2571)CAA>AAA	p.Q857K	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	857	Fibronectin type-III 5.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						GTGACCTCTTGAGTTTCACCC	0.498													71	109	---	---	---	---	PASS
KPNA5	3841	broad.mit.edu	37	6	117053364	117053364	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117053364C>G	uc003pxh.2	+	14	1629	c.1498C>G	c.(1498-1500)CTG>GTG	p.L500V		NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5	497	ARM 10; atypical.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		GGCATTTGATCTGATTGAACA	0.343													33	40	---	---	---	---	PASS
FZD1	8321	broad.mit.edu	37	7	90895308	90895308	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90895308C>T	uc003ula.2	+	1	1526	c.1113C>T	c.(1111-1113)GCC>GCT	p.A371A		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	371	Helical; Name=2; (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CCTACATCGCCGGCTTCCTCC	0.632													29	64	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111379265	111379265	+	Silent	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111379265G>T	uc003vfx.2	-	48	5399	c.5130C>A	c.(5128-5130)TCC>TCA	p.S1710S	DOCK4_uc011kml.1_Silent_p.S591S|DOCK4_uc011kmm.1_Silent_p.S617S|DOCK4_uc003vfw.2_Silent_p.S1160S|DOCK4_uc003vfy.2_Silent_p.S1755S|DOCK4_uc003vfv.2_Silent_p.S23S	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1710	Ser-rich.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				AGTTTTCTCGGGAATGTTTGT	0.502													6	74	---	---	---	---	PASS
NAT1	9	broad.mit.edu	37	8	18080042	18080042	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18080042C>G	uc010ltd.2	+	5	853	c.486C>G	c.(484-486)GAC>GAG	p.D162E	NAT1_uc003wyt.2_Missense_Mutation_p.D224E|NAT1_uc003wyu.2_Missense_Mutation_p.D162E|NAT1_uc003wyv.2_Missense_Mutation_p.D162E|NAT1_uc010ltc.2_Missense_Mutation_p.D162E|NAT1_uc003wys.2_Missense_Mutation_p.D224E|NAT1_uc003wyr.2_Missense_Mutation_p.D162E|NAT1_uc003wyq.2_Missense_Mutation_p.D162E|NAT1_uc011kyl.1_Missense_Mutation_p.D162E	NM_001160179	NP_001153651	P18440	ARY1_HUMAN	N-acetyltransferase 1 isoform a	162					xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity				0				Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)		GGTATCTAGACCAAATCAGAA	0.428													39	54	---	---	---	---	PASS
DENND3	22898	broad.mit.edu	37	8	142151335	142151335	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142151335C>T	uc003yvy.2	+	4	573	c.295C>T	c.(295-297)CGG>TGG	p.R99W	DENND3_uc003yvw.1_Missense_Mutation_p.R112W|DENND3_uc003yvx.2_Silent_p.T177T|DENND3_uc010mep.2_Missense_Mutation_p.R112W	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	99										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CAAAACGCACCGGGAGTGTCC	0.537													5	57	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145773665	145773665	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145773665C>T	uc003zdt.1	-	6	1360	c.805G>A	c.(805-807)GAG>AAG	p.E269K	ARHGAP39_uc011llk.1_Missense_Mutation_p.E269K|ARHGAP39_uc003zds.1_Missense_Mutation_p.E269K	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	269	Pro-rich.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						GGCCTCCTCTCTGGGAAGAAG	0.716													6	4	---	---	---	---	PASS
PSIP1	11168	broad.mit.edu	37	9	15510198	15510198	+	5'UTR	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15510198G>A	uc003zlv.3	-	2					PSIP1_uc003zlw.3_5'UTR|PSIP1_uc003zlz.3_5'UTR|PSIP1_uc003zma.3_5'UTR|PSIP1_uc003zly.2_5'UTR	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2						initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity			breast(1)	1				GBM - Glioblastoma multiforme(50;2.38e-06)		TTTCGGGGGCGAGACCGGGGG	0.672													32	34	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414340	20414340	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414340G>A	uc003zoe.2	-	5	763	c.504C>T	c.(502-504)AGC>AGT	p.S168S	MLLT3_uc011lne.1_Silent_p.S136S|MLLT3_uc011lnf.1_Silent_p.S165S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.A130V	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	168	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.144			T	MLL	ALL								12	892	---	---	---	---	PASS
ALDH1B1	219	broad.mit.edu	37	9	38396624	38396624	+	Silent	SNP	C	T	T	rs141592792		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38396624C>T	uc004aay.2	+	2	991	c.879C>T	c.(877-879)ATC>ATT	p.I293I		NM_000692	NP_000683	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1B1 precursor	293					carbohydrate metabolic process	mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity			skin(1)	1				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)	NADH(DB00157)	GCCCCAGCATCGTGCTGGCCG	0.617													26	33	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115936807	115936807	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115936807C>G	uc004bgs.2	-	22	2398	c.2280G>C	c.(2278-2280)GAG>GAC	p.E760D	FKBP15_uc004bgr.2_Missense_Mutation_p.E197D|FKBP15_uc011lxc.1_Missense_Mutation_p.E341D|FKBP15_uc011lxd.1_Missense_Mutation_p.E692D	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	760	Potential.				endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						TTTCATCTATCTCCTCCTCGG	0.468													59	15	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475702	120475702	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475702C>T	uc004bjz.2	+	3	1587	c.1296C>T	c.(1294-1296)TCC>TCT	p.S432S	TLR4_uc004bka.2_Silent_p.S392S|TLR4_uc004bkb.2_Silent_p.S232S	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	432	LRR 13.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TCCAGCATTCCAATTTGAAAC	0.378													40	12	---	---	---	---	PASS
RC3H2	54542	broad.mit.edu	37	9	125642530	125642530	+	Intron	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125642530C>G	uc010mwc.1	-						RC3H2_uc004bnc.2_Intron|RC3H2_uc004bnd.1_Intron|RC3H2_uc004bne.3_Intron|RC3H2_uc011lzf.1_Intron|RC3H2_uc011lzg.1_Intron|SNORD90_uc004bnf.1_RNA	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2							cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						GTAGGAGTATCAGTGATGAAT	0.303													27	7	---	---	---	---	PASS
FUBP3	8939	broad.mit.edu	37	9	133499065	133499065	+	Silent	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133499065G>T	uc004bzr.1	+	11	1050	c.942G>T	c.(940-942)GCG>GCT	p.A314A	FUBP3_uc010mzd.1_Silent_p.A254A|FUBP3_uc004bzs.1_Silent_p.A227A	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	314	KH 3.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		AGCATGCAGCGCATATCATCA	0.557													19	4	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135781358	135781358	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135781358A>T	uc004cca.2	-	15	1841	c.1607T>A	c.(1606-1608)TTA>TAA	p.L536*	TSC1_uc004ccb.3_Nonsense_Mutation_p.L535*|TSC1_uc011mcq.1_Nonsense_Mutation_p.L485*|TSC1_uc011mcr.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	536					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGAGGAGTGTAAAGGCTCAGG	0.587			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				24	5	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071420	141071420	+	Missense_Mutation	SNP	G	A	A	rs147421666	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071420G>A	uc004com.2	+	4	1084	c.823G>A	c.(823-825)GAC>AAC	p.D275N	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CTGGTTCCCCGACAACGTAAA	0.512													4	33	---	---	---	---	PASS
ZNF25	219749	broad.mit.edu	37	10	38241395	38241395	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38241395C>T	uc001ize.1	-	6	1136	c.1031G>A	c.(1030-1032)TGT>TAT	p.C344Y	ZNF25_uc001izf.1_Missense_Mutation_p.C308Y	NM_145011	NP_659448	P17030	ZNF25_HUMAN	zinc finger protein 25	344	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|central_nervous_system(1)	4		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				ACATTTATTACATTCAAAGGG	0.413													17	29	---	---	---	---	PASS
LRRC20	55222	broad.mit.edu	37	10	72061222	72061222	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72061222C>T	uc001jqx.1	-	5	665	c.443G>A	c.(442-444)AGC>AAC	p.S148N	LRRC20_uc001jqy.1_Missense_Mutation_p.S92N|LRRC20_uc001jqz.1_Missense_Mutation_p.S98N	NM_207119	NP_997002	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20 isoform 1	148	LRR 5.										0						GAGGTTGATGCTGCGCAAGGC	0.592													45	74	---	---	---	---	PASS
CAMK2G	818	broad.mit.edu	37	10	75602237	75602237	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75602237G>C	uc001jvv.1	-	11	982	c.858C>G	c.(856-858)TTC>TTG	p.F286L	CAMK2G_uc001jvm.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvo.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvq.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvr.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvp.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvs.1_Missense_Mutation_p.F294L|CAMK2G_uc001jvt.1_RNA|CAMK2G_uc001jvu.1_Missense_Mutation_p.F272L|CAMK2G_uc010qkv.1_Missense_Mutation_p.F13L|CAMK2G_uc009xrp.1_5'Flank	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	294	Calmodulin-binding.|Calmodulin-binding (By similarity).				insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					TCCGGGCATTGAACTTGCGCA	0.542													23	31	---	---	---	---	PASS
DUSP13	51207	broad.mit.edu	37	10	76855531	76855531	+	3'UTR	SNP	T	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76855531T>C	uc001jws.2	-	7					DUSP13_uc001jwr.2_Missense_Mutation_p.K66E|DUSP13_uc001jwu.2_Missense_Mutation_p.K159E|DUSP13_uc001jww.2_Missense_Mutation_p.K116E|DUSP13_uc009xrs.2_Missense_Mutation_p.K159E|DUSP13_uc001jwt.2_Missense_Mutation_p.K159E|DUSP13_uc001jwv.2_Missense_Mutation_p.K66E	NM_001007271	NP_001007272	Q6B8I1	MDSP_HUMAN	muscle-restricted dual specificity phosphatase							cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TGGATCAGCTTGCTCTTGTCC	0.567													42	64	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78799315	78799315	+	Silent	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78799315G>A	uc001jxn.2	-	15	2007	c.1830C>T	c.(1828-1830)TTC>TTT	p.F610F	KCNMA1_uc001jxj.2_Silent_p.F610F|KCNMA1_uc001jxk.1_Silent_p.F225F|KCNMA1_uc009xrt.1_Silent_p.F430F|KCNMA1_uc001jxl.1_Silent_p.F264F|KCNMA1_uc001jxo.2_Silent_p.F610F|KCNMA1_uc001jxm.2_Silent_p.F610F|KCNMA1_uc001jxq.2_Silent_p.F610F	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	610	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	ACAGACCCACGAAGGCACTGG	0.448													17	26	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93751913	93751913	+	Silent	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93751913C>A	uc001khr.2	+	21	2990	c.2892C>A	c.(2890-2892)GTC>GTA	p.V964V	BTAF1_uc001kht.1_Silent_p.V402V	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	964					negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				ACCATACTGTCACCAAGCACA	0.398													32	36	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10821251	10821251	+	Silent	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10821251C>G	uc001mjc.2	-	19	2589	c.2172G>C	c.(2170-2172)CTG>CTC	p.L724L	EIF4G2_uc001mjb.2_Silent_p.L518L|EIF4G2_uc009ygf.2_Silent_p.L518L|EIF4G2_uc001mjd.2_Silent_p.L686L	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	724	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		ATAAGAAACTCAGTCCCTTTC	0.378													40	45	---	---	---	---	PASS
CYP2R1	120227	broad.mit.edu	37	11	14900872	14900872	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14900872T>C	uc001mlr.2	-	4	1118	c.1118A>G	c.(1117-1119)AAT>AGT	p.N373S	CYP2R1_uc001mlo.2_Missense_Mutation_p.N140S|CYP2R1_uc001mlp.2_Missense_Mutation_p.N256S|CYP2R1_uc001mlq.2_Intron	NM_024514	NP_078790	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R,	373					hormone biosynthetic process|vitamin D metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding|vitamin D3 25-hydroxylase activity			ovary(1)|central_nervous_system(1)	2					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	TGGAACTATATTACAGAATCT	0.368													20	27	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35308446	35308446	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35308446C>A	uc001mwd.2	-	8	1736	c.1144G>T	c.(1144-1146)GAT>TAT	p.D382Y	SLC1A2_uc001mwe.2_Missense_Mutation_p.D373Y|SLC1A2_uc010rev.1_Missense_Mutation_p.D382Y	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	382					D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	ACACGCTTATCAATCCCCAGA	0.458													65	88	---	---	---	---	PASS
MS4A6A	64231	broad.mit.edu	37	11	59939727	59939727	+	Intron	SNP	C	G	G	rs140130948	byFrequency	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59939727C>G	uc001nor.2	-						MS4A6A_uc001noq.2_Intron|MS4A6A_uc001nos.3_Intron|MS4A6A_uc009ymv.2_Intron	NM_152852	NP_690591	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						AAAGTACACTCTAGAAGAAAC	0.338													41	44	---	---	---	---	PASS
ZNHIT2	741	broad.mit.edu	37	11	64884085	64884085	+	Silent	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64884085G>T	uc001ocw.2	-	1	1086	c.1041C>A	c.(1039-1041)ACC>ACA	p.T347T	uc009yqb.1_5'UTR	NM_014205	NP_055020	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT domain containing 2	347							metal ion binding			breast(1)	1						CATTTTCGTTGGTCCAGGCCA	0.647													3	48	---	---	---	---	PASS
COPS7A	50813	broad.mit.edu	37	12	6837406	6837406	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6837406C>G	uc001qqj.2	+	4	495	c.256C>G	c.(256-258)CCT>GCT	p.P86A	COPS7A_uc009zex.2_RNA|COPS7A_uc001qqk.2_Missense_Mutation_p.P86A|COPS7A_uc001qql.2_RNA|COPS7A_uc001qqh.2_Missense_Mutation_p.P86A|COPS7A_uc001qqi.2_Missense_Mutation_p.P86A|COPS7A_uc001qqm.2_RNA|COPS7A_uc001qqn.3_Missense_Mutation_p.P86A|COPS7A_uc001qqo.2_Missense_Mutation_p.P86A	NM_001164094	NP_001157566	Q9UBW8	CSN7A_HUMAN	COP9 complex subunit 7a	86	PCI.				cullin deneddylation	cytoplasm|signalosome				ovary(1)	1						CCGGAATCTTCCTCCACTAAC	0.512													17	49	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													2	13	---	---	---	---	PASS
RIMKLB	57494	broad.mit.edu	37	12	8926379	8926379	+	Nonstop_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8926379G>C	uc001quu.2	+	6	1411	c.1160G>C	c.(1159-1161)TGA>TCA	p.*387S	RIMKLB_uc009zgf.1_Intron|RIMKLB_uc001qux.2_Nonstop_Mutation_p.*387S|RIMKLB_uc010sgl.1_Nonstop_Mutation_p.*387S|RIMKLB_uc001quw.2_Intron	NM_020734	NP_065785	Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family	387					protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CTGGTGGACTGACTCCACTGG	0.458													53	58	---	---	---	---	PASS
MGP	4256	broad.mit.edu	37	12	15035937	15035937	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15035937G>A	uc001rcn.1	-	3	242	c.139C>T	c.(139-141)CAG>TAG	p.Q47*		NM_000900	NP_000891	P08493	MGP_HUMAN	matrix Gla protein precursor	47					cartilage condensation|cell differentiation|ossification|regulation of bone mineralization	proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent|structural constituent of bone			ovary(1)	1						CATCTCTGCTGAGGGGATATG	0.393													24	31	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44917247	44917247	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44917247C>A	uc001rog.2	-	17	2420	c.1825G>T	c.(1825-1827)GGG>TGG	p.G609W	NELL2_uc001rof.3_Missense_Mutation_p.G608W|NELL2_uc001roh.2_Missense_Mutation_p.G609W|NELL2_uc009zkd.2_Missense_Mutation_p.G561W|NELL2_uc010skz.1_Missense_Mutation_p.G659W|NELL2_uc010sla.1_Missense_Mutation_p.G632W|NELL2_uc001roi.1_Missense_Mutation_p.G609W	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	609	EGF-like 6; calcium-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CTGTGCCTCCCGGTCCCACAC	0.453													3	82	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56088080	56088080	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56088080G>A	uc001shh.2	-	18	2624	c.2404C>T	c.(2404-2406)CGA>TGA	p.R802*	ITGA7_uc001shg.2_Nonsense_Mutation_p.R798*|ITGA7_uc010sps.1_Nonsense_Mutation_p.R705*|ITGA7_uc009znw.2_Nonsense_Mutation_p.R45*|ITGA7_uc009znx.2_Nonsense_Mutation_p.R679*	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	842	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						ACACGGGCTCGTGCAGAGACT	0.602													118	77	---	---	---	---	PASS
TMTC2	160335	broad.mit.edu	37	12	83289890	83289890	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83289890C>G	uc001szt.2	+	3	1380	c.948C>G	c.(946-948)TTC>TTG	p.F316L	TMTC2_uc001szr.1_Missense_Mutation_p.F316L|TMTC2_uc001szs.1_Missense_Mutation_p.F316L|TMTC2_uc010suk.1_Missense_Mutation_p.F71L	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	316	Helical; (Potential).					endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						CTGTGGCCTTCTATACTGGAC	0.458													36	107	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113304588	113304588	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113304588G>C	uc010syl.1	+	7	749	c.387G>C	c.(385-387)GAG>GAC	p.E129D	RPH3A_uc001ttz.2_Missense_Mutation_p.E129D|RPH3A_uc001tty.2_Missense_Mutation_p.E125D|RPH3A_uc009zwe.1_Missense_Mutation_p.E125D|RPH3A_uc010sym.1_Missense_Mutation_p.E80D|RPH3A_uc001tua.2_5'Flank	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	129	RabBD.|FYVE-type.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GCGGAGTGGAGACCAACAACC	0.562													3	16	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122999747	122999747	+	Silent	SNP	C	T	T	rs142949567		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122999747C>T	uc001ucr.2	-	6	776	c.630G>A	c.(628-630)CCG>CCA	p.P210P	RSRC2_uc001uco.2_5'UTR|RSRC2_uc001ucp.2_Silent_p.P151P|RSRC2_uc001ucq.2_5'UTR|RSRC2_uc001ucs.2_5'UTR|RSRC2_uc001uct.2_Silent_p.P162P|RSRC2_uc001ucu.2_Silent_p.P210P	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	210										ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TAAATCTTCTCGGCTTTTCAA	0.383													4	105	---	---	---	---	PASS
C13orf28	122258	broad.mit.edu	37	13	113053427	113053427	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113053427C>A	uc001vsd.1	+	4	320	c.289C>A	c.(289-291)CAT>AAT	p.H97N		NM_145248	NP_660291	Q96KW9	SPAC7_HUMAN	hypothetical protein LOC122258 precursor	97						extracellular region					0	all_lung(23;0.000633)|Lung NSC(43;0.0161)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0997)|Medulloblastoma(90;0.163)					TGAGAATTACCATGAATTATT	0.373													17	32	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21868445	21868445	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21868445C>T	uc001was.1	-	24	3849	c.3755G>A	c.(3754-3756)CGT>CAT	p.R1252H	CHD8_uc001war.1_Missense_Mutation_p.R1148H|SNORD8_uc001wau.1_5'Flank|CHD8_uc001wav.1_Missense_Mutation_p.R702H	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1531					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTTGCGTCCACGAGGCACAGG	0.403													13	24	---	---	---	---	PASS
CFL2	1073	broad.mit.edu	37	14	35183755	35183755	+	5'Flank	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35183755C>T	uc001wsg.3	-						CFL2_uc010tpn.1_5'UTR|CFL2_uc001wsh.3_5'UTR|CFL2_uc001wsi.3_RNA|CFL2_uc001wsj.3_RNA	NM_021914	NP_068733	Q9Y281	COF2_HUMAN	cofilin 2							cytoplasm|cytoskeleton|nuclear matrix	actin binding			breast(2)	2	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		ATAGTGCCCTCGGCTGTGGCT	0.726													4	6	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107049083	107049083	+	RNA	SNP	A	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107049083A>G	uc010tyt.1	-	142		c.6604T>C								Parts of antibodies, mostly variable regions.												0						ACCTTTTAAAATAGCAACAAG	0.458													73	108	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62201309	62201309	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62201309C>G	uc002agz.2	-	65	8934	c.8860G>C	c.(8860-8862)GTG>CTG	p.V2954L	VPS13C_uc002aha.2_Missense_Mutation_p.V2911L|VPS13C_uc002ahb.1_Missense_Mutation_p.V2954L|VPS13C_uc002ahc.1_Missense_Mutation_p.V2911L|VPS13C_uc002ahd.1_Missense_Mutation_p.V331L	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	2954					protein localization					ovary(2)	2						TTTACATCCACCAAGATACCC	0.353													19	41	---	---	---	---	PASS
NEO1	4756	broad.mit.edu	37	15	73528817	73528817	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73528817C>G	uc002avm.3	+	8	1563	c.1421C>G	c.(1420-1422)TCT>TGT	p.S474C	NEO1_uc010ukx.1_Missense_Mutation_p.S474C|NEO1_uc010uky.1_Missense_Mutation_p.S474C|NEO1_uc010ukz.1_5'UTR|NEO1_uc002avn.3_Missense_Mutation_p.S139C	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor	474	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						CTTACCTACTCTGTGTTCTAC	0.567													33	55	---	---	---	---	PASS
SNX33	257364	broad.mit.edu	37	15	75942367	75942367	+	Silent	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75942367G>C	uc002bau.2	+	1	1020	c.924G>C	c.(922-924)CGG>CGC	p.R308R	IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_5'UTR	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN	sorting nexin 33	308	PX.				cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1						AGCGGAAGCGGAGACTCATCC	0.582													37	72	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	773990	773990	+	Intron	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773990C>G	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron|HAGHL_uc002cjl.1_5'Flank|HAGHL_uc002cjm.1_5'Flank	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GCAAGCCCCTCAGAGGCCCGG	0.662													11	4	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11114144	11114144	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11114144C>T	uc002dao.2	+	12	1628	c.1398C>T	c.(1396-1398)AGC>AGT	p.S466S	CLEC16A_uc002dan.3_Silent_p.S448S	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	466								p.0?(1)		ovary(1)|central_nervous_system(1)	2						AGGAGAAAAGCGCCGCCGCCA	0.617													4	16	---	---	---	---	PASS
SLC6A10P	386757	broad.mit.edu	37	16	32890622	32890622	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32890622T>G	uc002edh.1	-	5	440	c.264A>C	c.(262-264)AAA>AAC	p.K88N	SLC6A10P_uc002edi.1_RNA					RecName: Full=Transporter;												0						CGTTGGTGTTTTTGTAGACCA	0.512													2	11	---	---	---	---	PASS
C16orf87	388272	broad.mit.edu	37	16	46836943	46836943	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46836943G>C	uc002eek.1	-	4	399	c.386C>G	c.(385-387)TCT>TGT	p.S129C		NM_001001436	NP_001001436	Q6PH81	CP087_HUMAN	hypothetical protein LOC388272	129	Potential.										0						CTTTTCATCAGACAGGTTAGC	0.313													16	23	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48250187	48250187	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48250187G>C	uc002eff.1	-	6	1139	c.789C>G	c.(787-789)TTC>TTG	p.F263L	ABCC11_uc002efg.1_Missense_Mutation_p.F263L|ABCC11_uc002efh.1_Missense_Mutation_p.F263L|ABCC11_uc010vgk.1_5'Flank|ABCC11_uc010vgl.1_Missense_Mutation_p.F263L	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	263	ABC transmembrane type-1 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CACCGGTGAAGAAGCTGATGG	0.552									Cerumen_Type				49	50	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53721797	53721797	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53721797C>G	uc002ehp.2	-	5	674	c.610G>C	c.(610-612)GCC>CCC	p.A204P	RPGRIP1L_uc002eho.3_Missense_Mutation_p.A204P|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.A204P|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.A204P|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.A204P|RPGRIP1L_uc002ehq.1_Missense_Mutation_p.A204P	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	204	Potential.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				TCTCCTCTGGCTTCTTCAAGT	0.303													40	84	---	---	---	---	PASS
NOB1	28987	broad.mit.edu	37	16	69776441	69776441	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69776441G>A	uc002exs.2	-	9	1049	c.1033C>T	c.(1033-1035)CGC>TGC	p.R345C		NM_014062	NP_054781	Q9ULX3	NOB1_HUMAN	nin one binding protein	345						nucleus	metal ion binding|protein binding				0						TGAGGGAAGCGCTGATCCTCG	0.552													33	37	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89869700	89869700	+	Silent	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89869700C>G	uc002fou.1	-	8	801	c.759G>C	c.(757-759)CTG>CTC	p.L253L	FANCA_uc010vpn.1_Silent_p.L253L|FANCA_uc002fov.1_Silent_p.L236L|FANCA_uc002fow.1_Silent_p.L253L|FANCA_uc002fox.1_Silent_p.L253L|FANCA_uc010ciu.1_Silent_p.L221L|FANCA_uc002foy.2_Silent_p.L253L	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	253					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CAGTTCTTCTCAGATCTGAGT	0.393			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				52	60	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2598209	2598209	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2598209C>T	uc002fuy.1	-	16	2763	c.2677G>A	c.(2677-2679)GAG>AAG	p.E893K	KIAA0664_uc002fux.1_Missense_Mutation_p.E826K|KIAA0664_uc010ckc.1_5'UTR	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	893							binding			breast(2)	2						TTCCAGAGCTCCTGGGGGGTC	0.632													7	0	---	---	---	---	PASS
MPDU1	9526	broad.mit.edu	37	17	7495957	7495957	+	3'UTR	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7495957C>A	uc010vuc.1	+	6					SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank|FXR2_uc002gia.1_Intron			O75352	MPU1_HUMAN	SubName: Full=cDNA FLJ57793, moderately similar to Mannose-P-dolichol utilization defect 1 protein;						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1						CATCCAACCTCCCACCCTCGA	0.552													40	9	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10430322	10430322	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10430322G>C	uc010coi.2	-	29	4051	c.3923C>G	c.(3922-3924)TCA>TGA	p.S1308*	uc002gml.1_Intron|MYH2_uc002gmp.3_Nonsense_Mutation_p.S1308*|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1308	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTTGCCTCTTGATAACTGAGA	0.373													25	3	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18082089	18082089	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18082089G>T	uc010vxh.1	+	65	10836	c.10498G>T	c.(10498-10500)GAA>TAA	p.E3500*	uc002gsn.2_Intron|MYO15A_uc010vxi.1_Missense_Mutation_p.G781V|MYO15A_uc002gsl.2_Missense_Mutation_p.G532V|MYO15A_uc010vxm.1_3'UTR|MYO15A_uc010cpv.2_RNA	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	3500	Tail.|FERM.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GCAGGGACTGGAACTGTGTCG	0.592													19	6	---	---	---	---	PASS
CCDC144C	348254	broad.mit.edu	37	17	20268809	20268809	+	RNA	SNP	A	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20268809A>G	uc010cqy.1	+	12		c.2976A>G				NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						TCCAGAGAACAAGACAAGAGT	0.383													6	2	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26943411	26943411	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26943411G>A	uc002hbu.2	-	36	6373	c.6274C>T	c.(6274-6276)CGC>TGC	p.R2092C	SGK494_uc010waq.1_5'Flank|SGK494_uc010war.1_5'Flank|SGK494_uc002hbr.1_5'Flank|uc002hbs.1_RNA|KIAA0100_uc002hbt.2_Missense_Mutation_p.R421C	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	2092						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					GGCGATTTGCGAAATGACCTT	0.527													35	108	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29657369	29657369	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29657369G>A	uc002hgg.2	+	39	5998	c.5665G>A	c.(5665-5667)GAG>AAG	p.E1889K	NF1_uc002hgh.2_Missense_Mutation_p.E1868K|NF1_uc002hgi.1_Missense_Mutation_p.E901K|NF1_uc010cso.2_Missense_Mutation_p.E77K	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1889					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTAAAAATCGAGGGCCAGTT	0.393			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			38	75	---	---	---	---	PASS
FBXO47	494188	broad.mit.edu	37	17	37093420	37093420	+	3'UTR	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37093420C>T	uc002hrc.2	-	11						NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN	F-box protein 47												0						GCAAGGCTTTCTGAGGATTTA	0.388													14	33	---	---	---	---	PASS
ADAM11	4185	broad.mit.edu	37	17	42855099	42855099	+	Silent	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42855099G>C	uc002ihh.2	+	23	1938	c.1938G>C	c.(1936-1938)CTG>CTC	p.L646L	ADAM11_uc010wjd.1_Silent_p.L446L|ADAM11_uc002ihi.2_5'UTR	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein	646	Cys-rich.|Extracellular (Potential).				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				GCTCTGACCTGAGCTATGTGG	0.642													31	22	---	---	---	---	PASS
GNGT2	2793	broad.mit.edu	37	17	47284179	47284179	+	Silent	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47284179G>C	uc002ioo.1	-	4	457	c.150C>G	c.(148-150)CTC>CTG	p.L50L		NM_031498	NP_113686	O14610	GBGT2_HUMAN	guanine nucleotide binding protein-gamma	50					G-protein coupled receptor protein signaling pathway|phototransduction|synaptic transmission	extracellular region|heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGATGCCTTTGAGAAAAGGAT	0.493													60	44	---	---	---	---	PASS
TOB1	10140	broad.mit.edu	37	17	48940623	48940623	+	Silent	SNP	T	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48940623T>C	uc002isw.2	-	1	791	c.756A>G	c.(754-756)CCA>CCG	p.P252P	TOB1_uc010wmy.1_Silent_p.P252P|TOB1_uc010wmz.1_Silent_p.P252P	NM_005749	NP_005740	P50616	TOB1_HUMAN	transducer of ERBB2, 1	252	Poly-Pro.				negative regulation of cell proliferation		SH3/SH2 adaptor activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			gtggtggtggtggcggtggcg	0.264													3	34	---	---	---	---	PASS
MIR21	406991	broad.mit.edu	37	17	57918574	57918574	+	5'Flank	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57918574G>C	hsa-mir-21|MI0000077	+						TMEM49_uc002ixv.2_RNA																	0						AATCCTGCCTGACTGTCTGCT	0.398													14	28	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67148283	67148283	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67148283C>G	uc010dfa.1	-	37	5177	c.4298G>C	c.(4297-4299)AGA>ACA	p.R1433T	ABCA10_uc002jhz.2_5'Flank|ABCA10_uc010wqs.1_Missense_Mutation_p.R425T|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1433	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TAAATAATCTCTACCAAACTT	0.388													19	36	---	---	---	---	PASS
EIF4A3	9775	broad.mit.edu	37	17	78120641	78120641	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78120641G>C	uc010wuc.1	-	2	193	c.120C>G	c.(118-120)TTC>TTG	p.F40L	EIF4A3_uc002jxs.2_Missense_Mutation_p.F40L	NM_014740	NP_055555	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A,	40	Q motif.				mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			CCATGGTGTCGAACGTGGGGG	0.473													12	45	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21357556	21357556	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21357556G>C	uc002kuq.2	+	11	1527	c.1441G>C	c.(1441-1443)GAA>CAA	p.E481Q	LAMA3_uc010dlv.1_Missense_Mutation_p.E481Q|LAMA3_uc002kur.2_Missense_Mutation_p.E481Q	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	481	Domain V.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACCAAGTTCAGAAGATCCAGT	0.328													32	64	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50923757	50923757	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50923757C>A	uc002lfe.1	+	18	3355	c.2768C>A	c.(2767-2769)ACA>AAA	p.T923K	DCC_uc010xdr.1_Missense_Mutation_p.T751K|DCC_uc010dpf.1_Missense_Mutation_p.T558K	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	923	Extracellular (Potential).|Fibronectin type-III 5.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GTCATGGTAACAAAAAACAGA	0.423													4	68	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50985745	50985745	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50985745C>A	uc002lfe.1	+	24	4123	c.3536C>A	c.(3535-3537)CCC>CAC	p.P1179H	DCC_uc010dpf.1_Missense_Mutation_p.P814H	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	1179	Cytoplasmic (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGGGACTCTCCCATCCAAAGT	0.478													55	64	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56587489	56587489	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56587489A>C	uc002lho.2	+	4	2517	c.1970A>C	c.(1969-1971)AAC>ACC	p.N657T	ZNF532_uc002lhp.2_Missense_Mutation_p.N655T|ZNF532_uc010xeg.1_Missense_Mutation_p.N655T|ZNF532_uc002lhr.2_Missense_Mutation_p.N655T|ZNF532_uc002lhs.2_Missense_Mutation_p.N655T	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	657					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GTTTTTTACAACAAATGCAGC	0.478													3	60	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15276879	15276879	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15276879C>A	uc002nan.2	-	30	5462	c.5386G>T	c.(5386-5388)GCT>TCT	p.A1796S		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1796	Cytoplasmic (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CAGAAGGAAGCCAGCATTAGC	0.552													16	23	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33117659	33117659	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33117659G>T	uc002ntn.1	-	16	1651	c.1495C>A	c.(1495-1497)CCG>ACG	p.P499T		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	499	ANK 3.				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					AGGTGGAGCGGAGTGGCTCCA	0.607													5	2	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34791438	34791438	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34791438C>T	uc002nvd.3	+	2	919	c.60C>T	c.(58-60)GGC>GGT	p.G20G	KIAA0355_uc010edk.1_Silent_p.G10G	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	20										ovary(1)	1	Esophageal squamous(110;0.162)					TCCTGCTTGGCGGGTCCAAGC	0.622													3	43	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40902836	40902836	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40902836C>T	uc002onr.2	-	7	1692	c.1423G>A	c.(1423-1425)GAG>AAG	p.E475K	PRX_uc002onq.2_Missense_Mutation_p.E336K|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	475	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].|7.				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTTTCATCTCTGACACCTTG	0.582													56	95	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40903232	40903232	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40903232C>T	uc002onr.2	-	7	1296	c.1027G>A	c.(1027-1029)GAG>AAG	p.E343K	PRX_uc002onq.2_Missense_Mutation_p.E204K|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	343					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCTCCACCTCTGCACCCGGC	0.652													17	31	---	---	---	---	PASS
KLK12	43849	broad.mit.edu	37	19	51535219	51535219	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51535219C>T	uc002pvg.1	-	3	490	c.370G>A	c.(370-372)GTT>ATT	p.V124I	KLK12_uc010ycp.1_RNA|KLK12_uc010ycq.1_Intron|KLK12_uc010ycr.1_Intron|KLK12_uc010ycs.1_Intron|KLK12_uc002pvh.1_Missense_Mutation_p.V124I|KLK12_uc002pvi.1_Missense_Mutation_p.V124I|KLK12_uc002pvj.1_Intron	NM_145894	NP_665901	Q9UKR0	KLK12_HUMAN	kallikrein 12 isoform 2	124	Peptidase S1.				proteolysis	extracellular region|soluble fraction	serine-type endopeptidase activity			ovary(1)	1		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		AGGGGTTGAACGCTGCTGGTT	0.677													19	32	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55085555	55085555	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55085555G>A	uc002qgg.3	+	2	136	c.47G>A	c.(46-48)GGC>GAC	p.G16D	LILRA2_uc010ern.2_Missense_Mutation_p.G16D|LILRA2_uc002qgf.2_Missense_Mutation_p.G16D|LILRA2_uc010yfe.1_Missense_Mutation_p.G16D|LILRA2_uc010yff.1_Intron|LILRA2_uc010ero.2_Intron|LILRA2_uc010yfg.1_Missense_Mutation_p.G16D	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	16					defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		CTGAGTCTGGGCCCCAGGACC	0.647													31	53	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58563891	58563891	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58563891G>A	uc002qrc.1	+	5	746	c.499G>A	c.(499-501)GCC>ACC	p.A167T		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	167					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AGTGGCAGCAGCCCCAGCACT	0.652													32	25	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29632684	29632684	+	Intron	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29632684C>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.Q89E					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAAAAAGGCTCAGAAAGATGG	0.313													38	665	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44640373	44640373	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44640373C>A	uc002xqz.2	+	6	1003	c.984C>A	c.(982-984)TTC>TTA	p.F328L		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	328	Fibronectin type-II 2.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	TCTTCGGCTTCTGCCCGACCC	0.637											OREG0025989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	30	---	---	---	---	PASS
SYCP2	10388	broad.mit.edu	37	20	58439419	58439419	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58439419G>A	uc002yaz.2	-	44	4679	c.4540C>T	c.(4540-4542)CGC>TGC	p.R1514C		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1514					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AGTTCTCTGCGTACATTAAGA	0.299													6	14	---	---	---	---	PASS
C20orf20	55257	broad.mit.edu	37	20	61428556	61428556	+	Silent	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61428556G>C	uc002ydi.2	+	2	314	c.243G>C	c.(241-243)CTG>CTC	p.L81L		NM_018270	NP_060740	Q9NV56	MRGBP_HUMAN	MRG-binding protein	81					chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex					0	Breast(26;3.65e-08)					GGGACCATCTGAGCACCATGT	0.607													17	33	---	---	---	---	PASS
C20orf20	55257	broad.mit.edu	37	20	61429948	61429948	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61429948G>C	uc002ydi.2	+	3	351	c.280G>C	c.(280-282)GAG>CAG	p.E94Q		NM_018270	NP_060740	Q9NV56	MRGBP_HUMAN	MRG-binding protein	94					chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex					0	Breast(26;3.65e-08)					GCATGAGTCTGAGATTCTTCC	0.478													68	164	---	---	---	---	PASS
CHODL	140578	broad.mit.edu	37	21	19632552	19632552	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19632552C>G	uc002ykv.2	+	4	974	c.583C>G	c.(583-585)CTT>GTT	p.L195V	CHODL_uc002ykr.2_Missense_Mutation_p.L154V|CHODL_uc002yks.2_Missense_Mutation_p.L154V|CHODL_uc002ykt.2_Missense_Mutation_p.L154V|CHODL_uc002yku.2_Missense_Mutation_p.L154V	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor	195	Extracellular (Potential).				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		AAAGCCTTATCTTACAAATCA	0.323													36	59	---	---	---	---	PASS
BCL2L13	23786	broad.mit.edu	37	22	18171756	18171756	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18171756C>T	uc002zmw.2	+	4	452	c.234C>T	c.(232-234)TTC>TTT	p.F78F	BCL2L13_uc002zmu.2_Silent_p.F78F|BCL2L13_uc002zmv.2_Silent_p.F78F|BCL2L13_uc002zmx.2_Intron|BCL2L13_uc002zmy.2_Silent_p.F78F|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_5'UTR|BCL2L13_uc002zmz.2_5'UTR	NM_015367	NP_056182	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	78					induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)		CTTCAGCCTTCACCAGCACAG	0.323													33	31	---	---	---	---	PASS
MICAL3	57553	broad.mit.edu	37	22	18293495	18293495	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18293495C>G	uc002zng.3	-	28	5883	c.5530G>C	c.(5530-5532)GAG>CAG	p.E1844Q	MICAL3_uc011agl.1_Missense_Mutation_p.E1760Q|MICAL3_uc010gre.1_RNA	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1844	Potential.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		CGCTTAAGCTCCTCCTGCTTG	0.592													20	21	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31851891	31851891	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31851891C>A	uc003akz.1	-	8	1210	c.1046G>T	c.(1045-1047)AGC>ATC	p.S349I	EIF4ENIF1_uc003akx.1_Missense_Mutation_p.S28I|EIF4ENIF1_uc003aky.1_Missense_Mutation_p.S28I|EIF4ENIF1_uc003ala.1_Missense_Mutation_p.S349I|EIF4ENIF1_uc003alb.1_Missense_Mutation_p.S186I	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	349						nucleus	protein binding|protein transporter activity			ovary(1)	1						GCTGGATCGGCTTCCTGATCT	0.468											OREG0003517	type=REGULATORY REGION|Gene=LOC486366|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	56	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32266660	32266660	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32266660A>C	uc003als.2	+	33	3464	c.3322A>C	c.(3322-3324)AGC>CGC	p.S1108R	DEPDC5_uc011als.1_Missense_Mutation_p.S1039R|DEPDC5_uc011alu.1_Missense_Mutation_p.S1139R|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.S1130R|DEPDC5_uc003alu.2_Missense_Mutation_p.S557R|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.S460R|DEPDC5_uc003alw.2_Missense_Mutation_p.S406R|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Missense_Mutation_p.S134R|DEPDC5_uc011aly.1_5'UTR	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1108					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						CAGAGGCAACAGCCAGACCTT	0.512													15	32	---	---	---	---	PASS
H1F0	3005	broad.mit.edu	37	22	38201996	38201996	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38201996A>C	uc003aty.2	+	1	883	c.445A>C	c.(445-447)AAG>CAG	p.K149Q	GCAT_uc003atz.2_5'Flank|GCAT_uc003aua.1_5'Flank	NM_005318	NP_005309	P07305	H10_HUMAN	H1 histone family, member 0	149					DNA fragmentation involved in apoptotic nuclear change|nucleosome assembly	actin cytoskeleton|Golgi apparatus|nucleoplasm|nucleosome	DNA binding				0	Melanoma(58;0.045)					GGCCAAGAAGAAGCTGGCTGC	0.547													35	25	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42126536	42126536	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42126536G>C	uc003baz.1	+	9	1016	c.991G>C	c.(991-993)GAG>CAG	p.E331Q	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Missense_Mutation_p.E331Q|MEI1_uc011apd.1_RNA	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	331							binding			central_nervous_system(1)|skin(1)	2						GTTCCTCTTTGAGCATCTTTC	0.438													17	20	---	---	---	---	PASS
FAM9B	171483	broad.mit.edu	37	X	8995957	8995957	+	Silent	SNP	C	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8995957C>T	uc011mhu.1	-	6	533	c.444G>A	c.(442-444)AGG>AGA	p.R148R	FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Silent_p.R188R	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	148						nucleus					0		Hepatocellular(5;0.219)				GCCTCTCTCTCCTAACACTTC	0.323													37	51	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148732	34148732	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148732C>A	uc004ddg.2	-	1	1697	c.1664G>T	c.(1663-1665)AGT>ATT	p.S555I		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	555										ovary(4)|central_nervous_system(1)	5						CGGGTGGAGACTGGACACCCG	0.582													3	51	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54259293	54259293	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54259293G>A	uc004dtd.1	-	21	5087	c.4648C>T	c.(4648-4650)CGA>TGA	p.R1550*	WNK3_uc004dtc.1_Nonsense_Mutation_p.R1597*	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	1550					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GGGCGGCTTCGAAGTTTGCTT	0.408													43	39	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101910483	101910483	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101910483G>C	uc004ejj.3	+	5	2443	c.1642G>C	c.(1642-1644)GAG>CAG	p.E548Q	GPRASP1_uc004eji.3_Missense_Mutation_p.E548Q|GPRASP1_uc010nod.2_Missense_Mutation_p.E548Q	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	548	Glu-rich.					cytoplasm	protein binding			ovary(1)|lung(1)	2						TGAGGAAGAAGAGGTCATTGG	0.517													68	16	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140953305	140953305	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140953305C>A	uc011mwp.1	+	2	172	c.172C>A	c.(172-174)CAT>AAT	p.H58N		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	58										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TCATCTTGGGCATCTGAGGGA	0.512													49	57	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155785776	155785777	+	Intron	INS	-	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155785776_155785777insA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAGCAGGGCAGAAAAAAAAAAA	0.351													2	4	---	---	---	---	
TPR	7175	broad.mit.edu	37	1	186300536	186300536	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186300536delA	uc001grv.2	-							NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AGAACAAGCTAAAAAAAAAAA	0.303			T	NTRK1	papillary thyroid								11	6	---	---	---	---	
WDR54	84058	broad.mit.edu	37	2	74649917	74649917	+	Intron	DEL	C	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74649917delC	uc002slb.2	+							NM_032118	NP_115494	Q9H977	WDR54_HUMAN	WD repeat domain 54												0						aagactccgtcccccaaaaaa	0.199													8	4	---	---	---	---	
C3orf19	51244	broad.mit.edu	37	3	14702848	14702849	+	Intron	INS	-	T	T	rs141125865	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14702848_14702849insT	uc003byw.2	+						C3orf19_uc010hei.1_Intron|C3orf19_uc010hej.2_Intron	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244												0						CTTTTTCAAGATTTTTTTGTGT	0.401													3	4	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124066219	124066220	+	Intron	DEL	TG	-	-	rs35771518		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124066219_124066220delTG	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GGTGAGAAGCtgtgtgtgtgtg	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146995077	146995077	+	IGR	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146995077delA								PLSCR5 (671074 upstream) : ZIC4 (108760 downstream)																							TCTGGACTGtaaaaaaaaaaa	0.209													6	3	---	---	---	---	
FGFRL1	53834	broad.mit.edu	37	4	1019055	1019056	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1019055_1019056delCA	uc003gce.2	+	7	1596_1597	c.1435_1436delCA	c.(1435-1437)CACfs	p.H479fs	FGFRL1_uc003gcf.2_Frame_Shift_Del_p.H479fs|FGFRL1_uc003gcg.2_Frame_Shift_Del_p.H479fs|FGFRL1_uc010ibo.2_Frame_Shift_Del_p.H479fs	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	479	His-rich.|Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			cacagacatccacacacacaca	0.460													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	37086022	37086022	+	IGR	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37086022delA								NIPBL (20102 upstream) : C5orf42 (20308 downstream)																							AATTAATAGGAAAAAAAAaaa	0.204													6	3	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112720978	112720978	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112720978delA	uc003kql.3	-						MCC_uc003kqk.3_5'Flank	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CTGGTTAATGAAAAAAAAAAG	0.328													76	7	---	---	---	---	
PCDHB2	56133	broad.mit.edu	37	5	140476921	140476922	+	3'UTR	INS	-	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476921_140476922insT	uc003lil.2	+	1						NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATGTATGAGTTTTTTTGCGG	0.272													22	7	---	---	---	---	
ZFP57	346171	broad.mit.edu	37	6	29642978	29642979	+	Intron	INS	-	AACTTGAA	AACTTGAA	rs143499124	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29642978_29642979insAACTTGAA	uc011dlw.1	-						ZFP57_uc003nnl.3_Intron	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog						DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CTTGGATCTTCAACTTGAAGTC	0.292													4	4	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139167865	139167866	+	Intron	INS	-	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139167865_139167866insT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						TTTGTTTTTTGTTTTTTTTCAT	0.366													216	8	---	---	---	---	
FKBP9L	360132	broad.mit.edu	37	7	55774673	55774676	+	5'Flank	DEL	AGGG	-	-	rs72285105		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55774673_55774676delAGGG	uc010kzl.2	-							NR_003949				SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);												0						gaaggaaggaagggaggaaggaag	0.113													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98408891	98408893	+	IGR	DEL	TAG	-	-	rs140739561	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98408891_98408893delTAG								NPTX2 (149710 upstream) : TMEM130 (35219 downstream)																							gtggtggtgatagtggtggtggt	0.000													4	3	---	---	---	---	
LUC7L2	51631	broad.mit.edu	37	7	139094364	139094365	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139094364_139094365insAG	uc003vux.2	+	7	1117_1118	c.743_744insAG	c.(742-744)GAAfs	p.E248fs	LUC7L2_uc011kqs.1_Frame_Shift_Ins_p.E245fs|LUC7L2_uc011kqt.1_Frame_Shift_Ins_p.E314fs|LUC7L2_uc003vuy.2_Frame_Shift_Ins_p.E247fs|LUC7L2_uc003vuz.1_Frame_Shift_Ins_p.E195fs|LUC7L2_uc003vva.2_Frame_Shift_Ins_p.E195fs	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2	248	Arg/Ser-rich.						enzyme binding|metal ion binding				0	Melanoma(164;0.242)					AAACGAAGAGAAGAGAGAGAGA	0.396													11	6	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38112713	38112713	+	Intron	DEL	A	-	-	rs150194338		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38112713delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc003xld.2_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													4	2	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132966046	132966046	+	Intron	DEL	T	-	-	rs112472883		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132966046delT	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATTTTCTTCCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													3	3	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20787078	20787081	+	Intron	DEL	CAAA	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20787078_20787081delCAAA	uc003zog.1	+							NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		TAACCTTAGGcaaacaaacaaaca	0.382													228	10	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20862798	20862800	+	Intron	DEL	TGT	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20862798_20862800delTGT	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		ATTCCTAATCtgttgttgttgtt	0.310													858	25	---	---	---	---	
FAM21C	253725	broad.mit.edu	37	10	46254741	46254742	+	Intron	INS	-	A	A			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46254741_46254742insA	uc001jcu.2	+						FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Intron|FAM21C_uc010qfi.1_Intron|FAM21C_uc010qfj.1_Intron|FAM21C_uc010qfk.1_Intron	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725											ovary(1)	1						TCTTCCCCACCCCCCCCCCACC	0.416													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128821807	128821807	+	Intron	DEL	T	-	-	rs72037531		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128821807delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CCCTGTGGtcttttttttttt	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5141556	5141557	+	IGR	INS	-	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5141556_5141557insT								KCNA1 (114136 upstream) : KCNA5 (11528 downstream)																							actttcccttcttTTTTTTTTT	0.173													2	5	---	---	---	---	
IPO8	10526	broad.mit.edu	37	12	30818977	30818977	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30818977delA	uc001rjd.2	-						IPO8_uc001rje.1_5'Flank|IPO8_uc010sjt.1_Intron	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CCAGGAGAGGAAAAAAAAAAT	0.318													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55807232	55807234	+	IGR	DEL	TGC	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55807232_55807234delTGC								OR6C65 (11983 upstream) : OR6C76 (12804 downstream)																							ttgctgttgttgctgctgctgct	0.463													3	3	---	---	---	---	
TMEM19	55266	broad.mit.edu	37	12	72094757	72094757	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72094757delT	uc001sws.2	+	6	1576	c.993delT	c.(991-993)GGTfs	p.G331fs	TMEM19_uc009zru.1_RNA	NM_018279	NP_060749	Q96HH6	TMM19_HUMAN	transmembrane protein 19	331	Helical; (Potential).					integral to membrane					0		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		CTGCTTGGGGTTTTTGGCCCA	0.433													358	8	---	---	---	---	
ANKRD13A	88455	broad.mit.edu	37	12	110463769	110463770	+	Intron	INS	-	T	T			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110463769_110463770insT	uc001tpx.2	+						ANKRD13A_uc009zvl.1_Intron|ANKRD13A_uc010sxw.1_Intron|ANKRD13A_uc001tpy.2_Intron|ANKRD13A_uc001tpz.2_5'Flank	NM_033121	NP_149112	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13												0						CTCTCTCTCTCttttttttttt	0.203													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145415	119145416	+	IGR	INS	-	TGGTGA	TGGTGA	rs28483306		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145415_119145416insTGGTGA								SUDS3 (289576 upstream) : SRRM4 (273980 downstream)																							gatggtgatggtggtggtggtg	0.000													7	4	---	---	---	---	
ZCCHC8	55596	broad.mit.edu	37	12	122975027	122975027	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122975027delG	uc001ucn.2	-	4	536	c.405delC	c.(403-405)TCCfs	p.S135fs	ZCCHC8_uc009zxp.2_5'UTR|ZCCHC8_uc009zxq.2_5'UTR	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	135						catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AAAGATTAAAGGAAGTCTTTT	0.338													27	20	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													2	4	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133352941	133352942	+	Intron	INS	-	G	G	rs58544277		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133352941_133352942insG	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AGCTCCTTCCTCCCTGCTGCTC	0.663													89	7	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30012361	30012361	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30012361delA	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACTTTTTGGGAAAAAAAAAAA	0.294													5	3	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43690581	43690581	+	Intron	DEL	A	-	-	rs150462033		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690581delA	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		cccatctcataaaaaaaaaaa	0.090													4	2	---	---	---	---	
RNF111	54778	broad.mit.edu	37	15	59341944	59341945	+	Intron	INS	-	TT	TT	rs60727965		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59341944_59341945insTT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		ttctttctttcttttttttttt	0.168													4	2	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	8994680	8994680	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8994680delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc002czj.2_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TACAACAGGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		tttttttttcttttttttttt	0.209													4	3	---	---	---	---	
LLGL2	3993	broad.mit.edu	37	17	73569700	73569701	+	Frame_Shift_Ins	INS	-	G	G	rs112393371	byFrequency	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73569700_73569701insG	uc002joh.2	+	21	3018_3019	c.2864_2865insG	c.(2863-2865)CCGfs	p.P955fs	LLGL2_uc002joi.2_Frame_Shift_Ins_p.P955fs|LLGL2_uc010dgg.1_Frame_Shift_Ins_p.P955fs|LLGL2_uc002joj.2_Frame_Shift_Ins_p.P944fs|LLGL2_uc010wsd.1_Frame_Shift_Ins_p.P582fs	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	955					cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			AAGAAGGCCCCGAGCCGAGCCA	0.668													52	8	---	---	---	---	
SMAD4	4089	broad.mit.edu	37	18	48573269	48573269	+	Intron	DEL	T	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48573269delT	uc010xdp.1	+						SMAD4_uc010xdo.1_Intron	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4						BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity			pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GATGTGTGTCTTTTTTTTTTT	0.318									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				3	3	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7131996	7131997	+	Intron	INS	-	A	A	rs148055651		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7131996_7131997insA	uc002mgd.1	-						INSR_uc002mge.1_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	gcctccatctcaaaaaaaaaaa	0.267													4	2	---	---	---	---	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	-	-	rs111751275		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8398950_8398961delTCGCTGTCGCCA	uc010dwa.2	-	5	1533_1544	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)GATGGCGACAGCGAG>GAG	p.DGDS489del	KANK3_uc002mjp.1_In_Frame_Del_p.MATA1del	NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47	489_492											0						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.693													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9204884	9204885	+	IGR	INS	-	G	G			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9204884_9204885insG								OR1M1 (23 upstream) : OR7G2 (8062 downstream)																							CAGGAACTTCTGGGGGGTAGAA	0.421													8	7	---	---	---	---	
RAVER1	125950	broad.mit.edu	37	19	10428414	10428414	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10428414delC	uc002moa.2	-	12	2156	c.2076delG	c.(2074-2076)GGGfs	p.G692fs	FDX1L_uc002mnx.1_5'Flank|FDX1L_uc002mny.1_5'Flank|RAVER1_uc002mnz.2_Frame_Shift_Del_p.G60fs	NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	519						cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			GGCCCAGGAGCCCTTCTCCGG	0.697													4	2	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33620856	33620856	+	Intron	DEL	A	-	-	rs72246943		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33620856delA	uc002nug.1	+						GPATCH1_uc002nuh.1_Intron|WDR88_uc002nui.2_5'Flank	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					atctcgggggaaaaaaaaaaa	0.214													6	3	---	---	---	---	
C19orf46	163183	broad.mit.edu	37	19	36496126	36496126	+	Intron	DEL	T	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36496126delT	uc002ocq.1	-						C19orf46_uc002ocr.1_Intron|C19orf46_uc002ocs.1_Intron|C19orf46_uc010een.1_Intron	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183						establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			tttccattacttttttttttt	0.035													10	7	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61471746	61471747	+	Intron	INS	-	CT	CT	rs140852150	by1000genomes	TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61471746_61471747insCT	uc002ydm.2	+						COL9A3_uc002ydn.2_Intron	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CTTTGTGTGCCGTTCCCTCGGC	0.688													5	4	---	---	---	---	
PDXK	8566	broad.mit.edu	37	21	45161607	45161607	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45161607delG	uc002zdm.3	+	3	400	c.202delG	c.(202-204)GGCfs	p.G68fs	PDXK_uc010gpj.2_Frame_Shift_Del_p.G68fs|PDXK_uc002zdn.3_Frame_Shift_Del_p.G68fs|PDXK_uc002zdq.3_5'UTR	NM_003681	NP_003672	O00764	PDXK_HUMAN	pyridoxal kinase	68					cell proliferation|pyridoxal 5'-phosphate salvage	cytosol	ATP binding|lithium ion binding|magnesium ion binding|potassium ion binding|protein homodimerization activity|pyridoxal kinase activity|pyridoxal phosphate binding|sodium ion binding|zinc ion binding				0				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	GTTGTACGAAGGCCTGAGGCT	0.577													27	16	---	---	---	---	
MLC1	23209	broad.mit.edu	37	22	50507155	50507155	+	Intron	DEL	T	-	-	rs72191777		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50507155delT	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		tttctttttcttttttttttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	9371537	9371537	+	IGR	DEL	G	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9371537delG								FAM9B (238890 upstream) : TBL1X (59798 downstream)																							GTCAGCAAAAGGAAATTTATT	0.408													18	11	---	---	---	---	
SRPX	8406	broad.mit.edu	37	X	38079976	38079978	+	In_Frame_Del	DEL	GCA	-	-	rs72249350		TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38079976_38079978delGCA	uc004ddy.1	-	1	154_156	c.68_70delTGC	c.(67-72)CTGCGC>CGC	p.L23del	SRPX_uc004ddz.1_In_Frame_Del_p.L23del|SRPX_uc011mkh.1_In_Frame_Del_p.L23del|SRPX_uc011mki.1_In_Frame_Del_p.L23del	NM_006307	NP_006298	P78539	SRPX_HUMAN	sushi-repeat-containing protein, X-linked	23			Missing.		cell adhesion	cell surface|membrane					0						GGCGGGACGCgcagcagcagcag	0.576											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
DKC1	1736	broad.mit.edu	37	X	153994771	153994771	+	Intron	DEL	A	-	-			TCGA-BT-A20P-01	TCGA-BT-A20P-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153994771delA	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital_Dyskeratosis				4	2	---	---	---	---	
