Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	957838	957838	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:957838G>A	uc001ack.1	+	2	509	c.459G>A	c.(457-459)GTG>GTA	p.V153V		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	153	NtA.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		AGTTCTGTGTGGAAGGTGCGT	0.657													23	30	---	---	---	---	PASS
DFFB	1677	broad.mit.edu	37	1	3800260	3800260	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3800260C>T	uc001alc.2	+	7	1295	c.972C>T	c.(970-972)CCC>CCT	p.P324P	DFFB_uc001ale.2_RNA|DFFB_uc009vlp.2_RNA|DFFB_uc001alb.2_RNA|DFFB_uc010nzn.1_Silent_p.P348P|DFFB_uc009vlq.2_RNA|DFFB_uc009vlr.2_Silent_p.P275P|DFFB_uc001ald.2_Silent_p.P260P	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta	324					apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TCTACAAACCCCAGACAAGGT	0.498													28	65	---	---	---	---	PASS
LOC440563	440563	broad.mit.edu	37	1	13183388	13183388	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13183388G>C	uc010obg.1	-	1	580	c.485C>G	c.(484-486)TCT>TGT	p.S162C		NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	162						ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						TCCACTCTTAGAATTGAAGCC	0.502													79	496	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21226289	21226289	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21226289G>A	uc001bec.2	-	11	1988	c.1732C>T	c.(1732-1734)CGT>TGT	p.R578C	EIF4G3_uc010odi.1_Missense_Mutation_p.R182C|EIF4G3_uc010odj.1_Missense_Mutation_p.R577C|EIF4G3_uc009vpz.2_Missense_Mutation_p.R298C|EIF4G3_uc001bed.2_Missense_Mutation_p.R578C|EIF4G3_uc001bef.2_Missense_Mutation_p.R577C|EIF4G3_uc001bee.2_Missense_Mutation_p.R584C	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	578					interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GCACCATTACGTACTGGCTCA	0.438													15	271	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31478834	31478834	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31478834G>C	uc001bsi.1	-	5	699	c.586C>G	c.(586-588)CAG>GAG	p.Q196E	PUM1_uc001bsg.1_Missense_Mutation_p.Q8E|PUM1_uc001bsh.1_Missense_Mutation_p.Q196E|PUM1_uc001bsj.1_Missense_Mutation_p.Q196E|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Missense_Mutation_p.Q232E|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	196					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TGGAAACTCTGACCAGGTCTT	0.468													10	36	---	---	---	---	PASS
GJA9	81025	broad.mit.edu	37	1	39341511	39341511	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341511G>A	uc001cct.1	-	2	541	c.260C>T	c.(259-261)TCA>TTA	p.S87L	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	87	Helical; (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			CAGGGATGGTGAAGACACAAA	0.473													45	114	---	---	---	---	PASS
MAGOH	4116	broad.mit.edu	37	1	53699276	53699276	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53699276C>T	uc001cvf.1	-	3	284	c.196G>A	c.(196-198)GAC>AAC	p.D66N	MAGOH_uc010ont.1_Intron	NM_002370	NP_002361	P61326	MGN_HUMAN	mago-nashi homolog	66				DSE->RSR: Slightly reduced nonsense- mediated decay activity.	mRNA 3'-end processing|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|exon-exon junction complex|nuclear speck	protein binding|RNA binding				0						ATTTCACTGTCGTCAATTATT	0.408													47	103	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65145288	65145288	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65145288G>A	uc001dbo.1	+	24	3207	c.3102G>A	c.(3100-3102)GTG>GTA	p.V1034V	CACHD1_uc001dbp.1_Silent_p.V789V|CACHD1_uc001dbq.1_Silent_p.V789V|CACHD1_uc010opa.1_Silent_p.V278V	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	1085	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						GTGATGAGGTGATCACATTAA	0.493													31	64	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70488897	70488897	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70488897G>A	uc001dep.2	+	15	1550	c.1520G>A	c.(1519-1521)TGG>TAG	p.W507*	LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	507						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TGCACACCATGGGCCAGGTGT	0.587													20	34	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78045314	78045314	+	Splice_Site	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78045314C>G	uc001dhq.2	-	10	2457	c.1981_splice	c.e10-1	p.K661_splice	ZZZ3_uc001dhr.2_Splice_Site_p.K167_splice|ZZZ3_uc001dhp.2_Splice_Site_p.K660_splice	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						CCAGCTTTTTCTAAGCCATAC	0.323													37	70	---	---	---	---	PASS
PRMT6	55170	broad.mit.edu	37	1	107599800	107599800	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107599800G>C	uc010ous.1	+	1	534	c.463G>C	c.(463-465)GAG>CAG	p.E155Q		NM_018137	NP_060607	Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	155					base-excision repair|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone binding|histone methyltransferase activity (H2A-R3 specific)|histone methyltransferase activity (H3-R2 specific)|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity				0		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		CATCGTGAGCGAGTGGATGGG	0.652													23	49	---	---	---	---	PASS
KCNA10	3744	broad.mit.edu	37	1	111060995	111060995	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111060995C>G	uc001dzt.1	-	1	803	c.415G>C	c.(415-417)GAT>CAT	p.D139H		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	139						voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)		AGGATTCCATCAAAACTGGGC	0.453													31	64	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114310974	114310974	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114310974G>C	uc001edq.2	-	5	1732	c.1696C>G	c.(1696-1698)CGG>GGG	p.R566G	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	566						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACTGGTCCGAGGTAGGTAC	0.428													12	63	---	---	---	---	PASS
TTF2	8458	broad.mit.edu	37	1	117633211	117633211	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117633211G>T	uc001egy.2	+	15	2574	c.2554G>T	c.(2554-2556)GAG>TAG	p.E852*		NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	852					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TGAAGATGAAGAGACTGTTTA	0.368													17	51	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145299838	145299838	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145299838G>A	uc001end.3	+	6	922	c.887G>A	c.(886-888)CGC>CAC	p.R296H	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.R296H|NBPF10_uc010oyi.1_5'Flank|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	296											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAAATTGCGCCCCCAGCTG	0.488													9	344	---	---	---	---	PASS
LOC728855	728855	broad.mit.edu	37	1	149648623	149648623	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149648623C>T	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						AGTTTTAATTCAGGAGCATGG	0.418													20	134	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150443792	150443792	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150443792C>T	uc009wlr.2	+	11	2569	c.2368C>T	c.(2368-2370)CGA>TGA	p.R790*	RPRD2_uc010pcc.1_Nonsense_Mutation_p.R764*|RPRD2_uc001eup.3_Nonsense_Mutation_p.R764*	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	790	Ser-rich.						protein binding			ovary(1)	1						ATCTACATATCGACCCTTTGG	0.507													17	40	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155491121	155491121	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155491121C>T	uc009wqq.2	-	2	670	c.190G>A	c.(190-192)GAT>AAT	p.D64N	ASH1L_uc001fkt.2_Missense_Mutation_p.D64N|ASH1L_uc009wqr.1_Missense_Mutation_p.D64N	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	64					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GTCAAACCATCATCTTTCCCA	0.393													188	399	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156641159	156641159	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156641159C>T	uc001fpq.2	-	4	2954	c.2821G>A	c.(2821-2823)GAG>AAG	p.E941K		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	941	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCGGCAGCTCCTGTCCCTCC	0.547													105	185	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158151886	158151886	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158151886C>G	uc001frr.2	+	4	892	c.393C>G	c.(391-393)TTC>TTG	p.F131L	CD1D_uc009wsr.1_Missense_Mutation_p.F131L|CD1D_uc009wss.2_Missense_Mutation_p.F131L|CD1D_uc009wst.1_Missense_Mutation_p.F27L	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	131	Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					CAAATAACTTCTTCCATGTAG	0.498													104	223	---	---	---	---	PASS
ITLN2	142683	broad.mit.edu	37	1	160914926	160914926	+	3'UTR	SNP	T	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160914926T>G	uc001fxd.2	-	8					ITLN2_uc009wts.2_3'UTR|ITLN2_uc010pju.1_3'UTR	NM_080878	NP_543154	Q8WWU7	ITLN2_HUMAN	intelectin 2 precursor						signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CGCAGAGCTCTGTCTCATCTA	0.507													11	28	---	---	---	---	PASS
POU2F1	5451	broad.mit.edu	37	1	167381395	167381395	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167381395G>A	uc001gec.2	+	15	1848	c.1686G>A	c.(1684-1686)GTG>GTA	p.V562V	POU2F1_uc001ged.2_Silent_p.V560V|POU2F1_uc001gee.2_Silent_p.V562V|POU2F1_uc010plh.1_Silent_p.V499V|POU2F1_uc001gef.2_Silent_p.V574V|POU2F1_uc001geg.2_Silent_p.V460V|POU2F1_uc009wvg.1_RNA	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	562					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						CCAGCCAGGTGATGGTGACAG	0.592													11	32	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176903363	176903363	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176903363C>T	uc001glc.2	-	16	2808	c.2596G>A	c.(2596-2598)GAG>AAG	p.E866K	ASTN1_uc001glb.1_Missense_Mutation_p.E866K|ASTN1_uc001gld.1_Missense_Mutation_p.E866K	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	874					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GAACAGGACTCCTCAAAGCCG	0.517													9	61	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176903364	176903364	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176903364C>T	uc001glc.2	-	16	2807	c.2595G>A	c.(2593-2595)GAG>GAA	p.E865E	ASTN1_uc001glb.1_Silent_p.E865E|ASTN1_uc001gld.1_Silent_p.E865E	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	873					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						AACAGGACTCCTCAAAGCCGT	0.522													9	62	---	---	---	---	PASS
NCF2	4688	broad.mit.edu	37	1	183542321	183542321	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183542321G>A	uc001gqj.3	-	5	883	c.608C>T	c.(607-609)ACG>ATG	p.T203M	NCF2_uc010pod.1_Missense_Mutation_p.T158M|NCF2_uc010poe.1_Intron|NCF2_uc001gqk.3_Missense_Mutation_p.T203M	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	203					cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						CCCACCTACCGTCGCCTTGCC	0.572													90	130	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185144079	185144079	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185144079G>C	uc001grg.3	+	5	914	c.800G>C	c.(799-801)AGA>ACA	p.R267T	C1orf26_uc001grh.3_Missense_Mutation_p.R267T	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	267											0						CAGGAAGAAAGAGAATACCTG	0.368													54	88	---	---	---	---	PASS
TROVE2	6738	broad.mit.edu	37	1	193038174	193038174	+	5'UTR	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193038174G>C	uc001gss.2	+	2					TROVE2_uc001gst.1_Intron|TROVE2_uc001gsu.1_Intron|TROVE2_uc001gsv.1_5'UTR|TROVE2_uc001gsw.2_5'UTR|TROVE2_uc009wyp.2_5'UTR|TROVE2_uc009wyq.2_5'UTR|TROVE2_uc001gsx.1_5'UTR	NM_004600	NP_004591	P10155	RO60_HUMAN	TROVE domain family, member 2 isoform 2						transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0						GTTTCCTAAAGACAAAAAAAA	0.338													24	35	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390429	197390429	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390429G>A	uc001gtz.2	+	6	1606	c.1471G>A	c.(1471-1473)GAT>AAT	p.D491N	CRB1_uc010poz.1_Missense_Mutation_p.D422N|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.D379N|CRB1_uc010ppb.1_Missense_Mutation_p.D491N|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.D140N	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	491	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						ATTTGAGGGCGATGGCTTCCT	0.517													31	47	---	---	---	---	PASS
C1orf107	27042	broad.mit.edu	37	1	210006542	210006542	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210006542C>T	uc001hhr.1	+	4	477	c.401C>T	c.(400-402)TCT>TTT	p.S134F	C1orf107_uc009xcu.1_5'UTR	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	134	Glu-rich.				multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		GTAGCTTTATCTGCTGACCCT	0.398													24	40	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850784	216850784	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850784A>G	uc001hkw.1	-	2	272	c.106T>C	c.(106-108)TCG>CCG	p.S36P	ESRRG_uc001hky.1_Missense_Mutation_p.S13P|ESRRG_uc009xdp.1_Missense_Mutation_p.S13P|ESRRG_uc001hkz.1_Missense_Mutation_p.S13P|ESRRG_uc010puc.1_Missense_Mutation_p.S13P|ESRRG_uc001hla.1_Missense_Mutation_p.S13P|ESRRG_uc001hlb.1_Missense_Mutation_p.S13P|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.S13P|ESRRG_uc001hld.1_Missense_Mutation_p.S13P|ESRRG_uc001hkx.1_Missense_Mutation_p.S41P|ESRRG_uc009xdo.1_Missense_Mutation_p.S13P|ESRRG_uc001hle.1_Missense_Mutation_p.S13P	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	36					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ATGAAGGACGAACAGCTGGAA	0.438													29	32	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220825393	220825393	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220825393C>T	uc001hmn.3	+	15	2234	c.1637C>T	c.(1636-1638)TCA>TTA	p.S546L	MARK1_uc009xdw.2_Missense_Mutation_p.S546L|MARK1_uc010pun.1_Missense_Mutation_p.S546L|MARK1_uc001hmm.3_Missense_Mutation_p.S524L	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	546					intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		GCTGTCCCCTCAGCACGACCC	0.517													34	66	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237875065	237875065	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237875065G>C	uc001hyl.1	+	71	10371	c.10251G>C	c.(10249-10251)CAG>CAC	p.Q3417H	RYR2_uc010pxz.1_Missense_Mutation_p.Q372H	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3417					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGAAGAGCAGAACTTCGTTG	0.328													3	26	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240990424	240990424	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240990424T>A	uc001hyv.2	-	10	988	c.658A>T	c.(658-660)ATG>TTG	p.M220L	RGS7_uc010pyh.1_Missense_Mutation_p.M194L|RGS7_uc010pyj.1_Missense_Mutation_p.M136L|RGS7_uc001hyu.2_Missense_Mutation_p.M220L|RGS7_uc009xgn.1_Missense_Mutation_p.M167L|RGS7_uc001hyw.2_Missense_Mutation_p.M220L|RGS7_uc001hyt.2_Missense_Mutation_p.M52L	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	220					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GGGTTTCTCATTCTGGATGAC	0.403													21	49	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242428713	242428713	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242428713G>A	uc001hzn.1	-	4	660	c.533C>T	c.(532-534)TCG>TTG	p.S178L	PLD5_uc001hzl.3_Missense_Mutation_p.S116L|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_Missense_Mutation_p.S86L			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	178						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AATATTTTGCGAAGTCAGCTG	0.358													19	43	---	---	---	---	PASS
ZNF124	7678	broad.mit.edu	37	1	247323048	247323048	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247323048G>A	uc001ick.2	-	2	237	c.98C>T	c.(97-99)TCC>TTC	p.S33F	ZNF124_uc001ici.2_RNA|ZNF124_uc001icj.1_Missense_Mutation_p.S33F	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124	33	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			ATTCTTCTGGGAAGGATCCAA	0.423													31	72	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247464253	247464253	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247464253G>A	uc001ico.2	-	9	1797	c.1332C>T	c.(1330-1332)TTC>TTT	p.F444F	ZNF496_uc009xgv.2_Silent_p.F480F|ZNF496_uc001icp.2_Silent_p.F444F	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	444	C2H2-type 2.				positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CGCTGTCGCTGAACAGCTCCC	0.642													40	50	---	---	---	---	PASS
OR2L1P	26247	broad.mit.edu	37	1	248154375	248154375	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248154375A>T	uc001idv.1	+	1	807	c.563A>T	c.(562-564)GAG>GTG	p.E188V	OR2L13_uc001ids.2_Intron	NR_002145				RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;												0						TCTCCGACAGAGGACAAGGTT	0.527													38	55	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1653407	1653407	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1653407G>T	uc002qxa.2	-	17	2209	c.2145C>A	c.(2143-2145)AAC>AAA	p.N715K		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	715					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TTGCGATGAGGTTCAGGTACT	0.592													37	43	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25978935	25978935	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25978935C>G	uc002rgs.2	-	9	1209	c.988G>C	c.(988-990)GAA>CAA	p.E330Q	ASXL2_uc002rgt.1_Missense_Mutation_p.E70Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	330					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGAAGAATTCATTGTTAAGG	0.448													41	93	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25994376	25994376	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25994376G>A	uc002rgs.2	-	5	658	c.437C>T	c.(436-438)TCA>TTA	p.S146L	ASXL2_uc002rgt.1_5'UTR	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	146	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGGTGGGTGATGGGCAGCC	0.443													8	28	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25994388	25994388	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25994388G>T	uc002rgs.2	-	5	646	c.425C>A	c.(424-426)TCA>TAA	p.S142*	ASXL2_uc002rgt.1_5'UTR	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	142	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGCAGCCTGACTGCGGGGA	0.453													8	30	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26684967	26684967	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26684967C>T	uc002rhk.2	-	42	5402	c.5275G>A	c.(5275-5277)GAC>AAC	p.D1759N	OTOF_uc010yla.1_Missense_Mutation_p.D489N|OTOF_uc002rhh.2_Missense_Mutation_p.D992N|OTOF_uc002rhi.2_Missense_Mutation_p.D1069N|OTOF_uc002rhj.2_Missense_Mutation_p.D992N	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1759	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACGAAGATGTCACTGGACTTC	0.617													74	100	---	---	---	---	PASS
DNAJC5G	285126	broad.mit.edu	37	2	27501157	27501157	+	Silent	SNP	G	A	A	rs145408176		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27501157G>A	uc002rjl.1	+	5	895	c.477G>A	c.(475-477)GGG>GGA	p.G159G	SLC30A3_uc010ylh.1_5'Flank|DNAJC5G_uc010yli.1_Missense_Mutation_p.G72E|DNAJC5G_uc002rjm.1_Silent_p.G159G	NM_173650	NP_775921	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	159					protein folding	membrane	heat shock protein binding|unfolded protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGATAGTGGGAGAAAATATC	0.398													3	24	---	---	---	---	PASS
FEZ2	9637	broad.mit.edu	37	2	36808439	36808439	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36808439C>T	uc002rph.2	-	4	675	c.628G>A	c.(628-630)GAA>AAA	p.E210K	FEZ2_uc002rpe.2_Missense_Mutation_p.E39K|FEZ2_uc002rpf.2_Missense_Mutation_p.E39K|FEZ2_uc002rpg.2_Missense_Mutation_p.E210K|FEZ2_uc002rpi.2_Missense_Mutation_p.E65K|FEZ2_uc002rpj.2_Missense_Mutation_p.E210K	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1	210					axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				TTACTCTCTTCATAACTGCCG	0.408													90	158	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43458382	43458382	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43458382G>C	uc002rsw.3	-	38	5919	c.5567C>G	c.(5566-5568)TCA>TGA	p.S1856*	THADA_uc010far.2_Nonsense_Mutation_p.S1051*|THADA_uc002rsx.3_Nonsense_Mutation_p.S1856*|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1856							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GCCGGACTTTGAGAGGAGACA	0.512													11	16	---	---	---	---	PASS
GKN2	200504	broad.mit.edu	37	2	69173329	69173329	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69173329G>A	uc002sfa.2	-						GKN2_uc002sfb.3_3'UTR	NM_182536	NP_872342	Q86XP6	GKN2_HUMAN	trefoil factor interactions(z) 1 precursor							extracellular region					0						AAACTgaactgagtactgttc	0.080													21	20	---	---	---	---	PASS
WBP1	23559	broad.mit.edu	37	2	74686773	74686773	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74686773C>T	uc002slj.1	+	2	226	c.73C>T	c.(73-75)CGA>TGA	p.R25*	WBP1_uc002slh.1_RNA|INO80B_uc002sli.1_RNA|WBP1_uc002slk.1_Intron|WBP1_uc002sll.1_RNA	NM_012477	NP_036609	Q96G27	WBP1_HUMAN	WW domain binding protein 1	25							WW domain binding				0						CCCGCAGCTTCGAGAGCTGTG	0.592													26	63	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529770	80529770	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529770G>A	uc002sok.1	-	2	1445	c.1175C>T	c.(1174-1176)ACC>ATC	p.T392I	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	392	Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						CGCGAGCGTGGTGGCCGAGCT	0.721										HNSCC(69;0.2)			8	31	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80646667	80646667	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80646667G>A	uc010ysh.1	+	8	1236	c.1231G>A	c.(1231-1233)GAA>AAA	p.E411K	CTNNA2_uc010yse.1_Missense_Mutation_p.E411K|CTNNA2_uc010ysf.1_Missense_Mutation_p.E411K|CTNNA2_uc010ysg.1_Missense_Mutation_p.E411K|CTNNA2_uc010ysi.1_Missense_Mutation_p.E43K	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	411					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GAGCGGAAATGAAAAGGAAGT	0.458													4	83	---	---	---	---	PASS
GNLY	10578	broad.mit.edu	37	2	85921520	85921520	+	5'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85921520G>A	uc002sql.3	+	1					GNLY_uc010fgp.2_5'UTR|GNLY_uc010ysx.1_5'UTR	NM_006433	NP_006424	P22749	GNLY_HUMAN	granulysin isoform NKG5						cellular defense response|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0						GGTGTGAAAGGCATCTCAGCG	0.587													21	41	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98846623	98846623	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98846623G>C	uc002syo.2	+	16	2525	c.2261G>C	c.(2260-2262)TGG>TCG	p.W754S	VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.W273S|VWA3B_uc002sym.2_Missense_Mutation_p.W754S|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.W411S|VWA3B_uc002syp.1_Missense_Mutation_p.W146S|VWA3B_uc002syq.1_Missense_Mutation_p.W30S|VWA3B_uc002syr.1_Missense_Mutation_p.W71S	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	754										ovary(3)|large_intestine(2)|skin(1)	6						AAGGGACCATGGGGCCTTTCA	0.413													23	36	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100210124	100210124	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100210124C>G	uc002tag.2	-	14	2235	c.1999G>C	c.(1999-2001)GAG>CAG	p.E667Q	AFF3_uc002taf.2_Missense_Mutation_p.E692Q|AFF3_uc010fiq.1_Missense_Mutation_p.E667Q|AFF3_uc010yvr.1_Missense_Mutation_p.E820Q|AFF3_uc002tah.1_Missense_Mutation_p.E692Q	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	667					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						GACTCTGTCTCAATGAACTCC	0.622													47	94	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101580599	101580599	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101580599C>T	uc002tap.1	+	8	964	c.678C>T	c.(676-678)TTC>TTT	p.F226F	NPAS2_uc010yvt.1_Silent_p.F291F	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	226					central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						AGGTTTGCTTCATTGCCACCG	0.493													33	49	---	---	---	---	PASS
POLR2D	5433	broad.mit.edu	37	2	128605685	128605685	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128605685T>C	uc002tpj.2	-	4	480	c.425A>G	c.(424-426)TAT>TGT	p.Y142C	uc010fmc.2_5'Flank|POLR2D_uc002tpk.2_Missense_Mutation_p.Y110C	NM_004805	NP_004796	O15514	RPB4_HUMAN	DNA directed RNA polymerase II polypeptide D	142					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA-directed RNA polymerase activity|nucleotide binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0675)		TGGAGATTAATACTGAAAGCT	0.458													14	31	---	---	---	---	PASS
RAB6C	84084	broad.mit.edu	37	2	130737623	130737623	+	5'UTR	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130737623C>G	uc002tpx.1	+	1					uc002tpw.1_RNA	NM_032144	NP_115520	Q9H0N0	RAB6C_HUMAN	RAB6C, member RAS oncogene family						protein transport|response to drug|small GTPase mediated signal transduction		GTP binding|GTPase activity			lung(1)	1	Colorectal(110;0.1)					TTTCGTCAGCCGGCTGGAGGA	0.706													7	37	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136570082	136570082	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136570082G>A	uc002tuu.1	-	7	2163	c.2152C>T	c.(2152-2154)CCC>TCC	p.P718S		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	718	Extracellular (Potential).|4 X approximate repeats.|2.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GAGGTCTGGGGCCACACATGG	0.517													22	41	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848324	166848324	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848324G>C	uc010zcz.1	-	26	5446	c.5428C>G	c.(5428-5430)CAG>GAG	p.Q1810E		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1821	IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TCCATGAACTGAGTTGCATCG	0.443													34	97	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179400360	179400360	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179400360C>G	uc010zfg.1	-	307	93502	c.93278G>C	c.(93277-93279)AGA>ACA	p.R31093T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R24788T|TTN_uc010zfi.1_Missense_Mutation_p.R24721T|TTN_uc010zfj.1_Missense_Mutation_p.R24596T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32020							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCATCTTTTCTCTCTACCCC	0.433													48	95	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179584463	179584463	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179584463G>C	uc010zfg.1	-	79	20248	c.20024C>G	c.(20023-20025)TCA>TGA	p.S6675*	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.S3336*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7602							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACTTGGCTGAGAGTTCTGG	0.433													29	45	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198498722	198498722	+	Splice_Site	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198498722C>G	uc002uuo.3	-	4	841	c.439_splice	c.e4-1	p.I147_splice		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						CGACATTAATCTGATATTTAA	0.318													16	39	---	---	---	---	PASS
ALS2CR8	79800	broad.mit.edu	37	2	203806617	203806617	+	5'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203806617G>A	uc002uzo.2	+	3					ALS2CR8_uc002uzn.2_Intron|ALS2CR8_uc002uzm.2_5'UTR|ALS2CR8_uc010zhy.1_5'UTR|ALS2CR8_uc010zhz.1_Intron|ALS2CR8_uc010ftu.1_Intron|ALS2CR8_uc010zia.1_5'UTR|ALS2CR8_uc010zib.1_5'UTR|ALS2CR8_uc010zic.1_Intron|ALS2CR8_uc002uzp.2_5'UTR	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)	2						AATTGAATATGATGTCAGCAT	0.318													18	41	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207175392	207175392	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207175392G>A	uc002vbp.2	+	5	6390	c.6140G>A	c.(6139-6141)CGG>CAG	p.R2047Q		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2047							nucleic acid binding|zinc ion binding			ovary(3)	3						AAATATAAACGGAATATCTTT	0.358													9	19	---	---	---	---	PASS
PLCD4	84812	broad.mit.edu	37	2	219483480	219483480	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219483480G>T	uc002vij.1	+	4	555	c.360G>T	c.(358-360)CAG>CAT	p.Q120H	PLCD4_uc010zkj.1_Missense_Mutation_p.Q67H|PLCD4_uc002vik.1_5'Flank|PLCD4_uc010zkk.1_5'Flank	NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	120	PH.				intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GAGGGCTCCAGCTGTTGGTGG	0.602													4	15	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220161229	220161229	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220161229C>A	uc002vkz.2	-	17	2409	c.2320G>T	c.(2320-2322)GAC>TAC	p.D774Y	PTPRN_uc010zlc.1_Missense_Mutation_p.D684Y|PTPRN_uc002vla.2_Missense_Mutation_p.D745Y|uc010zld.1_5'Flank|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	774	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		ATCCGAGGGTCATGCTCAATC	0.592													17	39	---	---	---	---	PASS
WDFY1	57590	broad.mit.edu	37	2	224743338	224743338	+	3'UTR	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224743338C>T	uc002vnq.2	-	12						NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1							cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		AGAGGGACTTCATTTGGTGGA	0.498													3	5	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225670030	225670030	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225670030C>G	uc010fwz.1	-	36	4183	c.3944G>C	c.(3943-3945)AGA>ACA	p.R1315T	DOCK10_uc002vob.2_Missense_Mutation_p.R1309T|DOCK10_uc002voa.2_5'UTR|DOCK10_uc002voc.2_Missense_Mutation_p.R169T	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1315							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGACAAGGGTCTTGGGATCTG	0.418													40	52	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228881535	228881535	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228881535C>G	uc002vpq.2	-	7	4082	c.4035G>C	c.(4033-4035)GAG>GAC	p.E1345D	SPHKAP_uc002vpp.2_Missense_Mutation_p.E1345D|SPHKAP_uc010zlx.1_Missense_Mutation_p.E1345D	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1345						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTGCACACTTCTCTGCTTGCG	0.512													20	50	---	---	---	---	PASS
GPR55	9290	broad.mit.edu	37	2	231775157	231775157	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231775157T>A	uc002vrg.2	-	2	714	c.521A>T	c.(520-522)GAT>GTT	p.D174V	GPR55_uc002vrf.2_RNA|GPR55_uc010fxs.1_Missense_Mutation_p.D174V	NM_005683	NP_005674	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	174	Extracellular (Potential).				activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		CCAGGTATCATCAGACATGTT	0.532													49	58	---	---	---	---	PASS
KCNJ13	3769	broad.mit.edu	37	2	233635859	233635859	+	Missense_Mutation	SNP	C	A	A	rs77818131		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233635859C>A	uc002vto.2	-	1	257	c.214G>T	c.(214-216)GCA>TCA	p.A72S	GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vti.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron|KCNJ13_uc002vtn.2_Missense_Mutation_p.A72S|KCNJ13_uc002vtp.2_Missense_Mutation_p.A72S	NM_002242	NP_002233	O60928	IRK13_HUMAN	potassium inwardly-rectifying channel J13	72	Helical; Name=M1; (By similarity).					voltage-gated potassium channel complex	inward rectifier potassium channel activity				0		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		CAGAGCACTGCAAAGACAAGC	0.463													3	40	---	---	---	---	PASS
HJURP	55355	broad.mit.edu	37	2	234749700	234749700	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234749700G>A	uc002vvg.2	-	8	1792	c.1726C>T	c.(1726-1728)CGT>TGT	p.R576C	HJURP_uc010znd.1_Missense_Mutation_p.R515C|HJURP_uc010zne.1_Missense_Mutation_p.R484C	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	576					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TCATCGTAACGATTCCTTCCG	0.413													32	59	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238277457	238277457	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277457C>T	uc002vwl.2	-	10	4934	c.4649G>A	c.(4648-4650)GGA>GAA	p.G1550E	COL6A3_uc002vwo.2_Missense_Mutation_p.G1344E|COL6A3_uc010znj.1_Missense_Mutation_p.G943E	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1550	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTGGGATTTTCCACCCAGGAC	0.562													30	86	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	240036766	240036766	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240036766C>G	uc002vyk.3	-	13	2551	c.1759G>C	c.(1759-1761)GAG>CAG	p.E587Q	HDAC4_uc010fyz.1_Missense_Mutation_p.E582Q|HDAC4_uc010zoa.1_Missense_Mutation_p.E587Q|HDAC4_uc010fza.2_Missense_Mutation_p.E592Q|HDAC4_uc010fyy.2_Missense_Mutation_p.E544Q|HDAC4_uc010znz.1_Missense_Mutation_p.E470Q	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	587					B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AAGAGCAGCTCCTGCTCACTG	0.677													24	30	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242066101	242066101	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242066101G>C	uc002wao.1	-	10	2321	c.2229C>G	c.(2227-2229)CTC>CTG	p.L743L	PASK_uc010zol.1_Silent_p.L557L|PASK_uc010zom.1_Silent_p.L708L|PASK_uc010fzl.1_Silent_p.L743L|PASK_uc010zon.1_Silent_p.L524L|PASK_uc002wap.2_Silent_p.L286L|PASK_uc002waq.2_Silent_p.L743L	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	743					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AGAGTTCCTTGAGGTTCCAGG	0.547													27	41	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242066280	242066280	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242066280G>A	uc002wao.1	-	10	2142	c.2050C>T	c.(2050-2052)CCG>TCG	p.P684S	PASK_uc010zol.1_Missense_Mutation_p.P498S|PASK_uc010zom.1_Missense_Mutation_p.P649S|PASK_uc010fzl.1_Missense_Mutation_p.P684S|PASK_uc010zon.1_Missense_Mutation_p.P465S|PASK_uc002wap.2_Missense_Mutation_p.P227S|PASK_uc002waq.2_Missense_Mutation_p.P684S	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	684					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CACTCTGTCGGAACGAGTTCG	0.622													64	82	---	---	---	---	PASS
HDLBP	3069	broad.mit.edu	37	2	242192385	242192385	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242192385C>G	uc002waz.2	-	11	1587	c.1359G>C	c.(1357-1359)AAG>AAC	p.K453N	HDLBP_uc002wba.2_Missense_Mutation_p.K453N|HDLBP_uc002wbb.2_Missense_Mutation_p.K405N	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	453	KH 5.				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TGGCACCGCTCTTCCCAATGA	0.582													13	74	---	---	---	---	PASS
ZFYVE20	64145	broad.mit.edu	37	3	15124021	15124021	+	Silent	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15124021G>T	uc003bzm.1	-	9	1307	c.693C>A	c.(691-693)ATC>ATA	p.I231I	ZFYVE20_uc010hek.1_Silent_p.I231I|ZFYVE20_uc011avn.1_Intron	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN	FYVE-finger-containing Rab5 effector protein	231	FYVE-type.|Ser-rich.|Necessary for the correct targeting to endosomes.				blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2						TCATGCTGCTGATGCTGCCTC	0.602													20	20	---	---	---	---	PASS
OSBPL10	114884	broad.mit.edu	37	3	31710301	31710301	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31710301C>T	uc003cev.2	-	11	2310	c.1929G>A	c.(1927-1929)GTG>GTA	p.V643V	OSBPL10_uc003ceu.1_Silent_p.V400V|OSBPL10_uc011axf.1_Silent_p.V579V	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	643					lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		GGTTGTGCTTCACTTCTGCGG	0.393													44	36	---	---	---	---	PASS
ZNF167	55888	broad.mit.edu	37	3	44612209	44612209	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44612209G>C	uc010hin.2	+	6	1995	c.1607G>C	c.(1606-1608)AGA>ACA	p.R536T	ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Intron|ZNF167_uc003cnj.2_Missense_Mutation_p.R536T|ZNF167_uc003cnk.2_Intron	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1	536	C2H2-type 6.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		TGTTCCAATAGAAATCTCATT	0.438													39	27	---	---	---	---	PASS
PTH1R	5745	broad.mit.edu	37	3	46939420	46939420	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46939420C>T	uc003cqm.2	+	6	592	c.389C>T	c.(388-390)CCC>CTC	p.P130L	PTH1R_uc003cqn.2_Missense_Mutation_p.P130L	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor	130	Extracellular (Potential).					cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						GTGGCTGTGCCCTGTCCGGAC	0.607									Ollier_disease_/_Maffuci_syndrome				20	15	---	---	---	---	PASS
KIF9	64147	broad.mit.edu	37	3	47281297	47281297	+	Intron	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47281297G>C	uc010hjp.2	-						KIF9_uc003cqx.2_Intron|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|uc003cqw.1_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2						blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TGATGCATCTGACTTGCAGGA	0.368													9	11	---	---	---	---	PASS
KIF9	64147	broad.mit.edu	37	3	47281434	47281434	+	Intron	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47281434G>C	uc010hjp.2	-						KIF9_uc003cqx.2_Intron|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|uc003cqw.1_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2						blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		ACTGAGCCAGGAGTGTGAAGA	0.289													5	9	---	---	---	---	PASS
P4HTM	54681	broad.mit.edu	37	3	49043565	49043565	+	Silent	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49043565C>G	uc003cvg.2	+	8	1582	c.1233C>G	c.(1231-1233)GTC>GTG	p.V411V	P4HTM_uc003cvh.2_Silent_p.V472V|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	411	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	ACCTGCGTGTCAAGCCCCAAC	0.612													32	36	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49161498	49161498	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49161498G>A	uc003cwe.2	-	24	3759	c.3460C>T	c.(3460-3462)CAG>TAG	p.Q1154*		NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1154	Laminin EGF-like 13.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGGTGACACTGAGGTGTATCT	0.562													13	11	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52526262	52526262	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52526262C>T	uc011beg.1	+	22	4351	c.4279C>T	c.(4279-4281)CCG>TCG	p.P1427S	NISCH_uc003ded.3_Missense_Mutation_p.P1427S|NISCH_uc003dee.3_Missense_Mutation_p.P916S|NISCH_uc003deg.1_Intron|NISCH_uc003deh.3_Missense_Mutation_p.P176S	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1427					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCAGACCTACCCGCAGGCCCT	0.652													67	65	---	---	---	---	PASS
SLMAP	7871	broad.mit.edu	37	3	57827095	57827095	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57827095C>G	uc003dje.1	+	3	621	c.416C>G	c.(415-417)TCA>TGA	p.S139*	SLMAP_uc003djc.1_Nonsense_Mutation_p.S139*|SLMAP_uc003djd.1_Nonsense_Mutation_p.S139*|SLMAP_uc003djf.1_Nonsense_Mutation_p.S139*	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	139	Necessary for targeting to centrosomes (By similarity).|Cytoplasmic (Potential).				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		CGGCTCCGCTCAGAGTGAGTA	0.358													6	35	---	---	---	---	PASS
ZDHHC23	254887	broad.mit.edu	37	3	113673211	113673211	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113673211C>A	uc003eau.2	+	3	1125	c.826C>A	c.(826-828)CGG>AGG	p.R276R	ZDHHC23_uc003eav.2_Silent_p.R270R	NM_173570	NP_775841	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC domain containing 23	276	DHHC-type.					integral to membrane	acyltransferase activity|zinc ion binding			ovary(2)	2						ATGGCACTGCCGGATATGTGG	0.517													9	22	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121354589	121354589	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121354589T>C	uc003eeh.3	-	9	809	c.684A>G	c.(682-684)ATA>ATG	p.I228M	HCLS1_uc011bjj.1_Missense_Mutation_p.I191M|HCLS1_uc011bjk.1_RNA	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	228					erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		CACCGGCTTCTATGGGCGTCG	0.522													46	49	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122247537	122247537	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122247537C>T	uc010hri.2	-	11	2384	c.2239G>A	c.(2239-2241)GAG>AAG	p.E747K	PARP9_uc003eff.3_Missense_Mutation_p.E712K|PARP9_uc011bjs.1_Missense_Mutation_p.E712K|PARP9_uc003efg.2_Missense_Mutation_p.E292K|PARP9_uc003efi.2_Missense_Mutation_p.E712K|PARP9_uc003efh.2_Missense_Mutation_p.E747K	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	747	PARP catalytic.				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		TTGGCCTTCTCTGCCAGGTTT	0.373													42	68	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124738228	124738228	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124738228G>C	uc003ehs.3	-	5	1534	c.1466C>G	c.(1465-1467)TCA>TGA	p.S489*	HEG1_uc011bke.1_Nonsense_Mutation_p.S489*	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	489	Extracellular (Potential).|Ser-rich.					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						AGTAGAGTCTGAGAACTGGGT	0.463													39	164	---	---	---	---	PASS
CCDC48	79825	broad.mit.edu	37	3	128753034	128753034	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128753034C>T	uc011bkt.1	+	5	1311	c.1311C>T	c.(1309-1311)CTC>CTT	p.L437L		NM_024768	NP_079044	Q9HA90	CCD48_HUMAN	coiled-coil domain containing 48	437											0						CGGAGAAGCTCATGACTTACT	0.622													23	56	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128982840	128982840	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128982840G>C	uc003els.2	+	13	1322	c.1222G>C	c.(1222-1224)GAG>CAG	p.E408Q	COPG_uc010htb.2_Missense_Mutation_p.E314Q	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	408					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						GCTGCGGGAAGAGGTAAGAGT	0.547													10	18	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129023617	129023617	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129023617G>A	uc003elt.2	+	7	1102	c.1014G>A	c.(1012-1014)CTG>CTA	p.L338L	C3orf37_uc003elu.2_Silent_p.L296L|C3orf37_uc003elv.2_Silent_p.L338L|C3orf37_uc003elw.2_Silent_p.L338L	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	338										ovary(1)	1						AGCAATGGCTGAAGCGGGAGA	0.562													19	18	---	---	---	---	PASS
RPL32P3	132241	broad.mit.edu	37	3	129116292	129116292	+	Intron	SNP	A	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129116292A>C	uc003ema.2	-						RPL32P3_uc003emb.2_Intron|RPL32P3_uc003emd.1_Intron|SNORA7B_uc003eme.1_RNA|SNORA7B_uc003emf.2_5'Flank	NR_003111				Homo sapiens cDNA FLJ36158 fis, clone TESTI2025757, weakly similar to Human mRNA for ribosomal protein L32.												0						AGCAAATCCCACCCTGCCAGT	0.383													12	36	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130688229	130688229	+	Silent	SNP	C	A	A	rs137853013		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130688229C>A	uc003enl.2	+	17	1624	c.1402C>A	c.(1402-1404)CGA>AGA	p.R468R	ATP2C1_uc011blg.1_Silent_p.R502R|ATP2C1_uc011blh.1_Silent_p.R463R|ATP2C1_uc011bli.1_Silent_p.R502R|ATP2C1_uc003enk.2_Silent_p.R452R|ATP2C1_uc003enm.2_Silent_p.R468R|ATP2C1_uc003enn.2_Silent_p.R452R|ATP2C1_uc003eno.2_Silent_p.R468R|ATP2C1_uc003enp.2_Silent_p.R468R|ATP2C1_uc003enq.2_Silent_p.R468R|ATP2C1_uc003enr.2_Silent_p.R468R|ATP2C1_uc003ens.2_Silent_p.R468R|ATP2C1_uc003ent.2_Silent_p.R468R|ATP2C1_uc003enu.2_Silent_p.R146R	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	468	Cytoplasmic (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	GTGTGTACACCGAACACAGCA	0.378									Hailey-Hailey_disease				3	54	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135721655	135721655	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135721655C>T	uc003eqv.1	+	2	1880	c.1315C>T	c.(1315-1317)CAT>TAT	p.H439Y	PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	439					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						TGGACCTAGTCATGAGTTATT	0.348													36	63	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184009861	184009861	+	Silent	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184009861G>T	uc003fni.3	+	19	2525	c.2487G>T	c.(2485-2487)TCG>TCT	p.S829S	ECE2_uc003fnl.3_Silent_p.S757S|ECE2_uc003fnm.3_Silent_p.S711S|ECE2_uc003fnk.3_Silent_p.S682S	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	829	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTGGTGCTCGGTCCGCACAC	0.652													3	64	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184289145	184289145	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184289145C>A	uc003foz.2	+	2	595	c.158C>A	c.(157-159)GCG>GAG	p.A53E		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	53	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TCTGAGTTGGCGTGGACATCT	0.522													3	46	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197408132	197408132	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197408132C>T	uc003fyc.2	-	16	2481	c.2298G>A	c.(2296-2298)TGG>TGA	p.W766*	KIAA0226_uc003fyd.3_Nonsense_Mutation_p.W721*|KIAA0226_uc003fye.1_Nonsense_Mutation_p.W498*	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	766					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TGCTGAAGTCCCACTTGCGCA	0.537													5	134	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1806119	1806119	+	Missense_Mutation	SNP	G	A	A	rs28931614		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1806119G>A	uc003gdr.3	+	9	1394	c.1138G>A	c.(1138-1140)GGG>AGG	p.G380R	FGFR3_uc003gdu.2_Missense_Mutation_p.G382R|FGFR3_uc003gds.3_Intron|FGFR3_uc003gdq.3_Missense_Mutation_p.G380R	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	380	Helical; (Potential).				bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.G380R(15)|p.G380E(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CCTCAGCTACGGGGTGGGCTT	0.672		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				156	222	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1957529	1957529	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1957529G>A	uc003gdz.3	+	14	2804	c.2628G>A	c.(2626-2628)AAG>AAA	p.K876K	WHSC1_uc003geb.3_Silent_p.K876K|WHSC1_uc003gec.3_Silent_p.K876K|WHSC1_uc003ged.3_Silent_p.K876K|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Silent_p.K95K|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_Silent_p.K224K	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	876					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GGGCTGGGAAGAAGCTGCACT	0.507			T	IGH@	MM								17	34	---	---	---	---	PASS
ZBTB49	166793	broad.mit.edu	37	4	4317400	4317400	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4317400A>T	uc003ghu.2	+	6	1589	c.1414A>T	c.(1414-1416)ATT>TTT	p.I472F	ZBTB49_uc003ghv.2_5'UTR|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Intron	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509	472	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						TCACATTATTATTCACTCAGG	0.393													21	29	---	---	---	---	PASS
BST1	683	broad.mit.edu	37	4	15716979	15716979	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15716979C>G	uc003goh.3	+	5	801	c.606C>G	c.(604-606)ATC>ATG	p.I202M	BST1_uc003goi.2_Missense_Mutation_p.I13M	NM_004334	NP_004325	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1 precursor	202					humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity			central_nervous_system(1)	1						CCTATCCCATCAAAGGGTAAG	0.388													10	22	---	---	---	---	PASS
STIM2	57620	broad.mit.edu	37	4	26959236	26959236	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26959236C>T	uc003gsh.3	+	3	762	c.546C>T	c.(544-546)TTC>TTT	p.F182F	STIM2_uc003gsg.3_Silent_p.F182F|STIM2_uc010iex.2_Silent_p.F182F	NM_020860	NP_065911	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	95	EF-hand.|Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)				TTCTATAGTTCATCAGAGAAG	0.308													18	70	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47322172	47322172	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47322172G>C	uc003gxh.2	+	5	864	c.490G>C	c.(490-492)GAT>CAT	p.D164H	GABRB1_uc011bze.1_Missense_Mutation_p.D94H	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	164	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATGTATGATGGATCTTCGAAG	0.423													15	43	---	---	---	---	PASS
C4orf14	84273	broad.mit.edu	37	4	57829697	57829697	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57829697C>G	uc003hck.2	-	7	2091	c.2016G>C	c.(2014-2016)AAG>AAC	p.K672N		NM_032313	NP_115689	Q8NC60	CD014_HUMAN	hypothetical protein LOC84273	672							GTP binding			ovary(1)|breast(1)	2	Glioma(25;0.08)|all_neural(26;0.181)					CCACACTTTTCTTGATGCGCT	0.458													68	121	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66230766	66230766	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66230766G>A	uc003hcy.2	-	12	2398	c.2205C>T	c.(2203-2205)AAC>AAT	p.N735N	EPHA5_uc003hcx.2_Silent_p.N667N|EPHA5_uc003hcz.2_Silent_p.N713N|EPHA5_uc011cah.1_Silent_p.N736N|EPHA5_uc011cai.1_Silent_p.N714N|EPHA5_uc003hda.2_Silent_p.N736N	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	735	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						AATGGATGATGTTAGGATGAT	0.363										TSP Lung(17;0.13)			49	69	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68930646	68930646	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68930646G>C	uc003hdt.1	-	8	821	c.772C>G	c.(772-774)CAA>GAA	p.Q258E	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron|SYT14L_uc010ihn.2_5'Flank	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	258	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GCAATCCATTGAGTTGGGTCT	0.338													17	28	---	---	---	---	PASS
C4orf17	84103	broad.mit.edu	37	4	100463168	100463168	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100463168C>G	uc003huw.2	+	9	1305	c.982C>G	c.(982-984)CAG>GAG	p.Q328E	C4orf17_uc003hux.2_RNA	NM_032149	NP_115525	Q53FE4	CD017_HUMAN	hypothetical protein LOC84103	328											0				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		GCCTAACACTCAGGAGAGTGG	0.433													14	50	---	---	---	---	PASS
SLC39A8	64116	broad.mit.edu	37	4	103228665	103228665	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103228665C>A	uc003hwb.1	-	3	1009	c.480G>T	c.(478-480)AAG>AAT	p.K160N	SLC39A8_uc011ceo.1_Missense_Mutation_p.K160N|SLC39A8_uc003hwa.1_Missense_Mutation_p.K93N|SLC39A8_uc003hwc.2_Missense_Mutation_p.K160N	NM_022154	NP_071437	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter),	160	Extracellular (Potential).					integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AGGTCAAAATCTTTGGGAAAT	0.388													72	125	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123192861	123192861	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123192861G>A	uc003ieh.2	+	45	8227	c.8182G>A	c.(8182-8184)GAA>AAA	p.E2728K	KIAA1109_uc003iel.1_Missense_Mutation_p.E663K|KIAA1109_uc003iek.2_Missense_Mutation_p.E1347K	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2728					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AAAGTCTTCAGAAACATTTGG	0.338													11	36	---	---	---	---	PASS
NR3C2	4306	broad.mit.edu	37	4	149357276	149357276	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149357276G>C	uc003ilj.3	-	2	1071	c.737C>G	c.(736-738)TCC>TGC	p.S246C	NR3C2_uc003ilk.3_Missense_Mutation_p.S246C|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	246	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	GTGCGACCTGGAGCCTCGATT	0.537													24	45	---	---	---	---	PASS
FAM198B	51313	broad.mit.edu	37	4	159092463	159092463	+	Missense_Mutation	SNP	C	G	G	rs148186776		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159092463C>G	uc003ipp.3	-	2	517	c.65G>C	c.(64-66)CGG>CCG	p.R22P	uc003ipu.1_5'Flank|FAM198B_uc003ipq.3_Missense_Mutation_p.R22P|FAM198B_uc003ipr.3_Missense_Mutation_p.R22P|FAM198B_uc003ips.2_Missense_Mutation_p.R22P|uc003ipt.1_RNA	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 2	22	Cytoplasmic (Potential).					Golgi membrane|integral to membrane					0						CTTACGCACCCGCGGGACGCA	0.587													14	54	---	---	---	---	PASS
C4orf46	201725	broad.mit.edu	37	4	159590752	159590752	+	3'UTR	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159590752G>C	uc003iqa.2	-	2					C4orf46_uc010iqp.1_RNA|ETFDH_uc010iqq.2_5'Flank|ETFDH_uc003iqb.2_5'Flank|ETFDH_uc011cjg.1_5'Flank|ETFDH_uc010iqr.2_5'Flank	NM_001008393	NP_001008394	Q504U0	CD046_HUMAN	hypothetical protein LOC201725											skin(1)	1						ATTAAACAACGAAGTATGCCA	0.368													19	59	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160273906	160273906	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160273906G>A	uc003iqg.3	+	21	3762	c.3452G>A	c.(3451-3453)CGA>CAA	p.R1151Q		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	1151	Ser-rich.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ATTTCTTCACGATCCAGTATT	0.433													24	50	---	---	---	---	PASS
HELT	391723	broad.mit.edu	37	4	185941474	185941474	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185941474G>C	uc011ckq.1	+	4	532	c.532G>C	c.(532-534)GAG>CAG	p.E178Q	HELT_uc011cko.1_Missense_Mutation_p.E93Q|HELT_uc003ixa.3_Missense_Mutation_p.E92Q|HELT_uc011ckp.1_Missense_Mutation_p.E36Q	NM_001029887	NP_001025058	A6NFD8	HELT_HUMAN	HES/HEY-like transcription factor	178	Orange.						DNA binding				0		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TGGCTACCACGAGTGCATGAA	0.577													26	69	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189026057	189026057	+	Silent	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189026057C>G	uc003izl.2	-	2	105	c.69G>C	c.(67-69)TCG>TCC	p.S23S	TRIML2_uc011cle.1_Silent_p.S73S|TRIML2_uc011clf.1_Silent_p.S73S	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	23	Potential.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GTTTCTCCCTCGATGTGTTCA	0.403													27	88	---	---	---	---	PASS
MARCH11	441061	broad.mit.edu	37	5	16067555	16067555	+	3'UTR	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16067555C>T	uc003jfo.2	-	4					MARCH11_uc010itw.1_3'UTR	NM_001102562	NP_001096032	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0						CAGGGTGGTCCACACTGCATC	0.398													7	146	---	---	---	---	PASS
AMACR	23600	broad.mit.edu	37	5	34008107	34008107	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34008107G>C	uc003jig.2	-	1	100	c.18C>G	c.(16-18)ATC>ATG	p.I6M	AMACR_uc003jih.2_Missense_Mutation_p.I6M|AMACR_uc003jii.2_Missense_Mutation_p.I6M|AMACR_uc003jij.2_Missense_Mutation_p.I6M|AMACR_uc003jil.1_Missense_Mutation_p.I6M|AMACR_uc003jik.1_Missense_Mutation_p.I6M	NM_014324	NP_055139	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase isoform 1	6					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	mitochondrion|peroxisomal matrix	alpha-methylacyl-CoA racemase activity				0						CCACGACCGAGATGCCCTGCA	0.672													3	12	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37605251	37605251	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37605251C>T	uc003jkv.2	+	10	1061	c.1003C>T	c.(1003-1005)CCC>TCC	p.P335S	WDR70_uc010iva.1_Missense_Mutation_p.P335S	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	335	WD 4.									ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAAGTCATTCCCACTACGTG	0.423													8	77	---	---	---	---	PASS
FBXO4	26272	broad.mit.edu	37	5	41929935	41929935	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41929935G>A	uc003jmq.2	+	3	618	c.562G>A	c.(562-564)GAA>AAA	p.E188K	FBXO4_uc003jmp.2_Missense_Mutation_p.E188K|FBXO4_uc003jmr.2_Missense_Mutation_p.E188K	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1	188				E -> Q (in Ref. 1; AAF04468).	positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				AGGTTTGGAAGAATTGAATAC	0.418													78	110	---	---	---	---	PASS
HMGCS1	3157	broad.mit.edu	37	5	43295898	43295898	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43295898C>T	uc003jnr.3	-	6	1068	c.861G>A	c.(859-861)CAG>CAA	p.Q287Q	HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Silent_p.Q287Q	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1	287					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						TATCTCTATTCTGGTCATTAA	0.358													59	72	---	---	---	---	PASS
NAIP	4671	broad.mit.edu	37	5	70308614	70308614	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70308614C>T	uc003kar.1	-	4	847	c.129G>A	c.(127-129)CAG>CAA	p.Q43Q	NAIP_uc003kat.1_Intron|NAIP_uc011crs.1_Silent_p.Q43Q|NAIP_uc003kas.1_Intron	NM_004536	NP_004527	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein isoform	43					anti-apoptosis|apoptosis|nervous system development	basolateral plasma membrane|cytoplasm	caspase inhibitor activity|metal ion binding|nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		CTCGCTCCTTCTGCTCCTCTT	0.463													55	115	---	---	---	---	PASS
ANKRD34B	340120	broad.mit.edu	37	5	79855427	79855427	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79855427G>A	uc010jam.2	-	4	762	c.412C>T	c.(412-414)CTT>TTT	p.L138F	ANKRD34B_uc003kgw.2_Missense_Mutation_p.L138F|ANKRD34B_uc010jan.2_Missense_Mutation_p.L138F	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	138	ANK 4.					cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CAAGCACTAAGAAGAACTTTC	0.428													16	174	---	---	---	---	PASS
FAM174A	345757	broad.mit.edu	37	5	99897787	99897787	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99897787G>C	uc003knj.1	+	2	584	c.464G>C	c.(463-465)AGA>ACA	p.R155T		NM_198507	NP_940909	Q8TBP5	F174A_HUMAN	family with sequence similarity 174, member A	155	Cytoplasmic (Potential).					integral to membrane					0						AAGACTAGGAGATATGGAGTT	0.269													12	33	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120021694	120021694	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120021694G>A	uc003ksq.2	+	2	368	c.205G>A	c.(205-207)GAT>AAT	p.D69N	PRR16_uc003ksp.2_Missense_Mutation_p.D46N|PRR16_uc003ksr.2_5'UTR	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	69	Potential.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		ACAGCTGGAGGATGAGATGAC	0.473													10	46	---	---	---	---	PASS
SLC22A4	6583	broad.mit.edu	37	5	131679478	131679478	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131679478G>C	uc003kwq.2	+	10	1771	c.1606G>C	c.(1606-1608)GAC>CAC	p.D536H	uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	536	Cytoplasmic (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AAAAACAAGAGACTCAATGGA	0.338													9	41	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137506551	137506551	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137506551C>G	uc003lcf.1	-	6	465	c.410G>C	c.(409-411)AGA>ACA	p.R137T	BRD8_uc003lcc.1_RNA|BRD8_uc003lcg.2_Missense_Mutation_p.R137T|BRD8_uc003lci.2_Missense_Mutation_p.R137T|BRD8_uc003lch.2_5'UTR|BRD8_uc011cym.1_Missense_Mutation_p.R121T|BRD8_uc010jer.1_Missense_Mutation_p.R106T|BRD8_uc011cyn.1_Missense_Mutation_p.R96T|BRD8_uc010jes.1_Missense_Mutation_p.R4T	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	137	Potential.				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTCATCCAGTCTGCTGTCCAT	0.403													55	22	---	---	---	---	PASS
APBB3	10307	broad.mit.edu	37	5	139941409	139941409	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139941409G>A	uc003lgd.1	-						APBB3_uc003lgb.1_5'UTR|APBB3_uc003lgc.1_5'UTR|APBB3_uc003lge.1_Intron|APBB3_uc003lgf.1_Intron|APBB3_uc010jfp.1_Intron|APBB3_uc011czi.1_5'UTR|APBB3_uc010jfq.1_5'Flank	NM_133172	NP_573418	O95704	APBB3_HUMAN	amyloid beta precursor protein-binding, family							actin cytoskeleton|cytoplasm				ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGGCTCAGGATACCTGGTT	0.572													15	28	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140256020	140256020	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140256020C>T	uc003lic.2	+	1	1090	c.963C>T	c.(961-963)AAC>AAT	p.N321N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.N321N	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	321	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAGGTTAACGCCATTGATA	0.398													4	91	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476448	140476448	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476448C>T	uc003lil.2	+	1	2212	c.2074C>T	c.(2074-2076)CTG>TTG	p.L692L	PCDHB2_uc003lim.1_Silent_p.L353L	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	692	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGTCTACCTGGTGGTGGC	0.697													10	181	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140482301	140482301	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140482301C>T	uc003lio.2	+	1	2068	c.2068C>T	c.(2068-2070)CTG>TTG	p.L690L	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	690	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGTCTACCTGGTGGTGGC	0.682													7	132	---	---	---	---	PASS
PCDHB9	56127	broad.mit.edu	37	5	140567183	140567183	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140567183C>T	uc003liw.1	+	1	291	c.291C>T	c.(289-291)GGC>GGT	p.G97G		NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	protocadherin beta 9 precursor	97	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTGTGTGGCCCTAAAGAGC	0.458													27	28	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736303	140736303	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736303G>A	uc003ljq.1	+	1	1536	c.1536G>A	c.(1534-1536)GGG>GGA	p.G512G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.G512G	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	512	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAATACAGGGATCCTATATG	0.527													33	117	---	---	---	---	PASS
PCDHGC3	5098	broad.mit.edu	37	5	140856170	140856170	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140856170G>A	uc003lkv.1	+	1	602	c.487G>A	c.(487-489)GAT>AAT	p.D163N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lku.1_Missense_Mutation_p.D163N|PCDHGC3_uc003lkw.1_Intron	NM_002588	NP_002579	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3 isoform 1	163	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGATCCCGATGTGGGAAG	0.567													18	55	---	---	---	---	PASS
SPINK9	643394	broad.mit.edu	37	5	147715197	147715197	+	Silent	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147715197C>G	uc003lpe.1	+	1	76	c.21C>G	c.(19-21)GTC>GTG	p.V7V	uc003lpb.1_Intron	NM_001040433	NP_001035523	Q5DT21	ISK9_HUMAN	serine peptidase inhibitor, Kazal type 9	7						extracellular region	protein binding|serine-type endopeptidase inhibitor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCATAGTCCTACTCTTGG	0.483													22	47	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149437110	149437110	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149437110C>T	uc003lrl.2	-	15	2373	c.2178G>A	c.(2176-2178)ATG>ATA	p.M726I	CSF1R_uc011dcd.1_Intron|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.M726I	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	726	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	AGACAGGCCTCATCTCCACAT	0.552													7	22	---	---	---	---	PASS
FBXW11	23291	broad.mit.edu	37	5	171327031	171327031	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171327031C>A	uc003mbm.1	-	4	818	c.447G>T	c.(445-447)CTG>CTT	p.L149L	FBXW11_uc011dey.1_Silent_p.L117L|FBXW11_uc003mbl.1_Silent_p.L136L|FBXW11_uc003mbn.1_Silent_p.L115L	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform	149	F-box.				cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	p.N260_I262(1)		ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTACATACCAGCTCTGCTG	0.453													5	300	---	---	---	---	PASS
C5orf25	375484	broad.mit.edu	37	5	175717801	175717801	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175717801C>T	uc003mds.3	+	4	1624	c.1217C>T	c.(1216-1218)TCA>TTA	p.S406L	C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Missense_Mutation_p.S425L			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	406											0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		ATATCACTGTCAGAGCCTGCC	0.502													4	81	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176721219	176721219	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176721219G>C	uc003mfr.3	+	23	6988	c.6850G>C	c.(6850-6852)GAG>CAG	p.E2284Q	NSD1_uc003mft.3_Missense_Mutation_p.E2015Q|NSD1_uc011dfx.1_Missense_Mutation_p.E1932Q	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2284	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AAGACCTCTTGAGAGAACTGA	0.537			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			42	111	---	---	---	---	PASS
LOC202181	202181	broad.mit.edu	37	5	177058522	177058522	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177058522G>A	uc011dgc.1	-						LOC202181_uc011dgb.1_RNA	NM_198567	NP_940969			hypothetical protein LOC375484												0						GGCAGGCTCTGACAGTGATAT	0.507													10	25	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178410024	178410024	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178410024C>T	uc003mjr.2	-	9	2502	c.2323G>A	c.(2323-2325)GTG>ATG	p.V775M	GRM6_uc003mjq.2_Missense_Mutation_p.V178M	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	775	Cytoplasmic (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GTCTCGGGCACGCCACGGGCC	0.597													17	47	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12164682	12164682	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12164682G>A	uc003nac.2	+	9	8324	c.8145G>A	c.(8143-8145)GTG>GTA	p.V2715V	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2715					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACAGGCTTGTGATAGCAACCT	0.448													10	31	---	---	---	---	PASS
HIST1H2BL	8340	broad.mit.edu	37	6	27775562	27775562	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27775562G>C	uc003njl.2	-	1	148	c.123C>G	c.(121-123)TAC>TAG	p.Y41*	HIST1H3H_uc003njm.2_5'Flank	NM_003519	NP_003510	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	41					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCTTGTACACGTACACGGAGT	0.587													61	130	---	---	---	---	PASS
ZNF187	7741	broad.mit.edu	37	6	28244983	28244983	+	3'UTR	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28244983G>C	uc011dld.1	+	5					ZNF187_uc011dlc.1_3'UTR|ZNF187_uc003nku.3_3'UTR|ZNF187_uc003nkw.3_3'UTR|ZNF187_uc011dle.1_3'UTR|ZNF187_uc011dlf.1_3'UTR|ZNF187_uc011dlg.1_3'UTR	NM_001111039	NP_001104509	Q16670	ZN187_HUMAN	zinc finger protein 187 isoform b						viral reproduction	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTTGGGGGCTGAGTTGGAGGC	0.443													12	13	---	---	---	---	PASS
ZKSCAN3	80317	broad.mit.edu	37	6	28327555	28327555	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327555G>A	uc003nle.3	+	2	408	c.192G>A	c.(190-192)CTG>CTA	p.L64L	ZKSCAN3_uc010jrc.2_Silent_p.L64L|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	64	SCAN box.				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GCGAGGCGCTGAGTCGGCTCC	0.657													30	67	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29641454	29641454	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29641454C>A	uc011dlw.1	-	4	585	c.434G>T	c.(433-435)TGC>TTC	p.C145F	ZFP57_uc003nnl.3_Missense_Mutation_p.C125F	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						GGCCCCTCTGCATGCAAGGAA	0.552													47	80	---	---	---	---	PASS
DOM3Z	1797	broad.mit.edu	37	6	31938356	31938356	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31938356C>T	uc003nyo.1	-						DOM3Z_uc003nyp.1_Intron|DOM3Z_uc003nyq.1_Intron|DOM3Z_uc003nyr.1_Intron|DOM3Z_uc003nys.1_3'UTR|DOM3Z_uc010jtl.1_3'UTR|STK19_uc003nyt.2_5'Flank|STK19_uc011dow.1_5'Flank|STK19_uc011dox.1_5'Flank|STK19_uc003nyv.2_5'Flank|STK19_uc003nyw.2_5'Flank|STK19_uc010jtn.1_5'Flank	NM_005510	NP_005501	O77932	DOM3Z_HUMAN	DOM-3 homolog Z								identical protein binding|metal ion binding|nucleotide binding				0						AGCCTAAGCTCTCGCCCTGCC	0.592													15	32	---	---	---	---	PASS
CDKN1A	1026	broad.mit.edu	37	6	36652060	36652060	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36652060G>T	uc003omm.3	+	2	304	c.182G>T	c.(181-183)GGT>GTT	p.G61V	CDKN1A_uc011dtq.1_Missense_Mutation_p.G95V|CDKN1A_uc003oml.2_Missense_Mutation_p.G61V|CDKN1A_uc003omn.2_Missense_Mutation_p.G61V	NM_000389	NP_000380	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A	61					cell cycle arrest|cellular response to extracellular stimulus|cellular response to ionizing radiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of fibroblast proliferation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|S phase of mitotic cell cycle|stress-induced premature senescence	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleoplasm|PCNA-p21 complex	cyclin-dependent protein kinase activating kinase activity|cyclin-dependent protein kinase inhibitor activity|metal ion binding			ovary(1)|breast(1)	2						CCACTGGAGGGTGACTTCGCC	0.672									Multiple_Endocrine_Neoplasia_type_1				14	29	---	---	---	---	PASS
NFYA	4800	broad.mit.edu	37	6	41051850	41051850	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41051850C>A	uc003opo.2	+	4	406	c.228C>A	c.(226-228)CCC>CCA	p.P76P	NFYA_uc003opp.2_Silent_p.P47P|NFYA_uc003opq.2_Silent_p.P47P	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1	76	Gln-rich.				transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGGCCAACCCATCATGGTCC	0.438													3	45	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43155601	43155601	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43155601G>A	uc003ouk.2	+	7	1807	c.1732G>A	c.(1732-1734)GAA>AAA	p.E578K	CUL9_uc003ouj.1_Missense_Mutation_p.E468K|CUL9_uc003oul.2_Missense_Mutation_p.E578K|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_Missense_Mutation_p.E36K	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	578					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						GCTGTCTAATGAACCAAGCAG	0.522													20	41	---	---	---	---	PASS
C6orf108	10591	broad.mit.edu	37	6	43194090	43194090	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43194090G>A	uc003ouo.2	-	2	257	c.240C>T	c.(238-240)GAC>GAT	p.D80D	C6orf108_uc003oup.2_Silent_p.D80D	NM_006443	NP_006434	O43598	RCL_HUMAN	putative c-Myc-responsive isoform 1	80					cell proliferation|deoxyribonucleoside monophosphate catabolic process|positive regulation of cell growth	cytoplasm|nucleus	deoxyribonucleoside 5'-monophosphate N-glycosidase activity|nucleoside deoxyribosyltransferase activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0123)|OV - Ovarian serous cystadenocarcinoma(102;0.0531)			GCCACTCCAGGTCCTGCTCAT	0.617													7	31	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43304812	43304812	+	3'UTR	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43304812G>C	uc003oux.2	-	10					ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TTCCAGATGAGATAACAAACT	0.383													9	4	---	---	---	---	PASS
TJAP1	93643	broad.mit.edu	37	6	43472671	43472671	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43472671G>A	uc003ovd.2	+	11	1128	c.752G>A	c.(751-753)AGC>AAC	p.S251N	TJAP1_uc003ovf.2_Missense_Mutation_p.S241N|TJAP1_uc003ove.2_Missense_Mutation_p.S241N|TJAP1_uc003ovc.2_Missense_Mutation_p.S241N|TJAP1_uc010jyp.2_Missense_Mutation_p.S210N|TJAP1_uc011dvh.1_Missense_Mutation_p.S241N|TJAP1_uc003ovg.2_Missense_Mutation_p.S117N|TJAP1_uc011dvi.1_Missense_Mutation_p.S251N|TJAP1_uc011dvj.1_Missense_Mutation_p.S51N|TJAP1_uc003ovi.2_Missense_Mutation_p.S117N	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	251						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CAGTCAGGCAGCGCCGGGCGC	0.642													54	86	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76720899	76720899	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76720899G>T	uc003pik.1	-	8	980	c.850C>A	c.(850-852)CAT>AAT	p.H284N		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	284	SEA 1.				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CCTAACACATGGATTTTTTTG	0.313													11	21	---	---	---	---	PASS
GABRR2	2570	broad.mit.edu	37	6	89974215	89974215	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89974215G>A	uc003pnb.2	-	8	1085	c.1077C>T	c.(1075-1077)TTC>TTT	p.F359F	GABRR2_uc011dzx.1_Silent_p.F235F	NM_002043	NP_002034	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 2	359	Helical; (Potential).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)		AGAGGAACACGAACACAAAGC	0.592													23	29	---	---	---	---	PASS
BVES	11149	broad.mit.edu	37	6	105581450	105581450	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105581450C>A	uc003pqw.2	-	2	160	c.3G>T	c.(1-3)ATG>ATT	p.M1I	BVES_uc003pqx.2_Missense_Mutation_p.M1I|BVES_uc003pqy.2_Missense_Mutation_p.M1I	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	1	Extracellular (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				CTGTATAATTCATTTTGAAAA	0.323													32	55	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106553146	106553146	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106553146C>A	uc003prd.2	+	5	1345	c.1111C>A	c.(1111-1113)CGG>AGG	p.R371R	PRDM1_uc003pre.2_Silent_p.R237R	NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	371					negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TCAAGAGCACCGGGACTCCTA	0.642			D|N|Mis|F|S		DLBCL								3	46	---	---	---	---	PASS
FABP7	2173	broad.mit.edu	37	6	123100928	123100928	+	5'UTR	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123100928G>T	uc003pzf.2	+	1					FABP7_uc003pzd.2_5'UTR|FABP7_uc003pze.1_5'UTR	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain						negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	CTAAAGAGGGGAAAGGGCAAG	0.493													9	6	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128040891	128040891	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128040891C>G	uc003qbi.2	-	6	2155	c.1836G>C	c.(1834-1836)CAG>CAC	p.Q612H	THEMIS_uc010kfa.2_Missense_Mutation_p.Q515H|THEMIS_uc011ebt.1_Missense_Mutation_p.Q651H|THEMIS_uc010kfb.2_Missense_Mutation_p.Q577H	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	612					negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						CCAAATCATTCTGACTACCAA	0.443													42	27	---	---	---	---	PASS
EPM2A	7957	broad.mit.edu	37	6	145948488	145948488	+	3'UTR	SNP	A	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145948488A>T	uc003qkw.2	-	4					EPM2A_uc003qkv.2_Intron|EPM2A_uc010khr.2_3'UTR|EPM2A_uc003qkx.2_3'UTR|EPM2A_uc003qku.2_3'UTR	NM_005670	NP_005661	O95278	EPM2A_HUMAN	laforin isoform a						glycogen metabolic process	cytosol|endoplasmic reticulum|nucleus|plasma membrane|polysome	carbohydrate binding|identical protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		TTTCTAGGTCATTTGACCAAC	0.488													55	76	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147648368	147648368	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147648368G>A	uc003qlz.2	+	18	2197	c.2036G>A	c.(2035-2037)CGG>CAG	p.R679Q	STXBP5_uc010khz.1_Missense_Mutation_p.R679Q|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.R350Q|STXBP5_uc003qma.2_Missense_Mutation_p.R26Q	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	679	WD 10.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GATCCTTATCGGAGAGAACCC	0.418													28	57	---	---	---	---	PASS
ULBP3	79465	broad.mit.edu	37	6	150387242	150387242	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150387242G>A	uc003qns.3	-	2	145	c.145C>T	c.(145-147)CAG>TAG	p.Q49*	ULBP3_uc011eej.1_5'Flank|ULBP3_uc011eek.1_Intron	NM_024518	NP_078794	Q9BZM4	N2DL3_HUMAN	UL16 binding protein 3 precursor	49	MHC class I alpha-1 like.				antigen processing and presentation|immune response|natural killer cell activation	anchored to membrane|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.12)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.45e-12)		TCACACCACTGTTGCCCATGT	0.473													34	63	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151914325	151914325	+	Missense_Mutation	SNP	C	A	A	rs113968720		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151914325C>A	uc003qol.2	+	8	1466	c.1377C>A	c.(1375-1377)GAC>GAA	p.D459E		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	459											0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		TGCGGCTGGACGTGGTTTTAG	0.453													33	32	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155579176	155579176	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155579176T>C	uc003qqj.3	-	7	899	c.835A>G	c.(835-837)AGG>GGG	p.R279G	TFB1M_uc003qqk.2_Intron|uc003qqi.1_5'Flank	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	279					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TCTAACAGCCTGCCCGTGCTT	0.453													29	94	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23236339	23236339	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23236339G>A	uc003svu.2	+	5	822	c.563G>A	c.(562-564)AGG>AAG	p.R188K	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Missense_Mutation_p.R65K|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_Missense_Mutation_p.R65K|NUPL2_uc011jyx.1_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	188					carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						TGGAGGAACAGGGTAAATGAA	0.328													25	40	---	---	---	---	PASS
RP9	6100	broad.mit.edu	37	7	33139017	33139017	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33139017G>C	uc003tdm.2	-	3	233	c.215C>G	c.(214-216)CCA>CGA	p.P72R		NM_203288	NP_976033	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9	72	PIM1-binding (By similarity).				RNA splicing	nucleus	nucleic acid binding|protein binding|zinc ion binding				0			GBM - Glioblastoma multiforme(11;0.0403)			TGGTACATCTGGTATGCAATC	0.483													4	72	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43548862	43548862	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43548862G>A	uc003tid.1	+						HECW1_uc011kbi.1_Intron|uc003tig.1_RNA	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CAGAGTCCAAGAAGGAAGAAT	0.413													3	4	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44739835	44739835	+	Silent	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44739835A>G	uc003tln.2	+	19	2635	c.2526A>G	c.(2524-2526)CTA>CTG	p.L842L	OGDH_uc011kbx.1_Silent_p.L838L|OGDH_uc011kby.1_Silent_p.L692L|OGDH_uc003tlp.2_Silent_p.L853L|OGDH_uc011kbz.1_Silent_p.L637L	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	842					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TCCACGTGCTACGACGCCAGA	0.567													33	39	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48314904	48314904	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48314904G>C	uc003toq.2	+	17	5666	c.5641G>C	c.(5641-5643)GAA>CAA	p.E1881Q	ABCA13_uc010kyr.2_Missense_Mutation_p.E1384Q	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1881					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTCCCGAATGGAAATAACTAG	0.403													38	58	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48315084	48315084	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48315084G>C	uc003toq.2	+	17	5846	c.5821G>C	c.(5821-5823)GAA>CAA	p.E1941Q	ABCA13_uc010kyr.2_Missense_Mutation_p.E1444Q	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1941					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TAGCATCTCTGAACTCTGTCC	0.338													47	88	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91630326	91630326	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91630326G>C	uc003ulg.2	+	8	1320	c.1095G>C	c.(1093-1095)CAG>CAC	p.Q365H	AKAP9_uc003ule.2_Missense_Mutation_p.Q377H|AKAP9_uc003ulf.2_Missense_Mutation_p.Q365H|AKAP9_uc003uli.2_5'UTR	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	377	Glu-rich.|Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			tacaagaacagattgtgcaaa	0.020			T	BRAF	papillary thyroid								3	14	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99909483	99909483	+	5'Flank	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99909483G>C	uc003uug.1	+							NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3												0						CCCTGAGCCTGAGGAGACCTG	0.592													25	51	---	---	---	---	PASS
TSC22D4	81628	broad.mit.edu	37	7	100075057	100075057	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100075057T>A	uc003uva.2	-	2	1360	c.605A>T	c.(604-606)GAG>GTG	p.E202V	TSC22D4_uc003uvb.2_5'UTR|TSC22D4_uc011kjv.1_5'UTR|TSC22D4_uc010lgx.2_Missense_Mutation_p.E202V|TSC22D4_uc003uvc.3_Missense_Mutation_p.E202V	NM_030935	NP_112197	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	202					negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			breast(2)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCCGCACTCTCACCGGTCTC	0.711													11	13	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100458882	100458882	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100458882C>G	uc003uwp.2	+	10	1483	c.1341C>G	c.(1339-1341)TTC>TTG	p.F447L	SLC12A9_uc003uwq.2_Missense_Mutation_p.F358L|SLC12A9_uc011kki.1_5'UTR|SLC12A9_uc003uwr.2_Missense_Mutation_p.F183L|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_Missense_Mutation_p.F183L|SLC12A9_uc003uwv.2_5'UTR	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	447	Cytoplasmic (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCCCAACTTCCGGTGAGAGA	0.642													35	110	---	---	---	---	PASS
C7orf52	375607	broad.mit.edu	37	7	100817751	100817751	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100817751C>T	uc003uxy.1	-						C7orf52_uc003uxz.1_Intron|C7orf52_uc003uya.1_Silent_p.*113*|C7orf52_uc003uyb.1_Silent_p.*113*	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607								N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					CACCCCATGTCACCTGGGCCG	0.662													5	10	---	---	---	---	PASS
SPDYE6	729597	broad.mit.edu	37	7	101989042	101989042	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101989042G>T	uc011kkp.1	-	6	1252	c.831C>A	c.(829-831)AAC>AAA	p.N277K	SPDYE6_uc003uzb.2_Missense_Mutation_p.N133K	NM_001146210	NP_001139682	P0CI01	SPDE6_HUMAN	speedy homolog E6	277	Arg-rich.										0						TGCGAGAGCGGTTCTTCCTAT	0.537													51	447	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111422961	111422961	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111422961C>T	uc003vfx.2	-	34	3786	c.3517G>A	c.(3517-3519)GAG>AAG	p.E1173K	DOCK4_uc011kml.1_Missense_Mutation_p.E54K|DOCK4_uc011kmm.1_Missense_Mutation_p.E80K|DOCK4_uc003vfw.2_Missense_Mutation_p.E623K|DOCK4_uc003vfy.2_Missense_Mutation_p.E1218K	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1173	DHR-2.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCATCTACCTCTCCCATTTTC	0.383													24	73	---	---	---	---	PASS
TFEC	22797	broad.mit.edu	37	7	115580778	115580778	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115580778C>G	uc003vhj.1	-	8	1055	c.871G>C	c.(871-873)GAT>CAT	p.D291H	TFEC_uc003vhk.1_Missense_Mutation_p.D262H|TFEC_uc003vhl.3_3'UTR|TFEC_uc011kmw.1_3'UTR	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	291	Necessary for transcriptional transactivation.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			AATGATAAATCTGTGAAGTAT	0.433													55	106	---	---	---	---	PASS
POT1	25913	broad.mit.edu	37	7	124475365	124475365	+	Silent	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124475365T>A	uc003vlm.2	-	15	2074	c.1473A>T	c.(1471-1473)CCA>CCT	p.P491P	POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Silent_p.P360P|POT1_uc003vln.2_RNA	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1	491					DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						GTATAAGAAATGGTGCTGAAA	0.269													47	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142247175	142247175	+	Intron	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142247175G>C	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011kse.1_Intron|uc003vye.2_Intron|uc003vyd.3_Missense_Mutation_p.S94C					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		CTTCAGAGTAGAGACGGATCC	0.562													24	41	---	---	---	---	PASS
TAS2R39	259285	broad.mit.edu	37	7	142880972	142880972	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142880972T>C	uc011ksw.1	+	1	461	c.461T>C	c.(460-462)ATT>ACT	p.I154T		NM_176881	NP_795362	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	154	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1	Melanoma(164;0.059)					AGGTGGAGAATTACTGGATTG	0.433													34	60	---	---	---	---	PASS
ZNF786	136051	broad.mit.edu	37	7	148769089	148769089	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148769089G>A	uc003wfh.2	-	4	912	c.775C>T	c.(775-777)CTG>TTG	p.L259L	ZNF786_uc011kuk.1_Silent_p.L222L|ZNF786_uc003wfi.2_Silent_p.L173L	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	259	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TGGGCCGCCAGATGGCGCAGC	0.677													10	19	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149508033	149508033	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149508033C>T	uc010lpk.2	+	67	9427	c.9427C>T	c.(9427-9429)CCC>TCC	p.P3143S		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3143					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCAGGACTGCCCCTGTGCCCA	0.617													13	24	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149509070	149509070	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149509070C>T	uc010lpk.2	+	69	9616	c.9616C>T	c.(9616-9618)CGG>TGG	p.R3206W		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3206	TSP type-1 11.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCGGTGCCATCGGCACCGGTT	0.697													23	28	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	152027735	152027735	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152027735C>T	uc003wla.2	-	3	559	c.340G>A	c.(340-342)GAG>AAG	p.E114K		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	114					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCCGATTCCTCAGACACAGAT	0.433			N		medulloblastoma								17	84	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154561137	154561137	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154561137G>A	uc003wlk.2	+	9	1023	c.894G>A	c.(892-894)TTG>TTA	p.L298L	DPP6_uc003wli.2_Silent_p.L234L|DPP6_uc003wlm.2_Silent_p.L236L|DPP6_uc011kvq.1_Silent_p.L191L	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	298	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGGAGATTTTGAAGACACACA	0.507													25	45	---	---	---	---	PASS
SPAG11B	10407	broad.mit.edu	37	8	7308697	7308697	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7308697C>T	uc003wrk.2	-	3	406	c.239G>A	c.(238-240)CGA>CAA	p.R80Q	SPAG11B_uc003wrg.1_Intron|SPAG11B_uc003wrh.1_Intron|SPAG11B_uc003wri.2_Missense_Mutation_p.R27Q|SPAG11B_uc003wrj.2_Intron|SPAG11B_uc003wrl.2_Intron	NM_016512	NP_057596	Q08648	SG11B_HUMAN	sperm associated antigen 11B isoform A	80					spermatogenesis	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		TGAGGGTCCTCGAGCCTCCCG	0.468													17	29	---	---	---	---	PASS
INTS10	55174	broad.mit.edu	37	8	19690831	19690831	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19690831G>C	uc003wzj.2	+	12	1660	c.1529G>C	c.(1528-1530)AGA>ACA	p.R510T		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	510					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		GGGGAGTACAGAGTGAGTACT	0.577													7	21	---	---	---	---	PASS
ADAM28	10863	broad.mit.edu	37	8	24178763	24178763	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24178763C>T	uc003xdy.2	+	8	764	c.681C>T	c.(679-681)ATC>ATT	p.I227I	ADAM28_uc003xdx.2_Silent_p.I227I|ADAM28_uc011kzz.1_5'UTR|ADAM28_uc011laa.1_Intron	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	227	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AAGATGAGATCAGAAAGAGGG	0.318													14	67	---	---	---	---	PASS
EPHX2	2053	broad.mit.edu	37	8	27398124	27398124	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27398124G>A	uc003xfu.2	+	15	1411	c.1330G>A	c.(1330-1332)GAG>AAG	p.E444K	EPHX2_uc010luu.2_Missense_Mutation_p.E412K|EPHX2_uc010luv.2_Missense_Mutation_p.E378K|EPHX2_uc003xfv.2_Missense_Mutation_p.E391K|EPHX2_uc010luw.2_Missense_Mutation_p.E378K	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	444	Epoxide hydrolase.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)	GATGGTCACTGAGGAGGAAAT	0.502													24	34	---	---	---	---	PASS
MAK16	84549	broad.mit.edu	37	8	33346598	33346598	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33346598G>A	uc003xjj.2	+	5	373	c.333G>A	c.(331-333)CAG>CAA	p.Q111Q	C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898	Q9BXY0	MAK16_HUMAN	MAK16 homolog	111						nucleolus				ovary(1)	1						AATGTAAGCAGAGATTCACCA	0.353													40	60	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37729146	37729146	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37729146C>G	uc003xkm.1	-	4	3218	c.3174G>C	c.(3172-3174)AAG>AAC	p.K1058N	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Missense_Mutation_p.K387N|RAB11FIP1_uc003xko.1_Missense_Mutation_p.K387N|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	1058					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			AGCTTGAGCTCTTGCCAAGAT	0.557													56	98	---	---	---	---	PASS
FGFR1	2260	broad.mit.edu	37	8	38271717	38271717	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38271717C>T	uc003xlp.2	-	17	3081	c.2139G>A	c.(2137-2139)CTG>CTA	p.L713L	FGFR1_uc010lwf.2_RNA|FGFR1_uc011lbo.1_Silent_p.L711L|FGFR1_uc011lbp.1_Silent_p.L624L|FGFR1_uc011lbq.1_Silent_p.L622L|FGFR1_uc010lwk.2_Silent_p.L703L	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	713	Cytoplasmic (Potential).|Protein kinase.				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	GACCCTCCTTCAGCAGCTTGA	0.607		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						22	28	---	---	---	---	PASS
EFCAB1	79645	broad.mit.edu	37	8	49643172	49643172	+	Silent	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49643172G>T	uc003xqo.2	-	3	406	c.246C>A	c.(244-246)GGC>GGA	p.G82G	EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Silent_p.G30G|EFCAB1_uc010lxx.2_RNA|EFCAB1_uc011ldk.1_RNA	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a	82	EF-hand 1.|1 (Potential).						calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CATTTACACAGCCATCATTAT	0.368													3	45	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69046488	69046488	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69046488C>T	uc003xxv.1	+	32	3988	c.3961C>T	c.(3961-3963)CAG>TAG	p.Q1321*		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1321					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TTTTCACTTTCAGTCACTTCT	0.438													17	25	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767490	77767490	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767490C>T	uc003yav.2	+	10	8585	c.8198C>T	c.(8197-8199)TCT>TTT	p.S2733F	ZFHX4_uc003yau.1_Missense_Mutation_p.S2778F|ZFHX4_uc003yaw.1_Missense_Mutation_p.S2733F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2733						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCAGAGTGTTCTGAGGATGTA	0.403										HNSCC(33;0.089)			13	18	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87755883	87755883	+	5'UTR	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87755883C>G	uc003ydx.2	-	1						NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TGAAAACCCTCTGTATTTATG	0.368													49	50	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101153669	101153669	+	Silent	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101153669T>C	uc003yjd.2	-	2	1526	c.813A>G	c.(811-813)TTA>TTG	p.L271L	FBXO43_uc003yje.2_Silent_p.L237L|FBXO43_uc010mbp.1_Silent_p.L271L	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	271					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CATTAATGCATAAACTGCTAT	0.383													19	38	---	---	---	---	PASS
SNX31	169166	broad.mit.edu	37	8	101624228	101624228	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101624228C>A	uc003yjr.2	-	7	762	c.611G>T	c.(610-612)TGG>TTG	p.W204L	SNX31_uc011lha.1_5'UTR|SNX31_uc011lhb.1_Missense_Mutation_p.W105L	NM_152628	NP_689841	Q8N9S9	SNX31_HUMAN	sorting nexin 31	204					cell communication|protein transport		phosphatidylinositol binding				0	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			ACCTACTTACCACTTTCGGAG	0.468													3	55	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109228656	109228656	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109228656C>T	uc003ymu.2	-	9	964	c.936G>A	c.(934-936)CTG>CTA	p.L312L	EIF3E_uc003ymt.2_Silent_p.L263L|EIF3E_uc003ymv.2_Silent_p.L219L|EIF3E_uc010mci.1_Silent_p.L312L	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	312	PCI.			L->D: Promotes nuclear accumulation.	negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CACATTCCCTCAGCTTTTTCT	0.289													9	47	---	---	---	---	PASS
EXT1	2131	broad.mit.edu	37	8	118816983	118816983	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118816983T>A	uc003yok.1	-	10	2806	c.2033A>T	c.(2032-2034)TAT>TTT	p.Y678F		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	678	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TGTCTCCTTATACTGCTTCTT	0.478			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				31	58	---	---	---	---	PASS
TIGD5	84948	broad.mit.edu	37	8	144681868	144681868	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144681868C>G	uc003yyx.1	+	1	1648	c.1648C>G	c.(1648-1650)CTG>GTG	p.L550V	EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	NM_032862	NP_116251	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	599					regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			AGAAACAGCTCTGCGGTGGCT	0.687													7	11	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5089767	5089767	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5089767G>A	uc010mhm.2	+	19	2778	c.2665G>A	c.(2665-2667)GAA>AAA	p.E889K	JAK2_uc003ziw.2_Missense_Mutation_p.E889K	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	889	Protein kinase 2.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		GCATAGTACTGAAGAGCACCT	0.448		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				21	12	---	---	---	---	PASS
GNE	10020	broad.mit.edu	37	9	36229084	36229084	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36229084C>A	uc010mlh.2	-	6	1219	c.1004G>T	c.(1003-1005)CGG>CTG	p.R335L	CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Missense_Mutation_p.R335L|GNE_uc011lpl.1_Missense_Mutation_p.R225L|GNE_uc010mli.2_Missense_Mutation_p.R366L|GNE_uc010mlj.2_Missense_Mutation_p.R330L	NM_005476	NP_005467	Q9Y223	GLCNE_HUMAN	UDP-N-acetylglucosamine-2-epimerase/N-	335	UDP-N-acetylglucosamine 2-epimerase.				cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity				0			STAD - Stomach adenocarcinoma(86;0.228)			GTCAGCATCCCGGACATGAAG	0.383													5	97	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73233873	73233873	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73233873G>A	uc004aid.2	-	16	2476	c.2232C>T	c.(2230-2232)CAC>CAT	p.H744H	TRPM3_uc004ahu.2_Silent_p.H574H|TRPM3_uc004ahv.2_Silent_p.H546H|TRPM3_uc004ahw.2_Silent_p.H616H|TRPM3_uc004ahx.2_Silent_p.H603H|TRPM3_uc004ahy.2_Silent_p.H606H|TRPM3_uc004ahz.2_Silent_p.H593H|TRPM3_uc004aia.2_Silent_p.H591H|TRPM3_uc004aib.2_Silent_p.H581H|TRPM3_uc004aic.2_Silent_p.H744H	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	769	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TGAAGTCGCGGTGTTTGGCAG	0.612													18	13	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95274343	95274343	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95274343G>A	uc004ash.2	-	5	1185	c.1120C>T	c.(1120-1122)CTG>TTG	p.L374L	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Silent_p.L352L|ECM2_uc011lty.1_Silent_p.L374L|ECM2_uc004asg.2_Silent_p.L352L	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	374	LRR 1.				cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						TTTTTACTCAGATCAAGCCTT	0.393													35	15	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111741687	111741687	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111741687G>C	uc004bdo.1	-	7	1017	c.975C>G	c.(973-975)ATC>ATG	p.I325M	CTNNAL1_uc010mts.1_Missense_Mutation_p.I61M|CTNNAL1_uc010mtt.1_Missense_Mutation_p.I325M|CTNNAL1_uc004bdp.1_Missense_Mutation_p.I325M	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	325					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		TACGCTCCAAGATGACTTCCA	0.443													25	20	---	---	---	---	PASS
ENTPD2	954	broad.mit.edu	37	9	139945381	139945381	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139945381G>C	uc004ckw.1	-	5	803	c.747C>G	c.(745-747)CTC>CTG	p.L249L	ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Silent_p.L249L	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	249	Extracellular (Potential).					integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCAGCCTCTGGAGGACCTGGT	0.647													8	14	---	---	---	---	PASS
ENTPD2	954	broad.mit.edu	37	9	139945964	139945964	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139945964G>A	uc004ckw.1	-	3	440	c.384C>T	c.(382-384)CTC>CTT	p.L128L	ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Silent_p.L128L	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	128	Extracellular (Potential).					integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACACTCACTTGAGCAGGCGCA	0.637													13	25	---	---	---	---	PASS
GRIN1	2902	broad.mit.edu	37	9	140058079	140058079	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140058079G>C	uc004clk.2	+	17	2732	c.2402G>C	c.(2401-2403)CGC>CCC	p.R801P	GRIN1_uc004cli.1_Missense_Mutation_p.R476P|GRIN1_uc004clj.1_Missense_Mutation_p.R798P|GRIN1_uc004cll.2_Missense_Mutation_p.R801P|GRIN1_uc004clm.2_Missense_Mutation_p.R801P|GRIN1_uc004cln.2_Missense_Mutation_p.R819P|GRIN1_uc004clo.2_Missense_Mutation_p.R819P	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor	801	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	TGTGACTCGCGCAGCAACGCC	0.587													14	8	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7785117	7785117	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7785117G>A	uc001ijs.2	+	17	2266	c.2104G>A	c.(2104-2106)GAC>AAC	p.D702N		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	702					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						AGTTGAAAATGACCCACATTT	0.313													55	120	---	---	---	---	PASS
FAM107B	83641	broad.mit.edu	37	10	14572359	14572359	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14572359G>C	uc001imx.1	-	2	345	c.100C>G	c.(100-102)CAC>GAC	p.H34D	FAM107B_uc001ina.1_Missense_Mutation_p.H209D|FAM107B_uc010qbu.1_RNA|FAM107B_uc009xjg.1_Missense_Mutation_p.H34D|FAM107B_uc001imy.1_Missense_Mutation_p.H34D|FAM107B_uc001imz.1_Missense_Mutation_p.H34D	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	34										breast(4)	4						AGTTCTCTGTGAAGATCTTGA	0.348													34	57	---	---	---	---	PASS
ARHGAP12	94134	broad.mit.edu	37	10	32197217	32197217	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32197217C>A	uc001ivz.1	-	3	837	c.567G>T	c.(565-567)GAG>GAT	p.E189D	ARHGAP12_uc001ivy.1_Missense_Mutation_p.E187D|ARHGAP12_uc009xls.2_Missense_Mutation_p.E187D|ARHGAP12_uc001iwb.1_Missense_Mutation_p.E187D|ARHGAP12_uc001iwc.1_Missense_Mutation_p.E187D|ARHGAP12_uc009xlq.1_Missense_Mutation_p.E187D|ARHGAP12_uc001iwd.1_Missense_Mutation_p.E187D|ARHGAP12_uc009xlr.1_Missense_Mutation_p.E187D	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	189					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AGCTAGTTTTCTCTACATCCA	0.433													31	63	---	---	---	---	PASS
CXCL12	6387	broad.mit.edu	37	10	44873105	44873105	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44873105C>T	uc001jbf.2	-						CXCL12_uc001jbh.2_Intron|CXCL12_uc001jbi.2_3'UTR	NM_000609	NP_000600	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12 (stromal						blood circulation|cell adhesion|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|negative regulation of leukocyte apoptosis|positive regulation of monocyte chemotaxis|regulation of actin polymerization or depolymerization|response to virus	extracellular space	chemokine activity|growth factor activity|signal transducer activity				0					Dexamethasone(DB01234)	CAGAGGCAATCACAAAACCCA	0.423													3	4	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61022288	61022288	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61022288G>A	uc001jkn.2	-	11	1276	c.1142C>T	c.(1141-1143)CCG>CTG	p.P381L	FAM13C_uc001jko.2_Intron|FAM13C_uc010qid.1_Missense_Mutation_p.P298L|FAM13C_uc010qie.1_Missense_Mutation_p.P298L|FAM13C_uc010qif.1_Missense_Mutation_p.P403L|FAM13C_uc001jkp.2_Missense_Mutation_p.P298L	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	381										ovary(2)	2						GCTTGGCTCCGGGCCCGCAGC	0.542													8	68	---	---	---	---	PASS
PRF1	5551	broad.mit.edu	37	10	72360409	72360409	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72360409T>G	uc009xqg.2	-	2	411	c.250A>C	c.(250-252)ACC>CCC	p.T84P	PRF1_uc001jrf.3_Missense_Mutation_p.T84P	NM_001083116	NP_001076585	P14222	PERF_HUMAN	perforin 1 precursor	84	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						CGCTGGAGGGTGCCCTCCTGT	0.662			M			various leukaemia|lymphoma	Type 2 familial hemophagocytic lymphohistiocytosis		Familial_Hemophagocytic_Lymphohistiocytosis				7	23	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84738833	84738833	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84738833G>A	uc001kco.2	+	8	1567	c.1540G>A	c.(1540-1542)GAA>AAA	p.E514K	NRG3_uc010qlz.1_Missense_Mutation_p.E513K|NRG3_uc001kcp.2_Missense_Mutation_p.E293K|NRG3_uc001kcq.2_Missense_Mutation_p.E164K|NRG3_uc001kcr.2_Missense_Mutation_p.E164K	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	514	Cytoplasmic (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCAGCAACTCGAAGAATCAAG	0.493													4	33	---	---	---	---	PASS
IFIT3	3437	broad.mit.edu	37	10	91099496	91099496	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91099496C>T	uc001kgf.2	+	2	1313	c.1084C>T	c.(1084-1086)CAG>TAG	p.Q362*	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron|IFIT3_uc001kgg.2_Nonsense_Mutation_p.Q362*	NM_001549	NP_001540	O14879	IFIT3_HUMAN	interferon-induced protein with	362					type I interferon-mediated signaling pathway		protein binding			central_nervous_system(1)	1						ACAATCCCATCAGCGCTACTG	0.433													39	51	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105927285	105927285	+	Intron	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105927285A>G	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron|C10orf79_uc001kxx.3_3'UTR	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TACAATACCTAAACTTAAATT	0.264													13	11	---	---	---	---	PASS
CCDC147	159686	broad.mit.edu	37	10	106139898	106139898	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106139898C>A	uc001kyh.2	+	9	1419	c.1285C>A	c.(1285-1287)CAG>AAG	p.Q429K		NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147	429	Potential.									ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GGATGAGGCTCAGAAGCAGAG	0.493													12	59	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108338932	108338932	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108338932G>A	uc001kym.2	-						SORCS1_uc001kyl.2_Missense_Mutation_p.S1150F|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Missense_Mutation_p.S1150F|SORCS1_uc001kyo.2_3'UTR	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCTGCTTTCAGAGTGACTGAC	0.443													35	41	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123847305	123847305	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123847305C>T	uc001lfv.2	+	4	5650	c.5290C>T	c.(5290-5292)CTT>TTT	p.L1764F	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Missense_Mutation_p.L1764F|TACC2_uc010qtv.1_Missense_Mutation_p.L1764F	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1764						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TACAGCTGCCCTTCATGGGGA	0.647													4	8	---	---	---	---	PASS
C10orf120	399814	broad.mit.edu	37	10	124457887	124457887	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124457887C>G	uc001lgn.2	-	3	402	c.370G>C	c.(370-372)GAG>CAG	p.E124Q		NM_001010912	NP_001010912	Q5SQS8	CJ120_HUMAN	hypothetical protein LOC399814	124										kidney(1)	1		all_neural(114;0.169)|Glioma(114;0.222)				TTTTTATACTCCATTGCTTGT	0.438													121	165	---	---	---	---	PASS
FAM175B	23172	broad.mit.edu	37	10	126505169	126505169	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126505169C>G	uc001lib.3	+	3	233	c.188C>G	c.(187-189)TCA>TGA	p.S63*		NM_032182	NP_115558	Q15018	F175B_HUMAN	hypothetical protein LOC23172	63	MPN-like.					BRISC complex	polyubiquitin binding				0						CAGCCTTGTTCAAAACTTTTT	0.323													31	49	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3430163	3430163	+	RNA	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3430163G>A	uc010qxs.1	+	11		c.1262G>A			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						AAGCTGAAATGATGGCAGTAG	0.542													5	7	---	---	---	---	PASS
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5664543	5664543	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5664543G>C	uc001mbf.2	+	14	2377	c.2133G>C	c.(2131-2133)AAG>AAC	p.K711N	HBG2_uc001mak.1_Intron|TRIM34_uc001mbh.2_Missense_Mutation_p.K357N|TRIM34_uc009yeq.2_Missense_Mutation_p.K112N|TRIM34_uc001mbi.2_Missense_Mutation_p.K357N|TRIM78P_uc009yer.2_Intron	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	711						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		ACGTGTCCAAGAAAACTGCCT	0.408													22	12	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14825541	14825541	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14825541G>A	uc001mln.2	+	5	1820	c.1467G>A	c.(1465-1467)CCG>CCA	p.P489P	PDE3B_uc010rcr.1_Silent_p.P438P	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	489					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TGACTATCCCGAAGCAAAGGT	0.353													14	20	---	---	---	---	PASS
UEVLD	55293	broad.mit.edu	37	11	18586472	18586472	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18586472G>A	uc001mot.2	-	6	659	c.579C>T	c.(577-579)CTC>CTT	p.L193L	UEVLD_uc001mou.2_Silent_p.L193L|UEVLD_uc010rde.1_Silent_p.L63L|UEVLD_uc010rdf.1_Silent_p.L171L|UEVLD_uc010rdg.1_Silent_p.L63L|UEVLD_uc001mov.2_Silent_p.L171L|UEVLD_uc010rdh.1_Silent_p.L193L	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	193	NAD (By similarity).				cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						AGGCAATACCGAGTTCTCCAC	0.373													17	11	---	---	---	---	PASS
CAT	847	broad.mit.edu	37	11	34492549	34492549	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34492549C>G	uc001mvm.2	+	12	1562	c.1479C>G	c.(1477-1479)ATC>ATG	p.I493M	CAT_uc001mvn.2_Missense_Mutation_p.I102M	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase	493					hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GGAGCCACATCCAGGCTCTTC	0.507													67	57	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958523	57958523	+	Silent	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958523C>G	uc010rka.1	+	1	561	c.561C>G	c.(559-561)CTC>CTG	p.L187L		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				TATTAAAACTCTCCTGTGGGG	0.448													12	31	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58189810	58189810	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58189810G>A	uc010rkg.1	-	1	925	c.925C>T	c.(925-927)CTA>TTA	p.L309L		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CAAACTTATAGAAATTTTTGC	0.383													21	32	---	---	---	---	PASS
CCDC86	79080	broad.mit.edu	37	11	60609623	60609623	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60609623G>A	uc001nqa.2	+	1	195	c.26G>A	c.(25-27)CGA>CAA	p.R9Q	CCDC86_uc001nqb.2_5'UTR	NM_024098	NP_077003	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	9					interspecies interaction between organisms	nucleus					0						AGGCGCAGCCGACGGCTGGGA	0.637													3	19	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63066993	63066993	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63066993G>A	uc009yor.2	+	6	1170	c.962G>A	c.(961-963)AGA>AAA	p.R321K	SLC22A10_uc010rmo.1_RNA|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.R161K	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	321	Extracellular (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						AAGGTTGTAAGATCCACCATG	0.423													10	22	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65271718	65271718	+	RNA	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65271718C>G	uc010roh.1	+	1		c.6486C>G			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TCAGCATACTCAAAATTTTTT	0.408													7	16	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65272561	65272561	+	RNA	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65272561C>T	uc010roh.1	+	1		c.7329C>T			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GAATAGATTTCAGCTTTATGC	0.418													21	42	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66030506	66030506	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66030506C>A	uc010rov.1	+	5	994	c.751C>A	c.(751-753)CGG>AGG	p.R251R	KLC2_uc010row.1_Silent_p.R251R|KLC2_uc009yra.2_Silent_p.R251R|KLC2_uc001ohb.2_Silent_p.R251R|KLC2_uc010rox.1_Silent_p.R174R|KLC2_uc001ohc.2_Silent_p.R251R|KLC2_uc001ohd.2_Silent_p.R174R|KLC2_uc001ohe.1_Silent_p.R112R	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	251	TPR 2.				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						ACTGGTCTATCGGTGAGGACT	0.602													7	21	---	---	---	---	PASS
CD248	57124	broad.mit.edu	37	11	66082600	66082600	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66082600G>A	uc001ohm.1	-	1	1916	c.1899C>T	c.(1897-1899)ATC>ATT	p.I633I		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	633	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	GTGTAGGGCTGATGGGTGAGG	0.632													24	42	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66816082	66816082	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66816082G>A	uc009yrl.2	+	8	1350	c.1120G>A	c.(1120-1122)GAG>AAG	p.E374K	SYT12_uc001oju.2_Missense_Mutation_p.E374K	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	374	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						GACGGTGGCTGAGAGCAGCAG	0.607													18	40	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	67021049	67021049	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67021049C>T	uc001ojw.2	+	19	3922	c.3058C>T	c.(3058-3060)CGG>TGG	p.R1020W	KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_Missense_Mutation_p.R714W|KDM2A_uc001ojz.1_Missense_Mutation_p.R478W|KDM2A_uc001oka.2_Missense_Mutation_p.R144W	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	1020					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						CCCTCAAATTCGGGACTTGCT	0.552													59	76	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71719867	71719867	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71719867G>A	uc001orl.1	-	20	5255	c.5083C>T	c.(5083-5085)CGA>TGA	p.R1695*	NUMA1_uc001orj.2_5'UTR|NUMA1_uc009ysw.1_Nonsense_Mutation_p.R1244*|NUMA1_uc001ork.1_Nonsense_Mutation_p.R559*|NUMA1_uc001orm.1_Nonsense_Mutation_p.R1681*|NUMA1_uc001orn.2_Nonsense_Mutation_p.R1258*	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1695	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CCCAGGTCTCGAAGCTGCTGG	0.582			T	RARA	APL								17	80	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71728852	71728852	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71728852G>A	uc001orl.1	-	13	1172	c.1000C>T	c.(1000-1002)CTG>TTG	p.L334L	NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Silent_p.L334L|NUMA1_uc001orm.1_Silent_p.L334L|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Silent_p.L334L|NUMA1_uc001oro.1_Silent_p.L334L|NUMA1_uc009ysy.1_Silent_p.L334L|NUMA1_uc001orp.2_Silent_p.L334L|NUMA1_uc001orq.2_Silent_p.L334L	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	334	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						AGCTGCTGCAGATGACTGGCA	0.602			T	RARA	APL								16	28	---	---	---	---	PASS
MAP6	4135	broad.mit.edu	37	11	75298211	75298211	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75298211G>C	uc001owu.2	-	4	2400	c.2335C>G	c.(2335-2337)CTG>GTG	p.L779V		NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	779	Pro-rich.					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					TGAGTCTTCAGAGGTTCAGGG	0.532													37	55	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76873170	76873170	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76873170G>C	uc001oyb.2	+	13	1620	c.1348G>C	c.(1348-1350)GAG>CAG	p.E450Q	MYO7A_uc010rsl.1_Missense_Mutation_p.E450Q|MYO7A_uc010rsm.1_Missense_Mutation_p.E439Q|MYO7A_uc001oyc.2_Missense_Mutation_p.E450Q	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	450	Myosin head-like.		E -> Q (in USH1B).		actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CTGCAGCTTTGAGCAGCTCTG	0.572													3	5	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83770465	83770465	+	Missense_Mutation	SNP	G	T	T	rs146925269		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83770465G>T	uc001paj.2	-	6	800	c.497C>A	c.(496-498)GCG>GAG	p.A166E	DLG2_uc001pai.2_Missense_Mutation_p.A115E|DLG2_uc010rsy.1_Missense_Mutation_p.A133E|DLG2_uc010rsz.1_Missense_Mutation_p.A166E|DLG2_uc010rta.1_Missense_Mutation_p.A166E|DLG2_uc001pak.2_Missense_Mutation_p.A271E|DLG2_uc010rtb.1_Missense_Mutation_p.A133E|DLG2_uc001pal.1_Missense_Mutation_p.A166E|DLG2_uc001pam.1_Missense_Mutation_p.A205E	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	166	PDZ 1.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGCTTCCACCGCTTTACTGTG	0.478													5	43	---	---	---	---	PASS
ELMOD1	55531	broad.mit.edu	37	11	107535976	107535976	+	3'UTR	SNP	T	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107535976T>G	uc010rvs.1	+	12					ELMOD1_uc001pjm.2_3'UTR|ELMOD1_uc010rvt.1_3'UTR	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		ATTGTCTTGTTAGATCTCTGC	0.468													11	73	---	---	---	---	PASS
ZC3H12C	85463	broad.mit.edu	37	11	110035800	110035800	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110035800C>A	uc009yxw.2	+	6	2041	c.1990C>A	c.(1990-1992)CAC>AAC	p.H664N	ZC3H12C_uc010rwc.1_Missense_Mutation_p.H665N|ZC3H12C_uc010rwd.1_Missense_Mutation_p.H665N|ZC3H12C_uc001pkr.3_Missense_Mutation_p.H633N	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	664							endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GAAGTGTCAACACATGCACCC	0.522													57	57	---	---	---	---	PASS
TREH	11181	broad.mit.edu	37	11	118529682	118529682	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118529682G>A	uc001pty.1	-	13	1522	c.1477C>T	c.(1477-1479)CAG>TAG	p.Q493*	TREH_uc009zaj.1_Nonsense_Mutation_p.Q462*|TREH_uc001ptz.1_Nonsense_Mutation_p.Q370*	NM_007180	NP_009111	O43280	TREA_HUMAN	trehalase precursor	493					polysaccharide digestion|trehalose catabolic process	anchored to plasma membrane	alpha,alpha-trehalase activity			pancreas(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		TGAGCCAGCTGGAAAGCCACT	0.577											OREG0021385	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	52	42	---	---	---	---	PASS
SRPR	6734	broad.mit.edu	37	11	126138751	126138751	+	Splice_Site	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126138751C>T	uc001qdh.2	-	1	1	c.-50_splice	c.e1-1		SRPR_uc010sbm.1_Splice_Site|FOXRED1_uc001qdi.2_5'Flank|FOXRED1_uc010sbn.1_5'Flank|FOXRED1_uc010sbo.1_5'Flank|FOXRED1_uc010sbp.1_5'Flank|FOXRED1_uc010sbq.1_5'Flank|FOXRED1_uc001qdj.2_5'Flank|FOXRED1_uc010sbr.1_5'Flank|FOXRED1_uc001qdk.2_5'Flank	NM_003139	NP_003130	P08240	SRPR_HUMAN	signal recognition particle receptor						SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		AGGCCGCGTTCGCCGCCGCTT	0.677													10	12	---	---	---	---	PASS
C1RL	51279	broad.mit.edu	37	12	7249214	7249214	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249214C>T	uc001qsn.2	-	6	1254	c.1237G>A	c.(1237-1239)GAG>AAG	p.E413K	C1RL_uc009zft.2_3'UTR	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	413	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						GAAAACACCTCGGGTCTCTGT	0.552													63	130	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9574030	9574030	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9574030T>G	uc010sgs.1	-	20	2201	c.2006A>C	c.(2005-2007)AAC>ACC	p.N669T	DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						TAGCGGCTGGTTGGAGACCCC	0.597													9	45	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19407999	19407999	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19407999C>T	uc001reb.2	+	5	418	c.332C>T	c.(331-333)TCT>TTT	p.S111F	PLEKHA5_uc010sie.1_Missense_Mutation_p.S111F|PLEKHA5_uc001rea.2_Missense_Mutation_p.S111F|PLEKHA5_uc009zin.2_5'UTR|PLEKHA5_uc010sif.1_Missense_Mutation_p.S3F|PLEKHA5_uc010sig.1_Missense_Mutation_p.S3F|PLEKHA5_uc010sih.1_Missense_Mutation_p.S3F	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	111							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ACCATGACATCTGAAGAAAAG	0.378													10	63	---	---	---	---	PASS
GYS2	2998	broad.mit.edu	37	12	21721862	21721862	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21721862C>T	uc001rfb.2	-	5	1015	c.760G>A	c.(760-762)GTG>ATG	p.V254M		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	254					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						GTGGTGAACACGTGAGCGCAA	0.428													30	53	---	---	---	---	PASS
SYT10	341359	broad.mit.edu	37	12	33532824	33532824	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33532824C>G	uc001rll.1	-	6	1740	c.1443G>C	c.(1441-1443)TGG>TGC	p.W481C	SYT10_uc009zju.1_Missense_Mutation_p.W291C	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	481	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GCATTTCATTCCAGTGGTCTC	0.463													42	78	---	---	---	---	PASS
OR10AD1	121275	broad.mit.edu	37	12	48596451	48596451	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48596451G>A	uc001rrl.1	-	1	625	c.625C>T	c.(625-627)CTC>TTC	p.L209F		NM_001004134	NP_001004134	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATGGGGCTGAGAATTACCACG	0.537													14	28	---	---	---	---	PASS
TMPRSS12	283471	broad.mit.edu	37	12	51279358	51279358	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51279358C>T	uc001rwx.3	+						TMPRSS12_uc001rwy.2_3'UTR	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor						proteolysis	integral to membrane	serine-type endopeptidase activity				0						TTTCTGCTGTCATCAGTAGGC	0.279													6	3	---	---	---	---	PASS
KRT74	121391	broad.mit.edu	37	12	52967248	52967248	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967248G>A	uc001sap.1	-	1	362	c.314C>T	c.(313-315)TCT>TTT	p.S105F		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	105	Head.|Gly-rich.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		TGGGCACACAGACAAACATGC	0.637													35	48	---	---	---	---	PASS
MDM2	4193	broad.mit.edu	37	12	69207366	69207366	+	Silent	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69207366A>G	uc001sui.2	+	3	419	c.132A>G	c.(130-132)TTA>TTG	p.L44L	MDM2_uc009zri.2_Silent_p.L44L|MDM2_uc009zqx.2_Silent_p.L44L|MDM2_uc009zqw.2_Silent_p.L44L|MDM2_uc001suk.2_Silent_p.L44L|MDM2_uc009zqy.1_Silent_p.L33L|MDM2_uc001sun.3_Silent_p.L33L|MDM2_uc009zqz.2_Silent_p.L38L|MDM2_uc009zra.2_Silent_p.L38L|MDM2_uc009zrb.1_RNA|MDM2_uc001sum.1_Silent_p.L33L|MDM2_uc009zrd.2_Intron|MDM2_uc009zrc.2_5'UTR|MDM2_uc009zre.2_Silent_p.L33L|MDM2_uc009zrf.2_Intron|MDM2_uc001suo.2_Intron|MDM2_uc009zrg.2_Intron|MDM2_uc009zrh.2_Intron	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2	38	Necessary for interaction with USP2.|SWIB.				cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TGAAGTTATTAAAGTCTGTTG	0.353			A		sarcoma|glioma|colorectal|other								45	80	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70986212	70986212	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70986212G>A	uc001swb.3	-	5	1006	c.976C>T	c.(976-978)CAC>TAC	p.H326Y	PTPRB_uc010sto.1_Missense_Mutation_p.H326Y|PTPRB_uc010stp.1_Missense_Mutation_p.H326Y|PTPRB_uc001swc.3_Missense_Mutation_p.H544Y|PTPRB_uc001swa.3_Missense_Mutation_p.H544Y|PTPRB_uc001swd.3_Missense_Mutation_p.H543Y|PTPRB_uc009zrr.1_Missense_Mutation_p.H423Y|PTPRB_uc001swe.2_Missense_Mutation_p.H544Y	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	326	Fibronectin type-III 4.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTCCCTTTGTGAGACAGGGTG	0.418													6	47	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199359	86199359	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199359G>A	uc001taf.1	-	2	768	c.429C>T	c.(427-429)CTC>CTT	p.L143L		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	143					endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TTGCTGGGCTGAGCTCCCACA	0.398													88	135	---	---	---	---	PASS
USP44	84101	broad.mit.edu	37	12	95918479	95918479	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95918479G>C	uc001teg.2	-	4	1854	c.1710C>G	c.(1708-1710)CTC>CTG	p.L570L	USP44_uc001teh.2_Silent_p.L570L|USP44_uc009zte.2_Silent_p.L567L	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN	ubiquitin thiolesterase 44	570					anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)|breast(1)|central_nervous_system(1)	3						GGTGCAGTCTGAGAACCTGAG	0.403													33	35	---	---	---	---	PASS
BTBD11	121551	broad.mit.edu	37	12	108008937	108008937	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108008937C>T	uc001tmk.1	+	7	2520	c.1999C>T	c.(1999-2001)CAG>TAG	p.Q667*	BTBD11_uc009zut.1_Nonsense_Mutation_p.Q667*|BTBD11_uc001tmj.2_Nonsense_Mutation_p.Q667*|BTBD11_uc001tml.1_Nonsense_Mutation_p.Q204*	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	667	ANK 2.					integral to membrane	DNA binding			skin(2)|ovary(1)	3						TCCTGTAGTTCAGGTATTAAC	0.438													8	33	---	---	---	---	PASS
SDS	10993	broad.mit.edu	37	12	113830871	113830871	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113830871C>T	uc001tvg.2	-	8	984	c.862G>A	c.(862-864)GAG>AAG	p.E288K		NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	288					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	AGATTCCCCTCCAGTTGGAGC	0.652													57	92	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	A	A	rs12366766		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547087G>A	uc001ujn.2	+	46	8210	c.8175G>A	c.(8173-8175)CAG>CAA	p.Q2725Q	EP400_uc001ujl.2_Silent_p.Q2724Q|EP400_uc001ujm.2_Silent_p.Q2644Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.289													7	42	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25074482	25074482	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25074482C>T	uc001upl.2	-	4	479	c.373G>A	c.(373-375)GAG>AAG	p.E125K	PARP4_uc010tdc.1_Missense_Mutation_p.E125K	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	125					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCTTCCTCCTCTGTGGCACTG	0.398													26	55	---	---	---	---	PASS
N4BP2L2	10443	broad.mit.edu	37	13	33110210	33110210	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33110210C>A	uc001uuk.3	-	2	1133	c.955G>T	c.(955-957)GTA>TTA	p.V319L	N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron|N4BP2L2_uc001uul.1_Missense_Mutation_p.V319L|N4BP2L2_uc001uum.2_5'Flank	NM_014887	NP_055702	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5	319											0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		CAATTATTTACATAATATCCA	0.348													22	49	---	---	---	---	PASS
FAM48A	55578	broad.mit.edu	37	13	37618294	37618294	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37618294T>C	uc001uwg.2	-	7	565	c.317A>G	c.(316-318)TAT>TGT	p.Y106C	FAM48A_uc010abt.2_Missense_Mutation_p.Y107C|FAM48A_uc001uwh.2_Missense_Mutation_p.Y107C|FAM48A_uc001uwi.2_Missense_Mutation_p.Y106C|FAM48A_uc001uwj.2_Missense_Mutation_p.Y107C|FAM48A_uc001uwk.2_Missense_Mutation_p.Y106C|FAM48A_uc010tes.1_Missense_Mutation_p.Y94C|FAM48A_uc001uwl.1_Missense_Mutation_p.Y106C	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A	106					autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		TCCTTCTTCATAGGGCAGTCG	0.338													26	27	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49752710	49752710	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49752710G>A	uc001vcm.2	+	14	1842	c.1537G>A	c.(1537-1539)GGT>AGT	p.G513S	FNDC3A_uc001vcn.2_Missense_Mutation_p.G513S|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Missense_Mutation_p.G439S|FNDC3A_uc001vcq.2_Missense_Mutation_p.G457S	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	513	Fibronectin type-III 3.					Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CCAGGGATATGGTTTTAAGCC	0.338													9	24	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76409323	76409323	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76409323C>T	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Missense_Mutation_p.R705W|LMO7_uc001vjw.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GCCATTTATACGGCATAAAAC	0.393													18	28	---	---	---	---	PASS
ABCC4	10257	broad.mit.edu	37	13	95726579	95726579	+	Splice_Site	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95726579C>T	uc001vmd.3	-	23	2926	c.2807_splice	c.e23-1	p.E936_splice	ABCC4_uc010afk.2_Splice_Site_p.E889_splice	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	AACCAAGCCTCTGAATTTGAG	0.458													7	15	---	---	---	---	PASS
DNAJC3	5611	broad.mit.edu	37	13	96361561	96361561	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96361561G>A	uc001vmq.2	+	2	271	c.163G>A	c.(163-165)GAT>AAT	p.D55N	DNAJC3_uc001vmp.2_Missense_Mutation_p.D55N|DNAJC3_uc001vmr.2_Missense_Mutation_p.D55N	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	55	TPR 1.				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			ACAGCTAGCTGATGCTTTATC	0.358													10	47	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861189	108861189	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861189G>C	uc001vqn.2	-	2	2701	c.2428C>G	c.(2428-2430)CTC>GTC	p.L810V	LIG4_uc001vqo.2_Missense_Mutation_p.L810V|LIG4_uc010agg.1_Missense_Mutation_p.L743V|LIG4_uc010agf.2_Missense_Mutation_p.L810V|LIG4_uc001vqp.2_Missense_Mutation_p.L810V	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	810	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					AACATACTGAGAGGAGAGCAA	0.403								NHEJ					21	43	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113730363	113730363	+	Silent	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113730363T>A	uc001vsu.2	+	12	1585	c.1563T>A	c.(1561-1563)GCT>GCA	p.A521A	MCF2L_uc001vsq.2_Silent_p.A521A|MCF2L_uc010tjr.1_Silent_p.A464A|MCF2L_uc001vsr.2_Silent_p.A468A|MCF2L_uc001vss.3_Silent_p.A462A|MCF2L_uc010tjs.1_Silent_p.A462A|MCF2L_uc001vst.1_Silent_p.A426A	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	494					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GCGCGGAGGCTGCCCTCCAGG	0.522													12	15	---	---	---	---	PASS
CDC16	8881	broad.mit.edu	37	13	115008757	115008757	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115008757C>T	uc001vuk.1	+	7	765	c.567C>T	c.(565-567)CCC>CCT	p.P189P	CDC16_uc010tkm.1_3'UTR|CDC16_uc001vul.1_Silent_p.P189P|CDC16_uc001vum.1_Silent_p.P95P|CDC16_uc001vun.1_Silent_p.P188P|CDC16_uc001vuo.1_Silent_p.P188P	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6	189					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AATCACTACCCCTTAGCAAGC	0.308													21	58	---	---	---	---	PASS
RNASE9	390443	broad.mit.edu	37	14	21025034	21025034	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21025034G>A	uc010aho.2	-	4	354	c.195C>T	c.(193-195)GTC>GTT	p.V65V	RNASE9_uc001vxq.3_Silent_p.V70V|RNASE9_uc010ahp.2_Silent_p.V70V|RNASE9_uc010ahq.2_Silent_p.V70V|RNASE9_uc010ahr.2_Silent_p.V70V|RNASE9_uc010ahs.2_Silent_p.V65V|RNASE9_uc010aht.2_Silent_p.V65V|RNASE9_uc010ahu.2_Silent_p.V65V	NM_001110357	NP_001103827	P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	65						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(2)	2	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		CACGTCTTTTGACTTTTTCTT	0.363													46	70	---	---	---	---	PASS
FLJ10357	55701	broad.mit.edu	37	14	21556227	21556227	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21556227C>T	uc001vzp.2	+	22	4517	c.4488C>T	c.(4486-4488)GCC>GCT	p.A1496A	FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_Silent_p.A734A	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	1496					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		CCACCCTGGCCAGTCGAGGGA	0.567													22	23	---	---	---	---	PASS
PSME1	5720	broad.mit.edu	37	14	24607886	24607886	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24607886G>A	uc001wmg.2	+						PSME1_uc001wmh.2_3'UTR	NM_006263	NP_006254	Q06323	PSME1_HUMAN	proteasome activator subunit 1 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|proteasome activator complex				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00831)		CACAAGGCTAGAAATGGGGCA	0.577													22	14	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	32902953	32902953	+	Missense_Mutation	SNP	G	A	A	rs148757348		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32902953G>A	uc001wrq.2	+	2	424	c.254G>A	c.(253-255)CGA>CAA	p.R85Q	AKAP6_uc010aml.2_Missense_Mutation_p.R82Q	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	85					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GAGAGGGTCCGAGACCTAACC	0.502													20	17	---	---	---	---	PASS
FOXN3	1112	broad.mit.edu	37	14	89629013	89629013	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89629013C>A	uc001xxo.3	-	7	1355	c.1218G>T	c.(1216-1218)AAG>AAT	p.K406N	FOXN3_uc001xxn.3_Missense_Mutation_p.K384N|FOXN3_uc010atk.2_Missense_Mutation_p.K384N	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1	406					DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						CCAGAGAATCCTTGGGCTCCT	0.647													4	41	---	---	---	---	PASS
CALM1	801	broad.mit.edu	37	14	90867659	90867659	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90867659A>G	uc001xyl.1	+	3	293	c.91A>G	c.(91-93)AAG>GAG	p.K31E	CALM1_uc010atq.1_Missense_Mutation_p.K32E|CALM1_uc010atr.1_RNA|CALM1_uc001xym.1_5'UTR	NM_006888	NP_008819	P62158	CALM_HUMAN	calmodulin 1 isoform 1	31	1.|EF-hand 1.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			central_nervous_system(1)	1		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	CATCACAACAAAGGAACTTGG	0.413													56	27	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088400	94088400	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088400G>A	uc001ybv.1	+	28	4439	c.4356G>A	c.(4354-4356)CTG>CTA	p.L1452L	KIAA1409_uc001ybs.1_Silent_p.L1430L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1607						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ATTTAGATCTGATAGATCTAT	0.473													13	35	---	---	---	---	PASS
TCL1B	9623	broad.mit.edu	37	14	96152883	96152883	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96152883G>A	uc001yez.2	+	1	121	c.79G>A	c.(79-81)GAG>AAG	p.E27K	TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_Intron|TCL1B_uc010avj.2_Intron|TCL1B_uc001yfa.2_Missense_Mutation_p.E27K	NM_004918	NP_004909	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	27										ovary(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		CTACGAAGATGAGGAGGGGAG	0.642													22	25	---	---	---	---	PASS
PACS2	23241	broad.mit.edu	37	14	105859633	105859633	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105859633C>G	uc001yqt.2	+	23	2687	c.2512C>G	c.(2512-2514)CTC>GTC	p.L838V	PACS2_uc001yqs.2_Missense_Mutation_p.L763V|PACS2_uc001yqv.2_Missense_Mutation_p.L842V|PACS2_uc001yqu.2_Missense_Mutation_p.L853V	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	838					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CATCAGCCGGCTCATCTGCAC	0.602													16	23	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21937838	21937838	+	RNA	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21937838C>T	uc010tzj.1	-	1		c.2902G>A				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						TCTGGCATGCCAGTGAATTCT	0.433													46	395	---	---	---	---	PASS
OTUD7A	161725	broad.mit.edu	37	15	31862286	31862286	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31862286C>T	uc001zfq.2	-	2	359	c.266G>A	c.(265-267)CGA>CAA	p.R89Q	OTUD7A_uc001zfr.2_Missense_Mutation_p.R89Q|OTUD7A_uc001zfs.1_RNA|OTUD7A_uc010baa.1_Missense_Mutation_p.R89Q	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	89						cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		CTGTGGCTCTCGCTCTGGCTG	0.642													3	44	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43552715	43552715	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43552715C>T	uc001zrd.1	-	2	81	c.73G>A	c.(73-75)GAG>AAG	p.E25K	TGM5_uc001zre.1_Missense_Mutation_p.E25K	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	25					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	ACAGTGATCTCCTCCGTGTGG	0.582													41	77	---	---	---	---	PASS
PARP6	56965	broad.mit.edu	37	15	72552924	72552924	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72552924C>T	uc002auc.2	-	9	1110	c.651G>A	c.(649-651)ATG>ATA	p.M217I	PARP6_uc002aua.2_Missense_Mutation_p.M82I|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Missense_Mutation_p.M217I	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	217							NAD+ ADP-ribosyltransferase activity				0						TGGGGTTCTTCATGGTACAGG	0.587													202	349	---	---	---	---	PASS
CCDC33	80125	broad.mit.edu	37	15	74588272	74588272	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74588272G>A	uc002axo.2	+	11	1667	c.1273G>A	c.(1273-1275)GAG>AAG	p.E425K	CCDC33_uc002axp.2_Missense_Mutation_p.E247K	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	628							protein binding			ovary(3)|skin(2)	5						TCTGGTGCCTGAGATGTCCCA	0.587													7	12	---	---	---	---	PASS
SH3GL3	6457	broad.mit.edu	37	15	84233946	84233946	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84233946C>A	uc002bjw.2	+	3	370	c.175C>A	c.(175-177)CAG>AAG	p.Q59K	SH3GL3_uc010bms.2_Missense_Mutation_p.Q59K|SH3GL3_uc010uot.1_Missense_Mutation_p.Q59K|SH3GL3_uc002bjx.2_5'UTR|SH3GL3_uc002bju.2_Missense_Mutation_p.Q67K|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	59	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						TGAATATCTTCAGCCAAATCC	0.294													16	34	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89379446	89379446	+	Silent	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89379446T>A	uc010upo.1	+	2	383	c.9T>A	c.(7-9)ACT>ACA	p.T3T	ACAN_uc002bmx.2_Silent_p.T3T|ACAN_uc010upp.1_Silent_p.T3T|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	3					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTATGACCACTTTACTCTGGG	0.468													4	14	---	---	---	---	PASS
RHBDL1	9028	broad.mit.edu	37	16	726483	726483	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:726483G>A	uc002cis.1	+	1	409	c.382G>A	c.(382-384)GAG>AAG	p.E128K	RHBDL1_uc002cir.1_Missense_Mutation_p.E63K|RHBDL1_uc010uun.1_Missense_Mutation_p.E63K	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid protease 1	128					proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)				CTGCTACCAGGAGCTGGTGGA	0.706													9	9	---	---	---	---	PASS
RHBDL1	9028	broad.mit.edu	37	16	726497	726497	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:726497G>A	uc002cis.1	+	1	423	c.396G>A	c.(394-396)CTG>CTA	p.L132L	RHBDL1_uc002cir.1_Silent_p.L67L|RHBDL1_uc010uun.1_Silent_p.L67L	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid protease 1	132					proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)				TGGTGGACCTGGTCAGTGCCA	0.706													14	7	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1398294	1398294	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1398294G>C	uc002clk.1	+	33	3452	c.3452G>C	c.(3451-3453)AGA>ACA	p.R1151T	BAIAP3_uc002clj.2_Missense_Mutation_p.R1133T|BAIAP3_uc010uuz.1_Missense_Mutation_p.R1116T|BAIAP3_uc010uva.1_Missense_Mutation_p.R1088T|BAIAP3_uc010uvc.1_Missense_Mutation_p.R1080T	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1151					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TGCCGGCCCAGAGCCCAGGGT	0.731													2	12	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3820792	3820792	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3820792G>A	uc002cvv.2	-	14	2863	c.2659C>T	c.(2659-2661)CAG>TAG	p.Q887*	CREBBP_uc002cvw.2_Nonsense_Mutation_p.Q849*	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	887					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTTGATGGCTGAGTGGGAGCT	0.642			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				40	14	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3820952	3820952	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3820952G>C	uc002cvv.2	-	14	2703	c.2499C>G	c.(2497-2499)CTC>CTG	p.L833L	CREBBP_uc002cvw.2_Silent_p.L795L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	833					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCAGCATGTTGAGAGGGTTAG	0.542			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				58	27	---	---	---	---	PASS
GLYR1	84656	broad.mit.edu	37	16	4862198	4862198	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4862198G>A	uc002cxx.3	-	13	1208	c.1171C>T	c.(1171-1173)CAG>TAG	p.Q391*	GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Nonsense_Mutation_p.Q305*|GLYR1_uc002cya.2_Nonsense_Mutation_p.Q385*|GLYR1_uc010uxv.1_Nonsense_Mutation_p.Q310*	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN	cytokine-like nuclear factor n-pac	391					pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0						GACAGCTGCTGATTCCCTGAG	0.587													4	24	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14340888	14340888	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14340888G>C	uc010uza.1	+	12	1926	c.1771G>C	c.(1771-1773)GAG>CAG	p.E591Q	MKL2_uc002dcg.2_Missense_Mutation_p.E591Q|MKL2_uc002dcj.2_5'Flank	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein	580	Required for interaction with itself and with MKL1.|Potential.				cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						ACTGGAACAAGAGCAGAAGCT	0.532													7	38	---	---	---	---	PASS
NOMO1	23420	broad.mit.edu	37	16	14989571	14989571	+	3'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14989571G>A	uc002dcv.2	+	31						NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						CTACCCGCCCGTGGGATAAAA	0.592													47	88	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													5	52	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23646501	23646501	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23646501C>G	uc002dlx.1	-	4	1566	c.1366G>C	c.(1366-1368)GAG>CAG	p.E456Q		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	456					double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		TCAGTTTCCTCATTGGAAAGG	0.378			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				33	86	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28893844	28893844	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28893844G>A	uc002dro.1	+	5	581	c.397G>A	c.(397-399)GAC>AAC	p.D133N	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.D133N|ATP2A1_uc002drp.1_Missense_Mutation_p.D8N	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	133	Cytoplasmic (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTACCGGGCTGACCGCAAGTC	0.627													14	44	---	---	---	---	PASS
CD19	930	broad.mit.edu	37	16	28950083	28950083	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28950083G>A	uc002drs.2	+	13	1635	c.1573G>A	c.(1573-1575)GAG>AAG	p.E525K	uc010vct.1_Intron|CD19_uc010byo.1_Missense_Mutation_p.E526K	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	525	Cytoplasmic (Potential).				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						ACCCAATCATGAGGAAGGTGG	0.622													21	31	---	---	---	---	PASS
PPP4C	5531	broad.mit.edu	37	16	30092610	30092610	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30092610G>A	uc002dwe.2	+	3	273	c.129G>A	c.(127-129)CAG>CAA	p.Q43Q	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|PPP4C_uc002dwf.2_Silent_p.Q43Q|PPP4C_uc002dwg.2_RNA|PPP4C_uc002dwh.2_Intron	NM_002720	NP_002711	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	43					microtubule cytoskeleton organization|regulation of double-strand break repair via homologous recombination	centrosome|nucleus	metal ion binding|NF-kappaB-inducing kinase activity|protein binding|protein serine/threonine phosphatase activity			skin(1)	1						GCAACGTGCAGAGGGTGGACT	0.567													7	110	---	---	---	---	PASS
ZNF688	146542	broad.mit.edu	37	16	30581215	30581215	+	3'UTR	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30581215C>T	uc002dyt.2	-	3					ZNF688_uc002dys.2_3'UTR|uc002dyu.2_5'Flank	NM_145271	NP_660314	P0C7X2	ZN688_HUMAN	zinc finger protein 688 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGGTCAGGCTCAACTCCAGCC	0.642													16	34	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31499695	31499695	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31499695C>T	uc002ecf.3	+						SLC5A2_uc010car.2_Intron|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						GGTGGCCTCTCTCTGGCAGAC	0.701													3	30	---	---	---	---	PASS
ITFG1	81533	broad.mit.edu	37	16	47347638	47347638	+	Splice_Site	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47347638A>G	uc002eet.2	-	9	959	c.897_splice	c.e9+1	p.Q299_splice	ITFG1_uc010vgg.1_Splice_Site_p.Q44_splice|ITFG1_uc010vgh.1_Splice_Site_p.Q186_splice	NM_030790	NP_110417	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1							extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				AACTTGATATACCTGCTTCAT	0.363													18	31	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53504333	53504333	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53504333G>C	uc002ehi.3	+	16	2402	c.2284G>C	c.(2284-2286)GTC>CTC	p.V762L	RBL2_uc002ehj.2_Missense_Mutation_p.V472L|RBL2_uc010vgw.1_Intron	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	762	Spacer.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						ATTCTTCCCTGTCCAAGTCAA	0.502													12	36	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53878094	53878094	+	Missense_Mutation	SNP	C	T	T	rs76762929	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53878094C>T	uc002ehr.2	+	4	1001	c.779C>T	c.(778-780)TCT>TTT	p.S260F	FTO_uc010vha.1_5'UTR	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	260	Fe2OG dioxygenase domain.				DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GAGGATGACTCTCATCTCGAA	0.403													21	34	---	---	---	---	PASS
IRX3	79191	broad.mit.edu	37	16	54319259	54319259	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54319259G>A	uc002eht.1	-	2	950	c.534C>T	c.(532-534)TTC>TTT	p.F178F		NM_024336	NP_077312	P78415	IRX3_HUMAN	iroquois homeobox 3	178	Homeobox; TALE-type.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCGCGTTGGCGAACCAGGTGG	0.607													24	52	---	---	---	---	PASS
DOK4	55715	broad.mit.edu	37	16	57509424	57509424	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57509424C>A	uc010cdb.2	-	3	581	c.283G>T	c.(283-285)GAC>TAC	p.D95Y	DOK4_uc002elu.1_Missense_Mutation_p.D95Y|DOK4_uc002elv.3_Missense_Mutation_p.D95Y	NM_018110	NP_060580	Q8TEW6	DOK4_HUMAN	docking protein 4	95	PH.						insulin receptor binding			skin(1)	1						TCACCTGAGTCGCAGGTGAAG	0.617													4	10	---	---	---	---	PASS
AP1G1	164	broad.mit.edu	37	16	71805129	71805129	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71805129G>A	uc010cgg.2	-	5	809	c.495C>T	c.(493-495)ATC>ATT	p.I165I	AP1G1_uc002fba.2_Silent_p.I165I|AP1G1_uc002fbb.2_Silent_p.I188I|AP1G1_uc010vmg.1_RNA|AP1G1_uc010vmh.1_Silent_p.I247I	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	165					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				GAACTTTCCTGATGACATGAA	0.318													15	18	---	---	---	---	PASS
PMFBP1	83449	broad.mit.edu	37	16	72159145	72159145	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72159145C>T	uc002fcc.3	-	16	2600	c.2428G>A	c.(2428-2430)GAG>AAG	p.E810K	PMFBP1_uc002fcd.2_Missense_Mutation_p.E805K|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.E660K|PMFBP1_uc010cgo.1_Missense_Mutation_p.E101K	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	810	Potential.									ovary(2)	2		Ovarian(137;0.179)				ACCTCCAGCTCACTCTCCTGG	0.498											OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	106	---	---	---	---	PASS
NECAB2	54550	broad.mit.edu	37	16	84028251	84028251	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84028251G>C	uc002fhd.2	+	8	770	c.753G>C	c.(751-753)CAG>CAC	p.Q251H	NECAB2_uc002fhe.2_Missense_Mutation_p.Q168H	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2	251					antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						TGGAAGCCCAGATCAGCCGCT	0.602													5	31	---	---	---	---	PASS
LRRC50	123872	broad.mit.edu	37	16	84182710	84182710	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84182710G>A	uc002fhl.3	+	2	404	c.223G>A	c.(223-225)GCA>ACA	p.A75T	LRRC50_uc010chi.1_RNA	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	75			Missing (in CILD13).		axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						TGGTCACTTCGCACACCCAAG	0.413									Kartagener_syndrome				33	48	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3433367	3433367	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3433367G>A	uc002fvt.1	-	9	1518	c.1196C>T	c.(1195-1197)ACG>ATG	p.T399M	TRPV3_uc002fvs.1_RNA|TRPV3_uc010vrh.1_Missense_Mutation_p.T383M|TRPV3_uc010vri.1_Missense_Mutation_p.T354M|TRPV3_uc010vrj.1_Missense_Mutation_p.T383M|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.T383M|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.T399M|TRPV3_uc002fvu.2_Missense_Mutation_p.T399M|TRPV3_uc010vrn.1_Translation_Start_Site	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	399	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	TGAGTTGTCCGTGGTGGTGTC	0.607													30	18	---	---	---	---	PASS
GPS2	2874	broad.mit.edu	37	17	7217458	7217458	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7217458G>T	uc002gfv.1	-	4	601	c.338C>A	c.(337-339)TCA>TAA	p.S113*	GPS2_uc002gfw.1_Nonsense_Mutation_p.S75*|GPS2_uc002gfx.1_Nonsense_Mutation_p.S113*|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Nonsense_Mutation_p.S113*	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2	113					cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)				GTATGCAGCTGATGTTAGGGT	0.488													54	36	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10219314	10219314	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10219314A>G	uc002gmk.1	-	28	3857	c.3767T>C	c.(3766-3768)GTA>GCA	p.V1256A		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1256	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TTGATCTTCTACCGTCCGGCA	0.428													17	39	---	---	---	---	PASS
GRAP	10750	broad.mit.edu	37	17	18927599	18927599	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18927599C>T	uc002guy.2	-	4	494	c.397G>A	c.(397-399)GAC>AAC	p.D133N		NM_006613	NP_006604	Q13588	GRAP_HUMAN	GRB2-related adaptor protein	133	SH2.				cell-cell signaling|Ras protein signal transduction	cytoplasm	SH3/SH2 adaptor activity				0	all_cancers(12;0.0183)					CGGTAGAAGTCGACCAGCTCG	0.617													5	3	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27437053	27437053	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27437053C>T	uc002hdt.1	-	19	3312	c.3154G>A	c.(3154-3156)GAG>AAG	p.E1052K	MYO18A_uc010wbc.1_Missense_Mutation_p.E594K|MYO18A_uc002hds.2_Missense_Mutation_p.E594K|MYO18A_uc010csa.1_Missense_Mutation_p.E1052K|MYO18A_uc002hdu.1_Missense_Mutation_p.E1052K|MYO18A_uc010wbd.1_Missense_Mutation_p.E721K	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1052	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GCCCAGCCCTCAGCTACAGGC	0.647													8	24	---	---	---	---	PASS
ACCN1	40	broad.mit.edu	37	17	31344625	31344625	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31344625C>G	uc002hhu.2	-	8	1640	c.1366G>C	c.(1366-1368)GAG>CAG	p.E456Q	ACCN1_uc002hht.2_Missense_Mutation_p.E507Q	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	456	Cytoplasmic (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding	p.L456fs*2(1)		ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	AATCTTACCTCATAAATATAA	0.473													13	24	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34183340	34183340	+	Intron	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34183340C>T	uc002hke.1	-						C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Intron|C17orf66_uc010wcm.1_3'UTR	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957								binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		ATGCTAATTTCATTCATTTCC	0.458													6	12	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37872839	37872839	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37872839C>T	uc002hso.2	+	14	1956	c.1718C>T	c.(1717-1719)TCA>TTA	p.S573L	ERBB2_uc002hsm.2_Missense_Mutation_p.S543L|ERBB2_uc010cwa.2_Missense_Mutation_p.S558L|ERBB2_uc002hsp.2_Missense_Mutation_p.S376L|ERBB2_uc010cwb.2_Missense_Mutation_p.S573L|ERBB2_uc010wek.1_Missense_Mutation_p.S297L|ERBB2_uc002hsl.2_Missense_Mutation_p.S543L	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	573	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	CAGAATGGCTCAGTGACCTGT	0.637		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			10	19	---	---	---	---	PASS
KRTAP4-7	100132476	broad.mit.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	C	C	rs139671425	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39240627T>C	uc010wfn.1	+	1	169	c.169T>C	c.(169-171)TCT>CCT	p.S57P		NM_033061	NP_149050			keratin associated protein 4-7												0						GTGCTGCCAGTCTGTGTGCTG	0.493													3	50	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41355748	41355748	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41355748C>T	uc010czd.2	+	20	2812	c.2672C>T	c.(2671-2673)TCT>TTT	p.S891F	NBR1_uc010diz.2_Missense_Mutation_p.S891F|NBR1_uc010whu.1_Missense_Mutation_p.S891F|NBR1_uc010whv.1_Missense_Mutation_p.S891F|NBR1_uc010whw.1_Intron	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	891					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GGGGCTTTGTCTGTTGCTGCC	0.493													7	11	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41355760	41355760	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41355760C>T	uc010czd.2	+	20	2824	c.2684C>T	c.(2683-2685)TCT>TTT	p.S895F	NBR1_uc010diz.2_Missense_Mutation_p.S895F|NBR1_uc010whu.1_Missense_Mutation_p.S895F|NBR1_uc010whv.1_Missense_Mutation_p.S895F|NBR1_uc010whw.1_Intron	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	895					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GTTGCTGCCTCTGCATACAAG	0.502													7	10	---	---	---	---	PASS
HEXIM1	10614	broad.mit.edu	37	17	43227360	43227360	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43227360C>T	uc002iig.2	+	1	2677	c.803C>T	c.(802-804)TCG>TTG	p.S268L		NM_006460	NP_006451	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	268					negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding			ovary(1)	1						CGGGACTTCTCGGAGACGTAC	0.602													19	31	---	---	---	---	PASS
DLX3	1747	broad.mit.edu	37	17	48070801	48070801	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48070801G>A	uc002ipy.2	-	2	705	c.479C>T	c.(478-480)GCC>GTC	p.A160V		NM_005220	NP_005211	O60479	DLX3_HUMAN	distal-less homeobox 3	160	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGCCAGCTCGGCGCGCTCGGG	0.711													3	14	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53345431	53345431	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53345431G>C	uc002iug.1	+	2	960	c.435G>C	c.(433-435)CAG>CAC	p.Q145H	HLF_uc010dce.1_Missense_Mutation_p.Q60H|HLF_uc002iuh.2_Missense_Mutation_p.Q60H|HLF_uc010wni.1_Missense_Mutation_p.R94T	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	145					multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						ACTGTATGCAGAGCCCCATCA	0.582			T	TCF3	ALL								34	61	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62865278	62865278	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62865278G>C	uc002jey.2	-	8	3444	c.2913C>G	c.(2911-2913)CTC>CTG	p.L971L	LRRC37A3_uc010wqg.1_Silent_p.L89L|LRRC37A3_uc010wqf.1_Silent_p.L9L|LRRC37A3_uc010dek.1_5'UTR	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	971	Extracellular (Potential).|LRR 8.					integral to membrane					0						GATTGTGATTGAGAATTCTGA	0.318													32	104	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67270112	67270112	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67270112G>A	uc002jif.2	-	19	3970	c.2752C>T	c.(2752-2754)CAA>TAA	p.Q918*	ABCA5_uc002jic.2_Nonsense_Mutation_p.Q141*|ABCA5_uc002jid.2_5'UTR|ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_Nonsense_Mutation_p.Q918*|ABCA5_uc002jih.2_Nonsense_Mutation_p.Q918*|ABCA5_uc010dfe.2_Nonsense_Mutation_p.Q918*	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	918					cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					GCAGAATTTTGAAGAAGCAGA	0.393													34	49	---	---	---	---	PASS
GGA3	23163	broad.mit.edu	37	17	73235955	73235955	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73235955C>A	uc002jni.1	-	13	1507	c.1498G>T	c.(1498-1500)GTC>TTC	p.V500F	GGA3_uc002jnj.1_Missense_Mutation_p.V467F|GGA3_uc010wrw.1_Missense_Mutation_p.V378F|GGA3_uc002jnk.1_Missense_Mutation_p.V428F|GGA3_uc010wrx.1_Missense_Mutation_p.V378F|GGA3_uc010wry.1_Missense_Mutation_p.V428F	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	ADP-ribosylation factor binding protein 3	500	Unstructured hinge.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|breast(1)	2			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			TGCCCAGGGACTGCGGGCTCA	0.617													8	24	---	---	---	---	PASS
FSCN2	25794	broad.mit.edu	37	17	79496104	79496104	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79496104C>G	uc010wup.1	+	1	688	c.547C>G	c.(547-549)CGG>GGG	p.R183G	FSCN2_uc010wuo.1_Missense_Mutation_p.R183G	NM_012418	NP_036550	O14926	FSCN2_HUMAN	fascin 2 isoform 1	183					actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CCGGAGCCGACGGTACTGCCT	0.682													4	7	---	---	---	---	PASS
RAB40B	10966	broad.mit.edu	37	17	80616446	80616446	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80616446G>T	uc002kft.2	-	5	612	c.486C>A	c.(484-486)AAC>AAA	p.N162K	RAB40B_uc002kfs.2_RNA	NM_006822	NP_006813	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	162					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ACTCTGTGATGTTGAAATTGC	0.652													3	87	---	---	---	---	PASS
TYMS	7298	broad.mit.edu	37	18	670747	670747	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:670747G>A	uc010dka.1	+	5	751	c.612G>A	c.(610-612)GTG>GTA	p.V204V	TYMS_uc010dkb.1_Silent_p.V170V|TYMS_uc010dkc.1_Silent_p.V121V	NM_001071	NP_001062	P04818	TYSY_HUMAN	thymidylate synthase	204					DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity				0					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)	TCTATGTGGTGAACAGTGAGC	0.552													32	45	---	---	---	---	PASS
TYMS	7298	broad.mit.edu	37	18	670754	670754	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:670754G>A	uc010dka.1	+	5	758	c.619G>A	c.(619-621)GAG>AAG	p.E207K	TYMS_uc010dkb.1_Missense_Mutation_p.E173K|TYMS_uc010dkc.1_Missense_Mutation_p.E124K	NM_001071	NP_001062	P04818	TYSY_HUMAN	thymidylate synthase	207					DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity				0					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)	GGTGAACAGTGAGCTGTCCTG	0.567													30	46	---	---	---	---	PASS
CHMP1B	57132	broad.mit.edu	37	18	11851604	11851604	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11851604G>A	uc002kqe.2	+	1	216	c.94G>A	c.(94-96)GAA>AAA	p.E32K	GNAL_uc002kqc.2_Intron|GNAL_uc010dkz.2_Intron|GNAL_uc002kqd.2_Intron	NM_020412	NP_065145	Q7LBR1	CHM1B_HUMAN	chromatin modifying protein 1B	32	Potential.				cell cycle|cell division|protein transport	cytosol|late endosome membrane	protein domain specific binding				0						GGAAAAGGCCGAAAAGGCCAA	0.473													6	9	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358													4	37	---	---	---	---	PASS
RPRD1A	55197	broad.mit.edu	37	18	33607165	33607165	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33607165G>A	uc002kzf.1	-	5	601	c.595C>T	c.(595-597)CTA>TTA	p.L199L	RPRD1A_uc002kze.1_Silent_p.L163L|RPRD1A_uc002kzg.2_Silent_p.L199L|RPRD1A_uc010dmw.2_Silent_p.L163L|RPRD1A_uc010dmx.2_Silent_p.L199L	NM_018170	NP_060640	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing	199										ovary(1)|breast(1)	2						TTATCTAATAGAGATACTTCT	0.368													26	60	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47363122	47363122	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47363122C>G	uc002leb.2	-	38	5560	c.5272G>C	c.(5272-5274)GAG>CAG	p.E1758Q	MYO5B_uc002ldz.2_Missense_Mutation_p.E328Q|MYO5B_uc002lea.2_Missense_Mutation_p.E873Q	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	1758	Dilute.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CAGATAGCCTCTGCGTCCTCC	0.532													23	30	---	---	---	---	PASS
REXO1	57455	broad.mit.edu	37	19	1818820	1818820	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1818820G>A	uc002lua.3	-	9	2882	c.2787C>T	c.(2785-2787)CTC>CTT	p.L929L	REXO1_uc010dsq.2_Silent_p.L238L|REXO1_uc010xgs.1_5'UTR|MIR1909_hsa-mir-1909|MI0008330_5'Flank|REXO1_uc010dsp.1_RNA	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	929						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTACTCCCTGAGGCGGCTGT	0.677													8	17	---	---	---	---	PASS
TICAM1	148022	broad.mit.edu	37	19	4816641	4816641	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4816641C>A	uc002mbi.2	-	2	2000	c.1749G>T	c.(1747-1749)CAG>CAT	p.Q583H		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	583	Sufficient to induce apoptosis.				apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GCTGCTCCATCTGTGCCTGGT	0.632													5	42	---	---	---	---	PASS
TICAM1	148022	broad.mit.edu	37	19	4816911	4816911	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4816911C>G	uc002mbi.2	-	2	1730	c.1479G>C	c.(1477-1479)GAG>GAC	p.E493D		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	493				E->A: Loss of TCAM1-induced NF-kappa-B and IRF3 activation.	apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CCGGGGAGCTCTCCAGGGGCA	0.652													6	29	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7267597	7267597	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7267597C>T	uc002mgd.1	-	2	520	c.411G>A	c.(409-411)ATG>ATA	p.M137I	INSR_uc002mge.1_Missense_Mutation_p.M137I|INSR_uc002mgf.2_Missense_Mutation_p.M137I	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	137					activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GGGTGATGTTCATCAGGTTGT	0.522													15	44	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8999519	8999519	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8999519G>C	uc002mkp.2	-	56	40860	c.40656C>G	c.(40654-40656)ACC>ACG	p.T13552T	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.T369T|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGGGCGGTAGGTGCAGATGG	0.597													40	63	---	---	---	---	PASS
QTRT1	81890	broad.mit.edu	37	19	10812162	10812162	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10812162C>T	uc002mpr.2	+	1	51	c.26C>T	c.(25-27)TCC>TTC	p.S9F		NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	9					queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity			skin(1)	1			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			ACCCAGGCTTCCCTGGAGTCG	0.692													3	14	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11123707	11123707	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11123707C>A	uc002mqf.3	+	16	2641	c.2357C>A	c.(2356-2358)ACC>AAC	p.T786N	SMARCA4_uc010dxp.2_Missense_Mutation_p.T786N|SMARCA4_uc010dxo.2_Missense_Mutation_p.T786N|SMARCA4_uc002mqg.1_Missense_Mutation_p.T786N|SMARCA4_uc010dxq.2_Missense_Mutation_p.T786N|SMARCA4_uc010dxr.2_Missense_Mutation_p.T786N|SMARCA4_uc002mqj.3_Missense_Mutation_p.T786N|SMARCA4_uc010dxs.2_Missense_Mutation_p.T786N|SMARCA4_uc010dxt.1_Missense_Mutation_p.T6N	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	786	Helicase ATP-binding.|ATP (Potential).				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTGGGGAAGACCATCCAGACC	0.577			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				18	26	---	---	---	---	PASS
ACP5	54	broad.mit.edu	37	19	11687493	11687493	+	Intron	SNP	T	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11687493T>A	uc002msg.3	-						ACP5_uc002msh.3_Intron|ACP5_uc002msi.3_Intron|ACP5_uc002msj.3_Intron|ACP5_uc010dye.1_3'UTR	NM_001611	NP_001602	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant						water-soluble vitamin metabolic process	cytosol|integral to membrane|lysosome	acid phosphatase activity|ferric iron binding|ferrous iron binding			central_nervous_system(1)	1						GTCCCTGCTATGTGAGGATCT	0.582													18	57	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22156562	22156562	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156562T>C	uc002nqp.2	-	4	1423	c.1274A>G	c.(1273-1275)TAC>TGC	p.Y425C	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTCACATTTGTAGGGTTTCTC	0.388													33	53	---	---	---	---	PASS
ZNF146	7705	broad.mit.edu	37	19	36728009	36728009	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36728009C>T	uc002odq.3	+	4	2190	c.667C>T	c.(667-669)CAG>TAG	p.Q223*	ZNF146_uc010eet.2_Nonsense_Mutation_p.Q223*|ZNF146_uc010eeu.2_Nonsense_Mutation_p.Q223*	NM_007145	NP_009076	Q15072	OZF_HUMAN	zinc finger protein 146	223	Interaction with TERF2IP.|C2H2-type 8.				regulation of transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|heparin binding|zinc ion binding				0	Esophageal squamous(110;0.162)					AGCCTTCTCTCAGAGCTCATC	0.443													47	75	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39214966	39214966	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39214966C>A	uc002oja.1	+	15	1921	c.1862C>A	c.(1861-1863)TCC>TAC	p.S621Y	ACTN4_uc002ojb.1_5'Flank	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	621	Spectrin 3.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ATCATCAACTCCAAGTGGGAG	0.667													12	16	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41008156	41008156	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41008156C>T	uc002ony.2	+	9	1105	c.1019C>T	c.(1018-1020)TCC>TTC	p.S340F	SPTBN4_uc002onx.2_Missense_Mutation_p.S340F|SPTBN4_uc002onz.2_Missense_Mutation_p.S340F	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	340	Spectrin 1.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTTGCCAACTCCTTAAGTGGG	0.602													17	59	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43575862	43575862	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43575862G>C	uc002ovr.2	-	4	1047	c.954C>G	c.(952-954)GTC>GTG	p.V318V	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Silent_p.V318V|PSG2_uc010eiq.1_Silent_p.V318V|PSG2_uc002ovs.3_Silent_p.V318V|PSG2_uc002ovt.3_Silent_p.V318V	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	318					cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				CAGAGACTTTGACTGTCAACG	0.458													93	152	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44514437	44514437	+	Silent	SNP	G	A	A	rs150544790		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44514437G>A	uc002oyb.1	+	5	497	c.246G>A	c.(244-246)GCG>GCA	p.A82A		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	82	KRNB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				AGACTATTGCGGAAGCAGGAC	0.423													3	36	---	---	---	---	PASS
ZNF180	7733	broad.mit.edu	37	19	44981167	44981167	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44981167G>A	uc002ozf.3	-	5	1813	c.1531C>T	c.(1531-1533)CAT>TAT	p.H511Y	ZNF180_uc002ozh.3_Missense_Mutation_p.H168Y|ZNF180_uc002ozi.3_Missense_Mutation_p.H484Y|ZNF180_uc002ozg.3_Missense_Mutation_p.H510Y|ZNF180_uc010ejm.2_Missense_Mutation_p.H486Y	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	511	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				GTTCTCTGATGAGCAACAAGT	0.393													18	86	---	---	---	---	PASS
DMPK	1760	broad.mit.edu	37	19	46275904	46275904	+	Nonsense_Mutation	SNP	C	A	A	rs66859440		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46275904C>A	uc002pdd.1	-	9	1913	c.1369G>T	c.(1369-1371)GAA>TAA	p.E457*	DMPK_uc010xxs.1_Nonsense_Mutation_p.E358*|DMPK_uc002pde.1_Nonsense_Mutation_p.E452*|DMPK_uc002pdf.1_Nonsense_Mutation_p.E447*|DMPK_uc002pdg.1_Nonsense_Mutation_p.E442*|DMPK_uc002pdh.1_Nonsense_Mutation_p.E442*|DMPK_uc002pdi.1_Nonsense_Mutation_p.E473*|DMPK_uc010xxt.1_Nonsense_Mutation_p.E442*	NM_001081563	NP_001075032	Q09013	DMPK_HUMAN	myotonic dystrophy protein kinase isoform 1	457					regulation of heart contraction		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)	3		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CTTACTGTTTCATCCTGTGGG	0.632													7	27	---	---	---	---	PASS
PNMAL1	55228	broad.mit.edu	37	19	46973831	46973831	+	Silent	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46973831C>A	uc002peq.3	-	2	768	c.462G>T	c.(460-462)CTG>CTT	p.L154L	PNMAL1_uc002per.3_Silent_p.L154L	NM_018215	NP_060685	Q86V59	PNML1_HUMAN	PNMA-like 1 isoform a	154											0		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CCACTGCTCCCAGAAGCACCc	0.343													30	70	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51129249	51129249	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51129249T>C	uc002pst.2	-	5	1941	c.1307A>G	c.(1306-1308)AAC>AGC	p.N436S	SYT3_uc002psv.2_Missense_Mutation_p.N436S|SYT3_uc010ycd.1_Missense_Mutation_p.N436S	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	436	C2 2.|Cytoplasmic (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGTGAGAAGTTGAGCTCCCC	0.557													6	10	---	---	---	---	PASS
KLK2	3817	broad.mit.edu	37	19	51381950	51381950	+	3'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51381950G>A	uc002ptv.2	+	5					KLK2_uc002ptu.2_3'UTR|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_3'UTR|KLK2_uc010ycm.1_3'UTR|KLK2_uc010eoh.2_3'UTR	NM_005551	NP_005542	P20151	KLK2_HUMAN	kallikrein 2, prostatic isoform 1						proteolysis		serine-type endopeptidase activity			ovary(1)|skin(1)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		GAGTCCTACTGACCTGTGCTT	0.522			T	ETV4	prostate								3	6	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51914402	51914402	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51914402C>T	uc002pwo.2	-	11	2661	c.2045G>A	c.(2044-2046)CGG>CAG	p.R682Q	SIGLEC10_uc002pwp.2_Missense_Mutation_p.R624Q|SIGLEC10_uc002pwq.2_Missense_Mutation_p.R529Q|SIGLEC10_uc002pwr.2_Missense_Mutation_p.R587Q|SIGLEC10_uc010ycy.1_Missense_Mutation_p.R497Q|SIGLEC10_uc010ycz.1_Missense_Mutation_p.R539Q|SIGLEC10_uc010eow.2_Missense_Mutation_p.R399Q	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	682	Cytoplasmic (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CTTGGGCATCCGGGCCTCAGG	0.572													25	77	---	---	---	---	PASS
TFPT	29844	broad.mit.edu	37	19	54618717	54618717	+	5'UTR	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54618717C>T	uc010yej.1	-	1					TFPT_uc010erd.2_5'UTR|PRPF31_uc002qdh.2_5'Flank|PRPF31_uc010yek.1_5'Flank	NM_013342	NP_037474	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner						apoptosis|DNA recombination|DNA repair|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex	DNA binding|protein binding				0	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					TTAAGCCGTTCGCAAAACTAC	0.587			T	TCF3	pre-B ALL						OREG0003635|OREG0003633	type=REGULATORY REGION|Gene=PRPF31|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=TFPT|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	9	42	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55494635	55494635	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55494635G>A	uc002qij.2	+	6	1655	c.1569G>A	c.(1567-1569)GAG>GAA	p.E523E	NLRP2_uc010yfp.1_Silent_p.E500E|NLRP2_uc010esn.2_Silent_p.E499E|NLRP2_uc010eso.2_Silent_p.E520E|NLRP2_uc010esp.2_Silent_p.E501E	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	523	NACHT.|Poly-Glu.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGGAGGAAGAGGATAGGGACG	0.557													19	58	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56223188	56223188	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56223188C>T	uc002qly.2	-	8	2849	c.2821G>A	c.(2821-2823)GAC>AAC	p.D941N		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	941						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGGGCACAGTCCGGGTGGCTC	0.552													5	25	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56369819	56369819	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56369819G>A	uc002qmd.3	+	3	1482	c.1060G>A	c.(1060-1062)GAG>AAG	p.E354K	NLRP4_uc002qmf.2_Missense_Mutation_p.E279K|NLRP4_uc010etf.2_Missense_Mutation_p.E185K	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	354	NACHT.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TCTGAAGCAAGAGATGCAGAA	0.507													25	43	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56572902	56572902	+	3'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56572902G>A	uc002qmj.2	+	15					NLRP5_uc002qmi.2_3'UTR	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGAAGATACGGAAACCTGCCC	0.483													29	57	---	---	---	---	PASS
ZNF471	57573	broad.mit.edu	37	19	57027736	57027736	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57027736G>A	uc002qnh.2	+	3	259	c.126G>A	c.(124-126)ATG>ATA	p.M42I		NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		ACAGGAGTATGATGTTGGAGA	0.393													21	96	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													6	8	---	---	---	---	PASS
VPS16	64601	broad.mit.edu	37	20	2847241	2847241	+	3'UTR	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2847241C>G	uc002whe.2	+	24					VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|VPS16_uc002whf.2_3'UTR|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_3'UTR|VPS16_uc002whi.2_3'UTR	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1						intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						CTGTACATCTCAAGCAAGGGG	0.597													34	59	---	---	---	---	PASS
ANKRD5	63926	broad.mit.edu	37	20	10018917	10018917	+	5'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10018917G>A	uc002wno.2	+	3					uc002wnn.1_Intron|ANKRD5_uc002wnp.2_5'UTR|ANKRD5_uc010gbz.2_5'UTR	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5								calcium ion binding			ovary(1)|breast(1)	2						TTTAGTTTTGGTCCAGAAAGC	0.323													15	28	---	---	---	---	PASS
RIN2	54453	broad.mit.edu	37	20	19941346	19941346	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19941346C>G	uc002wro.1	+	4	390	c.354C>G	c.(352-354)ATC>ATG	p.I118M	RIN2_uc010gcu.1_Missense_Mutation_p.I118M|RIN2_uc010gcv.1_Translation_Start_Site	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	118	SH2.				endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						TCCACTAGATCTTCCTGGTTC	0.438													3	7	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33448014	33448014	+	Intron	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33448014G>C	uc002xay.2	-						GGT7_uc002xaz.1_Intron|GGT7_uc002xba.1_3'UTR	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						CCCAAGGAGAGATGCAAACGG	0.587													9	79	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990777	39990777	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990777C>T	uc002xjy.1	-	4	1656	c.1432G>A	c.(1432-1434)GAG>AAG	p.E478K		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	478	Potential.					proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				AGGCGCTCCTCGAGGCTCTGC	0.637													14	62	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46265061	46265061	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46265061C>G	uc002xtk.2	+	12	2136	c.1931C>G	c.(1930-1932)TCA>TGA	p.S644*	NCOA3_uc010ght.1_Nonsense_Mutation_p.S654*|NCOA3_uc002xtl.2_Nonsense_Mutation_p.S644*|NCOA3_uc002xtm.2_Nonsense_Mutation_p.S644*|NCOA3_uc002xtn.2_Nonsense_Mutation_p.S644*|NCOA3_uc010zyc.1_Nonsense_Mutation_p.S439*	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	644	Ser-rich.				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						CCCCTAGATTCAAGTTGTAAA	0.463													39	63	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47691370	47691370	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47691370G>C	uc002xty.2	+	11	1249	c.1115G>C	c.(1114-1116)AGA>ACA	p.R372T	CSE1L_uc010zyg.1_Missense_Mutation_p.R155T|CSE1L_uc010ghx.2_Missense_Mutation_p.R316T|CSE1L_uc010ghy.2_Missense_Mutation_p.R21T|CSE1L_uc010zyh.1_Missense_Mutation_p.R21T	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	372					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TACATAAGGAGAGATTTGGAA	0.388													18	33	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60891982	60891982	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60891982C>T	uc002ycq.2	-	56	7676	c.7609G>A	c.(7609-7611)GAT>AAT	p.D2537N		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2537	Potential.|Domain II and I.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCAGCAGCATCCTCGGCAGCC	0.697													4	14	---	---	---	---	PASS
CYYR1	116159	broad.mit.edu	37	21	27840756	27840756	+	3'UTR	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27840756G>A	uc002ymd.2	-	4					CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_3'UTR	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0						GCCTGTTTCTGAGTAGAGGCA	0.433													6	15	---	---	---	---	PASS
C21orf59	56683	broad.mit.edu	37	21	33974135	33974135	+	3'UTR	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33974135G>C	uc002yqc.2	-	7					C21orf59_uc002ypx.1_Intron|C21orf59_uc002ypy.1_Intron|C21orf59_uc002ypz.1_Intron|C21orf59_uc010glx.2_3'UTR|C21orf59_uc002yqd.2_3'UTR|C21orf59_uc002yqa.3_3'UTR|C21orf59_uc002yqb.3_3'UTR|C21orf59_uc011adr.1_3'UTR	NM_021254	NP_067077	P57076	CU059_HUMAN	hypothetical protein LOC56683							cytosol|nucleus					0						GGAGAAAGGTGAGCTAATCTC	0.343													15	31	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37710178	37710178	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37710178C>G	uc002yvi.2	+	4	470	c.394C>G	c.(394-396)CAG>GAG	p.Q132E		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	132					cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						CCTTTTGTCTCAGACCTACTT	0.428													41	87	---	---	---	---	PASS
PIGP	51227	broad.mit.edu	37	21	38444858	38444858	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38444858C>T	uc002yvw.1	-	1	246	c.30G>A	c.(28-30)CTG>CTA	p.L10L	TTC3_uc002yvz.2_5'Flank|TTC3_uc011aee.1_5'Flank|PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron|TTC3_uc011aed.1_5'Flank|TTC3_uc010gne.1_5'Flank	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	10					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				GGAACACAATCAGCGCCAGCG	0.577													34	133	---	---	---	---	PASS
COL18A1	80781	broad.mit.edu	37	21	46925183	46925183	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46925183C>T	uc011afs.1	+	35	4261	c.4240C>T	c.(4240-4242)CAC>TAC	p.H1414Y	COL18A1_uc002zhg.2_Missense_Mutation_p.H999Y|COL18A1_uc002zhi.2_Missense_Mutation_p.H1179Y|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_5'UTR|COL18A1_uc002zhk.2_5'Flank	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	1417	Nonhelical region 10 (NC10).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TCCTGGCCCTCACAGGCAGAG	0.697													5	12	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19864662	19864662	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19864662C>A	uc011ahc.1	-	17	1574	c.1541G>T	c.(1540-1542)GGC>GTC	p.G514V	TXNRD2_uc002zql.1_Missense_Mutation_p.G268V|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Missense_Mutation_p.G513V|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Missense_Mutation_p.G164V	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	514					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					GGGGTCCAGGCCTGAGCGCTT	0.667													12	6	---	---	---	---	PASS
ARVCF	421	broad.mit.edu	37	22	19959927	19959927	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19959927C>G	uc002zqz.2	-	17	2920	c.2649G>C	c.(2647-2649)GAG>GAC	p.E883D	ARVCF_uc002zqy.2_Missense_Mutation_p.E399D	NM_001670	NP_001661	O00192	ARVC_HUMAN	armadillo repeat protein	883					cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)					TGCCAGTTTTCTCGCCCTCTG	0.647													8	31	---	---	---	---	PASS
RTDR1	27156	broad.mit.edu	37	22	23482515	23482515	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23482515C>T	uc002zwt.2	-	2	251	c.93G>A	c.(91-93)CTG>CTA	p.L31L	RTDR1_uc010gtv.1_Silent_p.L31L	NM_014433	NP_055248	Q9UHP6	RTDR1_HUMAN	rhabdoid tumor deletion region protein 1	31							binding			ovary(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		GCTCCTCCTTCAGCTTGGGCA	0.562													7	22	---	---	---	---	PASS
TBC1D10A	83874	broad.mit.edu	37	22	30722669	30722669	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30722669C>T	uc011akt.1	-	1	226	c.202G>A	c.(202-204)GAG>AAG	p.E68K	TBC1D10A_uc010gvu.2_Missense_Mutation_p.E68K|TBC1D10A_uc003ahk.3_Missense_Mutation_p.E68K	NM_031937	NP_114143	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	68						intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity			ovary(1)	1						CACGCGCCCTCGGCGCCCTGC	0.716													4	20	---	---	---	---	PASS
SEC14L2	23541	broad.mit.edu	37	22	30805112	30805112	+	Intron	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30805112G>T	uc003ahr.2	+						SEC14L2_uc003ahq.2_Intron|SEC14L2_uc011akx.1_Intron|SEC14L2_uc003ahs.2_Intron|SEC14L2_uc011aky.1_Intron|SEC14L2_uc003aht.2_RNA|SEC14L2_uc003ahu.3_5'Flank|SEC14L2_uc010gvv.2_5'Flank|SEC14L2_uc010gvw.1_5'Flank|MTP18_uc010gvx.1_5'Flank|MTP18_uc003ahv.1_5'Flank|MTP18_uc010gvy.1_5'Flank	NM_012429	NP_036561	O76054	S14L2_HUMAN	SEC14-like 2 isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transporter activity|vitamin E binding				0					Vitamin E(DB00163)	CATTTGGCCTGGACTGGAACG	0.502													10	19	---	---	---	---	PASS
CACNG2	10369	broad.mit.edu	37	22	36960929	36960929	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36960929C>T	uc003aps.1	-	4	723	c.441G>A	c.(439-441)CTG>CTA	p.L147L		NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2	147	Helical; (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						TGATGTTACTCAGACCTGCGG	0.557													71	99	---	---	---	---	PASS
RPL3	6122	broad.mit.edu	37	22	39708981	39708981	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39708981C>T	uc003axi.2	-	10	1244	c.1176G>A	c.(1174-1176)CTG>CTA	p.L392L	RPL3_uc003axh.2_Silent_p.L343L|RPL3_uc003axj.2_Silent_p.L240L|RPL3_uc010gxx.2_Silent_p.L300L|RPL3_uc003axg.2_Silent_p.L340L	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a	392					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)					GGTCTTTCTTCAGTGGTCCCT	0.498													8	27	---	---	---	---	PASS
TNFRSF13C	115650	broad.mit.edu	37	22	42321519	42321519	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42321519C>T	uc003bbl.2	-	3	451	c.407G>A	c.(406-408)GGA>GAA	p.G136E	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|TNFRSF13C_uc010gyp.1_Missense_Mutation_p.G137E	NM_052945	NP_443177	Q96RJ3	TR13C_HUMAN	BAFF receptor	136	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						ATCAGAGATTCCCGGAGACAG	0.637													23	55	---	---	---	---	PASS
A4GALT	53947	broad.mit.edu	37	22	43089310	43089310	+	Silent	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43089310G>A	uc003bdb.2	-	3	909	c.648C>T	c.(646-648)CTC>CTT	p.L216L	A4GALT_uc010gzd.2_Silent_p.L216L	NM_017436	NP_059132	Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	216	Lumenal (Potential).				glycosphingolipid biosynthetic process|plasma membrane organization	Golgi stack|integral to Golgi membrane|membrane fraction	lactosylceramide 4-alpha-galactosyltransferase activity			central_nervous_system(2)	2						ACGCGCCGTTGAGGACGTAGC	0.617													11	32	---	---	---	---	PASS
BIK	638	broad.mit.edu	37	22	43520163	43520163	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43520163C>T	uc003bdk.2	+	2	195	c.135C>T	c.(133-135)TTC>TTT	p.F45F		NM_001197	NP_001188	Q13323	BIK_HUMAN	BCL2-interacting killer	45					apoptosis|induction of apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	endomembrane system|integral to membrane					0		Ovarian(80;0.0694)				TGGAGGACTTCGATTCTTTGG	0.567													33	62	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43972201	43972201	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43972201C>T	uc003bdy.1	-	26	3611	c.3396G>A	c.(3394-3396)CAG>CAA	p.Q1132Q	EFCAB6_uc003bdz.1_Silent_p.Q980Q|EFCAB6_uc010gzi.1_Silent_p.Q980Q|EFCAB6_uc010gzj.1_Silent_p.Q358Q	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1132					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				AGCTAAAGTTCTGGAGAAAAT	0.313													11	37	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46725395	46725395	+	Silent	SNP	G	C	C			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46725395G>C	uc011aqy.1	+	11	2279	c.2067G>C	c.(2065-2067)CTG>CTC	p.L689L	GTSE1_uc011aqz.1_Silent_p.L536L|GTSE1_uc003bhn.2_RNA|uc011ara.1_5'Flank|uc003bho.3_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	670					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		GCAGGCCTCTGATCGACCTCA	0.527													43	80	---	---	---	---	PASS
TYMP	1890	broad.mit.edu	37	22	50965730	50965730	+	Intron	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50965730G>A	uc003bmb.3	-						SCO2_uc003bma.2_5'Flank|SCO2_uc003blz.3_5'Flank|TYMP_uc003bmc.3_Intron|TYMP_uc003bmd.3_Intron|TYMP_uc010hbd.2_Intron|TYMP_uc003bme.3_Intron|TYMP_uc003bmf.3_Intron|TYMP_uc011arz.1_3'UTR	NM_001113756	NP_001107228	P19971	TYPH_HUMAN	endothelial cell growth factor 1						angiogenesis|cell differentiation|chemotaxis|DNA replication|mitochondrial genome maintenance|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol	growth factor activity|platelet-derived growth factor receptor binding|pyrimidine-nucleoside phosphorylase activity|thymidine phosphorylase activity			ovary(1)	1		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Docetaxel(DB01248)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Sulfasalazine(DB00795)|Tamoxifen(DB00675)	GGAGGCAGAGGAGGTTGGAGA	0.587													12	33	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	3002367	3002367	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3002367G>A	uc004cre.1	+	6	711	c.490G>A	c.(490-492)GGC>AGC	p.G164S	ARSF_uc004crf.1_Missense_Mutation_p.G164S	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	164						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTACTACTATGGCATGCCGTT	0.512													37	8	---	---	---	---	PASS
CLCN4	1183	broad.mit.edu	37	X	10176604	10176604	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10176604G>T	uc004csy.3	+	9	1793	c.1363G>T	c.(1363-1365)GTT>TTT	p.V455F	CLCN4_uc011mid.1_Missense_Mutation_p.V361F	NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4	455	Helical; (By similarity).					early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						CAAAATCGTCGTTACCATATT	0.527													70	18	---	---	---	---	PASS
TCEAL6	158931	broad.mit.edu	37	X	101396306	101396306	+	5'UTR	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101396306C>T	uc004eiq.2	-	3						NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						TTTTCCATGTCGAGATTTCTC	0.338													6	20	---	---	---	---	PASS
RBMX2	51634	broad.mit.edu	37	X	129537824	129537824	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129537824C>T	uc004evt.2	+	3	234	c.170C>T	c.(169-171)TCA>TTA	p.S57L		NM_016024	NP_057108	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	57	RRM.						nucleotide binding|RNA binding			breast(3)|ovary(1)	4						TGTGTGTTCTCACAGTAAGTG	0.343													88	120	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132161712	132161712	+	Silent	SNP	C	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132161712C>T	uc010nrm.1	-	6	1007	c.537G>A	c.(535-537)AAG>AAA	p.K179K	USP26_uc011mvf.1_Silent_p.K179K	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	179					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					TTCTTTTCCTCTTCTTGTGCT	0.393													21	42	---	---	---	---	PASS
GDI1	2664	broad.mit.edu	37	X	153665607	153665607	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153665607G>A	uc004fli.3	+	1	349	c.7G>A	c.(7-9)GAG>AAG	p.E3K	GDI1_uc011mzo.1_Missense_Mutation_p.E3K	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	3					protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GACCATGGACGAGGAATACGA	0.552													3	1	---	---	---	---	PASS
HNRNPR	10236	broad.mit.edu	37	1	23659999	23660004	+	Intron	DEL	AAGAAC	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23659999_23660004delAAGAAC	uc001bgr.3	-						HNRNPR_uc001bgp.3_Intron|HNRNPR_uc009vqk.2_Intron|HNRNPR_uc001bgs.3_Intron|HNRNPR_uc010odw.1_Intron|HNRNPR_uc010odx.1_Intron|HNRNPR_uc009vql.2_Intron	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R							catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		TAAACTGCTAAAGAACACTTACCTCC	0.442													22	8	---	---	---	---	
TMCO2	127391	broad.mit.edu	37	1	40716809	40716809	+	Intron	DEL	A	-	-	rs145848914		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40716809delA	uc001cfe.2	+							NM_001008740	NP_001008740	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2							integral to membrane				ovary(1)	1	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			actccatctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
ZCCHC11	23318	broad.mit.edu	37	1	52927296	52927296	+	Intron	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52927296delA	uc001ctx.2	-						ZCCHC11_uc001cty.2_Intron|ZCCHC11_uc001ctz.2_Intron|ZCCHC11_uc009vze.1_Intron|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cua.1_5'Flank	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform						miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						AACCTAATTTAAAAAAAAAAG	0.284													43	9	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70728658	70728659	+	Intron	INS	-	AG	AG	rs150975244	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70728658_70728659insAG	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						CAAGAACCAGAAGAATTCAAAT	0.302													7	4	---	---	---	---	
TXNIP	10628	broad.mit.edu	37	1	145441053	145441054	+	Splice_Site	INS	-	GT	GT			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145441053_145441054insGT	uc001enn.3	+	7	1481	c.1140_splice	c.e7+1	p.E380_splice	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Splice_Site_p.E325_splice	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein						cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTTATACTGAGGTGAGGATTGT	0.416													238	12	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	146397619	146397621	+	Intron	DEL	ATA	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146397619_146397621delATA	uc001emp.3	+						uc010ozk.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAACAAGGATAATAATAAGTT	0.355													6	3	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150432871	150432873	+	Intron	DEL	GTT	-	-	rs72401668		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150432871_150432873delGTT	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						TTTTGGGGGGgttgttgttgttg	0.158													4	2	---	---	---	---	
ARHGAP30	257106	broad.mit.edu	37	1	161021110	161021121	+	In_Frame_Del	DEL	GGCCAGGGCCAA	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161021110_161021121delGGCCAGGGCCAA	uc001fxl.2	-	10	1749_1760	c.1403_1414delTTGGCCCTGGCC	c.(1402-1416)CTTGGCCCTGGCCCC>CCC	p.LGPG468del	ARHGAP30_uc001fxk.2_In_Frame_Del_p.LGPG468del|ARHGAP30_uc001fxm.2_In_Frame_Del_p.LGPG314del|ARHGAP30_uc009wtx.2_In_Frame_Del_p.LGPG141del|ARHGAP30_uc001fxn.1_In_Frame_Del_p.LGPG314del	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	468_471					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCACCTGGGgggccagggccaaggccagggcc	0.434													64	7	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9611343	9611343	+	Intron	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9611343delA	uc002qzo.1	+						CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		actccatctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29145663	29145664	+	Intron	INS	-	TTTT	TTTT	rs61402912		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29145663_29145664insTTTT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTCTTGCTGTGTTTTTTTTTTT	0.342													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64602807	64602809	+	IGR	DEL	ACC	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64602807_64602809delACC								PELI1 (231202 upstream) : HSPC159 (78518 downstream)																							ccataccactaccaccaccacca	0.025													4	2	---	---	---	---	
DCTN1	1639	broad.mit.edu	37	2	74596944	74596945	+	Intron	DEL	AA	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74596944_74596945delAA	uc002skx.2	-						DCTN1_uc002skv.2_Intron|DCTN1_uc002sku.2_Intron|DCTN1_uc002skw.1_Intron|DCTN1_uc010ffd.2_Intron|DCTN1_uc002sky.2_Intron	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1						cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						tccatctcagaaaaaaaaaaaa	0.243													8	4	---	---	---	---	
NPAS2	4862	broad.mit.edu	37	2	101582334	101582334	+	Intron	DEL	C	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101582334delC	uc002tap.1	+						NPAS2_uc010yvt.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						TACCTGGTTTCTTTTTAAGGT	0.582													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112645761	112645761	+	IGR	DEL	T	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112645761delT								ANAPC1 (4020 upstream) : MERTK (10430 downstream)																							CACACACTGGttttttttttt	0.199													4	2	---	---	---	---	
SF3B1	23451	broad.mit.edu	37	2	198257294	198257295	+	Intron	INS	-	GG	GG	rs72167899		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198257294_198257295insGG	uc002uue.2	-							NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTTGGGGAGTTGGGGGGGGGGG	0.366													4	3	---	---	---	---	
C3orf19	51244	broad.mit.edu	37	3	14702848	14702849	+	Intron	INS	-	T	T	rs141125865	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14702848_14702849insT	uc003byw.2	+						C3orf19_uc010hei.1_Intron|C3orf19_uc010hej.2_Intron	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244												0						CTTTTTCAAGATTTTTTTGTGT	0.401													8	4	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130719948	130719949	+	Intron	INS	-	A	A	rs146588901		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130719948_130719949insA	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron|ATP2C1_uc003enu.2_Intron	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	cttcatctcagaaaaaaaaaaa	0.074									Hailey-Hailey_disease				11	5	---	---	---	---	
TOPBP1	11073	broad.mit.edu	37	3	133341981	133341982	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133341981_133341982delTT	uc003eps.2	-	19	3263_3264	c.3131_3132delAA	c.(3130-3132)AAAfs	p.K1044fs	TOPBP1_uc003ept.1_Frame_Shift_Del_p.K48fs	NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1044					DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						GTGCTGACTCTTTATTATTGGT	0.287								Other_conserved_DNA_damage_response_genes					23	13	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175041833	175041833	+	Intron	DEL	G	-	-	rs12497409		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175041833delG	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		aaaaaaaaaagaaaaagaaaa	0.124													39	8	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180372434	180372434	+	Intron	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180372434delA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			aagaaaaaggaaaaaaaaaaa	0.303													4	4	---	---	---	---	
PPARGC1A	10891	broad.mit.edu	37	4	23825730	23825731	+	Intron	INS	-	G	G	rs143200765	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23825730_23825731insG	uc003gqs.2	-						PPARGC1A_uc003gqt.2_Intron|PPARGC1A_uc011bxp.1_Intron|PPARGC1A_uc010ier.1_Intron	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				attttttattagtttttttttt	0.302													4	3	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134050651	134050651	+	Intron	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134050651delA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGGCATTTTAAAAGTTCTGG	0.294													26	18	---	---	---	---	
CAMK2A	815	broad.mit.edu	37	5	149624901	149624902	+	Intron	INS	-	CCT	CCT	rs149294022	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149624901_149624902insCCT	uc003lru.2	-						CAMK2A_uc003lrs.2_5'Flank|CAMK2A_uc003lrt.2_Intron|CAMK2A_uc010jhe.2_Intron	NM_171825	NP_741960	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGGGGGAGGcctcctcctcc	0.540													3	3	---	---	---	---	
SIRT5	23408	broad.mit.edu	37	6	13584590	13584591	+	Intron	INS	-	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13584590_13584591insT	uc003nay.2	+						SIRT5_uc003naw.2_Intron|SIRT5_uc003nax.2_Intron|SIRT5_uc011dit.1_Intron	NM_012241	NP_036373	Q9NXA8	SIRT5_HUMAN	sirtuin 5 isoform 1						chromatin silencing|protein ADP-ribosylation|protein deacetylation	mitochondrial intermembrane space|mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|zinc ion binding			skin(2)|upper_aerodigestive_tract(1)	3	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)		Suramin(DB04786)	GTCATCttctcttttttttttt	0.208													4	2	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139170711	139170711	+	Intron	DEL	T	-	-	rs72395106		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139170711delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						AAAGCGAAGCttttttttttt	0.229													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34193010	34193011	+	3'UTR	INS	-	TA	TA	rs140714031	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34193010_34193011insTA	uc011kap.1	+	15						NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						Gtatatatgtgtatatatatat	0.307													4	2	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86536850	86536850	+	Intron	DEL	A	-	-	rs72283133		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536850delA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CATTCCCTACAAAAAAAAAAA	0.323													4	3	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99796752	99796753	+	Intron	DEL	AA	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99796752_99796753delAA	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron|STAG3_uc003uub.1_5'Flank	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					gtctctatcgaaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148888416	148888419	+	IGR	DEL	CTCA	-	-	rs147356472		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148888416_148888419delCTCA								ZNF398 (8300 upstream) : ZNF282 (4158 downstream)																							gagatggagtctcactctgtcgcc	0.172													8	5	---	---	---	---	
LSM1	27257	broad.mit.edu	37	8	38021524	38021524	+	Intron	DEL	T	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38021524delT	uc003xkw.2	-						LSM1_uc003xkx.2_Intron	NM_014462	NP_055277	O15116	LSM1_HUMAN	Lsm1 protein						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|mRNA processing|RNA splicing, via transesterification reactions	cytosol|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0	Colorectal(12;0.000442)					AAGAAATGCCTGACAACACTA	0.284													5	4	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400235	400236	+	Intron	INS	-	CAC	CAC			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400235_400236insCAC	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		acctccaccatcaccaccacct	0.000													4	3	---	---	---	---	
C9orf150	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	GGCGGCGGC	GGCGGCGGC	rs139315731	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12775861_12775862insGGCGGCGGC	uc003zkw.2	+	1	850_851	c.147_148insGGCGGCGGC	c.(145-150)insGGCGGCGGC	p.55_56insGGG		NM_203403	NP_981948	Q8IV03	CI150_HUMAN	hypothetical protein LOC286343	58_59	Gly-rich.										0				GBM - Glioblastoma multiforme(1;1.64e-13)		gcggtggtggtggcggcggcgg	0.505													5	8	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													4	3	---	---	---	---	
PRSS3	5646	broad.mit.edu	37	9	33795418	33795423	+	Intron	DEL	GCCGAG	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33795418_33795423delGCCGAG	uc003ztj.3	+						uc003ztk.1_Intron|PRSS3_uc003zti.3_Intron|PRSS3_uc003ztl.3_5'Flank	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			GCCAAACGTAGCCGAGCTGATGCAAG	0.529													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44109175	44109177	+	IGR	DEL	AAC	-	-	rs145089083		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44109175_44109177delAAC								FAM75A6 (478445 upstream) : FAM27C (881059 downstream)																							AAGGTAGACTAACTCTTCGCTAT	0.340													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30672265	30672265	+	IGR	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30672265delA								MTPAP (8888 upstream) : MAP3K8 (50601 downstream)																							ATTGCCAGCCAAAAAAAAAAA	0.328													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30978028	30978029	+	IGR	DEL	TG	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30978028_30978029delTG								LYZL2 (59381 upstream) : ZNF438 (155538 downstream)																							ACGTGTGAAATGTGTGTGTGTG	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	107446298	107446299	+	IGR	INS	-	A	A			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107446298_107446299insA								SORCS3 (421305 upstream) : SORCS1 (887123 downstream)																							AAGGTGTTGAGAAAAAACAGCA	0.396													86	35	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89868965	89868965	+	Intron	DEL	T	-	-	rs34639551		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89868965delT	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Intron|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGTCATCAACTTTTTTTTTTT	0.308													2	4	---	---	---	---	
ATP5L	10632	broad.mit.edu	37	11	118277624	118277628	+	Intron	DEL	TTTTG	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118277624_118277628delTTTTG	uc001psx.2	+							NM_006476	NP_006467	O75964	ATP5L_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|protein binding				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)		CATCCTGGTTttttgttttgttttg	0.424													4	2	---	---	---	---	
RPL41	6171	broad.mit.edu	37	12	56510606	56510607	+	Intron	INS	-	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56510606_56510607insT	uc001sjn.2	+						RPL41_uc001sjo.2_Intron|ZC3H10_uc001sjp.1_5'Flank	NM_021104		P62945	RL41_HUMAN	ribosomal protein L41						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0			OV - Ovarian serous cystadenocarcinoma(18;0.12)			TGGTAGTAAGCTTGGGAGGTAG	0.535													144	62	---	---	---	---	
PPM1H	57460	broad.mit.edu	37	12	63053049	63053049	+	Intron	DEL	C	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63053049delC	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GTAAAAACTGCaaaaaaaaaa	0.388													4	2	---	---	---	---	
RAP1B	5908	broad.mit.edu	37	12	69020554	69020555	+	Intron	INS	-	T	T	rs77399444		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69020554_69020555insT	uc001sub.2	+						RAP1B_uc010ste.1_Intron|RAP1B_uc001suc.2_Intron|RAP1B_uc010stf.1_Intron|RAP1B_uc010stg.1_Intron|RAP1B_uc010sth.1_Intron|RAP1B_uc010sti.1_Intron	NM_001089704	NP_001083173	P61224	RAP1B_HUMAN	SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;						blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		TTTCCAGGGTGTTTTTTTTTTG	0.376													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21835723	21835728	+	IGR	DEL	GGCGAG	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21835723_21835728delGGCGAG								MRP63 (82505 upstream) : ZDHHC20 (114782 downstream)																							GATGGACTGAGGCGAGGGGTGGGACT	0.646													4	2	---	---	---	---	
ABHD4	63874	broad.mit.edu	37	14	23073152	23073156	+	Intron	DEL	TTTTG	-	-	rs36208766		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23073152_23073156delTTTTG	uc001wgm.2	+						ABHD4_uc010tmz.1_3'UTR|ABHD4_uc010tna.1_Intron|ABHD4_uc010tnb.1_Intron	NM_022060	NP_071343	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4						lipid catabolic process		hydrolase activity			central_nervous_system(1)	1	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		TTttttgtttttttgttttgttttg	0.161													4	6	---	---	---	---	
CCNDBP1	23582	broad.mit.edu	37	15	43481299	43481300	+	Intron	INS	-	AG	AG	rs6493079		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43481299_43481300insAG	uc001zqv.2	+						CCNDBP1_uc001zqu.2_Intron|CCNDBP1_uc010bdc.2_Intron|CCNDBP1_uc010bdb.2_Intron|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_Intron|CCNDBP1_uc001zqx.2_Intron|CCNDBP1_uc010bdd.2_Intron|CCNDBP1_uc001zqy.2_Intron	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1						cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		aaaaaaaaaaaaaagaaaaaga	0.134													4	2	---	---	---	---	
DPP8	54878	broad.mit.edu	37	15	65792757	65792757	+	Intron	DEL	A	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65792757delA	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						attctgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99514433	99514440	+	Intron	DEL	GGGGGGGT	-	-	rs67495544		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99514433_99514440delGGGGGGGT	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						TGGGGGGGGGGGGGGGGTGGGCACCAAG	0.615													5	3	---	---	---	---	
AQP8	343	broad.mit.edu	37	16	25235924	25235924	+	Intron	DEL	C	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25235924delC	uc002doc.2	+							NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		AGTGGGGTGACCATGCCCAGA	0.428													3	24	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8413358	8413359	+	Intron	INS	-	TT	TT	rs145464629		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8413358_8413359insTT	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						TGAGATACTAAttttttttttt	0.218													15	7	---	---	---	---	
GOSR2	9570	broad.mit.edu	37	17	45097086	45097119	+	Intron	DEL	GTATTGATCTCAACCCAGAGCAGAGGCTCCGCAA	-	-	rs11426497		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45097086_45097119delGTATTGATCTCAACCCAGAGCAGAGGCTCCGCAA	uc010wkh.1	+						uc010wki.1_RNA	NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			ATGTTGTCATGTATTGATCTCAACCCAGAGCAGAGGCTCCGCAAGTGCCTGTGC	0.513													64	7	---	---	---	---	
PLIN4	729359	broad.mit.edu	37	19	4510385	4510389	+	Intron	DEL	AAAAC	-	-	rs56906779		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4510385_4510389delAAAAC	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0						ctcaaaaaaaaaaacaaaaCAGTCA	0.288													4	2	---	---	---	---	
HNRNPM	4670	broad.mit.edu	37	19	8520629	8520630	+	Intron	INS	-	T	T	rs151081584	by1000genomes	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8520629_8520630insT	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						tttgttttgtgttttttttttg	0.366													4	2	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46112870	46112871	+	3'UTR	DEL	TC	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46112870_46112871delTC	uc002pcn.2	-	19					EML2_uc002pco.2_RNA|EML2_uc002pcp.2_3'UTR|EML2_uc010xxl.1_3'UTR|EML2_uc010xxm.1_3'UTR	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCAATAGACATCTCCCGAAAAT	0.520													22	10	---	---	---	---	
SNRPD2	6633	broad.mit.edu	37	19	46191994	46191995	+	Intron	INS	-	T	T			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46191994_46191995insT	uc002pcw.2	-						SNRPD2_uc002pcv.2_Intron	NM_004597	NP_004588	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 isoform 1						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		cctaacagacattttttttttt	0.178													6	3	---	---	---	---	
KDELR1	10945	broad.mit.edu	37	19	48893549	48893549	+	Intron	DEL	C	-	-	rs36034010		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893549delC	uc002pjb.1	-						KDELR1_uc002pja.1_Intron	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		agagtccaggcccccggcccc	0.000													3	4	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55512434	55512438	+	3'UTR	DEL	CTTAT	-	-	rs4200	byFrequency	TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55512434_55512438delCTTAT	uc002qij.2	+	13					NLRP2_uc010yfp.1_3'UTR|NLRP2_uc010esn.2_3'UTR|NLRP2_uc010eso.2_3'UTR|NLRP2_uc010esp.2_3'UTR	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGCACACATCCTTATCTTTGTTACA	0.415													5	5	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61463679	61463689	+	Intron	DEL	AGTCGCCCTTT	-	-	rs143006001		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61463679_61463689delAGTCGCCCTTT	uc002ydm.2	+							NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CGTGTCTGTCAGTCGCCCTTTCTGGCTCCTG	0.645													2	5	---	---	---	---	
CECR1	51816	broad.mit.edu	37	22	17673720	17673720	+	Intron	DEL	A	-	-	rs35262317		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17673720delA	uc002zmk.1	-						CECR1_uc010gqu.1_Intron|CECR1_uc011agi.1_Intron|CECR1_uc011agj.1_Intron|CECR1_uc002zmj.1_Intron	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1						adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				ctctgtctcgaaaaaaaaaaa	0.279													3	3	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23114749	23114749	+	Intron	DEL	T	-	-	rs74864698		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23114749delT	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CATCCTCTCCTTTTTTTTTTT	0.498													9	4	---	---	---	---	
LMF2	91289	broad.mit.edu	37	22	50942526	50942526	+	Intron	DEL	C	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50942526delC	uc003blp.2	-						LMF2_uc010hba.2_Intron|LMF2_uc003blo.2_Intron	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2							endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		gggctccacaccccccccagt	0.313													4	3	---	---	---	---	
STS	412	broad.mit.edu	37	X	7193988	7193988	+	Intron	DEL	G	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7193988delG	uc004cry.3	+							NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	ttttttttttGCAGGAACACT	0.398									Ichthyosis				3	3	---	---	---	---	
MAP3K15	389840	broad.mit.edu	37	X	19431232	19431233	+	Intron	DEL	AC	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19431232_19431233delAC	uc004czk.1	-						MAP3K15_uc004czj.1_Intron	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					ATGTTTTTATacacacacacac	0.144													9	4	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41064887	41064888	+	Intron	DEL	TT	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41064887_41064888delTT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						ATTGGGTGGGTTTTTTTTTTTT	0.322													6	3	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44820575	44820575	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44820575delT	uc004dge.3	+	3	647	c.272delT	c.(271-273)GTGfs	p.V91fs	KDM6A_uc010nhk.2_Frame_Shift_Del_p.V91fs|KDM6A_uc011mkz.1_Frame_Shift_Del_p.V91fs|KDM6A_uc011mla.1_Frame_Shift_Del_p.V91fs|KDM6A_uc011mlb.1_Frame_Shift_Del_p.V91fs|KDM6A_uc011mlc.1_5'UTR	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	91					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.0(14)|p.0?(6)		kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						GAAGGAAAAGTGGAGTCTGAT	0.289			D|N|F|S		renal|oesophageal SCC|MM								12	21	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44949952	44949952	+	Intron	DEL	T	-	-			TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44949952delT	uc004dge.3	+						KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron|KDM6A_uc011mld.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TTTATAACTGTTTTTTTTTTT	0.368			D|N|F|S		renal|oesophageal SCC|MM								30	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13500484	13500485	+	IGR	DEL	TG	-	-	rs76069150		TCGA-BT-A20T-01	TCGA-BT-A20T-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13500484_13500485delTG								None (None upstream) : None (None downstream)																							cctgagtaactgggaCTGGTTA	0.114													6	5	---	---	---	---	
