Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBE2J2	118424	broad.mit.edu	37	1	1203256	1203256	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1203256C>T	uc001adn.2	-	2	427	c.117G>A	c.(115-117)TCG>TCA	p.S39S	UBE2J2_uc001adm.2_5'UTR|UBE2J2_uc001ado.2_Silent_p.S39S|UBE2J2_uc001adp.2_Silent_p.S39S|UBE2J2_uc001adq.2_5'UTR|UBE2J2_uc001adr.2_Intron|UBE2J2_uc001ads.2_5'UTR	NM_194458	NP_919440	Q8N2K1	UB2J2_HUMAN	ubiquitin conjugating enzyme E2, J2 isoform 3	39	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		CGAGAATATTCGAAGGGAGGG	0.637													15	205	---	---	---	---	PASS
LRRC47	57470	broad.mit.edu	37	1	3703763	3703763	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3703763C>A	uc001akx.1	-	2	755	c.727G>T	c.(727-729)GAG>TAG	p.E243*		NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	243	LRR 7.				translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		ACCATCTTCTCCAGGCGCTTG	0.622													16	47	---	---	---	---	PASS
ATP13A2	23400	broad.mit.edu	37	1	17316492	17316492	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17316492C>G	uc001baa.2	-	22	2609	c.2419G>C	c.(2419-2421)GAC>CAC	p.D807H	ATP13A2_uc001azz.1_5'UTR|ATP13A2_uc001bab.2_Missense_Mutation_p.D802H|ATP13A2_uc001bac.2_Intron	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	807	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GCAGCCTGGTCAGGATCCTGG	0.647													7	17	---	---	---	---	PASS
CTPS	1503	broad.mit.edu	37	1	41448943	41448943	+	Intron	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41448943C>T	uc001cgk.3	+						CTPS_uc010ojo.1_Intron|CTPS_uc010ojp.1_Intron|CTPS_uc001cgl.3_5'UTR	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase						CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)	ATTTTTCCTTCTTCCAGGTCA	0.254													6	34	---	---	---	---	PASS
LRRC41	10489	broad.mit.edu	37	1	46763283	46763283	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46763283C>T	uc001cpn.2	-	3	353	c.309G>A	c.(307-309)TGG>TGA	p.W103*	LRRC41_uc010omb.1_Nonsense_Mutation_p.W103*|LRRC41_uc001cpo.1_Nonsense_Mutation_p.W103*	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	103										ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					AGAGTCGGCGCCAGATGGCCT	0.458													11	43	---	---	---	---	PASS
SLC5A9	200010	broad.mit.edu	37	1	48697274	48697274	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48697274G>A	uc001cro.2	+	6	720	c.668G>A	c.(667-669)GGA>GAA	p.G223E	SLC5A9_uc010oms.1_RNA|SLC5A9_uc001crn.2_Missense_Mutation_p.G248E|SLC5A9_uc010omt.1_Missense_Mutation_p.G237E|SLC5A9_uc001crp.2_5'UTR|SLC5A9_uc010omu.1_5'UTR	NM_001011547	NP_001011547	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/glucose	223	Helical; (Potential).					integral to membrane|plasma membrane	low-affinity glucose:sodium symporter activity			ovary(3)	3						ATGGTAGGGGGAGCCCTGGTC	0.537													9	23	---	---	---	---	PASS
ALG6	29929	broad.mit.edu	37	1	63902557	63902557	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63902557C>G	uc010oow.1	+	15	1695	c.1390C>G	c.(1390-1392)CAG>GAG	p.Q464E	ALG6_uc001daz.2_RNA|ALG6_uc009waj.2_RNA|ALG6_uc010oox.1_Missense_Mutation_p.Q211E	NM_013339	NP_037471	Q9Y672	ALG6_HUMAN	dolichyl pyrophosphate Man9GlcNAc2	464					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0						GGATCCTCCTCAGAAACTACC	0.373													31	126	---	---	---	---	PASS
PGM1	5236	broad.mit.edu	37	1	64089033	64089033	+	Intron	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64089033C>A	uc001dbh.2	+						PGM1_uc010ooy.1_Intron|PGM1_uc010ooz.1_5'UTR	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1						cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3						TTTAGTTACTCATACGACACT	0.463													3	31	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82451025	82451025	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82451025C>G	uc001dit.3	+	20	3624	c.3443C>G	c.(3442-3444)TCA>TGA	p.S1148*	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Nonsense_Mutation_p.S1148*|LPHN2_uc001div.2_Nonsense_Mutation_p.S1148*|LPHN2_uc009wcd.2_Intron|LPHN2_uc001diw.2_Nonsense_Mutation_p.S732*	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1161	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		AATAGCACTTCAACACTTAAT	0.289													4	13	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86252137	86252137	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86252137C>G	uc001dlj.2	-	48	4001	c.3959G>C	c.(3958-3960)AGA>ACA	p.R1320T	COL24A1_uc001dli.2_Missense_Mutation_p.R456T|COL24A1_uc010osd.1_Missense_Mutation_p.R620T|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1320	Collagen-like 15.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGGGCCGCCTCTGATGCCCTA	0.478													11	34	---	---	---	---	PASS
GCLM	2730	broad.mit.edu	37	1	94354444	94354444	+	3'UTR	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94354444C>G	uc001dqg.1	-	7						NM_002061	NP_002052	P48507	GSH0_HUMAN	glutamate-cysteine ligase regulatory protein						glutamate metabolic process|glutathione biosynthetic process|regulation of blood vessel size|response to drug|response to oxidative stress|xenobiotic metabolic process	cytosol|soluble fraction	glutamate-cysteine ligase catalytic subunit binding			ovary(1)	1		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	GAAAGAATATCTGCCTCAATG	0.343													4	18	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144930642	144930642	+	Intron	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144930642G>C	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Nonsense_Mutation_p.S356*|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGCAGGTCTGAAAGCTCCAA	0.478			T	PDGFRB	MPD								5	117	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155252454	155252454	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155252454C>T	uc001fjz.1	+	2	539	c.531C>T	c.(529-531)CTC>CTT	p.L177L	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_5'UTR	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	177	Helical; Name=Segment S3; (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGGTTGACCTCATCTCTTCTA	0.607													12	70	---	---	---	---	PASS
RUSC1	23623	broad.mit.edu	37	1	155292388	155292388	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155292388C>G	uc001fkj.2	+	2	1053	c.824C>G	c.(823-825)TCT>TGT	p.S275C	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_5'Flank|C1orf104_uc001fki.2_Intron|RUSC1_uc001fkk.2_Missense_Mutation_p.S275C|RUSC1_uc009wqn.1_RNA|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank|RUSC1_uc001fkp.2_5'Flank|RUSC1_uc001fkq.2_5'Flank|RUSC1_uc010pgb.1_5'Flank|RUSC1_uc009wqp.1_5'Flank|RUSC1_uc001fkn.2_5'Flank|RUSC1_uc001fko.2_5'Flank|RUSC1_uc001fkr.2_5'Flank|RUSC1_uc001fks.2_5'Flank	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	275						cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			AAATTCGACTCTGGTTGGAAA	0.428													8	142	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160156121	160156121	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160156121G>A	uc001fve.3	+	21	3504	c.3025G>A	c.(3025-3027)GAA>AAA	p.E1009K	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.E512K|ATP1A4_uc001fvh.2_Missense_Mutation_p.E145K	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	1009	Helical; (Potential).			ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228).	ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGTCTATGATGAAATCAGAAA	0.557													52	214	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171621749	171621749	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171621749C>T	uc001ghu.2	-	1	25	c.3G>A	c.(1-3)ATG>ATA	p.M1I	MYOC_uc010pmk.1_Missense_Mutation_p.M1I	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	1					anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGAAGAACCTCATTGCAGAGG	0.612													7	18	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204228731	204228731	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204228731C>G	uc001hau.2	-	8	979	c.662G>C	c.(661-663)AGA>ACA	p.R221T	PLEKHA6_uc009xaw.1_5'Flank|PLEKHA6_uc009xax.1_5'Flank|PLEKHA6_uc009xay.1_5'Flank|PLEKHA6_uc009xaz.1_5'Flank|PLEKHA6_uc009xba.1_5'Flank|PLEKHA6_uc009xbb.1_5'Flank|PLEKHA6_uc009xbc.1_5'Flank	NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	221	Pro-rich.									ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTCAGGCCTTCTCTCTGCCTT	0.637													14	56	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237881784	237881784	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237881784G>A	uc001hyl.1	+	73	10637	c.10517G>A	c.(10516-10518)CGA>CAA	p.R3506Q	RYR2_uc010pxz.1_Missense_Mutation_p.R461Q	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3506					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATGAAGTACGAGATATAATC	0.333													9	17	---	---	---	---	PASS
HNRNPU	3192	broad.mit.edu	37	1	245017797	245017797	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245017797C>G	uc001iaz.1	-	14	2651	c.2433G>C	c.(2431-2433)TGG>TGC	p.W811C	HNRNPU_uc001iaw.1_RNA|HNRNPU_uc001iax.1_RNA|HNRNPU_uc001iay.1_Missense_Mutation_p.W535C|HNRNPU_uc001iba.1_Missense_Mutation_p.W792C	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	811	Gly-rich.				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			GCTTCTGACCCCAGAATTGCT	0.328													10	38	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245809541	245809541	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245809541C>T	uc001ibf.1	+	10	2657	c.2217C>T	c.(2215-2217)GTC>GTT	p.V739V	KIF26B_uc010pyq.1_Silent_p.V739V|KIF26B_uc001ibg.1_Silent_p.V357V|KIF26B_uc001ibh.1_5'UTR	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	739	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TGGGCAATGTCATCCTGGCTC	0.502													6	30	---	---	---	---	PASS
RETSAT	54884	broad.mit.edu	37	2	85577947	85577947	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85577947G>C	uc002spd.2	-	3	744	c.553C>G	c.(553-555)CCA>GCA	p.P185A	RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.P124A|RETSAT_uc010fgf.2_Intron	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	185					retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	TCCTCCTGTGGAAACTTCTCC	0.468													6	152	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88888374	88888374	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88888374G>A	uc002stc.3	-	7	1413	c.1211C>T	c.(1210-1212)TCA>TTA	p.S404L		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	404	Lumenal (Potential).				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						AAACTTTTCTGAAATTCTGAC	0.338													25	78	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098954	178098954	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098954C>T	uc002ulh.3	-	2	646	c.91G>A	c.(91-93)GGA>AGA	p.G31R	NFE2L2_uc002ulg.3_Missense_Mutation_p.G15R|NFE2L2_uc010zfa.1_Missense_Mutation_p.G15R|NFE2L2_uc002uli.3_Missense_Mutation_p.G15R|NFE2L2_uc010fra.2_Missense_Mutation_p.G15R|NFE2L2_uc010frb.2_Missense_Mutation_p.G15R	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	31					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.G31R(1)		central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CGACTTACTCCAAGATCTATA	0.358			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			11	35	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201515748	201515748	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201515748G>A	uc002uvx.2	+	26	3000	c.2899G>A	c.(2899-2901)GAG>AAG	p.E967K	AOX1_uc010zhf.1_Missense_Mutation_p.E523K|AOX1_uc010fsu.2_Missense_Mutation_p.E333K	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	967					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CTACAAACAAGAGATCAATGC	0.418													13	79	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9483388	9483388	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9483388C>T	uc003brt.2	+	9	1357	c.922C>T	c.(922-924)CGA>TGA	p.R308*	SETD5_uc003brs.1_Nonsense_Mutation_p.R289*|SETD5_uc003bru.2_Nonsense_Mutation_p.R210*|SETD5_uc003brv.2_Nonsense_Mutation_p.R197*|SETD5_uc010hck.2_5'Flank|SETD5_uc003brw.1_5'Flank|SETD5_uc003brx.2_5'Flank	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	308	SET.									ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AGTCATGTTACGACAGCAATT	0.443													14	80	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38888407	38888407	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38888407C>G	uc011ays.1	-	26	5353	c.5154G>C	c.(5152-5154)AAG>AAC	p.K1718N		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1718					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	CATACAACTTCTTGAGAGGAT	0.433													35	145	---	---	---	---	PASS
IMPDH2	3615	broad.mit.edu	37	3	49064436	49064436	+	Silent	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49064436G>T	uc003cvt.2	-	6	668	c.576C>A	c.(574-576)ATC>ATA	p.I192I		NM_000884	NP_000875	P12268	IMDH2_HUMAN	inosine monophosphate dehydrogenase 2	192	CBS 2.				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	IMP dehydrogenase activity|metal ion binding|nucleotide binding|protein binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)	CCTTCAGTGTGATGCCTGCAG	0.502													7	292	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105243325	105243325	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105243325G>A	uc003dvx.2	+	3	907	c.367G>A	c.(367-369)GAG>AAG	p.E123K	ALCAM_uc003dvv.2_Missense_Mutation_p.E123K|ALCAM_uc003dvw.1_Missense_Mutation_p.E123K|ALCAM_uc003dvy.2_Missense_Mutation_p.E123K|ALCAM_uc011bhh.1_Missense_Mutation_p.E72K	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	123	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						CAACGTGTTTGAGGCACCTAC	0.418													21	64	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119451310	119451310	+	Silent	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119451310C>G	uc003ede.3	+	9	1265	c.1188C>G	c.(1186-1188)CTC>CTG	p.L396L	C3orf15_uc010hqy.1_Silent_p.L396L|C3orf15_uc010hqz.2_Silent_p.L334L|C3orf15_uc011bjd.1_Silent_p.L270L|C3orf15_uc011bje.1_Silent_p.L376L|C3orf15_uc010hra.1_Silent_p.L157L	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	Error:Variant_position_missing_in_Q7Z4T9_after_alignment						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		ACTACTATCTCAACACCTATG	0.323													9	19	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141889249	141889249	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141889249G>A	uc003euq.1	-	15	1490	c.1359C>T	c.(1357-1359)GAC>GAT	p.D453D	GK5_uc003eup.1_Silent_p.D174D|GK5_uc010hus.1_RNA	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	453					glycerol metabolic process		ATP binding|glycerol kinase activity				0						CATTAATCAGGTCTGAAGTCA	0.408													4	64	---	---	---	---	PASS
MBNL1	4154	broad.mit.edu	37	3	152018007	152018007	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152018007C>T	uc003ezm.2	+	1	814	c.25C>T	c.(25-27)CGG>TGG	p.R9W	MBNL1_uc003ezh.2_Missense_Mutation_p.R9W|MBNL1_uc003ezi.2_Missense_Mutation_p.R9W|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Missense_Mutation_p.R9W|MBNL1_uc003ezp.2_Missense_Mutation_p.R9W|MBNL1_uc003ezn.2_Missense_Mutation_p.R9W|MBNL1_uc003ezo.2_Missense_Mutation_p.R9W|MBNL1_uc003ezg.1_RNA|MBNL1_uc003ezk.1_RNA	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	9					embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CACACCAATTCGGGACACAAA	0.438													14	49	---	---	---	---	PASS
TBL1XR1	79718	broad.mit.edu	37	3	176752109	176752109	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176752109C>A	uc003fiw.3	-	13	1387	c.1127G>T	c.(1126-1128)TGG>TTG	p.W376L	TBL1XR1_uc003fix.3_Missense_Mutation_p.W376L|TBL1XR1_uc011bpz.1_Missense_Mutation_p.W48L	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	376	WD 5.				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TTTCATACTCCATATCTAAAC	0.269													6	13	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5633669	5633669	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5633669C>T	uc003gij.2	-	11	1615	c.1561G>A	c.(1561-1563)GAC>AAC	p.D521N	EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.D441N	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	521	Potential.					integral to membrane				large_intestine(3)|ovary(2)	5						TTGGCAAAGTCTTCTTCTTGT	0.468													5	89	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39290425	39290425	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39290425C>G	uc003gty.1	-	25	3537	c.3403G>C	c.(3403-3405)GAT>CAT	p.D1135H	RFC1_uc003gtx.1_Missense_Mutation_p.D1134H	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	1135					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GGCTCCTTATCTTTTTCTGGT	0.363													17	50	---	---	---	---	PASS
UGT2B11	10720	broad.mit.edu	37	4	70080466	70080466	+	5'Flank	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70080466C>G	uc003heh.2	-						uc003hei.1_RNA	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,						estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						TCATTCTTTTCCAGTCACTGT	0.358													11	48	---	---	---	---	PASS
CNOT6L	246175	broad.mit.edu	37	4	78641571	78641571	+	3'UTR	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78641571G>A	uc011ccd.1	-	12					CNOT6L_uc003hks.2_3'UTR	NM_144571	NP_653172	Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding			large_intestine(1)	1						CCGTCTTGGCGGGGCAGTACT	0.478													10	80	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187549509	187549509	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187549509G>A	uc003izf.2	-	9	4797	c.4609C>T	c.(4609-4611)CAA>TAA	p.Q1537*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1537	Extracellular (Potential).|Cadherin 13.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GGCACATCTTGATCTCGTACC	0.458										HNSCC(5;0.00058)			7	9	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187549807	187549807	+	Silent	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187549807G>T	uc003izf.2	-	8	4622	c.4434C>A	c.(4432-4434)ATC>ATA	p.I1478I		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1478	Extracellular (Potential).|Cadherin 13.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CCACAGCACTGATTTGCAAAA	0.398										HNSCC(5;0.00058)			20	25	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11346575	11346575	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11346575C>T	uc003jfa.1	-	9	1682	c.1537G>A	c.(1537-1539)GAG>AAG	p.E513K	CTNND2_uc010itt.2_Missense_Mutation_p.E422K|CTNND2_uc011cmy.1_Missense_Mutation_p.E176K|CTNND2_uc011cmz.1_Missense_Mutation_p.E80K|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.E80K	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	513					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TATGGAGACTCAACAGAGGGA	0.607													26	96	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82868358	82868358	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82868358T>G	uc003kii.3	+	13	10215	c.9859T>G	c.(9859-9861)TAT>GAT	p.Y3287D	VCAN_uc003kij.3_Missense_Mutation_p.Y2300D|VCAN_uc010jau.2_Missense_Mutation_p.Y1533D|VCAN_uc003kik.3_Missense_Mutation_p.Y546D|VCAN_uc003kil.3_Missense_Mutation_p.Y1951D	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3287	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		CCATCTCACCTATACGTGCAA	0.383													12	47	---	---	---	---	PASS
F12	2161	broad.mit.edu	37	5	176833003	176833003	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176833003G>A	uc003mgo.3	-	3	224	c.175C>T	c.(175-177)CAC>TAC	p.H59Y	F12_uc011dfy.1_5'Flank|F12_uc003mgn.3_5'Flank|F12_uc010jkl.2_RNA	NM_000505	NP_000496	P00748	FA12_HUMAN	coagulation factor XII precursor	59	Fibronectin type-II.				Factor XII activation|fibrinolysis|innate immune response|positive regulation of blood coagulation|positive regulation of fibrinolysis|positive regulation of plasminogen activation|protein autoprocessing|response to misfolded protein|zymogen activation	extracellular space|plasma membrane	serine-type endopeptidase activity				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTACATTTGTGGTACAGCTGC	0.607									Hereditary_Angioedema				32	112	---	---	---	---	PASS
BTN3A3	10384	broad.mit.edu	37	6	26452381	26452381	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26452381C>T	uc003nhz.2	+	11	1677	c.1497C>T	c.(1495-1497)TTC>TTT	p.F499F	BTN3A3_uc003nia.2_Silent_p.F457F|BTN3A3_uc011dkn.1_Silent_p.F450F	NM_006994	NP_008925	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3 isoform a	499	B30.2/SPRY.|Cytoplasmic (Potential).					integral to membrane					0						ATCCTGTTTTCAGAATTTTGA	0.478													5	124	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88317511	88317511	+	Missense_Mutation	SNP	C	T	T	rs149324991	byFrequency	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88317511C>T	uc003pmh.2	+	6	592	c.548C>T	c.(547-549)TCA>TTA	p.S183L	ORC3L_uc011dzl.1_Missense_Mutation_p.S183L|ORC3L_uc011dzm.1_Missense_Mutation_p.S183L|ORC3L_uc011dzn.1_RNA|ORC3L_uc003pmg.2_Missense_Mutation_p.S183L|ORC3L_uc003pmi.2_Missense_Mutation_p.S183L|ORC3L_uc011dzo.1_Missense_Mutation_p.S40L|ORC3L_uc011dzp.1_Missense_Mutation_p.S40L	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2	183					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		TCAATGGATTCACTTTCCAGT	0.373													23	65	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599223	136599223	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599223G>A	uc003qgx.1	-	4	1049	c.796C>T	c.(796-798)CAG>TAG	p.Q266*	BCLAF1_uc003qgw.1_Nonsense_Mutation_p.Q266*|BCLAF1_uc003qgy.1_Nonsense_Mutation_p.Q264*|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Nonsense_Mutation_p.Q264*	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	266					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GGACTATGCTGAATGGAATGT	0.448													5	38	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144803379	144803379	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144803379G>A	uc003qkt.2	+	26	3634	c.3542G>A	c.(3541-3543)AGA>AAA	p.R1181K		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1181	Spectrin 8.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AAGGAGGTGAGAGTGAAGATT	0.453													9	33	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47870786	47870786	+	Intron	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47870786G>C	uc003tny.1	-						C7orf69_uc003toa.1_RNA	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						CTGAGGACCTGAGGATGTTTG	0.483													9	75	---	---	---	---	PASS
LANCL2	55915	broad.mit.edu	37	7	55459492	55459492	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55459492C>G	uc003tqp.2	+	2	789	c.211C>G	c.(211-213)CAT>GAT	p.H71D		NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2	71					negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TCAGATCATTCATAATTTCAT	0.363													12	27	---	---	---	---	PASS
PION	54103	broad.mit.edu	37	7	77010667	77010667	+	Silent	SNP	A	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77010667A>G	uc003ugf.2	-	8	610	c.531T>C	c.(529-531)ATT>ATC	p.I177I	PION_uc003ugg.1_5'UTR	NM_017439	NP_059135	A4D1B5	GSAP_HUMAN	pigeon homolog	177					beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1						GAAATTGTTCAATATCTTTAA	0.289													5	24	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116409705	116409705	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116409705G>A	uc003vij.2	+	12	2777	c.2590G>A	c.(2590-2592)GAT>AAT	p.D864N	MET_uc010lkh.2_Missense_Mutation_p.D882N|MET_uc011knj.1_Missense_Mutation_p.D434N	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	864	Extracellular (Potential).				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCAGGGAAATGATATTGACCC	0.358			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				14	42	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8185504	8185504	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8185504C>T	uc003wsh.3	-	4	2788	c.2788G>A	c.(2788-2790)GGG>AGG	p.G930R		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	930							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						TGGGTGCTCCCGGTGGAGGCT	0.677													14	47	---	---	---	---	PASS
GATA4	2626	broad.mit.edu	37	8	11616017	11616017	+	3'UTR	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11616017G>T	uc003wuc.2	+	7					GATA4_uc003wub.1_3'UTR|GATA4_uc011kxc.1_3'UTR|uc003wud.1_5'Flank	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4						atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		TTCCTGCACGGACCTGGGACT	0.567													3	34	---	---	---	---	PASS
SCARA5	286133	broad.mit.edu	37	8	27762132	27762132	+	Intron	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27762132C>G	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_3'UTR|SCARA5_uc003xgl.2_3'UTR	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		ATCAGCATCTCTTGCTAGACC	0.562													5	22	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48874100	48874100	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48874100C>G	uc003xqk.1	+	3	190	c.95C>G	c.(94-96)TCT>TGT	p.S32C	PRKDC_uc003xqi.2_5'Flank|PRKDC_uc003xqj.2_5'Flank|PRKDC_uc011ldh.1_5'Flank|MCM4_uc003xql.1_Missense_Mutation_p.S32C|MCM4_uc011ldi.1_Missense_Mutation_p.S32C|MCM4_uc010lxw.1_RNA	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	32					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GCCAGGTCATCTCCCTCTCAG	0.577													16	37	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361016	105361016	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361016G>A	uc003ylx.1	+	2	285	c.236G>A	c.(235-237)CGA>CAA	p.R79Q		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	79					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AAGCATGCACGATGTTTTATT	0.522													17	65	---	---	---	---	PASS
CNTLN	54875	broad.mit.edu	37	9	17464544	17464544	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17464544G>C	uc003zmz.2	+	21	3477	c.3451G>C	c.(3451-3453)GAC>CAC	p.D1151H	CNTLN_uc003zmy.2_Missense_Mutation_p.D1152H|CNTLN_uc010mio.2_Missense_Mutation_p.D831H	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	1152	Potential.					centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		TTTGATAGAGGACTTGAAATT	0.294													5	20	---	---	---	---	PASS
NDUFB6	4712	broad.mit.edu	37	9	32572968	32572968	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32572968G>C	uc003zre.1	-	1	215	c.91C>G	c.(91-93)CGG>GGG	p.R31G	NDUFB6_uc003zrf.1_Missense_Mutation_p.R31G	NM_002493	NP_002484	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	31					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)	NADH(DB00157)	ACCGGCTCCCGAGGGCTCAGC	0.562											OREG0019131	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	74	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135785837	135785837	+	Intron	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135785837G>A	uc004cca.2	-						TSC1_uc004ccb.3_Intron|TSC1_uc011mcq.1_Intron|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Intron|TSC1_uc004ccc.1_3'UTR	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CAATTATTCTGATTCAAACCC	0.254			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				9	14	---	---	---	---	PASS
CELF2	10659	broad.mit.edu	37	10	11047307	11047307	+	5'UTR	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11047307C>A	uc001iki.3	+	1					CELF2_uc010qbi.1_5'UTR|CELF2_uc010qbj.1_5'UTR	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GATGTTTGAGCATACTTCTGA	0.313													12	95	---	---	---	---	PASS
ACBD7	414149	broad.mit.edu	37	10	15130774	15130774	+	5'UTR	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15130774C>G	uc001inv.2	-	1					ACBD7_uc010qby.1_5'UTR	NM_001039844	NP_001034933	Q8N6N7	ACBD7_HUMAN	acyl-Coenzyme A binding domain containing 7								fatty-acyl-CoA binding				0						GTCCGGTGCTCTGCCCCCTCT	0.751													4	11	---	---	---	---	PASS
ARHGAP12	94134	broad.mit.edu	37	10	32098165	32098165	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32098165G>A	uc001ivz.1	-	17	2391	c.2121C>T	c.(2119-2121)GTC>GTT	p.V707V	ARHGAP12_uc001ivy.1_Silent_p.V653V|ARHGAP12_uc009xls.2_Silent_p.V658V|ARHGAP12_uc001iwb.1_Silent_p.V700V|ARHGAP12_uc001iwc.1_Silent_p.V675V|ARHGAP12_uc009xlq.1_Silent_p.V628V|ARHGAP12_uc001ivw.1_5'Flank|ARHGAP12_uc001ivx.1_5'UTR	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	707	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				TACCATGATTGACTGCAAACC	0.343													4	33	---	---	---	---	PASS
MAPK8	5599	broad.mit.edu	37	10	49633981	49633981	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49633981G>C	uc009xnz.2	+	8	963	c.739G>C	c.(739-741)GAA>CAA	p.E247Q	MAPK8_uc001jgl.2_Missense_Mutation_p.E247Q|MAPK8_uc001jgm.2_Missense_Mutation_p.E247Q|MAPK8_uc001jgo.2_Missense_Mutation_p.E247Q|MAPK8_uc009xoa.2_Intron|MAPK8_uc001jgn.2_Missense_Mutation_p.E247Q|MAPK8_uc010qgk.1_Missense_Mutation_p.E247Q|MAPK8_uc001jgp.2_Missense_Mutation_p.E247Q|MAPK8_uc001jgq.2_Missense_Mutation_p.E247Q	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	247	Protein kinase.				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding	p.E247*(1)		central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		ACCATGTCCTGAATTCATGAA	0.343													7	45	---	---	---	---	PASS
MAPK8	5599	broad.mit.edu	37	10	49634089	49634089	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49634089G>C	uc009xnz.2	+	8	1071	c.847G>C	c.(847-849)GAC>CAC	p.D283H	MAPK8_uc001jgl.2_Missense_Mutation_p.D283H|MAPK8_uc001jgm.2_Missense_Mutation_p.D283H|MAPK8_uc001jgo.2_Missense_Mutation_p.D283H|MAPK8_uc009xoa.2_Missense_Mutation_p.D207H|MAPK8_uc001jgn.2_Missense_Mutation_p.D283H|MAPK8_uc010qgk.1_Missense_Mutation_p.D283H|MAPK8_uc001jgp.2_Missense_Mutation_p.D283H|MAPK8_uc001jgq.2_Missense_Mutation_p.D283H	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	283	Protein kinase.				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		TTTCCCAGCTGACTCAGAACA	0.378													4	61	---	---	---	---	PASS
CDK1	983	broad.mit.edu	37	10	62553724	62553724	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62553724G>A	uc001jld.2	+	8	1019	c.885G>A	c.(883-885)AAG>AAA	p.K295K	CDK1_uc001jle.2_RNA|CDK1_uc001jlf.2_Silent_p.K295K|CDK1_uc001jlg.2_Silent_p.K238K	NM_001786	NP_001777	P06493	CDK1_HUMAN	cell division cycle 2 isoform 1	295					activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity			ovary(1)	1						ATCAGATTAAGAAGATGTAGC	0.294													7	34	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63170341	63170341	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63170341G>A	uc001jlo.2	-	6	1215	c.846C>T	c.(844-846)ATC>ATT	p.I282I	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlp.1_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	282	Helical; (Potential).					integral to membrane					0	Prostate(12;0.0112)					GCATCTGATTGATCACTTTGA	0.507													7	16	---	---	---	---	PASS
ACTA2	59	broad.mit.edu	37	10	90697972	90697972	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90697972G>T	uc001kfp.2	-	8	952	c.836C>A	c.(835-837)ACC>AAC	p.T279N	STAMBPL1_uc010qmx.1_Intron|ACTA2_uc010qmy.1_Missense_Mutation_p.T234N|ACTA2_uc001kfq.2_Missense_Mutation_p.T279N|uc001kfo.1_RNA	NM_001613	NP_001604	P62736	ACTA_HUMAN	alpha 2 actin	279					response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		GTTGTAGGTGGTTTCATGGAT	0.493													12	86	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112343991	112343991	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112343991G>T	uc001kze.2	+	13	1268	c.1142G>T	c.(1141-1143)CGA>CTA	p.R381L		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	381					cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAGCAGGGTCGAGGAAGCCAG	0.378													4	93	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3716747	3716747	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3716747G>A	uc001lyh.2	-	26	4390	c.4099C>T	c.(4099-4101)CAG>TAG	p.Q1367*	NUP98_uc001lyi.2_Nonsense_Mutation_p.Q1367*|NUP98_uc001lyg.2_Nonsense_Mutation_p.Q332*	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1384					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GCTTGGAGCTGATGCCAGTCC	0.478			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								4	164	---	---	---	---	PASS
ZNF214	7761	broad.mit.edu	37	11	7022446	7022446	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7022446C>A	uc001mfa.2	-	3	771	c.468G>T	c.(466-468)ATG>ATT	p.M156I	ZNF214_uc010ray.1_Missense_Mutation_p.M156I|ZNF214_uc009yfh.1_Missense_Mutation_p.M156I	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	156					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		GTGAACCACTCATGTAGATTT	0.383													4	44	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62393546	62393546	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62393546G>A	uc001nub.2	-	23	2749	c.2716C>T	c.(2716-2718)CAG>TAG	p.Q906*	GANAB_uc001ntz.2_Nonsense_Mutation_p.Q93*|GANAB_uc001nua.2_Nonsense_Mutation_p.Q928*|GANAB_uc001nuc.2_Nonsense_Mutation_p.Q809*|GANAB_uc010rma.1_Nonsense_Mutation_p.Q814*|GANAB_uc010rmb.1_Nonsense_Mutation_p.Q792*	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	906					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						CCTTTTGTCTGGAGTACCACA	0.552													11	356	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62393547	62393547	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62393547G>A	uc001nub.2	-	23	2748	c.2715C>T	c.(2713-2715)CTC>CTT	p.L905L	GANAB_uc001ntz.2_Silent_p.L92L|GANAB_uc001nua.2_Silent_p.L927L|GANAB_uc001nuc.2_Silent_p.L808L|GANAB_uc010rma.1_Silent_p.L813L|GANAB_uc010rmb.1_Silent_p.L791L	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	905					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						CTTTTGTCTGGAGTACCACAG	0.557													11	355	---	---	---	---	PASS
ATL3	25923	broad.mit.edu	37	11	63403040	63403040	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63403040C>G	uc001nxk.1	-	10	1277	c.1001G>C	c.(1000-1002)GGA>GCA	p.G334A	ATL3_uc010rms.1_Missense_Mutation_p.G316A|ATL3_uc010rmr.1_5'UTR	NM_015459	NP_056274	Q6DD88	ATLA3_HUMAN	atlastin 3	334	Cytoplasmic.				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			pancreas(1)	1						CAGATCTTCTCCTTGATAAAT	0.303											OREG0021036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	50	---	---	---	---	PASS
FRMD8	83786	broad.mit.edu	37	11	65161533	65161533	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65161533G>A	uc001odu.3	+	5	569	c.377G>A	c.(376-378)CGA>CAA	p.R126Q	FRMD8_uc009yqj.2_Missense_Mutation_p.R70Q|FRMD8_uc010rof.1_Missense_Mutation_p.R92Q	NM_031904	NP_114110	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	126	FERM.					cytoskeleton	binding			lung(1)|pancreas(1)	2						CTGCAGTTCCGAAGGAACGTG	0.672													11	30	---	---	---	---	PASS
C11orf80	79703	broad.mit.edu	37	11	66581356	66581356	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66581356G>T	uc001ojf.2	+	10	1066	c.1059G>T	c.(1057-1059)TTG>TTT	p.L353F	C11orf80_uc001ojg.2_Missense_Mutation_p.L120F|C11orf80_uc001ojh.2_Missense_Mutation_p.L121F|C11orf80_uc001oji.2_Missense_Mutation_p.L121F|C11orf80_uc010rpl.1_5'UTR|C11orf80_uc001ojj.2_5'UTR	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703	198											0						ATGGACCTTTGGGTCTGCCTC	0.348													3	44	---	---	---	---	PASS
RNF169	254225	broad.mit.edu	37	11	74547657	74547657	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74547657G>A	uc001ovl.3	+	6	2022	c.2009G>A	c.(2008-2010)CGA>CAA	p.R670Q	XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169	670							zinc ion binding			ovary(1)	1						GAAGAAGACCGACAGTTGGCT	0.552													13	57	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76175124	76175124	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76175124G>A	uc001oxl.2	+	7	974	c.831G>A	c.(829-831)AAG>AAA	p.K277K	C11orf30_uc009yuj.1_Silent_p.K292K|C11orf30_uc010rsa.1_Silent_p.K227K|C11orf30_uc001oxm.2_Silent_p.K278K|C11orf30_uc010rsb.1_Silent_p.K292K|C11orf30_uc010rsc.1_Silent_p.K292K|C11orf30_uc001oxn.2_Silent_p.K278K|C11orf30_uc010rsd.1_Silent_p.K291K	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	277	Interaction with BRCA2.				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						CAACACAGAAGGTATGTGGTG	0.348													9	30	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106681029	106681029	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106681029G>T	uc001pjg.1	-	5	1772	c.1382C>A	c.(1381-1383)GCC>GAC	p.A461D	GUCY1A2_uc010rvo.1_Missense_Mutation_p.A482D|GUCY1A2_uc009yxn.1_Missense_Mutation_p.A461D	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	461					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		CCCATCTTGGGCCTTTGCCTG	0.463													3	24	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108115627	108115627	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108115627C>T	uc001pkb.1	+	7	1160	c.775C>T	c.(775-777)CTT>TTT	p.L259F	ATM_uc009yxr.1_Missense_Mutation_p.L259F	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	259					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		AGATGAAATTCTTCCCACTTT	0.338			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			4	67	---	---	---	---	PASS
MPZL2	10205	broad.mit.edu	37	11	118127913	118127913	+	Intron	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118127913G>A	uc001psn.2	-						MPZL2_uc001pso.2_3'UTR	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor						anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GGACATGTCAGAAAGCTGAAG	0.408													7	31	---	---	---	---	PASS
PKNOX2	63876	broad.mit.edu	37	11	125281675	125281675	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125281675G>A	uc001qbu.2	+	10	1164	c.850G>A	c.(850-852)GAG>AAG	p.E284K	PKNOX2_uc010saz.1_Missense_Mutation_p.E255K|PKNOX2_uc010sba.1_Missense_Mutation_p.E255K|PKNOX2_uc010sbb.1_Missense_Mutation_p.E220K|PKNOX2_uc001qbv.2_Missense_Mutation_p.E49K	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	284						nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CCTGGACAATGAGGATAAGAA	0.527													15	44	---	---	---	---	PASS
MRPS35	60488	broad.mit.edu	37	12	27877118	27877118	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27877118G>C	uc001rih.2	+	5	569	c.521G>C	c.(520-522)AGA>ACA	p.R174T	MRPS35_uc001rii.2_Missense_Mutation_p.R174T	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor	174					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)					GTAGTCTTAAGAGTAAGAGTT	0.289													6	31	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30814158	30814158	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30814158C>T	uc001rjd.2	-	16	1968	c.1798G>A	c.(1798-1800)GAA>AAA	p.E600K	IPO8_uc001rje.1_Missense_Mutation_p.E89K|IPO8_uc010sjt.1_Missense_Mutation_p.E395K	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	600					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTTCAACTTCTTCATATTCA	0.338													9	25	---	---	---	---	PASS
IRAK4	51135	broad.mit.edu	37	12	44166804	44166804	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44166804G>C	uc001rnu.3	+	6	710	c.580G>C	c.(580-582)GAG>CAG	p.E194Q	IRAK4_uc001rnt.3_Missense_Mutation_p.E194Q|IRAK4_uc001rnx.3_Missense_Mutation_p.E70Q|IRAK4_uc001rny.3_Missense_Mutation_p.E70Q|IRAK4_uc010sky.1_Missense_Mutation_p.E70Q|IRAK4_uc001rnv.3_Missense_Mutation_p.E70Q|IRAK4_uc001rnw.3_Missense_Mutation_p.E70Q	NM_001114182	NP_001107654	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	194	ATP (By similarity).|Protein kinase.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0	all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		TAAAATGGGAGAGGGAGGATT	0.338													9	30	---	---	---	---	PASS
KRT86	3892	broad.mit.edu	37	12	52651959	52651959	+	Intron	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52651959C>T	uc010snq.1	+						uc010snr.1_5'UTR	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86						cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCCACCTTGTCCATGAAGGCC	0.557													22	95	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102043044	102043044	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102043044G>C	uc001tii.2	+	13	1230	c.1128G>C	c.(1126-1128)AAG>AAC	p.K376N	MYBPC1_uc001tif.1_Missense_Mutation_p.K389N|MYBPC1_uc001tig.2_Missense_Mutation_p.K401N|MYBPC1_uc010svq.1_Missense_Mutation_p.K363N|MYBPC1_uc001tih.2_Missense_Mutation_p.K401N|MYBPC1_uc001tij.2_Missense_Mutation_p.K376N|MYBPC1_uc010svr.1_Missense_Mutation_p.K376N|MYBPC1_uc010svs.1_Missense_Mutation_p.K376N|MYBPC1_uc010svt.1_Missense_Mutation_p.K364N|MYBPC1_uc010svu.1_Missense_Mutation_p.K357N|MYBPC1_uc001tik.2_Missense_Mutation_p.K350N	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	376	Ig-like C2-type 3.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						TCAGGTTTAAGAATGGTGAAG	0.239													10	36	---	---	---	---	PASS
HIP1R	9026	broad.mit.edu	37	12	123340550	123340550	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123340550G>A	uc001udj.1	+	14	1211	c.1152G>A	c.(1150-1152)CTG>CTA	p.L384L	HIP1R_uc001udg.1_Silent_p.L372L|HIP1R_uc001udi.1_Silent_p.L384L|HIP1R_uc001udk.1_5'UTR	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	384	Potential.				receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		TCGCGCAGCTGAAGAGCCAGG	0.692													4	9	---	---	---	---	PASS
RILPL2	196383	broad.mit.edu	37	12	123900409	123900409	+	3'UTR	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123900409G>C	uc001uey.1	-	4						NM_145058	NP_659495	Q969X0	RIPL2_HUMAN	Rab interacting lysosomal protein-like 2							cytosol|plasma membrane	identical protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000546)|Epithelial(86;0.00179)|all cancers(50;0.0168)		TCTAGAATCAGAGCCATAGCC	0.493													5	366	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19748219	19748219	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19748219G>C	uc009zzj.2	-	5	1186	c.1137C>G	c.(1135-1137)AGC>AGG	p.S379R		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	379					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCGTGGTGTTGCTCAGCATGC	0.622													20	64	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99064179	99064179	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99064179G>C	uc001vnj.2	+	16	2053	c.1717G>C	c.(1717-1719)GAG>CAG	p.E573Q	FARP1_uc001vnh.2_Missense_Mutation_p.E573Q	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	573	DH.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			AGTGAGCAAAGAGGACGCCAT	0.433													3	143	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23887584	23887584	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23887584G>A	uc001wjx.2	-	30	4110	c.4004C>T	c.(4003-4005)TCG>TTG	p.S1335L	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1335	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ATGCCGGGCCGACTGCAGTGC	0.657													13	29	---	---	---	---	PASS
IPO4	79711	broad.mit.edu	37	14	24655393	24655393	+	Intron	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24655393G>A	uc001wmv.1	-						IPO4_uc001wmt.1_5'Flank|IPO4_uc001wmu.2_5'UTR|IPO4_uc001wmx.1_Intron|IPO4_uc001wmy.1_Intron|IPO4_uc010tnz.1_Intron|IPO4_uc001wmw.1_Intron|IPO4_uc001wmz.1_Intron	NM_024658	NP_078934	Q8TEX9	IPO4_HUMAN	importin 4						intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)		CACAACCTGAGATGGGATGGG	0.582													5	168	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59819340	59819340	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59819340G>C	uc001xdz.1	+	19	2412	c.2287G>C	c.(2287-2289)GAG>CAG	p.E763Q	DAAM1_uc001xea.1_Missense_Mutation_p.E753Q|DAAM1_uc001xec.1_5'Flank	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	763	FH2.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GTTCCTTTTTGAGATGAGCCG	0.403													8	18	---	---	---	---	PASS
NUMB	8650	broad.mit.edu	37	14	73743889	73743889	+	Silent	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73743889G>C	uc001xny.1	-	13	1673	c.1353C>G	c.(1351-1353)GTC>GTG	p.V451V	NUMB_uc010aro.1_Silent_p.V256V|NUMB_uc010arp.1_Silent_p.V245V|NUMB_uc010arq.1_Silent_p.V305V|NUMB_uc010arr.1_Silent_p.V294V|NUMB_uc001xoa.1_Silent_p.V403V|NUMB_uc001xnz.1_Silent_p.V440V|NUMB_uc001xob.1_Silent_p.V392V|NUMB_uc001xod.1_Silent_p.V403V|NUMB_uc001xoc.1_Silent_p.V451V|NUMB_uc010ars.1_Silent_p.V440V|NUMB_uc010ttz.1_Silent_p.V149V|NUMB_uc001xoe.2_RNA	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1	451					axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GCTGAGCCCGGACGCTCTTAG	0.607													8	28	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105418922	105418922	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105418922C>T	uc010axc.1	-	7	2986	c.2866G>A	c.(2866-2868)GAT>AAT	p.D956N	AHNAK2_uc001ypx.2_Missense_Mutation_p.D856N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	956						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACCTCGCCATCGGGGGCTGTC	0.622													5	437	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25446475	25446475	+	Intron	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25446475G>A	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-17_uc001yzn.1_RNA|SNORD115-17_uc001yzo.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GGGTTGGGTCGATGATGAGAA	0.502													7	212	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41819725	41819725	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41819725C>A	uc001zod.2	-	12	1631	c.1507G>T	c.(1507-1509)GAT>TAT	p.D503Y		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	503						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCGTCCTCATCCTCCTTGTCC	0.557													9	42	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41822071	41822071	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41822071C>G	uc001zod.2	-	8	1174	c.1050G>C	c.(1048-1050)CAG>CAC	p.Q350H		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	350						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCTCCTGTGTCTGCTGCCGCC	0.607													7	23	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41823249	41823249	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41823249C>G	uc001zod.2	-	7	1039	c.915G>C	c.(913-915)AAG>AAC	p.K305N		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	305						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCTTGTCTCTCTTCCTGGGCT	0.557													51	133	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41823378	41823378	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41823378C>G	uc001zod.2	-	7	910	c.786G>C	c.(784-786)TTG>TTC	p.L262F		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	262						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TGTGAGATCTCAAGAAAGCAA	0.567													40	163	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55839115	55839115	+	Nonsense_Mutation	SNP	G	T	T	rs149582531		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55839115G>T	uc010bfl.1	-	3	422	c.366C>A	c.(364-366)TAC>TAA	p.Y122*	PYGO1_uc002adf.1_Nonsense_Mutation_p.Y122*	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	122	Pro-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TCCTGAGTGAGTAAGGACCAC	0.473													16	55	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72645501	72645501	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72645501C>T	uc002aun.3	-	5	685	c.478G>A	c.(478-480)GAG>AAG	p.E160K	CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.E171K|HEXA_uc002auo.3_Missense_Mutation_p.E23K|HEXA_uc010bix.2_Missense_Mutation_p.E160K|HEXA_uc010biy.2_Missense_Mutation_p.E23K|HEXA_uc010uko.1_Intron|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	160					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						TCCTCAATCTCAGTCTTGTTG	0.488													5	19	---	---	---	---	PASS
ZNF710	374655	broad.mit.edu	37	15	90611183	90611183	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90611183G>C	uc002bov.1	+	2	937	c.814G>C	c.(814-816)GAT>CAT	p.D272H		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GGCCCAGCTGGATCGGCTGGA	0.632													19	74	---	---	---	---	PASS
C15orf58	390637	broad.mit.edu	37	15	90785018	90785018	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90785018G>A	uc002bpc.2	+	4	1057	c.878G>A	c.(877-879)CGG>CAG	p.R293Q		NM_001013657	NP_001013679	Q6ZNW5	VTC2_HUMAN	hypothetical protein LOC390637	293					glucose metabolic process	cytoplasm	GDP-D-glucose phosphorylase activity				0						TTTGTCACCCGGGGAGCTCCG	0.557													10	68	---	---	---	---	PASS
IGFALS	3483	broad.mit.edu	37	16	1841120	1841120	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1841120C>T	uc002cmy.2	-	2	1380	c.1299G>A	c.(1297-1299)CTG>CTA	p.L433L	IGFALS_uc010uvn.1_Silent_p.L471L|IGFALS_uc010uvo.1_Silent_p.L67L	NM_004970	NP_004961	P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid	433					cell adhesion|signal transduction	soluble fraction	insulin-like growth factor binding				0						GCAGCTCCGCCAGCCCCCACA	0.682													6	14	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2813372	2813372	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2813372G>A	uc002crk.2	+	11	3392	c.2843G>A	c.(2842-2844)CGG>CAG	p.R948Q	SRRM2_uc002crj.1_Missense_Mutation_p.R852Q|SRRM2_uc002crl.1_Missense_Mutation_p.R948Q|SRRM2_uc010bsu.1_Missense_Mutation_p.R852Q	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	948	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						ACAACTCCACGGCGAAGCAGA	0.483													4	86	---	---	---	---	PASS
BCKDK	10295	broad.mit.edu	37	16	31123424	31123424	+	Intron	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31123424C>T	uc002eaw.3	+						BCKDK_uc002eav.3_3'UTR|BCKDK_uc010cah.2_Intron|BCKDK_uc010cai.2_3'UTR	NM_005881	NP_005872	O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase						branched chain family amino acid catabolic process|peptidyl-histidine phosphorylation	mitochondrial alpha-ketoglutarate dehydrogenase complex	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity|ATP binding|protein binding|protein serine/threonine kinase activity|two-component sensor activity			stomach(1)|breast(1)	2						CCTGTCCTGTCCCCCTGCCCA	0.677													11	33	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46650007	46650007	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46650007G>A	uc002eec.3	-	4	487	c.447C>T	c.(445-447)CTC>CTT	p.L149L		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	149										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				GAGAGTCACAGAGGTATGGTT	0.468													13	57	---	---	---	---	PASS
ZNF276	92822	broad.mit.edu	37	16	89788955	89788955	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89788955C>T	uc002fos.3	+	2	319	c.222C>T	c.(220-222)CTC>CTT	p.L74L	C16orf7_uc002fol.1_5'Flank|C16orf7_uc002fom.1_5'Flank|ZNF276_uc010ciq.2_5'UTR|ZNF276_uc002fop.2_5'UTR|ZNF276_uc002foq.3_5'UTR|ZNF276_uc010cir.2_RNA|ZNF276_uc002for.3_5'UTR|ZNF276_uc010cis.2_5'UTR|ZNF276_uc002fot.3_RNA|ZNF276_uc010vpm.1_5'Flank|ZNF276_uc010cit.1_5'Flank	NM_001113525	NP_001106997	Q8N554	ZN276_HUMAN	zinc finger protein 276 isoform a	74					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GCCGGGCTCTCGCCATGGGTC	0.662													6	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161578	90161578	+	Silent	SNP	G	A	A	rs13337896	by1000genomes	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161578G>A	uc002fqp.2	+	3	931	c.453G>A	c.(451-453)ACG>ACA	p.T151T	uc002fqq.2_Silent_p.T168T					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		GCCAAGGGACGCTACACCGAA	0.587													5	41	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	4017635	4017635	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4017635G>C	uc002fxe.2	-	4	888	c.824C>G	c.(823-825)TCC>TGC	p.S275C	ZZEF1_uc002fxk.1_Missense_Mutation_p.S275C	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	275	DOC.						calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTGCCAGTAGGATGAGGTTTC	0.388													33	88	---	---	---	---	PASS
GPS2	2874	broad.mit.edu	37	17	7216114	7216114	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7216114G>T	uc002gfv.1	-	10	1208	c.945C>A	c.(943-945)TTC>TTA	p.F315L	GPS2_uc002gfw.1_Missense_Mutation_p.F277L|GPS2_uc002gfx.1_Missense_Mutation_p.F315L|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Missense_Mutation_p.F315L	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2	315					cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)				TGTGTTGGATGAAGGGGAGCC	0.562													4	153	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	A	A	rs121913343		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577121G>A	uc002gim.2	-	8	1011	c.817C>T	c.(817-819)CGT>TGT	p.R273C	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141C|TP53_uc010cng.1_Missense_Mutation_p.R141C|TP53_uc002gii.1_Missense_Mutation_p.R141C|TP53_uc010cnh.1_Missense_Mutation_p.R273C|TP53_uc010cni.1_Missense_Mutation_p.R273C|TP53_uc002gij.2_Missense_Mutation_p.R273C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(467)|p.R273C(396)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCACAAACACGCACCTCAAAG	0.542	R273C(SH10TC_STOMACH)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(RH30_SOFT_TISSUE)|R273C(PANC0213_PANCREAS)|R273C(SJRH30_SOFT_TISSUE)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(TT2609C02_THYROID)|R273C(MFE319_ENDOMETRIUM)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(NCIH1048_LUNG)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			8	21	---	---	---	---	PASS
SREBF1	6720	broad.mit.edu	37	17	17723649	17723649	+	Missense_Mutation	SNP	G	A	A	rs149599437		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17723649G>A	uc002gru.1	-	2	472	c.278C>T	c.(277-279)GCG>GTG	p.A93V	SREBF1_uc002grp.1_5'Flank|SREBF1_uc002grq.1_5'UTR|SREBF1_uc002grr.1_5'UTR|SREBF1_uc002grs.1_Missense_Mutation_p.A69V|SREBF1_uc002grt.1_Missense_Mutation_p.A123V|SREBF1_uc010cpp.1_Missense_Mutation_p.A69V|SREBF1_uc010cpq.1_Missense_Mutation_p.A93V	NM_004176	NP_004167	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription	93	Pro/Ser-rich.|Cytoplasmic (Potential).				cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1						GGGTGAGGGCGCTGCCTGCGG	0.637													28	59	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35445914	35445914	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35445914G>C	uc002hnm.2	-	55	7067	c.6876C>G	c.(6874-6876)ATC>ATG	p.I2292M	ACACA_uc002hnk.2_Missense_Mutation_p.I2214M|ACACA_uc002hnl.2_Missense_Mutation_p.I2234M|ACACA_uc002hnn.2_Missense_Mutation_p.I2292M|ACACA_uc002hno.2_Missense_Mutation_p.I2329M|ACACA_uc010cuy.2_Missense_Mutation_p.I937M|ACACA_uc010wdb.1_Missense_Mutation_p.I330M|ACACA_uc010wdc.1_Missense_Mutation_p.I418M	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	2292					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TGATGCATTTGATGTTTTCCT	0.463													10	221	---	---	---	---	PASS
C17orf53	78995	broad.mit.edu	37	17	42225570	42225570	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42225570C>T	uc002ifi.1	+	3	584	c.399C>T	c.(397-399)GCC>GCT	p.A133A	C17orf53_uc010czq.1_Silent_p.A133A|C17orf53_uc002ifj.1_Silent_p.A133A|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	133											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AGTCCTCAGCCTTACACCCCC	0.517													7	173	---	---	---	---	PASS
GFAP	2670	broad.mit.edu	37	17	42985496	42985496	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42985496G>C	uc002ihq.2	-	8	1253	c.1193C>G	c.(1192-1194)TCT>TGT	p.S398C		NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1	398	Tail.					cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				TTCTGACACAGACTTGGTGTC	0.592													31	75	---	---	---	---	PASS
B4GALNT2	124872	broad.mit.edu	37	17	47218697	47218697	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47218697G>A	uc002ion.2	+	2	342	c.283G>A	c.(283-285)GCA>ACA	p.A95T	B4GALNT2_uc010wlt.1_Missense_Mutation_p.A9T|B4GALNT2_uc010wlu.1_Missense_Mutation_p.A35T	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	95	Lumenal (Potential).				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			GTTCCTTCAAGCAGTGTTCAG	0.507													34	119	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78936369	78936369	+	Silent	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78936369G>C	uc002jyt.1	+	32	4606	c.3801G>C	c.(3799-3801)CTG>CTC	p.L1267L	RPTOR_uc010wug.1_Silent_p.L1109L|RPTOR_uc002jyu.1_Silent_p.L160L	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	1267	WD 6.				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						AGGCGGACCTGATCGCATGGT	0.642													11	43	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3090701	3090701	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3090701C>G	uc002klp.2	-	27	4298	c.3964G>C	c.(3964-3966)GAT>CAT	p.D1322H	MYOM1_uc002klq.2_Missense_Mutation_p.D1226H	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1322						striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GCTTTTCCATCTTGAAGCTGG	0.413													28	61	---	---	---	---	PASS
SLC39A3	29985	broad.mit.edu	37	19	2737188	2737188	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2737188G>A	uc002lwg.2	-	2	322	c.68C>T	c.(67-69)TCC>TTC	p.S23F	SLC39A3_uc010xgy.1_Missense_Mutation_p.S23F|SLC39A3_uc002lwh.2_Missense_Mutation_p.S23F	NM_144564	NP_653165	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter),	23	Helical; (Potential).					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGAGCAGGGAGCCGAGCAG	0.547													3	22	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048660	9048660	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048660G>C	uc002mkp.2	-	5	33175	c.32971C>G	c.(32971-32973)CTG>GTG	p.L10991V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10993	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTAGCAACCAGAGAGGTCACC	0.512													7	66	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15536463	15536463	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15536463C>T	uc002nbc.2	-	5	1743	c.1720G>A	c.(1720-1722)GAG>AAG	p.E574K	WIZ_uc002nba.3_Missense_Mutation_p.E441K|WIZ_uc002nbb.3_Missense_Mutation_p.E400K	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1257						nucleus	zinc ion binding				0						ACGGACCACTCGGTCACACCC	0.612													6	32	---	---	---	---	PASS
KCNN1	3780	broad.mit.edu	37	19	18085055	18085055	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18085055G>A	uc002nht.2	+	3	668	c.358G>A	c.(358-360)GTC>ATC	p.V120I	KCNN1_uc010xqa.1_Missense_Mutation_p.V120I	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance	120	Helical; Name=Segment S1; (Potential).				synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						TGGCATCGTCGTCATGGTGAC	0.642													3	37	---	---	---	---	PASS
CNTD2	79935	broad.mit.edu	37	19	40729459	40729459	+	Intron	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40729459G>C	uc010xvi.1	-						CNTD2_uc002ond.2_RNA	NM_024877	NP_079153	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2 isoform 2						regulation of cyclin-dependent protein kinase activity		protein kinase binding				0						gcgggctgcagatgggggatg	0.284													29	82	---	---	---	---	PASS
LIPE	3991	broad.mit.edu	37	19	42906947	42906947	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42906947C>G	uc002otr.2	-	9	3056	c.2779G>C	c.(2779-2781)GAG>CAG	p.E927Q	uc010eif.1_Intron	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	927					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				GGGCTCAGCTCATTTTTGGCC	0.612													10	38	---	---	---	---	PASS
APOC2	344	broad.mit.edu	37	19	45452519	45452519	+	3'UTR	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452519C>A	uc002pah.2	+	4						NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor						cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		GCCAGACCCCCCATCAGTGGA	0.542													3	18	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53612598	53612598	+	Missense_Mutation	SNP	G	A	A	rs150561707	byFrequency	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53612598G>A	uc002qax.2	-	7	1193	c.844C>T	c.(844-846)CGT>TGT	p.R282C	ZNF415_uc002qat.2_Missense_Mutation_p.R246C|ZNF415_uc002qaw.2_Missense_Mutation_p.R234C|ZNF415_uc010yds.1_Missense_Mutation_p.R234C|ZNF415_uc010ydt.1_Missense_Mutation_p.R234C|ZNF415_uc002qau.2_Missense_Mutation_p.R221C|ZNF415_uc002qav.2_Missense_Mutation_p.R246C|ZNF415_uc002qba.2_Missense_Mutation_p.R4C|ZNF415_uc002qay.2_Missense_Mutation_p.R221C|ZNF415_uc002qaz.2_Missense_Mutation_p.R282C	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	282	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		CTTACCTGACGTACAGTCATG	0.398													30	67	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	13098330	13098330	+	Silent	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13098330C>T	uc002wod.1	+	8	1399	c.1110C>T	c.(1108-1110)ACC>ACT	p.T370T		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	370					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	GCACATTCACCAAAAGTTTTG	0.542													13	81	---	---	---	---	PASS
CRNKL1	51340	broad.mit.edu	37	20	20024216	20024216	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20024216C>G	uc002wrs.2	-	8	1407	c.1375G>C	c.(1375-1377)GAG>CAG	p.E459Q		NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	459	HAT 7.				spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						AACTTCTTCTCAAAGATGGTA	0.408													5	103	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33568508	33568508	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33568508C>A	uc010gfa.1	+	5	591	c.470C>A	c.(469-471)GCG>GAG	p.A157E	MYH7B_uc002xbi.1_Missense_Mutation_p.A199E			A7E2Y1	MYH7B_HUMAN	RecName: Full=Myosin-7B; AltName: Full=Myosin heavy chain 7B, cardiac muscle beta isoform; AltName: Full=Myosin cardiac muscle beta chain; AltName: Full=Antigen MLAA-21; AltName: Full=Slow A MYH14;	157	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TATGCGGTGGCGGACAACGCC	0.617													3	93	---	---	---	---	PASS
PRPF6	24148	broad.mit.edu	37	20	62657330	62657330	+	Silent	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62657330G>A	uc002yho.2	+	15	2115	c.1947G>A	c.(1945-1947)GTG>GTA	p.V649V	PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	649	HAT 6.				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					TGGCAGCCGTGAAGCTGGAGT	0.652													62	207	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33076226	33076226	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33076226T>A	uc002ypd.2	-	4	599	c.173A>T	c.(172-174)TAC>TTC	p.Y58F	SFRS15_uc002ype.2_Missense_Mutation_p.Y58F|SFRS15_uc010glu.2_Missense_Mutation_p.Y43F|SFRS15_uc002ypf.1_5'Flank|SFRS15_uc002ypg.2_Missense_Mutation_p.Y58F	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	58	CID.					nucleus	nucleotide binding|RNA binding				0						CGGAACCTTGTATTCTGGTTT	0.348													3	44	---	---	---	---	PASS
RASL10A	10633	broad.mit.edu	37	22	29709763	29709763	+	Intron	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29709763G>T	uc003aff.2	-						RASL10A_uc003afg.2_3'UTR	NM_006477	NP_006468	Q92737	RSLAA_HUMAN	RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0						CCCGGCCCACGACGTTGGGAG	0.667													6	21	---	---	---	---	PASS
RASL10A	10633	broad.mit.edu	37	22	29709773	29709773	+	Intron	SNP	G	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29709773G>A	uc003aff.2	-						RASL10A_uc003afg.2_3'UTR	NM_006477	NP_006468	Q92737	RSLAA_HUMAN	RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0						GACGTTGGGAGACCCTACACA	0.652													7	24	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24759577	24759577	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24759577C>G	uc004dbl.2	+	21	2307	c.2284C>G	c.(2284-2286)CTT>GTT	p.L762V	SCARNA23_uc004dbo.1_5'Flank	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	762					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	GCTAAATGTTCTTCCATTAGC	0.383													3	109	---	---	---	---	PASS
CXorf21	80231	broad.mit.edu	37	X	30577604	30577604	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30577604C>T	uc004dcg.1	-	3	1145	c.869G>A	c.(868-870)AGT>AAT	p.S290N		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	290										ovary(1)	1						AATATGGAGACTAGGAGTGCT	0.368													12	74	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028425	37028425	+	Missense_Mutation	SNP	A	G	G	rs145580328	byFrequency	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028425A>G	uc004ddl.1	+	1	1956	c.1942A>G	c.(1942-1944)AAT>GAT	p.N648D		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	648										ovary(3)	3						GGAGCCTCCCAATACTGGAGT	0.642													5	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	48155421	48155421	+	3'UTR	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48155421C>T	uc010nib.1	-	8						NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		GCCATGCCCACGTTCGTGAAA	0.493													5	38	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54497828	54497828	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54497828G>T	uc004dtg.2	-	2	1134	c.400C>A	c.(400-402)CGC>AGC	p.R134S	FGD1_uc011moi.1_5'Flank	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	134	Pro-rich.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GGGTCTGAGCGAAGCCGCTGG	0.612													17	39	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962899	73962899	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962899G>C	uc004eby.2	-	3	2110	c.1493C>G	c.(1492-1494)TCA>TGA	p.S498*		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	498					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						ACCCTCTAGTGAGTCAACATC	0.438													11	22	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134427903	134427903	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134427903A>T	uc004eyp.2	-	3	2819	c.164T>A	c.(163-165)TTC>TAC	p.F55Y	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'Flank|ZNF75D_uc004eyo.2_Missense_Mutation_p.F55Y	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	55	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATGATAACGGAAGCTCCAGAA	0.478													34	82	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153277189	153277189	+	3'UTR	SNP	C	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153277189C>T	uc004fjs.1	-	14					IRAK1_uc004fjr.1_3'UTR|IRAK1_uc004fjt.1_3'UTR|IRAK1_uc010nur.2_Intron	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTTCTCTCCCCCGCGGGCAT	0.627													6	12	---	---	---	---	PASS
FBLIM1	54751	broad.mit.edu	37	1	16103380	16103381	+	Intron	DEL	AG	-	-	rs55657597		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16103380_16103381delAG	uc001axd.1	+						FBLIM1_uc001axe.1_Intron|FBLIM1_uc001axf.2_Intron|FBLIM1_uc001axh.1_Intron|FBLIM1_uc001axi.1_Intron	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a						cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		aaaaaaaaaaagaagtactgaa	0.203													3	3	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.663			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108519282	108519283	+	IGR	INS	-	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108519282_108519283insA								RGPD4 (10283 upstream) : SLC5A7 (83712 downstream)																							ttctgtctcagaaaaaaaaaaa	0.188													3	3	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130719948	130719949	+	Intron	INS	-	A	A	rs146588901		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130719948_130719949insA	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron|ATP2C1_uc003enu.2_Intron	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	cttcatctcagaaaaaaaaaaa	0.074									Hailey-Hailey_disease				4	4	---	---	---	---	
TP63	8626	broad.mit.edu	37	3	189526295	189526303	+	In_Frame_Del	DEL	GCCAAGTCG	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189526295_189526303delGCCAAGTCG	uc003fry.2	+	4	648_656	c.559_567delGCCAAGTCG	c.(559-567)GCCAAGTCGdel	p.AKS187del	TP63_uc003frx.2_In_Frame_Del_p.AKS187del|TP63_uc003frz.2_In_Frame_Del_p.AKS187del|TP63_uc010hzc.1_In_Frame_Del_p.AKS187del|TP63_uc003fsa.2_In_Frame_Del_p.AKS93del|TP63_uc003fsb.2_In_Frame_Del_p.AKS93del|TP63_uc003fsc.2_In_Frame_Del_p.AKS93del|TP63_uc003fsd.2_In_Frame_Del_p.AKS93del|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_In_Frame_Del_p.AKS68del	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	187_189					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GTCGAGCACCGCCAAGTCGGCCACCTGGA	0.622									Hay-Wells_syndrome	HNSCC(45;0.13)			45	9	---	---	---	---	
ZMIZ2	83637	broad.mit.edu	37	7	44798683	44798684	+	Intron	INS	-	AA	AA	rs71563954		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44798683_44798684insAA	uc003tlr.2	+						ZMIZ2_uc003tlq.2_Intron|ZMIZ2_uc003tls.2_Intron|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						tgtctcaaattaaaaaaaaaaa	0.198													9	4	---	---	---	---	
ZNF786	136051	broad.mit.edu	37	7	148771740	148771740	+	Intron	DEL	A	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148771740delA	uc003wfh.2	-						ZNF786_uc011kuk.1_Intron|ZNF786_uc003wfi.2_Intron	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACAACATGTCAAAAAAAAAAA	0.378													3	3	---	---	---	---	
CTSB	1508	broad.mit.edu	37	8	11711114	11711114	+	Intron	DEL	T	-	-	rs34504234		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11711114delT	uc003wum.2	-						CTSB_uc011kxl.1_Intron|CTSB_uc003wun.2_Intron|CTSB_uc003wuo.2_Intron|CTSB_uc003wup.2_Intron|CTSB_uc003wuq.2_Intron|CTSB_uc010lsc.2_Intron|CTSB_uc003wur.2_Intron|CTSB_uc003wus.1_Intron|CTSB_uc003wut.1_Intron	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CGGAGAACTCTTAAGGAGCTG	0.667													4	4	---	---	---	---	
LACTB2	51110	broad.mit.edu	37	8	71550980	71550980	+	Intron	DEL	T	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71550980delT	uc011lfd.1	-						LACTB2_uc003xyp.2_Intron	NM_016027	NP_057111	Q53H82	LACB2_HUMAN	lactamase, beta 2								hydrolase activity|metal ion binding			ovary(1)	1	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			CTTAAACACAttttttttttt	0.114													4	2	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													4	5	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134125651	134125651	+	Intron	DEL	T	-	-	rs72433148		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134125651delT	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATTTCGTATCTTTTTTTTTTT	0.398													57	7	---	---	---	---	
LHX3	8022	broad.mit.edu	37	9	139090465	139090466	+	Intron	INS	-	C	C	rs147905773	by1000genomes	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139090465_139090466insC	uc004cha.2	-						LHX3_uc004cgz.2_Intron	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a						inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CGCGCGCTCGTCCCCCCCCGAG	0.639													2	4	---	---	---	---	
MBL1P	8512	broad.mit.edu	37	10	81680656	81680656	+	Intron	DEL	A	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81680656delA	uc001kbf.2	+						MBL1P_uc001kbg.1_RNA					Homo sapiens mannose-binding protein-A pseudogene (MBL1P1) mRNA sequence.												0						GCTTTTGGGGAAAAAAAAAAG	0.542													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													4	6	---	---	---	---	
YARS2	51067	broad.mit.edu	37	12	32903075	32903076	+	Intron	INS	-	AT	AT			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32903075_32903076insAT	uc001rli.2	-							NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial						tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	ACATCATATAAATGTTTATTCA	0.287													42	11	---	---	---	---	
HOXC12	3228	broad.mit.edu	37	12	54348571	54348572	+	5'Flank	INS	-	A	A	rs55739629		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348571_54348572insA	uc010soq.1	+							NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GGATGGTGGGGGGGGGGGATCG	0.594													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125396165	125396166	+	IGR	INS	-	AAAAAAAAA	AAAAAAAAA	rs68000265		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125396165_125396166insAAAAAAAAA								SCARB1 (47646 upstream) : UBC (28 downstream)																							AAAATAAACTTaaaaaaaaaaa	0.361													6	4	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49829865	49829865	+	Intron	DEL	A	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49829865delA	uc001vcu.2	+						CDADC1_uc001vcs.1_Intron|CDADC1_uc001vct.1_Intron|CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		TTCATCATGGAAAAAAAAATG	0.264													4	2	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64879352	64879352	+	Intron	DEL	A	-	-	rs10678665		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64879352delA	uc001xhb.2	+						MTHFD1_uc010aqe.2_Intron|MTHFD1_uc010aqf.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	ACCTCCAGGTAtttttttttt	0.239													10	6	---	---	---	---	
PLEKHG3	26030	broad.mit.edu	37	14	65204696	65204698	+	Intron	DEL	GGA	-	-	rs78348535		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65204696_65204698delGGA	uc001xho.1	+						PLEKHG3_uc001xhn.1_Intron|PLEKHG3_uc001xhp.2_In_Frame_Del_p.E517del|PLEKHG3_uc010aqh.1_Intron|PLEKHG3_uc001xhq.1_5'Flank	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		aggaggtggtggaggaggaggag	0.448													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29060451	29060451	+	5'Flank	DEL	T	-	-	rs77995187		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29060451delT	uc010uaq.1	+											DL491344																		TGAAATTGGCTTTTTTTTTCA	0.294													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84790135	84790136	+	IGR	INS	-	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84790135_84790136insT								ADAMTSL3 (81544 upstream) : LOC388152 (77464 downstream)																							ATTTTGTTTTCTTTTTTTTTTT	0.302													7	4	---	---	---	---	
OR4F4	26682	broad.mit.edu	37	15	102463460	102463460	+	5'Flank	DEL	T	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102463460delT	uc002cdf.1	-							NM_001004195	NP_001004195	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CATAATTTTGTCTCGCACTAC	0.313													3	3	---	---	---	---	
NOMO3	408050	broad.mit.edu	37	16	16350133	16350134	+	Intron	INS	-	T	T			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16350133_16350134insT	uc002deq.2	+						NOMO3_uc002dep.2_Intron|NOMO3_uc010bvp.1_Intron	NM_001004067	NP_001004067	P69849	NOMO3_HUMAN	nodal modulator 3 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		AAGATTAGTACttttttttttt	0.208													2	6	---	---	---	---	
DCTPP1	79077	broad.mit.edu	37	16	30441340	30441341	+	5'UTR	INS	-	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30441340_30441341insG	uc002dyf.2	-	1						NM_024096	NP_077001	Q9H773	DCTP1_HUMAN	dCTP pyrophosphatase 1						nucleoside triphosphate catabolic process	cytosol	dCTP diphosphatase activity|identical protein binding|magnesium ion binding				0						GGAAAACCCACGAGCCACGCTC	0.634													6	4	---	---	---	---	
NAE1	8883	broad.mit.edu	37	16	66844127	66844128	+	Intron	INS	-	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66844127_66844128insA	uc002eqf.2	-						NAE1_uc002eqe.2_Intron|NAE1_uc002eqg.2_Intron|NAE1_uc010cdv.2_Intron	NM_003905	NP_003896	Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1 isoform a						apoptosis|cell cycle|DNA replication|mitotic cell cycle DNA replication checkpoint|protein neddylation|signal transduction	cytoplasm|insoluble fraction|plasma membrane	catalytic activity|protein heterodimerization activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	ATTATGAGAGGAAAAAAAAAAC	0.347													6	3	---	---	---	---	
CDH3	1001	broad.mit.edu	37	16	68684841	68684841	+	Intron	DEL	A	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68684841delA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding			ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGAACAGGTTAAAAAAAAAAA	0.483													4	3	---	---	---	---	
MTSS1L	92154	broad.mit.edu	37	16	70714812	70714812	+	Intron	DEL	G	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70714812delG	uc002ezj.2	-						MTSS1L_uc002ezk.1_5'Flank	NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like						filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1						GTGGTTGGGCGGGGGGGGGGC	0.667													4	2	---	---	---	---	
TBC1D29	26083	broad.mit.edu	37	17	28887478	28887478	+	Intron	DEL	C	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28887478delC	uc002hfh.2	+						TBC1D29_uc002hfi.2_Intron|uc002hfj.1_5'Flank	NM_015594	NP_056409	Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29							intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)				GAAATGAGTGCCCCCCCATAA	0.632													3	5	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34930247	34930247	+	Intron	DEL	T	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34930247delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron|GGNBP2_uc002hnc.1_5'Flank	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		gactgtagtcttttttttttt	0.159													4	3	---	---	---	---	
CCDC45	90799	broad.mit.edu	37	17	62528252	62528252	+	Intron	DEL	T	-	-	rs71831837		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62528252delT	uc002jem.2	+						CCDC45_uc002jen.2_Intron|CCDC45_uc010wqb.1_Intron|CCDC45_uc002jeo.1_5'Flank	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45							centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CCGAAGAAAGTTTTTTTTTTT	0.423													6	3	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087407	76087408	+	Intron	INS	-	A	A			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087407_76087408insA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			gactccgtctcaaaaaaaaaaa	0.178													2	5	---	---	---	---	
APC2	10297	broad.mit.edu	37	19	1452862	1452863	+	Intron	INS	-	C	C	rs148977773	by1000genomes	TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1452862_1452863insC	uc002lsr.1	+						APC2_uc002lss.1_Intron|APC2_uc002lst.1_5'UTR|APC2_uc002lsu.1_5'UTR	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCCTGAGACCCCCCCCAAC	0.673													3	3	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33132673	33132673	+	Intron	DEL	C	-	-	rs149712420		TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33132673delC	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					TTTACTTCTtctttttttttt	0.169													3	3	---	---	---	---	
SIGLEC10	89790	broad.mit.edu	37	19	51914228	51914229	+	3'UTR	INS	-	AG	AG			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51914228_51914229insAG	uc002pwo.2	-	11					SIGLEC10_uc002pwp.2_3'UTR|SIGLEC10_uc002pwq.2_3'UTR|SIGLEC10_uc002pwr.2_3'UTR|SIGLEC10_uc010ycy.1_3'UTR|SIGLEC10_uc010ycz.1_3'UTR|SIGLEC10_uc010eow.2_3'UTR	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor						cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		Aagagagagaaagagagagaga	0.153													9	9	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	32996717	32996717	+	Intron	DEL	T	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32996717delT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						ttctctcttcttttttttttt	0.139													4	2	---	---	---	---	
MRPL39	54148	broad.mit.edu	37	21	26979913	26979914	+	5'Flank	INS	-	G	G			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26979913_26979914insG	uc002ylo.2	-						MRPL39_uc002yln.2_5'Flank	NM_017446	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39 isoform a							mitochondrial ribosome	nucleotide binding				0						TCGCCTCCACCGGGGGGCGTCA	0.678											OREG0026146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
UPF3B	65109	broad.mit.edu	37	X	118971579	118971579	+	Intron	DEL	A	-	-			TCGA-BT-A20U-01	TCGA-BT-A20U-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118971579delA	uc004erz.1	-						UPF3B_uc004esa.1_Intron	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						actctgtctcaaaaaaaaaaa	0.139													8	4	---	---	---	---	
