Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
HES3	390992	broad.mit.edu	37	1	6305619	6305619	+	3'UTR	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6305619C>A	uc009vly.1	+	4						NM_001024598	NP_001019769	Q5TGS1	HES3_HUMAN	hairy and enhancer of split 3						transcription, DNA-dependent	nucleus	DNA binding				0	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		AGCACGCCCACAGTGACTGCC	0.677													3	3	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12422812	12422812	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12422812A>T	uc001atv.2	+	51	10319	c.10178A>T	c.(10177-10179)GAT>GTT	p.D3393V	VPS13D_uc001atw.2_Missense_Mutation_p.D3368V|VPS13D_uc001atx.2_Missense_Mutation_p.D2580V	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3392					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CGATACATTGATACCTGCATG	0.428													68	142	---	---	---	---	PASS
C1orf144	26099	broad.mit.edu	37	1	16721628	16721628	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16721628G>A	uc001aym.3	+	4	622	c.452G>A	c.(451-453)CGC>CAC	p.R151H	C1orf144_uc010ocb.1_Silent_p.A114A|C1orf144_uc001ayi.3_Missense_Mutation_p.R132H|C1orf144_uc001ayk.3_Missense_Mutation_p.R131H	NM_001114600	NP_001108072	Q7Z422	CA144_HUMAN	putative MAPK activating protein PM20,PM21	151											0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.12e-05)|Kidney(64;0.00018)|KIRC - Kidney renal clear cell carcinoma(64;0.00267)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TTCAAACAGCGCAGATAAATG	0.582													5	16	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918403	16918403	+	Silent	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918403G>C	uc009vos.1	-	7	1002	c.114C>G	c.(112-114)CTC>CTG	p.L38L	NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	38						cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ATTTCTCTTTGAGGTTTCTGA	0.468													47	807	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19441918	19441918	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19441918C>T	uc001bbi.2	-	74	11041	c.11037G>A	c.(11035-11037)GAG>GAA	p.E3679E	UBR4_uc001bbj.1_Silent_p.E94E	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3679					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGTACACATTCTCTCCACAGT	0.517													17	35	---	---	---	---	PASS
PPIE	10450	broad.mit.edu	37	1	40214727	40214727	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40214727G>A	uc001cds.1	+	8	704	c.661G>A	c.(661-663)GAT>AAT	p.D221N	PPIE_uc001cdt.1_Missense_Mutation_p.D155N|PPIE_uc010oiy.1_Missense_Mutation_p.D142N|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Missense_Mutation_p.D221N|PPIE_uc001cdw.2_Missense_Mutation_p.D221N|PPIE_uc001cdx.1_Missense_Mutation_p.D137N	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1	221	PPIase cyclophilin-type.				protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GAAGTTCGATGATGAAAACTT	0.557													31	32	---	---	---	---	PASS
CDC14A	8556	broad.mit.edu	37	1	100920981	100920981	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100920981C>T	uc001dtg.3	+	8	1028	c.540C>T	c.(538-540)TTC>TTT	p.F180F	CDC14A_uc009web.2_RNA|CDC14A_uc010oui.1_Silent_p.F122F|CDC14A_uc001dte.3_Silent_p.F180F|CDC14A_uc001dtf.2_Silent_p.F180F|CDC14A_uc009wed.1_Intron|CDC14A_uc009wee.2_Silent_p.F180F	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	180	B.				cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		ATGGTGACTTCAACTGGATTG	0.303													27	38	---	---	---	---	PASS
C1orf161	126868	broad.mit.edu	37	1	116670903	116670903	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116670903G>A	uc001egc.1	+	6	1063	c.798G>A	c.(796-798)CTG>CTA	p.L266L		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	266											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGAGGCACCTGAAGGAGGACA	0.587													4	23	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144923818	144923818	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144923818T>C	uc001elw.3	-	6	931	c.640A>G	c.(640-642)ATG>GTG	p.M214V	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.M280V|PDE4DIP_uc001emc.1_Missense_Mutation_p.M214V|PDE4DIP_uc001emd.1_Missense_Mutation_p.M214V|PDE4DIP_uc001emb.1_Missense_Mutation_p.M377V|PDE4DIP_uc001eme.1_5'Flank|PDE4DIP_uc001emf.1_Missense_Mutation_p.M1V	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	214					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCTTCAGTCATGGGCTAGGAA	0.403			T	PDGFRB	MPD								19	103	---	---	---	---	PASS
FAM63A	55793	broad.mit.edu	37	1	150974829	150974829	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150974829C>G	uc001ewf.2	-	3	1949	c.265G>C	c.(265-267)GAG>CAG	p.E89Q	FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_5'UTR|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Missense_Mutation_p.E137Q|FAM63A_uc001ewg.2_Missense_Mutation_p.E89Q	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	89							protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTTATTGTCTCTACTTCAGGC	0.582													23	39	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155168291	155168291	+	Silent	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155168291C>A	uc001fix.2	-	17	2006	c.1983G>T	c.(1981-1983)GGG>GGT	p.G661G	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Silent_p.G652G|THBS3_uc001fiz.2_Silent_p.G624G|THBS3_uc001fiy.2_Silent_p.G190G|THBS3_uc010pfu.1_Silent_p.G541G|THBS3_uc010pfv.1_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	661	TSP type-3 7.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGTCATCATCCCCATCACACT	0.532													3	54	---	---	---	---	PASS
LMNA	4000	broad.mit.edu	37	1	156096551	156096551	+	Intron	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156096551G>A	uc001fni.2	+						LMNA_uc001fnf.1_Intron|LMNA_uc001fng.2_Intron|LMNA_uc001fnh.2_Intron|LMNA_uc009wro.1_Intron|LMNA_uc010pgz.1_Intron|LMNA_uc001fnj.2_5'UTR|LMNA_uc001fnk.2_Intron	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor						cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)					GGAAGAGTTAGAAACAGGATG	0.537									Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				4	2	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156503868	156503868	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156503868G>C	uc001fpf.2	-	30	3881	c.3806C>G	c.(3805-3807)TCA>TGA	p.S1269*		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1269					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACCATGTCTGAGTACTCGTC	0.607													26	47	---	---	---	---	PASS
APOA1BP	128240	broad.mit.edu	37	1	156563648	156563648	+	Intron	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156563648C>G	uc001fph.2	+						APOA1BP_uc001fpg.2_3'UTR|APOA1BP_uc001fpi.2_Intron|APOA1BP_uc001fpj.2_Intron|APOA1BP_uc001fpk.2_Intron|APOA1BP_uc010php.1_Intron	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor							extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CATCTGGCCTCTTCCTGAACA	0.542													32	78	---	---	---	---	PASS
OLFML2B	25903	broad.mit.edu	37	1	161968053	161968053	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161968053T>A	uc001gbu.2	-	6	1460	c.1036A>T	c.(1036-1038)ACC>TCC	p.T346S	OLFML2B_uc010pkq.1_Missense_Mutation_p.T347S	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	346										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GGCCTCCGGGTGACACTGGTC	0.567													26	70	---	---	---	---	PASS
TNFSF4	7292	broad.mit.edu	37	1	173176222	173176222	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173176222G>A	uc001giw.2	-	1	250	c.94C>T	c.(94-96)CAG>TAG	p.Q32*	TNFSF4_uc001giv.2_5'Flank	NM_003326	NP_003317	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily,	32	Helical; Signal-anchor for type II membrane protein; (Potential).				acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1						CCCAGTCCCTGAATTACAGAG	0.537													15	35	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186113383	186113383	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186113383G>A	uc001grq.1	+	90	14232	c.14003G>A	c.(14002-14004)AGA>AAA	p.R4668K	HMCN1_uc001grs.1_Missense_Mutation_p.R237K	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4668	TSP type-1 3.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ACAAGAGCAAGACTTTGTAAT	0.478													37	106	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186324850	186324850	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186324850T>C	uc001grv.2	-	16	2236	c.1939A>G	c.(1939-1941)ACA>GCA	p.T647A		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	647					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GTCTGTGATGTACTTGGACGT	0.398			T	NTRK1	papillary thyroid								31	53	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201060841	201060841	+	Silent	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201060841G>C	uc001gvv.2	-	5	848	c.621C>G	c.(619-621)GTC>GTG	p.V207V		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	207	Helical; Name=S5 of repeat I; (Potential).|I.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CATAGATGATGACCATAAAGA	0.562													14	45	---	---	---	---	PASS
PTPN7	5778	broad.mit.edu	37	1	202124738	202124738	+	Splice_Site	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202124738C>T	uc001gxm.1	-	5	523	c.392_splice	c.e5-1	p.N131_splice	PTPN7_uc001gxl.1_Splice_Site_p.N170_splice|PTPN7_uc001gxn.1_Splice_Site_p.N131_splice|PTPN7_uc010ppv.1_Splice_Site|PTPN7_uc010ppw.1_Splice_Site_p.N79_splice|PTPN7_uc010ppx.1_Splice_Site_p.N205_splice|PTPN7_uc010ppy.1_Intron|PTPN7_uc001gxo.1_Splice_Site_p.N83_splice	NM_002832	NP_002823	P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type							cytosol|internal side of plasma membrane	protein binding|protein tyrosine phosphatase activity			skin(1)	1						CTCTGGGGATCTAGGAAATAA	0.527													7	20	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207300089	207300089	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207300089T>A	uc001hfo.2	+	7	932	c.738T>A	c.(736-738)CAT>CAA	p.H246Q		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	246	Sushi 4.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ATGTTTCACATGGGGAAATGG	0.378													30	80	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214557171	214557171	+	Missense_Mutation	SNP	G	A	A	rs139115216	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214557171G>A	uc001hkk.1	-	13	2298	c.2027C>T	c.(2026-2028)CCG>CTG	p.P676L	PTPN14_uc010pty.1_Missense_Mutation_p.P577L	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	676					lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CTCCTCGGGCGGTCCCTGCTC	0.632													16	27	---	---	---	---	PASS
H3F3A	3020	broad.mit.edu	37	1	226252162	226252162	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226252162A>G	uc001hpw.2	+	2	225	c.110A>G	c.(109-111)AAG>AGG	p.K37R	H3F3A_uc010pvl.1_Missense_Mutation_p.K37R	NM_005324	NP_005315	P84243	H33_HUMAN	H3 histone, family 3B	37					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding				0	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		GGAGGGGTGAAGAAACCTCAT	0.448											OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	28	---	---	---	---	PASS
PSEN2	5664	broad.mit.edu	37	1	227071519	227071519	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227071519G>A	uc009xeo.1	+	5	682	c.255G>A	c.(253-255)GCG>GCA	p.A85A	PSEN2_uc009xep.1_Silent_p.A85A|PSEN2_uc001hqk.2_RNA	NM_000447	NP_000438	P49810	PSN2_HUMAN	presenilin 2 isoform 1	85	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding			lung(2)	2		Prostate(94;0.0771)				AATACGGAGCGAAGCACGTGA	0.582													19	50	---	---	---	---	PASS
PPP3R1	5534	broad.mit.edu	37	2	68480214	68480214	+	5'Flank	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68480214G>A	uc002sei.1	-							NM_000945	NP_000936	P63098	CANB1_HUMAN	protein phosphatase 3, regulatory subunit B,						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)	ATCCACTACAGAATTGCACGG	0.537													11	10	---	---	---	---	PASS
GGCX	2677	broad.mit.edu	37	2	85785670	85785670	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85785670C>T	uc002sps.2	-	4	538	c.432G>A	c.(430-432)CTG>CTA	p.L144L	GGCX_uc010yss.1_Silent_p.L16L|GGCX_uc010yst.1_Silent_p.L87L	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1	144	Helical; (Potential).				blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	ACCAGTATGGCAGCAGGAATA	0.493													24	44	---	---	---	---	PASS
GPR39	2863	broad.mit.edu	37	2	133174772	133174772	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133174772C>T	uc002ttl.2	+	1	626	c.157C>T	c.(157-159)CGG>TGG	p.R53W		NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39	53	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						CGCCACCATTCGGGTCACCCA	0.537													19	32	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141272335	141272335	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141272335G>T	uc002tvj.1	-	51	9128	c.8156C>A	c.(8155-8157)TCT>TAT	p.S2719Y		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2719	Extracellular (Potential).|LDL-receptor class A 16.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCAAGAGCAAGAAGAATCTAG	0.284										TSP Lung(27;0.18)			13	26	---	---	---	---	PASS
SP3	6670	broad.mit.edu	37	2	174783487	174783487	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174783487C>T	uc002uig.2	-	5	1830	c.1666G>A	c.(1666-1668)GAT>AAT	p.D556N	SP3_uc002uie.2_Missense_Mutation_p.D488N|SP3_uc002uif.2_Missense_Mutation_p.D503N|SP3_uc010zel.1_Missense_Mutation_p.D553N	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	556	Repressor domain.				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TCTTCAGGATCAGGTTCTTCT	0.403													17	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179638034	179638034	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179638034C>G	uc010zfg.1	-	33	7881	c.7657G>C	c.(7657-7659)GAG>CAG	p.E2553Q	TTN_uc010zfh.1_Missense_Mutation_p.E2507Q|TTN_uc010zfi.1_Missense_Mutation_p.E2507Q|TTN_uc010zfj.1_Missense_Mutation_p.E2507Q|TTN_uc002unb.2_Missense_Mutation_p.E2553Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2553							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTCAACCTCAAACACCACA	0.353													18	33	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189953486	189953486	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189953486G>C	uc002uqk.2	-	8	855	c.580C>G	c.(580-582)CAA>GAA	p.Q194E	COL5A2_uc010frx.2_5'Flank	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	194					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCAGCCATTTGAGCTGAAAAC	0.378													25	75	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190593544	190593544	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190593544A>G	uc002uqw.1	+	14	2977	c.2977A>G	c.(2977-2979)ATT>GTT	p.I993V	ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqx.1_RNA|ANKAR_uc002uqy.1_Missense_Mutation_p.I160V	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1064						integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ATCCATTTGTATTGGTTTGTA	0.393													31	48	---	---	---	---	PASS
GTF3C3	9330	broad.mit.edu	37	2	197639909	197639909	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197639909G>C	uc002uts.2	-	13	1852	c.1762C>G	c.(1762-1764)CTT>GTT	p.L588V	GTF3C3_uc010zgu.1_Missense_Mutation_p.L559V	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	588						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7						ACTTTAATAAGATAAAGATGC	0.333													14	37	---	---	---	---	PASS
CCDC36	339834	broad.mit.edu	37	3	49249260	49249260	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49249260C>A	uc003cwk.2	+	4	434	c.47C>A	c.(46-48)TCA>TAA	p.S16*	CCDC36_uc003cwl.3_Nonsense_Mutation_p.S16*|CCDC36_uc011bck.1_Nonsense_Mutation_p.S16*|CCDC36_uc010hkt.2_RNA	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	16										ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		AGTATTCCTTCAGGCTCTGGG	0.239													22	63	---	---	---	---	PASS
CCDC36	339834	broad.mit.edu	37	3	49249266	49249266	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49249266C>T	uc003cwk.2	+	4	440	c.53C>T	c.(52-54)TCT>TTT	p.S18F	CCDC36_uc003cwl.3_Missense_Mutation_p.S18F|CCDC36_uc011bck.1_Missense_Mutation_p.S18F|CCDC36_uc010hkt.2_RNA	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	18										ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		CCTTCAGGCTCTGGGTAAGTT	0.229													21	61	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49723526	49723526	+	Silent	SNP	G	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723526G>T	uc003cxg.2	-	9	1188	c.1116C>A	c.(1114-1116)ATC>ATA	p.I372I	MST1_uc011bcs.1_Missense_Mutation_p.S411Y|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	358	Kringle 3.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TACAACGCCGGATCTGGTAGC	0.687													3	11	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51393912	51393912	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51393912G>C	uc011bds.1	+	43	4514	c.4491G>C	c.(4489-4491)GAG>GAC	p.E1497D		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1497	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTGAAGTGGAGAGGAGGGAAC	0.542													16	47	---	---	---	---	PASS
ARHGEF3	50650	broad.mit.edu	37	3	56787589	56787589	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56787589G>C	uc003dig.2	-	4	550	c.381C>G	c.(379-381)ATC>ATG	p.I127M	ARHGEF3_uc011bew.1_Missense_Mutation_p.I127M|ARHGEF3_uc003dih.2_Missense_Mutation_p.I159M|ARHGEF3_uc011bev.1_Missense_Mutation_p.I98M|ARHGEF3_uc003dif.2_Missense_Mutation_p.I133M|ARHGEF3_uc010hmy.1_Translation_Start_Site|ARHGEF3_uc003dii.2_Missense_Mutation_p.I127M	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	127	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		AAAGCTCAAAGATCGCCTGCA	0.368													27	83	---	---	---	---	PASS
ARL13B	200894	broad.mit.edu	37	3	93761858	93761858	+	Splice_Site	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93761858G>C	uc003drc.2	+	7	1085	c.799_splice	c.e7-1	p.N267_splice	ARL13B_uc010hop.2_Splice_Site_p.N118_splice|ARL13B_uc003drd.2_Splice_Site_p.N160_splice|ARL13B_uc003dre.2_Splice_Site_p.N252_splice|ARL13B_uc003drf.2_Splice_Site_p.N267_splice|ARL13B_uc003drg.2_Splice_Site_p.N164_splice	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						TTTTTTGTTAGAATGAAGGAA	0.313													2	6	---	---	---	---	PASS
ARL13B	200894	broad.mit.edu	37	3	93761880	93761880	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93761880G>C	uc003drc.2	+	7	1106	c.820G>C	c.(820-822)GAG>CAG	p.E274Q	ARL13B_uc010hop.2_Missense_Mutation_p.E125Q|ARL13B_uc003drd.2_Missense_Mutation_p.E167Q|ARL13B_uc003dre.2_Missense_Mutation_p.E259Q|ARL13B_uc003drf.2_Missense_Mutation_p.E274Q|ARL13B_uc003drg.2_Missense_Mutation_p.E171Q	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	274							GTP binding				0						ACTTGAAAGAGAGAAAAAAAA	0.328													4	10	---	---	---	---	PASS
RPL32P3	132241	broad.mit.edu	37	3	129116292	129116292	+	Intron	SNP	A	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129116292A>C	uc003ema.2	-						RPL32P3_uc003emb.2_Intron|RPL32P3_uc003emd.1_Intron|SNORA7B_uc003eme.1_RNA|SNORA7B_uc003emf.2_5'Flank	NR_003111				Homo sapiens cDNA FLJ36158 fis, clone TESTI2025757, weakly similar to Human mRNA for ribosomal protein L32.												0						AGCAAATCCCACCCTGCCAGT	0.383													7	25	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153840100	153840100	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153840100C>G	uc011bog.1	+	2	530	c.319C>G	c.(319-321)CGA>GGA	p.R107G	uc003ezu.1_5'Flank|SGEF_uc011boh.1_Missense_Mutation_p.R107G	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	107	Pro-rich.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TGCCTCTCCTCGACTTCGACG	0.687													5	17	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184557485	184557485	+	Splice_Site	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184557485G>A	uc003fpb.1	+	7	652	c.481_splice	c.e7-1	p.A161_splice	VPS8_uc010hyd.1_Splice_Site_p.A161_splice|VPS8_uc003fpc.1_3'UTR	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TTTGTTTTCAGGCAGTATCCA	0.358													7	12	---	---	---	---	PASS
TFRC	7037	broad.mit.edu	37	3	195794923	195794923	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195794923C>T	uc003fvz.3	-	8	1163	c.880G>A	c.(880-882)GAA>AAA	p.E294K	TFRC_uc003fwa.3_Missense_Mutation_p.E294K|TFRC_uc010hzy.2_Missense_Mutation_p.E213K|TFRC_uc011btr.1_Missense_Mutation_p.E12K	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor	294	Extracellular (Potential).|PA.				cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)		AATGAAAGTTCTGCGTTAACA	0.353			T	BCL6	NHL								7	33	---	---	---	---	PASS
HTRA3	94031	broad.mit.edu	37	4	8288305	8288305	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8288305G>A	uc003gla.2	+	3	707	c.503G>A	c.(502-504)CGC>CAC	p.R168H	HTRA3_uc003gkz.2_Missense_Mutation_p.R168H	NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor	168					proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						CTGTTTGGCCGCAACGTGCCC	0.657													16	64	---	---	---	---	PASS
CHRNA9	55584	broad.mit.edu	37	4	40356611	40356611	+	3'UTR	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40356611G>C	uc003gva.1	+	5						NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9						elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	GTTCTTCCAAGATTTTTGTTC	0.333													12	30	---	---	---	---	PASS
CHRNA9	55584	broad.mit.edu	37	4	40356674	40356674	+	3'UTR	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40356674G>C	uc003gva.1	+	5						NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9						elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	AGCTTCAAATGAATGTCGAAG	0.353													7	6	---	---	---	---	PASS
METAP1	23173	broad.mit.edu	37	4	99982412	99982412	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99982412G>C	uc003huf.3	+	11	1222	c.1105G>C	c.(1105-1107)GAA>CAA	p.E369Q	METAP1_uc003hug.2_RNA|METAP1_uc010ild.2_RNA	NM_015143	NP_055958	P53582	AMPM1_HUMAN	methionyl aminopeptidase 1	369					N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis|regulation of translation	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		CACTGGCTGTGAAATCCTAAC	0.512													25	59	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106156496	106156496	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106156496C>G	uc003hxk.2	+	3	1783	c.1397C>G	c.(1396-1398)TCT>TGT	p.S466C	TET2_uc011cez.1_Missense_Mutation_p.S487C|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.S466C|TET2_uc003hxi.1_Missense_Mutation_p.S466C	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	466					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CCTAATCCATCTACACATGTA	0.458			Mis N|F		MDS								13	35	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106156625	106156625	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106156625C>G	uc003hxk.2	+	3	1912	c.1526C>G	c.(1525-1527)TCA>TGA	p.S509*	TET2_uc011cez.1_Nonsense_Mutation_p.S530*|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Nonsense_Mutation_p.S509*|TET2_uc003hxi.1_Nonsense_Mutation_p.S509*	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	509					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.S509*(3)		haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGACCAATGTCAGAACACCTC	0.433			Mis N|F		MDS								11	37	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160253617	160253617	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160253617C>T	uc003iqg.3	+	11	1730	c.1420C>T	c.(1420-1422)CTA>TTA	p.L474L		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	474					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TAAAGAACTTCTAACAAGATT	0.358													18	43	---	---	---	---	PASS
CPE	1363	broad.mit.edu	37	4	166414359	166414359	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166414359C>T	uc003irg.3	+	7	1427	c.1150C>T	c.(1150-1152)CAA>TAA	p.Q384*		NM_001873	NP_001864	P16870	CBPE_HUMAN	carboxypeptidase E preproprotein	384					cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCGAGACCTTCAAGGTAACCC	0.408											OREG0016391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	36	---	---	---	---	PASS
UFSP2	55325	broad.mit.edu	37	4	186334999	186334999	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186334999G>T	uc003ixo.2	-	7	829	c.712C>A	c.(712-714)CAC>AAC	p.H238N	UFSP2_uc003ixn.2_Missense_Mutation_p.H128N|UFSP2_uc003ixq.2_Missense_Mutation_p.H128N|UFSP2_uc003ixp.2_RNA	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	238						endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GGTCTGTCGTGAGGCAGATTG	0.333													26	31	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	36985880	36985880	+	Silent	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36985880A>G	uc003jkl.3	+	10	3097	c.2598A>G	c.(2596-2598)CTA>CTG	p.L866L	NIPBL_uc003jkk.3_Silent_p.L866L|NIPBL_uc003jkm.1_Silent_p.L745L	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	866					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTGATAAACTAGAACGAAAAC	0.413													14	20	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209470	140209470	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209470C>T	uc003lho.2	+	1	1821	c.1794C>T	c.(1792-1794)GAC>GAT	p.D598D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.D598D	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	598	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCAGTTGACGCCGACTCAG	0.667													3	54	---	---	---	---	PASS
IL17B	27190	broad.mit.edu	37	5	148754143	148754143	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148754143C>T	uc003lqo.2	-	3	382	c.332G>A	c.(331-333)CGT>CAT	p.R111H		NM_014443	NP_055258	Q9UHF5	IL17B_HUMAN	interleukin 17B precursor	111					cell-cell signaling|immune response|inflammatory response	extracellular space	cytokine activity|signal transducer activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGGGGATACGGCTGGGGTC	0.627													6	21	---	---	---	---	PASS
SYNPO	11346	broad.mit.edu	37	5	150028061	150028061	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150028061C>T	uc003lsn.2	+	3	1330	c.956C>T	c.(955-957)TCG>TTG	p.S319L	SYNPO_uc003lso.3_Missense_Mutation_p.S75L|SYNPO_uc003lsp.2_Missense_Mutation_p.S75L	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	319					positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACCTTGCCTCGCCCAGTGCC	0.607													44	93	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158526496	158526496	+	5'UTR	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158526496C>T	uc010jip.2	-	1					EBF1_uc011ddw.1_5'Flank|EBF1_uc011ddx.1_5'UTR|EBF1_uc003lxl.3_5'UTR|uc003lxm.1_5'Flank	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAAACAACCTTTTCTTGTG	0.388			T	HMGA2	lipoma								48	99	---	---	---	---	PASS
KIAA1949	170954	broad.mit.edu	37	6	30653297	30653297	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30653297G>T	uc003nra.2	-	2	730	c.499C>A	c.(499-501)CTG>ATG	p.L167M	KIAA1949_uc003nrb.3_Missense_Mutation_p.L167M	NM_001134870	NP_001128342	Q6NYC8	PHTNS_HUMAN	phostensin	167						cytoplasm|cytoskeleton	actin binding				0						CGAGCCTCCAGAGGCCTCAGG	0.602													65	127	---	---	---	---	PASS
RNF5	6048	broad.mit.edu	37	6	32148014	32148014	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32148014C>T	uc003oaj.3	+	6	581	c.454C>T	c.(454-456)CTG>TTG	p.L152L	AGPAT1_uc003oaf.2_5'Flank|AGPAT1_uc003oag.2_5'Flank|AGPAT1_uc003oah.2_5'Flank	NM_006913	NP_008844	Q99942	RNF5_HUMAN	ring finger protein 5	152					ER-associated misfolded protein catabolic process|protein K48-linked ubiquitination|protein K63-linked ubiquitination	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						AGGTGTGGATCTGGGACAGGG	0.562													83	175	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70875870	70875870	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70875870G>C	uc003pfc.1	+	37	2555	c.2438G>C	c.(2437-2439)GGA>GCA	p.G813A	COL19A1_uc010kam.1_Missense_Mutation_p.G709A	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	813	Triple-helical region 4 (COL4).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						GGACCACCTGGACCACCTGTG	0.428													3	136	---	---	---	---	PASS
B3GAT2	135152	broad.mit.edu	37	6	71665793	71665793	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71665793T>C	uc003pfv.2	-	1	996	c.340A>G	c.(340-342)ATC>GTC	p.I114V	B3GAT2_uc011dxz.1_RNA|B3GAT2_uc003pfw.2_Missense_Mutation_p.I114V	NM_080742	NP_542780	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	114	Lumenal (Potential).				carbohydrate biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						TCCACCAGGATCCAGTGCAGC	0.721													5	10	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129691106	129691106	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129691106G>A	uc003qbn.2	+	34	5035	c.4930G>A	c.(4930-4932)GTG>ATG	p.V1644M	LAMA2_uc003qbo.2_Missense_Mutation_p.V1644M	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1644	Domain II and I.|Potential.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAATACACTCGTGACCGAAAT	0.433													29	31	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152668238	152668238	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152668238C>T	uc010kiw.2	-	73	12636	c.12034G>A	c.(12034-12036)GGC>AGC	p.G4012S	SYNE1_uc003qot.3_Missense_Mutation_p.G3941S|SYNE1_uc003qou.3_Missense_Mutation_p.G4012S|SYNE1_uc010kja.1_Missense_Mutation_p.G717S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4012	Spectrin 10.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCTTTGTGCCCTGCAGATGA	0.493										HNSCC(10;0.0054)			12	39	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161007642	161007642	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161007642C>T	uc003qtl.2	-	26	4088	c.3968G>A	c.(3967-3969)TGC>TAC	p.C1323Y		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3831	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGATTCCTGCAGTAGTTCCT	0.483													19	47	---	---	---	---	PASS
CRHR2	1395	broad.mit.edu	37	7	30721547	30721547	+	Silent	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30721547G>C	uc003tbn.2	-	2	457	c.213C>G	c.(211-213)GTC>GTG	p.V71V	CRHR2_uc010kvw.1_Silent_p.V71V|CRHR2_uc010kvx.1_Silent_p.V71V|CRHR2_uc010kvy.1_5'UTR|CRHR2_uc003tbo.2_Silent_p.V57V|CRHR2_uc003tbp.2_Silent_p.V98V|CRHR2_uc010kvz.1_RNA|CRHR2_uc003tbq.1_RNA	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	71	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						TGTTGTACTTGACGCCGTTGA	0.647													10	17	---	---	---	---	PASS
MRPS17	51373	broad.mit.edu	37	7	56022649	56022649	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56022649G>A	uc003trd.2	+	3	201	c.171G>A	c.(169-171)CAG>CAA	p.Q57Q	MRPS17_uc003trb.2_Silent_p.Q152Q	NM_015969	NP_057053	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17 precursor	57					translation	mitochondrial small ribosomal subunit	rRNA binding|structural constituent of ribosome				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CCCTTCAGCAGTGCACAGTTG	0.443													88	212	---	---	---	---	PASS
TSGA13	114960	broad.mit.edu	37	7	130370187	130370187	+	5'UTR	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130370187C>G	uc003vqi.2	-	2					TSGA13_uc003vqj.2_5'UTR	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13											ovary(2)	2	Melanoma(18;0.0435)					TACTCATGCCCCATTCTTGAG	0.408													5	18	---	---	---	---	PASS
TBXAS1	6916	broad.mit.edu	37	7	139636073	139636073	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139636073G>A	uc011kqv.1	+	5	584	c.420G>A	c.(418-420)CTG>CTA	p.L140L	TBXAS1_uc003vvh.2_Silent_p.L140L|TBXAS1_uc010lne.2_Silent_p.L72L|TBXAS1_uc011kqu.1_Silent_p.L91L|TBXAS1_uc003vvi.2_Silent_p.L140L|TBXAS1_uc003vvj.2_Silent_p.L140L|TBXAS1_uc011kqw.1_Silent_p.L120L	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	139	Cytoplasmic (Potential).				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GAGGTGCCCTGATGTCTGCTT	0.473													65	134	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149129112	149129112	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149129112C>T	uc003wfv.2	-	6	2414	c.2251G>A	c.(2251-2253)GCC>ACC	p.A751T		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TCGGGGCAGGCGTGCGGCCGC	0.682													28	44	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3326258	3326258	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3326258G>A	uc011kwk.1	-	12	1930	c.1540C>T	c.(1540-1542)CCT>TCT	p.P514S		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	514	CUB 3.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTAAACCCAGGTGAGCCAATG	0.478													7	9	---	---	---	---	PASS
SPAG11A	653423	broad.mit.edu	37	8	7721244	7721244	+	3'UTR	SNP	C	T	T	rs77003603	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7721244C>T	uc003wsa.2	+	3					SPAG11A_uc003wrz.2_3'UTR|SPAG11A_uc003wsb.2_RNA	NM_058202	NP_478109	Q6PDA7	SG11A_HUMAN	sperm associated antigen 11B isoform H							extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GACTGGCTCCCCAGGGATCCA	0.577													4	4	---	---	---	---	PASS
FAM120A	23196	broad.mit.edu	37	9	96320268	96320268	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96320268C>T	uc004atw.2	+	14	2669	c.2644C>T	c.(2644-2646)CAG>TAG	p.Q882*	FAM120A_uc004aty.2_Nonsense_Mutation_p.Q663*|FAM120A_uc004atz.2_Nonsense_Mutation_p.Q531*|FAM120A_uc010mrg.2_Nonsense_Mutation_p.Q195*	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	882	RNA binding.					cytoplasm|plasma membrane	RNA binding				0						CCCACCCTCTCAGGGCAGGGG	0.602													10	3	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114152334	114152334	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114152334A>C	uc004bfe.1	-	31	3743	c.3743T>G	c.(3742-3744)CTT>CGT	p.L1248R		NM_001080398	NP_001073867			KIAA0368 protein												0						TGGCTGGCTAAGATCACTTGC	0.398													6	6	---	---	---	---	PASS
USP20	10868	broad.mit.edu	37	9	132614875	132614875	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132614875T>G	uc004bys.2	+	3	252	c.41T>G	c.(40-42)ATA>AGA	p.I14R	USP20_uc004byr.2_Missense_Mutation_p.I14R|USP20_uc004byt.1_Missense_Mutation_p.I14R	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	14					endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				CTTGACTCCATAGGAGAGGTG	0.577													2	4	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071420	141071420	+	Missense_Mutation	SNP	G	A	A	rs147421666	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071420G>A	uc004com.2	+	4	1084	c.823G>A	c.(823-825)GAC>AAC	p.D275N	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CTGGTTCCCCGACAACGTAAA	0.512													4	63	---	---	---	---	PASS
BMI1	648	broad.mit.edu	37	10	22616891	22616891	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22616891C>G	uc001irh.2	+	6	968	c.329C>G	c.(328-330)TCT>TGT	p.S110C	BMI1_uc009xkg.2_Missense_Mutation_p.S253C	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	110					hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						GCCAATGGCTCTAATGAAGAT	0.308													15	63	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23321935	23321935	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23321935C>T	uc001irm.3	+	18	2475	c.2392C>T	c.(2392-2394)CGA>TGA	p.R798*	ARMC3_uc010qcv.1_Nonsense_Mutation_p.R791*|ARMC3_uc010qcw.1_Nonsense_Mutation_p.R535*	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	798							binding				0						CTTCTACCATCGAGCTTTGCT	0.363													20	43	---	---	---	---	PASS
RASGEF1A	221002	broad.mit.edu	37	10	43701441	43701441	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43701441C>T	uc001jap.1	-	2	205	c.124G>A	c.(124-126)GAT>AAT	p.D42N	RASGEF1A_uc001jao.1_Missense_Mutation_p.D50N	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	42	N-terminal Ras-GEF.				cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						AGGTGTCCATCTTGGAAGATG	0.647													10	12	---	---	---	---	PASS
ASAH2	56624	broad.mit.edu	37	10	51974561	51974561	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51974561C>T	uc001jjd.2	-	8	1082	c.1082G>A	c.(1081-1083)CGT>CAT	p.R361H	ASAH2_uc009xos.2_Missense_Mutation_p.R361H	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a	361	Lumenal (Potential).				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						GTTGATGCAACGTGGTCCAAG	0.448													19	28	---	---	---	---	PASS
C10orf54	64115	broad.mit.edu	37	10	73520454	73520454	+	Intron	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73520454G>A	uc001jsd.2	-						CDH23_uc001jrx.3_Intron|C10orf54_uc001jse.2_Intron|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Missense_Mutation_p.P247S	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24 precursor							integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GGGCTTCTGGGGATTGCACCA	0.587													3	3	---	---	---	---	PASS
DDIT4	54541	broad.mit.edu	37	10	74034918	74034918	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74034918C>T	uc001jsx.1	+	3	873	c.671C>T	c.(670-672)TCG>TTG	p.S224L		NM_019058	NP_061931	Q9NX09	DDIT4_HUMAN	RTP801	224					apoptosis					pancreas(1)	1						CTGTACAGCTCGGAACAGCTG	0.567											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	10	---	---	---	---	PASS
CYP26A1	1592	broad.mit.edu	37	10	94836820	94836820	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94836820G>A	uc001kil.2	+	7	1298	c.1253G>A	c.(1252-1254)CGA>CAA	p.R418Q	CYP26A1_uc001kik.1_Missense_Mutation_p.R349Q|CYP26A1_uc001kim.1_Missense_Mutation_p.R316Q	NM_000783	NP_000774	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A,	418					negative regulation of retinoic acid receptor signaling pathway|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|oxygen binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		Colorectal(252;0.122)				AATCCTGACCGATTCATGCTG	0.448													17	51	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135350733	135350733	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135350733C>T	uc001lnj.1	+	7	1167	c.1134C>T	c.(1132-1134)TTC>TTT	p.F378F	CYP2E1_uc001lnk.1_Silent_p.F241F|CYP2E1_uc009ybl.1_Silent_p.F179F|CYP2E1_uc009ybm.1_Silent_p.F32F|CYP2E1_uc001lnl.1_Silent_p.F179F	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,	378					drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	ACACCATTTTCAGAGGATACC	0.542									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				19	27	---	---	---	---	PASS
SMPD1	6609	broad.mit.edu	37	11	6413286	6413286	+	Missense_Mutation	SNP	C	T	T	rs142476839		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6413286C>T	uc001mcw.2	+	2	1165	c.991C>T	c.(991-993)CCC>TCC	p.P331S	SMPD1_uc001mcv.1_Intron|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.P331S|SMPD1_uc009yew.2_Missense_Mutation_p.P330S	NM_000543	NP_000534	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid	329					cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Desipramine(DB01151)	TAGCTTCCCTCCCCCCTTCAT	0.612													13	25	---	---	---	---	PASS
OR10A6	390093	broad.mit.edu	37	11	7949563	7949563	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7949563A>G	uc010rbh.1	-	1	647	c.647T>C	c.(646-648)TTG>TCG	p.L216S		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AATGTAAGACAAGAGTATCAA	0.438													18	43	---	---	---	---	PASS
BEST1	7439	broad.mit.edu	37	11	61727388	61727388	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61727388A>G	uc001nss.2	+	9	1553	c.973A>G	c.(973-975)ATG>GTG	p.M325V	BEST1_uc010rlq.1_Silent_p.R332R|BEST1_uc010rlr.1_Intron|BEST1_uc010rls.1_Intron|BEST1_uc001nsr.2_Missense_Mutation_p.M265V|BEST1_uc009ynt.2_RNA|BEST1_uc010rlt.1_Missense_Mutation_p.M265V|BEST1_uc001nst.2_Missense_Mutation_p.M238V|BEST1_uc010rlu.1_Silent_p.R286R|BEST1_uc010rlv.1_Missense_Mutation_p.M219V	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1	325	Cytoplasmic (Potential).		M -> T (in ARB).		response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						TGTGGATGAGATGCACCAGGA	0.572													2	7	---	---	---	---	PASS
CCDC87	55231	broad.mit.edu	37	11	66359214	66359214	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66359214G>A	uc001oiq.3	-	1	1341	c.1273C>T	c.(1273-1275)CAC>TAC	p.H425Y	CCS_uc001oir.2_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	425										ovary(1)|skin(1)	2						GGCTGTGGGTGAAGTGGAAAG	0.552													18	39	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105880796	105880796	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880796T>C	uc001piy.2	-	3	677	c.504A>G	c.(502-504)ATA>ATG	p.I168M	KIAA1826_uc001piz.2_Missense_Mutation_p.I168M	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	168						nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		TGGAATCTGGTATGACGGATG	0.393													35	57	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118374132	118374132	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118374132G>A	uc001pta.2	+	27	7539	c.7516G>A	c.(7516-7518)GAA>AAA	p.E2506K	MLL_uc001ptb.2_Missense_Mutation_p.E2509K	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2506					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CATGCAAGTAGAAGGATCTGC	0.448			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								13	31	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118374590	118374590	+	Missense_Mutation	SNP	G	C	C	rs142807735	byFrequency	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118374590G>C	uc001pta.2	+	27	7997	c.7974G>C	c.(7972-7974)AAG>AAC	p.K2658N	MLL_uc001ptb.2_Missense_Mutation_p.K2661N	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2658					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		AGCGAGGCAAGAGATCAGCTG	0.443			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								9	31	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118375131	118375131	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118375131G>A	uc001pta.2	+	27	8538	c.8515G>A	c.(8515-8517)GAT>AAT	p.D2839N	MLL_uc001ptb.2_Missense_Mutation_p.D2842N	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2839					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TAACAACAGTGATGACTGTGG	0.448			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								37	93	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44124323	44124323	+	Silent	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44124323T>C	uc001rnq.3	-	9	2451	c.1962A>G	c.(1960-1962)CAA>CAG	p.Q654Q	PUS7L_uc001rnr.3_Silent_p.Q654Q|PUS7L_uc001rns.3_Silent_p.Q654Q|PUS7L_uc009zkb.2_Silent_p.Q341Q	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	654					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		CTTCCATTAGTTGGTATGAGA	0.368													34	92	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51868160	51868160	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51868160C>T	uc001rys.1	+	15	2117	c.1939C>T	c.(1939-1941)CAC>TAC	p.H647Y	SLC4A8_uc010sni.1_Missense_Mutation_p.H594Y|SLC4A8_uc001rym.2_Missense_Mutation_p.H594Y|SLC4A8_uc001ryn.2_Missense_Mutation_p.H594Y|SLC4A8_uc001ryo.2_Missense_Mutation_p.H594Y|SLC4A8_uc010snj.1_Missense_Mutation_p.H674Y|SLC4A8_uc001ryq.3_Missense_Mutation_p.H647Y|SLC4A8_uc001ryr.2_Missense_Mutation_p.H647Y|SLC4A8_uc010snk.1_Missense_Mutation_p.H594Y	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	647	Extracellular (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TCCAAACAATCACACCCTCCA	0.458													9	30	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51868256	51868256	+	Intron	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51868256C>G	uc001rys.1	+						SLC4A8_uc010sni.1_Missense_Mutation_p.P626A|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Missense_Mutation_p.P679A|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TGCCAGATGTCCTAGCATTGT	0.488													2	8	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85518355	85518355	+	Intron	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85518355G>C	uc001tac.2	+						LRRIQ1_uc001tab.1_3'UTR	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TTTGATGGATGATATTAGTCA	0.303													18	24	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25168432	25168432	+	RNA	SNP	T	C	C	rs149337771	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25168432T>C	uc001upm.2	+	10		c.1104T>C			LOC374491_uc001upn.2_RNA|LOC374491_uc001upo.2_RNA					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						TTGAAACAGCTGGTGTATTAA	0.373													3	23	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77743819	77743819	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77743819G>A	uc001vkf.2	-	40	5802	c.5711C>T	c.(5710-5712)TCC>TTC	p.S1904F	MYCBP2_uc010aev.2_Missense_Mutation_p.S1308F	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1904					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AAACAGACTGGAAGAACTCAG	0.383													18	66	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60212834	60212834	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60212834C>T	uc001xen.1	-	2	816	c.607G>A	c.(607-609)GAG>AAG	p.E203K		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	203					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TTCACCTCCTCGGGTCTGGTT	0.453													70	138	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92909725	92909725	+	Intron	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92909725G>A	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_5'UTR	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGCAGCCAACGACGGGGCTCT	0.647													5	19	---	---	---	---	PASS
SNORD115-20	100033460	broad.mit.edu	37	15	25470410	25470410	+	Intron	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25470410C>T	uc001yzq.1	+						SNORD115-26_uc001yzw.1_Intron|SNORD115-30_uc001yzy.1_RNA|SNORD115-31_uc001yzz.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						AAATCATGCTCAATAGGATTA	0.498													67	152	---	---	---	---	PASS
SNX22	79856	broad.mit.edu	37	15	64446590	64446590	+	Silent	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64446590G>C	uc002anc.1	+	7	524	c.465G>C	c.(463-465)TCG>TCC	p.S155S	SNX22_uc002amz.1_3'UTR|SNX22_uc002ana.1_3'UTR|SNX22_uc002anb.1_RNA	NM_024798	NP_079074	Q96L94	SNX22_HUMAN	sorting nexin 22	155					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0						CCACAGAGTCGCTGCCCAACG	0.602											OREG0023180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	111	---	---	---	---	PASS
SNX33	257364	broad.mit.edu	37	15	75941596	75941596	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75941596T>G	uc002bau.2	+	1	249	c.153T>G	c.(151-153)TTT>TTG	p.F51L	IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_5'Flank	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN	sorting nexin 33	51	SH3.				cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1						CAGGGCTCTTTCCTGCCTCTT	0.587													23	61	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1616196	1616196	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1616196C>G	uc002cmb.2	-	16	2229	c.1867G>C	c.(1867-1869)GAG>CAG	p.E623Q	IFT140_uc002clz.2_Missense_Mutation_p.E274Q	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	623										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				GACAGCGTCTCTCTCCGATCA	0.428													57	135	---	---	---	---	PASS
C16orf59	80178	broad.mit.edu	37	16	2510687	2510687	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2510687C>T	uc002cqh.2	+	3	220	c.189C>T	c.(187-189)CCC>CCT	p.P63P	C16orf59_uc002cqf.1_Silent_p.P63P|C16orf59_uc002cqg.1_5'UTR|C16orf59_uc002cqi.2_5'UTR|C16orf59_uc010uwb.1_5'Flank	NM_025108	NP_079384	Q7L2K0	CP059_HUMAN	hypothetical protein LOC80178	63											0		Ovarian(90;0.17)				GAGAGGACCCCCTTCCAGGTA	0.637													12	16	---	---	---	---	PASS
CPPED1	55313	broad.mit.edu	37	16	12758794	12758794	+	Silent	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12758794C>G	uc002dca.3	-	4	1005	c.894G>C	c.(892-894)CTG>CTC	p.L298L	CPPED1_uc002dcb.3_Silent_p.L156L|CPPED1_uc002dbz.3_RNA	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	298							hydrolase activity|metal ion binding				0						CTTTCTCACTCAGCTCATCTA	0.478													26	43	---	---	---	---	PASS
C16orf88	400506	broad.mit.edu	37	16	19726111	19726111	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19726111C>G	uc002dgq.2	-	2	262	c.247G>C	c.(247-249)GAA>CAA	p.E83Q	IQCK_uc002dgr.2_5'Flank|IQCK_uc002dgs.2_5'Flank|IQCK_uc010vat.1_5'Flank|IQCK_uc010bwc.2_5'Flank|IQCK_uc010vau.1_5'Flank	NM_001012991	NP_001013009	Q1ED39	CP088_HUMAN	hypothetical protein LOC400506	83	Lys-rich.					nucleolus					0						GTCTCAGGTTCTACATGCTCC	0.488													16	37	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53272307	53272307	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53272307A>G	uc002ehb.2	+	11	2850	c.2686A>G	c.(2686-2688)ATT>GTT	p.I896V	CHD9_uc002egy.2_Missense_Mutation_p.I896V|CHD9_uc002eha.1_Missense_Mutation_p.I896V|CHD9_uc002ehc.2_Missense_Mutation_p.I896V|CHD9_uc002ehf.2_Missense_Mutation_p.I10V|CHD9_uc002ehd.2_Missense_Mutation_p.I422V|CHD9_uc002ehe.1_Missense_Mutation_p.I10V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	896	Helicase ATP-binding.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TATTCAATCAATTACATTCCT	0.358													18	32	---	---	---	---	PASS
AMFR	267	broad.mit.edu	37	16	56396325	56396325	+	3'UTR	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56396325G>A	uc002eiy.2	-	14					AMFR_uc002eiw.2_RNA|AMFR_uc002eix.2_3'UTR	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						GCATGAGCCCGTGGGTCTGGC	0.572													27	69	---	---	---	---	PASS
IL34	146433	broad.mit.edu	37	16	70693984	70693984	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70693984C>T	uc002ezh.1	+	6	1006	c.623C>T	c.(622-624)GCG>GTG	p.A208V	IL34_uc002ezi.1_Missense_Mutation_p.A207V	NM_152456	NP_689669	Q6ZMJ4	IL34_HUMAN	interleukin 34 precursor	208					positive regulation of cell proliferation|positive regulation of protein phosphorylation	extracellular space	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding			central_nervous_system(1)|skin(1)	2						TTGCAGTATGCGGCCACCCAG	0.647													4	123	---	---	---	---	PASS
HPR	3250	broad.mit.edu	37	16	72110371	72110371	+	Silent	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72110371C>G	uc002fby.2	+	5	468	c.438C>G	c.(436-438)CTC>CTG	p.L146L	TXNL4B_uc010cgl.2_Intron	NM_020995	NP_066275	P00739	HPTR_HUMAN	haptoglobin-related protein precursor	146	Peptidase S1.				proteolysis	spherical high-density lipoprotein particle	hemoglobin binding|serine-type endopeptidase activity			central_nervous_system(1)	1		Ovarian(137;0.125)				CTAAAAATCTCTTCCTGAACC	0.478													13	24	---	---	---	---	PASS
C17orf81	23587	broad.mit.edu	37	17	7162148	7162148	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7162148G>A	uc002gfg.1	+	8	846	c.739G>A	c.(739-741)GAT>AAT	p.D247N	C17orf81_uc002gfj.2_3'UTR|C17orf81_uc010cmb.2_3'UTR|C17orf81_uc002gfh.1_Missense_Mutation_p.D247N|C17orf81_uc002gfi.1_Missense_Mutation_p.D247N|C17orf81_uc002gfl.1_Intron	NM_203415	NP_981960	Q8TE02	DERP6_HUMAN	S-phase 2 protein isoform 4	247					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding				0						CCTACAGGTGGATCCCACAAC	0.502													18	20	---	---	---	---	PASS
C17orf81	23587	broad.mit.edu	37	17	7162193	7162193	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7162193G>C	uc002gfg.1	+	8	891	c.784G>C	c.(784-786)GAG>CAG	p.E262Q	C17orf81_uc002gfj.2_3'UTR|C17orf81_uc010cmb.2_3'UTR|C17orf81_uc002gfh.1_Missense_Mutation_p.E262Q|C17orf81_uc002gfi.1_Missense_Mutation_p.E262Q|C17orf81_uc002gfl.1_Intron	NM_203415	NP_981960	Q8TE02	DERP6_HUMAN	S-phase 2 protein isoform 4	262					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding				0						GTCCAAGAAAGAGAGAGAAGC	0.512													17	21	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16022773	16022773	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16022773G>A	uc002gpo.2	-	17	2119	c.1879C>T	c.(1879-1881)CGA>TGA	p.R627*	NCOR1_uc002gpn.2_Nonsense_Mutation_p.R627*|NCOR1_uc002gpp.1_Nonsense_Mutation_p.R518*|NCOR1_uc002gpr.2_Nonsense_Mutation_p.R518*	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	627	SANT 2.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCTGTCCATCGAGAGGTCTCC	0.333													31	38	---	---	---	---	PASS
EPN2	22905	broad.mit.edu	37	17	19216560	19216560	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19216560C>A	uc002gvd.3	+	7	1563	c.1115C>A	c.(1114-1116)CCT>CAT	p.P372H	EPN2_uc010cql.1_Missense_Mutation_p.P81H|EPN2_uc002gve.3_Missense_Mutation_p.P315H|EPN2_uc002gvf.3_Missense_Mutation_p.P87H|EPN2_uc010vyo.1_Missense_Mutation_p.P80H|EPN2_uc002gvg.1_Missense_Mutation_p.P315H|EPN2_uc010vyp.1_Missense_Mutation_p.P308H|EPN2_uc010vyq.1_Missense_Mutation_p.P309H|EPN2_uc002gvh.1_Missense_Mutation_p.P372H|EPN2_uc002gvj.3_Missense_Mutation_p.P35H	NM_014964	NP_055779	O95208	EPN2_HUMAN	epsin 2 isoform b	372	6 X 3 AA repeats of [DE]-P-W.				endocytosis		lipid binding			skin(1)	1	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CCAGCGGCTCCTGCGAGTACT	0.657													141	277	---	---	---	---	PASS
RNF112	7732	broad.mit.edu	37	17	19319463	19319463	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19319463G>A	uc010vyw.1	+	14	2070	c.1871G>A	c.(1870-1872)CGA>CAA	p.R624Q	RNF112_uc010vyv.1_Missense_Mutation_p.R625Q	NM_007148	NP_009079	Q7Z5V9	Q7Z5V9_HUMAN	ring finger protein 112	624							GTP binding|GTPase activity|zinc ion binding			ovary(2)	2						GAAGGGGACCGAGAGCCCCTT	0.627													10	25	---	---	---	---	PASS
KSR1	8844	broad.mit.edu	37	17	25936221	25936221	+	Splice_Site	SNP	G	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25936221G>T	uc010crg.2	+	17	2192	c.1747_splice	c.e17-1	p.G583_splice	KSR1_uc002gzm.2_Splice_Site_p.G362_splice|KSR1_uc002gzn.2_5'Flank	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras						Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GTGTCCTCCAGGGCATGGGAT	0.363													3	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39567602	39567602	+	RNA	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39567602C>A	uc002hwo.1	+	3		c.2067C>A								Homo sapiens cDNA FLJ41849 fis, clone NT2RI3003409.																		ACCTCACCTTCTGCTGGAGCT	0.353													4	9	---	---	---	---	PASS
UBTF	7343	broad.mit.edu	37	17	42289089	42289089	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42289089T>G	uc002igb.2	-	9	999	c.932A>C	c.(931-933)GAG>GCG	p.E311A	UBTF_uc002igc.2_Missense_Mutation_p.E274A|UBTF_uc010czs.2_Missense_Mutation_p.E311A|UBTF_uc002igd.2_Missense_Mutation_p.E274A|UBTF_uc010czt.2_Missense_Mutation_p.E311A|UBTF_uc002ige.2_Missense_Mutation_p.E274A	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	311	HMG box 3.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGCCATGAGCTCTGCGCAGTA	0.617													12	51	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44109507	44109507	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44109507G>C	uc002ikb.2	-	13	3081	c.2996C>G	c.(2995-2997)TCA>TGA	p.S999*	KIAA1267_uc002ikc.2_Nonsense_Mutation_p.S999*|KIAA1267_uc002ikd.2_Nonsense_Mutation_p.S999*|KIAA1267_uc010dav.2_Nonsense_Mutation_p.S998*|KIAA1267_uc010wkb.1_Nonsense_Mutation_p.S330*|KIAA1267_uc010wkc.1_Nonsense_Mutation_p.S267*	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	999						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				GAGGGGTGCTGAGTGCAGTTC	0.602													11	55	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48275121	48275121	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48275121G>C	uc002iqm.2	-	9	794	c.668C>G	c.(667-669)CCA>CGA	p.P223R		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	223	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	AGGGGGACCTGGGGGACCTCG	0.507			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						36	126	---	---	---	---	PASS
PDE6G	5148	broad.mit.edu	37	17	79620333	79620333	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79620333C>T	uc002kay.3	-	2	147	c.3G>A	c.(1-3)ATG>ATA	p.M1I	PDE6G_uc002kaz.3_Intron	NM_002602	NP_002593	P18545	CNRG_HUMAN	phosphodiesterase 6G	1					platelet activation|visual perception	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity				0	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GTTCCAGGTTCATGGTGAGGC	0.662													26	32	---	---	---	---	PASS
POLI	11201	broad.mit.edu	37	18	51818253	51818253	+	Nonsense_Mutation	SNP	C	T	T	rs56152401		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51818253C>T	uc002lfj.3	+	9	1317	c.1249C>T	c.(1249-1251)CGA>TGA	p.R417*	POLI_uc010xds.1_Nonsense_Mutation_p.R338*|POLI_uc002lfk.3_Nonsense_Mutation_p.R314*|POLI_uc010dpg.2_Nonsense_Mutation_p.R13*	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	417					DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		GAAACTTTTTCGAAATATGGT	0.308								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					10	41	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70502500	70502500	+	Intron	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70502500G>A	uc002lkw.2	-						NETO1_uc002lkx.1_Intron|NETO1_uc002lky.1_Intron|NETO1_uc002lkz.2_3'UTR	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3						memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		agatgatggagaaggagagat	0.219													15	40	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74091604	74091604	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74091604G>A	uc010dqx.1	-	3	2701	c.2466C>T	c.(2464-2466)CTC>CTT	p.L822L	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	822					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTTTGCCACCGAGGGCAGGCG	0.622													31	72	---	---	---	---	PASS
ELAVL1	1994	broad.mit.edu	37	19	8046039	8046039	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8046039G>A	uc002mjb.2	-	3	371	c.204C>T	c.(202-204)TAC>TAT	p.Y68Y		NM_001419	NP_001410	Q15717	ELAV1_HUMAN	ELAV-like 1	68	RRM 1.				3'-UTR-mediated mRNA stabilization|multicellular organismal development	cytoplasm|nucleoplasm	identical protein binding|mRNA binding|nucleotide binding				0						TCGCGGTCACGTAGTTCACAA	0.532													14	46	---	---	---	---	PASS
LPAR2	9170	broad.mit.edu	37	19	19737749	19737749	+	Silent	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19737749G>A	uc002nnb.3	-	2	484	c.345C>T	c.(343-345)CTC>CTT	p.L115L	LPAR2_uc002nna.3_Silent_p.L115L|LPAR2_uc002nnc.3_Silent_p.L115L	NM_004720	NP_004711	Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	115	Helical; Name=3; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	cell surface|integral to plasma membrane	LIM domain binding|lipid binding			ovary(1)|breast(1)	2						CCGACGCAGTGAGGCTTGTGT	0.672													6	6	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229523	38229523	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229523G>C	uc002ohe.2	-	4	1890	c.1868C>G	c.(1867-1869)TCA>TGA	p.S623*	ZNF573_uc010efs.2_Nonsense_Mutation_p.S536*|ZNF573_uc002ohd.2_Nonsense_Mutation_p.S621*|ZNF573_uc002ohf.2_Nonsense_Mutation_p.S565*|ZNF573_uc002ohg.2_Nonsense_Mutation_p.S535*	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	603	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			AACAAGGTTTGAAGCACGACT	0.413													46	77	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49713574	49713574	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49713574C>T	uc002pmw.2	+	21	3312	c.3240C>T	c.(3238-3240)ATC>ATT	p.I1080I	TRPM4_uc010emu.2_Silent_p.I935I|TRPM4_uc010yak.1_Silent_p.I544I|TRPM4_uc002pmx.2_Silent_p.I906I|TRPM4_uc010emv.2_Silent_p.I965I|TRPM4_uc010yal.1_Silent_p.I726I|TRPM4_uc002pmy.2_Silent_p.I422I	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	1080	Cytoplasmic (Potential).|Calmodulin-binding.				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CGCCCTTTATCGTCATCTCCC	0.637													20	30	---	---	---	---	PASS
LENG8	114823	broad.mit.edu	37	19	54967251	54967251	+	Silent	SNP	T	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54967251T>G	uc002qfv.1	+	8	1164	c.1020T>G	c.(1018-1020)GGT>GGG	p.G340G	LENG8_uc002qfw.2_Silent_p.G377G			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	340							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGGGCGGGGGTGCCCCGTCCC	0.687													6	24	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55329821	55329821	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55329821G>A	uc002qhk.3	+	3	185	c.122G>A	c.(121-123)CGA>CAA	p.R41Q	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_5'UTR|KIR3DL1_uc010esf.2_Intron|KIR3DL1_uc010yfo.1_5'UTR|KIR3DL1_uc002qhl.3_Missense_Mutation_p.R41Q	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	41	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		GTGGTGCCTCGAGGAGGACAC	0.542													37	54	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56466176	56466176	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56466176C>T	uc002qmh.2	+	3	823	c.752C>T	c.(751-753)ACG>ATG	p.T251M	NLRP8_uc010etg.2_Missense_Mutation_p.T251M	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	251	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GTGAACCAGACGACAGACCAG	0.512													38	75	---	---	---	---	PASS
SNRPB2	6629	broad.mit.edu	37	20	16719531	16719531	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16719531C>G	uc002wph.1	+	5	629	c.413C>G	c.(412-414)TCA>TGA	p.S138*	SNRPB2_uc002wpi.1_Nonsense_Mutation_p.S138*	NM_003092	NP_003083	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B''	138						catalytic step 2 spliceosome|nucleoplasm|U2 snRNP	nucleotide binding|protein binding|RNA binding			large_intestine(1)	1						CAAGGAAATTCAACACCAAAT	0.338													8	22	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625947	29625947	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625947T>C	uc010ztl.1	+	2	133	c.101T>C	c.(100-102)ATT>ACT	p.I34T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TCAGATGCAATTGGACCAAGA	0.343													8	79	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628283	29628283	+	Silent	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628283G>C	uc010ztl.1	+	3	227	c.195G>C	c.(193-195)GGG>GGC	p.G65G	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Silent_p.G17G					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGAAGCAGGGGACATAGAAG	0.378													4	105	---	---	---	---	PASS
CEP250	11190	broad.mit.edu	37	20	34051427	34051427	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34051427G>C	uc002xcm.2	+	6	885	c.214G>C	c.(214-216)GAG>CAG	p.E72Q	CEP250_uc010zve.1_5'UTR|CEP250_uc010gfe.1_RNA|CEP250_uc010zvd.1_RNA	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	72					centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTGGTGCCAAGAGCTGGAGAA	0.547											OREG0025891	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	25	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11021134	11021134	+	3'UTR	SNP	G	A	A	rs9712730	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11021134G>A	uc002yit.1	-	9					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACTTGTCACTGCTAGAAAACA	0.353													9	87	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641252	33641252	+	3'UTR	SNP	T	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641252T>C	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						tttttttttcttttttttttt	0.159													3	13	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40604198	40604198	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40604198G>A	uc002yxk.1	-	25	3044	c.2905C>T	c.(2905-2907)CGA>TGA	p.R969*	BRWD1_uc010goc.1_5'UTR|BRWD1_uc002yxl.2_Nonsense_Mutation_p.R969*|BRWD1_uc010god.1_5'Flank	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	969					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGACCCTGTCGAAAATATATT	0.308													6	33	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22974942	22974942	+	RNA	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22974942G>A	uc011aim.1	+	106		c.7430G>A			POM121L1P_uc011ait.1_RNA					Parts of antibodies, mostly variable regions.												0						AGTGAGTGTCGGCCTGCGCAG	0.607													5	8	---	---	---	---	PASS
GNAZ	2781	broad.mit.edu	37	22	23465561	23465561	+	Silent	SNP	C	T	T	rs139659965		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23465561C>T	uc002zwu.1	+	3	1548	c.1011C>T	c.(1009-1011)TTC>TTT	p.F337F	RTDR1_uc002zwt.2_Intron	NM_002073	NP_002064	P19086	GNAZ_HUMAN	guanine nucleotide binding protein, alpha z	337						endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity			kidney(1)|skin(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		AGTTTGTCTTCGACGCGGTGA	0.562													13	16	---	---	---	---	PASS
SUN2	25777	broad.mit.edu	37	22	39132222	39132222	+	3'UTR	SNP	T	G	G			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39132222T>G	uc003awh.1	-	19					SUN2_uc011anz.1_3'UTR|SUN2_uc011aoa.1_3'UTR|SUN2_uc003awi.1_3'UTR|SUN2_uc010gxq.1_3'UTR|SUN2_uc010gxr.1_3'UTR|SUN2_uc010gxs.1_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						AGCGGCGGGGTGCTGTTCACC	0.627													8	9	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41739424	41739424	+	Silent	SNP	C	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41739424C>A	uc003azw.2	+	13	1519	c.1303C>A	c.(1303-1305)CGG>AGG	p.R435R	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	451					interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						CATAGGCCCCCGGGCTGGCGA	0.637													3	62	---	---	---	---	PASS
MOSPD2	158747	broad.mit.edu	37	X	14891637	14891637	+	5'UTR	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14891637C>T	uc004cwi.2	+	1					FANCB_uc004cwg.1_5'Flank|FANCB_uc004cwh.1_5'Flank	NM_152581	NP_689794	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2							integral to membrane	structural molecule activity			lung(1)	1	Hepatocellular(33;0.183)					GCAATCACATCCACGACGGTG	0.677													9	10	---	---	---	---	PASS
IL2RG	3561	broad.mit.edu	37	X	70331308	70331308	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70331308G>C	uc004dyw.1	-	1	96	c.82C>G	c.(82-84)CTG>GTG	p.L28V	IL2RG_uc004dyv.1_5'Flank|IL2RG_uc004dyx.1_5'UTR	NM_000206	NP_000197	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma precursor	28	Extracellular (Potential).				immune response|interleukin-4-mediated signaling pathway|interspecies interaction between organisms	external side of plasma membrane|integral to plasma membrane	cytokine receptor activity|interleukin-2 binding			pancreas(1)	1	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	TTGGGCGTCAGAATTGTCGTG	0.562									Severe_Combined_Immunodeficiency_X-linked				12	9	---	---	---	---	PASS
WBP5	51186	broad.mit.edu	37	X	102612724	102612724	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102612724G>A	uc004ekd.2	+	3	413	c.112G>A	c.(112-114)GAG>AAG	p.E38K	WBP5_uc004eke.2_Missense_Mutation_p.E38K|WBP5_uc004ekf.2_Missense_Mutation_p.E38K|WBP5_uc004ekg.2_Missense_Mutation_p.E38K	NM_001006612	NP_001006613	Q9UHQ7	WPB5_HUMAN	WW domain binding protein 5	38	Glu-rich.										0						GCTAGAGGAGGAGGCCAAAGC	0.408													21	13	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118602427	118602427	+	5'UTR	SNP	A	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118602427A>C	uc004erh.3	+	1					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_Intron	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	CCGGAGTCAAAGCCGGTTCCC	0.582													3	2	---	---	---	---	PASS
SRPK3	26576	broad.mit.edu	37	X	153049816	153049816	+	Silent	SNP	C	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153049816C>T	uc004fil.2	+	11	1247	c.1215C>T	c.(1213-1215)ATC>ATT	p.I405I	SRPK3_uc004fik.2_Silent_p.I471I|SRPK3_uc010nul.2_Silent_p.I329I|SRPK3_uc004fin.2_Silent_p.I404I|SRPK3_uc004fim.2_Silent_p.I371I	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3	405	Protein kinase.				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGATCAAGATCAAGATCGCAG	0.607													8	6	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27099094	27099097	+	Frame_Shift_Del	DEL	CAGT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27099094_27099097delCAGT	uc001bmv.1	+	13	3883_3886	c.3510_3513delCAGT	c.(3508-3513)CACAGTfs	p.H1170fs	ARID1A_uc001bmt.1_Frame_Shift_Del_p.H1170fs|ARID1A_uc001bmu.1_Frame_Shift_Del_p.H1170fs|ARID1A_uc001bmw.1_Frame_Shift_Del_p.H787fs|ARID1A_uc001bmx.1_Frame_Shift_Del_p.H17fs|ARID1A_uc009vsm.1_5'Flank|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1170_1171					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCACACCACACAGTCAGATCCCCC	0.564			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								36	10	---	---	---	---	
LHX8	431707	broad.mit.edu	37	1	75606525	75606525	+	Intron	DEL	A	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75606525delA	uc001dgo.2	+						LHX8_uc001dgq.2_Intron	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						ATGACATCTTAAAAAAAAATG	0.264													11	8	---	---	---	---	
ITLN1	55600	broad.mit.edu	37	1	160850095	160850096	+	Intron	INS	-	A	A	rs141641663		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160850095_160850096insA	uc001fxc.2	-							NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor						positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			aactccatctcaaaaaaaaaaa	0.005													5	3	---	---	---	---	
TSEN15	116461	broad.mit.edu	37	1	184041947	184041947	+	Intron	DEL	T	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184041947delT	uc001gqt.3	+						TSEN15_uc009wyg.2_Intron|TSEN15_uc001gqu.3_Intron	NM_052965	NP_443197	Q8WW01	SEN15_HUMAN	tRNA splicing endonuclease 15 isoform 1						mRNA processing|tRNA processing	nucleolus	protein binding				0						CATCCTGATCTTTTTTTTTTC	0.303													91	7	---	---	---	---	
ELF3	1999	broad.mit.edu	37	1	201981870	201981871	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201981870_201981871insT	uc001gxg.3	+	4	3773_3774	c.581_582insT	c.(580-582)TCTfs	p.S194fs	ELF3_uc001gxi.3_Frame_Shift_Ins_p.S194fs|ELF3_uc001gxh.3_Frame_Shift_Ins_p.S194fs	NM_004433	NP_004424	P78545	ELF3_HUMAN	E74-like factor 3 (ets domain transcription	194					epidermis development|epithelial cell differentiation|inflammatory response|mammary gland involution|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0						CCTGGCAGCTCTGACGTCTCCA	0.663													31	16	---	---	---	---	
TSNAX	7257	broad.mit.edu	37	1	231696991	231696995	+	Frame_Shift_Del	DEL	AAAAT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231696991_231696995delAAAAT	uc001huw.2	+	5	643_647	c.485_489delAAAAT	c.(484-489)GAAAATfs	p.E162fs	TSNAX-DISC1_uc010pwe.1_5'UTR|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_5'UTR|TSNAX-DISC1_uc010pwi.1_5'UTR|TSNAX-DISC1_uc010pwj.1_5'UTR|TSNAX-DISC1_uc010pwk.1_5'UTR|TSNAX-DISC1_uc010pwl.1_Intron	NM_005999	NP_005990	Q99598	TSNAX_HUMAN	translin-associated factor X	162_163	Interaction with C1D.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding				0		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				AATGGGAAAGAAAATAAAACTGTGA	0.273													33	10	---	---	---	---	
IFIH1	64135	broad.mit.edu	37	2	163174805	163174806	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163174805_163174806insCC	uc002uce.2	-	1	234_235	c.12_13insGG	c.(10-15)GGGTATfs	p.G4fs	IFIH1_uc002ucf.2_Frame_Shift_Ins_p.G4fs	NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	4_5					detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						TCTGTGGAATACCCATTCGACA	0.530													62	22	---	---	---	---	
RFTN2	130132	broad.mit.edu	37	2	198540354	198540354	+	5'UTR	DEL	C	-	-	rs56400552		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540354delC	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaacccaaaaaaaa	0.249													6	3	---	---	---	---	
ATG9A	79065	broad.mit.edu	37	2	220092238	220092238	+	Intron	DEL	A	-	-	rs34195462		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220092238delA	uc002vke.1	-						ATG9A_uc002vkd.1_5'Flank|ATG9A_uc002vkf.1_Intron|ANKZF1_uc010zkv.1_5'Flank|ANKZF1_uc010zkw.1_5'Flank|ANKZF1_uc002vkg.2_5'Flank|ANKZF1_uc002vkh.2_5'Flank|ANKZF1_uc002vki.2_5'Flank	NM_001077198	NP_001070666	Q7Z3C6	ATG9A_HUMAN	APG9 autophagy 9-like 1						autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		catctcaaacaaaaaaaaaaG	0.199													1	6	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494685	195494686	+	Intron	INS	-	CAC	CAC			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494685_195494686insCAC	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		atcaccaccatcaccaccacca	0.000													4	2	---	---	---	---	
TMEM192	201931	broad.mit.edu	37	4	166023937	166023937	+	Intron	DEL	T	-	-	rs11363030		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166023937delT	uc003iqz.3	-							NM_001100389	NP_001093859	Q8IY95	TM192_HUMAN	transmembrane protein 192							Golgi apparatus|integral to membrane|late endosome|lysosomal membrane|nucleus				skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		gtgtacgtacTTTTTTTTTTT	0.075													7	4	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169317284	169317285	+	Intron	INS	-	A	A	rs5863929		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169317284_169317285insA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TGCTACTATTTAAAAAAAAAAA	0.178													6	4	---	---	---	---	
C7	730	broad.mit.edu	37	5	40979699	40979699	+	Intron	DEL	T	-	-	rs35148902		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40979699delT	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGTTTCCACCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94877399	94877400	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94877399_94877400insA	uc003klb.2	-						TTC37_uc010jbf.1_Intron	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						ACAAATGTTTGAAAAAAAAAAA	0.277													4	2	---	---	---	---	
ELL2	22936	broad.mit.edu	37	5	95234666	95234667	+	Intron	INS	-	AAAC	AAAC	rs143997177	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95234666_95234667insAAAC	uc003klr.3	-							NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		GCTTaagcaaaaaacaaacaaa	0.198													4	3	---	---	---	---	
HIST1H4L	8368	broad.mit.edu	37	6	27841112	27841114	+	In_Frame_Del	DEL	AAG	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27841112_27841114delAAG	uc003njz.2	-	1	176_178	c.175_177delCTT	c.(175-177)CTTdel	p.L59del	HIST1H3I_uc003njy.2_5'Flank	NM_003546	NP_003537	P62805	H4_HUMAN	histone cluster 1, H4l	59					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|breast(1)	2						AAAACACTTTAAGAACTCCGCGT	0.552													41	12	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35554625	35554625	+	Intron	DEL	T	-	-	rs112376611		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35554625delT	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_3'UTR	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						GAATCTGTACTTTTTTTTTTT	0.189													4	3	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	66054075	66054075	+	Intron	DEL	A	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66054075delA	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CAGATCCTTTAAAAAAAAAGA	0.333													42	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659635	57659636	+	IGR	INS	-	CG	CG	rs76134547		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659635_57659636insCG								ZNF716 (126370 upstream) : None (None downstream)																							TGCAAATTGCATGTTTTTTGTG	0.347													5	5	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72662348	72662349	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72662348_72662349insA	uc003txs.1	-						FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						actctgtctccaaaaaaaaaaa	0.183													4	2	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5091046	5091046	+	Intron	DEL	T	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5091046delT	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TACATTTAACTTTTTTTTTTT	0.289		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44109097	44109098	+	IGR	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44109097_44109098insA								FAM75A6 (478367 upstream) : FAM27C (881138 downstream)																							ATAAAGGTCTCAAAAATCCAGA	0.347													8	4	---	---	---	---	
RPSAP9	653162	broad.mit.edu	37	9	79014569	79014570	+	3'UTR	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79014569_79014570insA	uc011lsj.1	+	1						NR_026890				SubName: Full=Laminin receptor-like protein LAMRL5;												0						ATCAGTTTCTTAAAAAAAAAAA	0.342													1	5	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137600270	137600270	+	Intron	DEL	T	-	-	rs4841925	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137600270delT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ACTCCCGGGGTGGGGGCTCTG	0.652													4	2	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138715799	138715800	+	Frame_Shift_Ins	INS	-	T	T	rs148250832	byFrequency	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138715799_138715800insT	uc004cgr.3	-	10	1396_1397	c.1396_1397insA	c.(1396-1398)ACCfs	p.T466fs	CAMSAP1_uc004cgq.3_Frame_Shift_Ins_p.T356fs|CAMSAP1_uc010nbg.2_Frame_Shift_Ins_p.T188fs	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	466						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GACTCACCTGGTTTTTTTTTCT	0.337													4	2	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16911557	16911557	+	Intron	DEL	G	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911557delG	uc001ioo.2	-						CUBN_uc009xjq.1_Intron	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGTGGGGGTGGGGGGGGGGC	0.403													36	8	---	---	---	---	
PDSS1	23590	broad.mit.edu	37	10	27031522	27031523	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27031522_27031523insA	uc001isv.2	+						PDSS1_uc001isw.2_Intron|PDSS1_uc010qdf.1_Intron	NM_014317	NP_055132	Q5T2R2	DPS1_HUMAN	prenyl diphosphate synthase, subunit 1						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	metal ion binding|protein heterodimerization activity				0						ACTGTTTTTTTAAAAAAAAGGC	0.366													40	9	---	---	---	---	
STK33	65975	broad.mit.edu	37	11	8578833	8578834	+	Intron	INS	-	AA	AA	rs150095375	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8578833_8578834insAA	uc001mgj.1	-						STK33_uc001mgk.1_Intron|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		ggaggggaggggaggagagaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11158592	11158592	+	IGR	DEL	G	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158592delG								ZBED5 (278972 upstream) : GALNTL4 (133829 downstream)																							aaaaaaaaaagaaaaaaaaat	0.154													7	5	---	---	---	---	
SLC38A2	54407	broad.mit.edu	37	12	46759079	46759080	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46759079_46759080insA	uc001rpg.2	-						SLC38A2_uc010sli.1_5'UTR|SLC38A2_uc001rph.2_Intron	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		AACAAACACACAAAAAAGACAT	0.327													3	3	---	---	---	---	
PFDN5	5204	broad.mit.edu	37	12	53692936	53692937	+	Intron	INS	-	AG	AG	rs58044200		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53692936_53692937insAG	uc001scl.2	+						PFDN5_uc001scm.2_Intron|PFDN5_uc001scn.2_Intron|PFDN5_uc001sco.2_Intron|C12orf10_uc010sof.1_5'Flank|C12orf10_uc001scp.3_5'Flank|C12orf10_uc009zmx.2_5'Flank|C12orf10_uc001scq.3_5'Flank	NM_002624	NP_002615	Q99471	PFD5_HUMAN	prefoldin subunit 5 isoform alpha						'de novo' posttranslational protein folding|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent	nucleus|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)	1						aaaaaaaaaaaGGTTATTAACA	0.208													6	3	---	---	---	---	
KIAA1704	55425	broad.mit.edu	37	13	45580365	45580367	+	In_Frame_Del	DEL	GAT	-	-	rs138421508		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45580365_45580367delGAT	uc001uzq.2	+	3	353_355	c.250_252delGAT	c.(250-252)GATdel	p.D88del	KIAA1704_uc010tfo.1_RNA|KIAA1704_uc001uzr.1_In_Frame_Del_p.D88del|KIAA1704_uc001uzs.2_5'UTR|KIAA1704_uc001uzt.2_5'UTR	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425	88	Poly-Asp.									pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		Ggatgatgacgatgatgatgatg	0.286													329	7	---	---	---	---	
ESD	2098	broad.mit.edu	37	13	47351547	47351548	+	Intron	DEL	AT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47351547_47351548delAT	uc001vbn.2	-						ESD_uc001vbo.2_Intron|ESD_uc001vbp.1_3'UTR	NM_001984	NP_001975	P10768	ESTD_HUMAN	esterase D/formylglutathione hydrolase							cytoplasmic membrane-bounded vesicle	carboxylesterase activity|S-formylglutathione hydrolase activity			ovary(1)	1		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	CTAATTTTTCATAGTTACATTA	0.287													42	13	---	---	---	---	
SAMD4A	23034	broad.mit.edu	37	14	55241532	55241532	+	Intron	DEL	A	-	-	rs35827295		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55241532delA	uc001xbb.2	+						SAMD4A_uc001xbc.2_Intron|SAMD4A_uc001xbg.2_Intron	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						accctgactcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76352962	76352963	+	Intron	INS	-	T	T			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76352962_76352963insT	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xrz.2_Intron|TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		ATGATTTAAAATTTTTTTTTTT	0.327													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20148686	20148725	+	IGR	DEL	ATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGC	-	-	rs71114078		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20148686_20148725delATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGC								None (None upstream) : GOLGA6L6 (588369 downstream)																							CATCTCCACTATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGCATTTTGCCCC	0.592													9	4	---	---	---	---	
POTEB	339010	broad.mit.edu	37	15	22074567	22074568	+	Intron	INS	-	AC	AC			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22074567_22074568insAC	uc010tzr.1	-						POTEB_uc010tzq.1_Intron	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,												0						AATCTAGAACAACACACAGATT	0.277													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30384348	30384349	+	5'Flank	INS	-	C	C			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30384348_30384349insC	uc001zcx.1	-						uc010uau.1_5'Flank					DQ595055																		TGAGCCTGACTCCCCCTGCACC	0.604													3	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63908449	63908450	+	Intron	INS	-	TCTA	TCTA	rs144336374	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63908449_63908450insTCTA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CAGGAGCCTGCTCTATTAGAAG	0.485													6	3	---	---	---	---	
DENND4A	10260	broad.mit.edu	37	15	65982629	65982629	+	Intron	DEL	C	-	-	rs34408949		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65982629delC	uc002aph.2	-						DENND4A_uc002api.2_Intron	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						ACAAAACTTACATACCCAATG	0.308													7	5	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	93007302	93007303	+	Intron	INS	-	T	T	rs34156050		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93007302_93007303insT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGtttcttttcttttttttttt	0.441													4	2	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600733	600734	+	Intron	INS	-	T	T	rs145905062	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600733_600734insT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TGAGGGTCCCCGTCGGTGAGGG	0.738													4	2	---	---	---	---	
XPO6	23214	broad.mit.edu	37	16	28167920	28167921	+	Intron	INS	-	AA	AA	rs150507094	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28167920_28167921insAA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						AATTCTCCTTCAAAAAAatata	0.252													4	3	---	---	---	---	
CLN3	1201	broad.mit.edu	37	16	28493308	28493308	+	Intron	DEL	A	-	-	rs2520416		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28493308delA	uc002dpo.2	-						uc010vct.1_Intron|CLN3_uc002dpl.2_Intron|CLN3_uc010vcu.1_Intron|CLN3_uc002dpn.2_Intron|CLN3_uc002dpm.2_Intron|CLN3_uc010vcv.1_Intron|CLN3_uc010byd.2_Intron|CLN3_uc002dpp.2_Intron|CLN3_uc002dpt.1_Intron|CLN3_uc002dpq.1_Intron|CLN3_uc010bye.1_Intron|CLN3_uc002dpr.1_Intron|CLN3_uc010byf.1_Intron|CLN3_uc002dps.1_Intron|CLN3_uc002dpu.1_Intron	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3						amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						actctgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
KIAA0174	9798	broad.mit.edu	37	16	71955133	71955133	+	Intron	DEL	T	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71955133delT	uc002fbj.1	+						KIAA0174_uc010cgh.1_Intron|KIAA0174_uc002fbk.1_Intron|KIAA0174_uc002fbm.1_Intron|KIAA0174_uc002fbl.1_Intron|KIAA0174_uc002fbn.1_Intron|KIAA0174_uc010cgi.1_Intron|KIAA0174_uc010cgj.1_Intron|KIAA0174_uc010vml.1_5'Flank|KIAA0174_uc010vmk.1_Intron			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;						cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						gctctgaacctttttttccct	0.244													4	2	---	---	---	---	
CA5A	763	broad.mit.edu	37	16	87969778	87969778	+	Intron	DEL	A	-	-	rs72326144		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87969778delA	uc002fkn.1	-							NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor						one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		acgccatcttaaaaaaaaaaa	0.224													4	3	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10555063	10555064	+	Intron	DEL	TG	-	-	rs113649252		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10555063_10555064delTG	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						ttattattattgtttttttttt	0.193													4	2	---	---	---	---	
DHRS7B	25979	broad.mit.edu	37	17	21094331	21094333	+	In_Frame_Del	DEL	GAA	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21094331_21094333delGAA	uc002gyo.2	+	7	870_872	c.843_845delGAA	c.(841-846)GGGAAG>GGG	p.K285del		NM_015510	NP_056325	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	285	Peroxisomal (Potential).					integral to membrane|peroxisomal membrane	binding|oxidoreductase activity			pancreas(1)	1						CTGCTGTGGGGAAGAAGAAGAAA	0.507													1646	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289395	25289395	+	IGR	DEL	T	-	-	rs113949263		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289395delT								None (None upstream) : WSB1 (331711 downstream)																							TATTTACATCTTTTTTTGTCT	0.433													39	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36398126	36398127	+	Intron	DEL	TC	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36398126_36398127delTC	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																		CCTGAAAATGTCTCTCTCTCTC	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43616611	43616612	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43616611_43616612insA	uc002ijh.2	-						uc010wjv.1_Intron					Homo sapiens cDNA FLJ45049 fis, clone BRAWH3022347.																		CTAAGATTTCTAAAAAAAAAAG	0.307													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43686352	43686352	+	IGR	DEL	A	-	-	rs146987505		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43686352delA								LOC644172 (6604 upstream) : CRHR1 (11360 downstream)																							AATTGTACTTAAAAAAAAAAA	0.224													6	5	---	---	---	---	
CASKIN2	57513	broad.mit.edu	37	17	73498817	73498819	+	In_Frame_Del	DEL	AGG	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73498817_73498819delAGG	uc002joc.2	-	18	2886_2888	c.2336_2338delCCT	c.(2335-2340)TCCTAC>TAC	p.S779del	CASKIN2_uc010wsc.1_In_Frame_Del_p.S697del	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	779	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCGGCCAAGTAGGAGAAGGCCCA	0.695													9	5	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3134954	3134954	+	Intron	DEL	T	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134954delT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TATTTTACGAttttttttttt	0.169													4	2	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1079503	1079503	+	Intron	DEL	A	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1079503delA	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													3	3	---	---	---	---	
PLIN4	729359	broad.mit.edu	37	19	4510389	4510389	+	Intron	DEL	C	-	-	rs56906779		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4510389delC	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0						aaaaaaaaaacaaaaCAGTCA	0.294													3	3	---	---	---	---	
GMFG	9535	broad.mit.edu	37	19	39820128	39820129	+	Intron	DEL	AC	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39820128_39820129delAC	uc002okz.3	-						GMFG_uc002okx.3_Intron	NM_004877	NP_004868	O60234	GMFG_HUMAN	glia maturation factor, gamma						protein phosphorylation	intracellular	actin binding|enzyme activator activity|growth factor activity|protein kinase inhibitor activity			skin(1)	1	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.15e-27)|all cancers(26;1.3e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			ttacacacaaacacacacacac	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48298226	48298237	+	IGR	DEL	TGCTGGGCGTGG	-	-	rs61719038		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48298226_48298237delTGCTGGGCGTGG								SEPW1 (10287 upstream) : TPRX1 (6263 downstream)																							ATGGAGTCTTTgctgggcgtggtggctcacgc	0.175													6	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8665965	8665966	+	Intron	DEL	CA	-	-	rs75405686		TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8665965_8665966delCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AAAATGCAACCACGGCTGACAT	0.441													2	5	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AACAAACAAACAAAAAAAACC	0.408													2	4	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074087	62074089	+	Intron	DEL	CCT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074087_62074089delCCT	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	atcatcaccacctccaccatcac	0.000													4	3	---	---	---	---	
C21orf81	391267	broad.mit.edu	37	21	15343608	15343609	+	Intron	INS	-	A	A			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15343608_15343609insA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						TAAAACAGCAGAAAAAATTAAT	0.272													90	7	---	---	---	---	
USP25	29761	broad.mit.edu	37	21	17238522	17238523	+	Intron	DEL	AT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17238522_17238523delAT	uc002yjy.1	+						USP25_uc011aby.1_Intron|USP25_uc002yjz.1_Intron|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25						protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TGatttacaaatatatatatat	0.228													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	32114509	32114538	+	IGR	DEL	ACAGTCAGATCCATATCCAGAGCCGTATTG	-	-	rs79327030	by1000genomes	TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32114509_32114538delACAGTCAGATCCATATCCAGAGCCGTATTG								KRTAP20-3 (99054 upstream) : KRTAP21-2 (4733 downstream)																							AACCATAGCCACAGTCAGATCCATATCCAGAGCCGTATTGACAGCCAGAG	0.530													92	35	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37571732	37571735	+	Intron	DEL	CTTT	-	-			TCGA-BT-A20Q-01	TCGA-BT-A20Q-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37571732_37571735delCTTT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						CCTAACTTTGCTTTCtttcttttt	0.255													4	2	---	---	---	---	
