Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf158	93190	broad.mit.edu	37	1	12819342	12819342	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12819342C>T	uc001auh.2	+	3	541	c.325C>T	c.(325-327)CCG>TCG	p.P109S	C1orf158_uc010obe.1_Missense_Mutation_p.P109S	NM_152290	NP_689503	Q8N1D5	CA158_HUMAN	hypothetical protein LOC93190	109										ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTTACAACCCGGGGCTGCC	0.537													17	182	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29651735	29651735	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29651735C>T	uc001bru.2	+	30	4285	c.4175C>T	c.(4174-4176)GCC>GTC	p.A1392V	PTPRU_uc001brv.2_Missense_Mutation_p.A1388V|PTPRU_uc001brw.2_Missense_Mutation_p.A1382V|PTPRU_uc009vtq.2_Missense_Mutation_p.A1386V|PTPRU_uc009vtr.2_Missense_Mutation_p.A1379V|PTPRU_uc001brx.2_Missense_Mutation_p.A118V	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1392	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ACCTTCTGCGCCTGCGCCACG	0.577													9	89	---	---	---	---	PASS
IL23R	149233	broad.mit.edu	37	1	67666418	67666418	+	Splice_Site	SNP	A	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67666418A>C	uc001ddo.2	+	5	577	c.492_splice	c.e5-2	p.S164_splice	IL23R_uc009waz.2_Intron|IL23R_uc001ddp.2_Splice_Site|IL23R_uc010opi.1_Splice_Site|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Splice_Site_p.S121_splice|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_Splice_Site|IL23R_uc001ddq.2_Intron|IL23R_uc010opn.1_Splice_Site_p.I9_splice|IL23R_uc001ddr.2_Splice_Site|IL23R_uc010opo.1_Splice_Site_p.S23_splice|IL23R_uc010opp.1_Splice_Site|IL23R_uc010opq.1_Splice_Site_p.S23_splice|IL23R_uc010opr.1_Splice_Site|IL23R_uc010ops.1_Intron|IL23R_uc010opt.1_Splice_Site|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Splice_Site_p.S23_splice|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Intron|IL23R_uc010opz.1_Intron|IL23R_uc010oqa.1_Splice_Site|IL23R_uc010oqb.1_Splice_Site_p.S23_splice|IL23R_uc010oqc.1_Intron|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Intron|IL23R_uc010oqg.1_Splice_Site|IL23R_uc010oqh.1_Intron	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						TTTTGTTTTAAGTTTAGAGAC	0.239													5	75	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86934615	86934615	+	5'UTR	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86934615G>A	uc001dlt.2	+	1					CLCA1_uc001dls.1_5'UTR	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor						calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TTCGTAACCCGCATTTTCCAA	0.393													4	95	---	---	---	---	PASS
FNBP1L	54874	broad.mit.edu	37	1	94016559	94016559	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94016559G>T	uc001dpw.2	+	14	1533	c.1533G>T	c.(1531-1533)GAG>GAT	p.E511D	FNBP1L_uc001dpv.2_Missense_Mutation_p.E511D|FNBP1L_uc010otk.1_Missense_Mutation_p.E389D|FNBP1L_uc010otl.1_Missense_Mutation_p.E121D	NM_001024948	NP_001020119	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like isoform 1	569	Interaction with DNM2 and WASL.|Interaction with DNM1.|SH3.|Interaction with DAAM1, DIAPH1 and DIAPH2.				endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		ACATTATAGAGGAGGACAAAG	0.398													3	27	---	---	---	---	PASS
NRAS	4893	broad.mit.edu	37	1	115258745	115258745	+	Missense_Mutation	SNP	C	G	G	rs121434595		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115258745C>G	uc009wgu.2	-	2	291	c.37G>C	c.(37-39)GGT>CGT	p.G13R		NM_002524	NP_002515	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	13	GTP.		G -> D (in a patient with an autoimmune lymphoproliferative disorder).|G -> R (in colorectal cancer).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	Golgi membrane|plasma membrane	GTP binding|GTPase activity	p.G13D(174)|p.G13R(59)|p.G13V(55)|p.G13C(21)|p.G13A(16)|p.G13S(5)|p.G13G(3)|p.G13N(1)|p.G13Y(1)		haematopoietic_and_lymphoid_tissue(1008)|skin(956)|thyroid(334)|large_intestine(62)|NS(60)|soft_tissue(32)|lung(31)|upper_aerodigestive_tract(25)|urinary_tract(12)|liver(10)|adrenal_gland(9)|autonomic_ganglia(8)|testis(8)|central_nervous_system(8)|prostate(8)|breast(7)|biliary_tract(6)|ovary(6)|stomach(5)|pancreas(5)|endometrium(2)|kidney(2)|cervix(2)|eye(1)	2607	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCCCAACACCACCTGCTCCA	0.498	G13R(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		melanoma|MM|AML|thyroid				Noonan_syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)			9	97	---	---	---	---	PASS
LOC728989	728989	broad.mit.edu	37	1	146493279	146493279	+	Missense_Mutation	SNP	C	T	T	rs3929735		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146493279C>T	uc001epd.2	-	5	708	c.634G>A	c.(634-636)GTC>ATC	p.V212I		NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						CGCTGGCTGACAATGAACTGC	0.547													11	26	---	---	---	---	PASS
RUSC1	23623	broad.mit.edu	37	1	155294949	155294949	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155294949G>A	uc001fkj.2	+	4	1742	c.1513G>A	c.(1513-1515)GCC>ACC	p.A505T	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fki.2_5'Flank|RUSC1_uc001fkk.2_Missense_Mutation_p.A505T|RUSC1_uc009wqn.1_Intron|RUSC1_uc009wqo.1_Missense_Mutation_p.A36T|RUSC1_uc001fkl.2_Missense_Mutation_p.A95T|RUSC1_uc001fkp.2_Missense_Mutation_p.A36T|RUSC1_uc001fkq.2_Missense_Mutation_p.A36T|RUSC1_uc010pgb.1_Missense_Mutation_p.A36T|RUSC1_uc009wqp.1_5'UTR|RUSC1_uc001fkn.2_5'UTR|RUSC1_uc001fko.2_RNA|RUSC1_uc001fkr.2_Missense_Mutation_p.A36T|RUSC1_uc001fks.2_5'Flank	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	505						cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TTTCGGGGCCGCCCGGAACTT	0.622											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	146	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158613184	158613184	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158613184G>C	uc001fst.1	-	31	4569	c.4370C>G	c.(4369-4371)GCT>GGT	p.A1457G		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1457	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAGGCTCTCAGCAAAATGTTC	0.468													3	53	---	---	---	---	PASS
NIT1	4817	broad.mit.edu	37	1	161090591	161090591	+	3'UTR	SNP	A	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161090591A>C	uc001fxv.1	+	7					PFDN2_uc001fxu.2_5'Flank|NIT1_uc001fxw.2_Intron|NIT1_uc001fxx.1_3'UTR|NIT1_uc001fxy.1_3'UTR|NIT1_uc010pka.1_3'UTR	NM_005600	NP_005591	Q86X76	NIT1_HUMAN	nitrilase 1						nitrogen compound metabolic process	mitochondrion	nitrilase activity				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGCCCCTCCCACCCCCACCCT	0.557													7	25	---	---	---	---	PASS
MPZ	4359	broad.mit.edu	37	1	161276712	161276712	+	Splice_Site	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161276712C>A	uc001gaf.3	-	3	302	c.265_splice	c.e3-1	p.I89_splice	MPZ_uc010pko.1_Splice_Site	NM_000530	NP_000521	P25189	MYP0_HUMAN	myelin protein zero						synaptic transmission	integral to plasma membrane	structural molecule activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)	Breast(1374;0.181)	BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGTGGAAGATCTATGAGGAAT	0.463													37	68	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220195731	220195731	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220195731C>T	uc001hly.1	-	9	1343	c.1073G>A	c.(1072-1074)CGC>CAC	p.R358H	EPRS_uc010puf.1_Missense_Mutation_p.R109H|EPRS_uc001hlz.1_Missense_Mutation_p.R358H|EPRS_uc009xdt.1_Missense_Mutation_p.R159H	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	358	Glutamyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AATTTTGCAGCGATAAAGGGT	0.383													11	204	---	---	---	---	PASS
RBM34	23029	broad.mit.edu	37	1	235324570	235324570	+	5'UTR	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235324570C>A	uc001hwn.2	-	1					RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA|RBM34_uc010pxp.1_5'UTR	NM_015014	NP_055829	P42696	RBM34_HUMAN	RNA binding motif protein 34 isoform 1							nucleolus	nucleotide binding|RNA binding			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CAGACTGCAGCTGCGCGCCAG	0.677													4	67	---	---	---	---	PASS
RHOB	388	broad.mit.edu	37	2	20647511	20647511	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20647511C>T	uc002rdv.2	+	1	677	c.285C>T	c.(283-285)ATC>ATT	p.I95I		NM_004040	NP_004031	P62745	RHOB_HUMAN	ras homolog gene family, member B precursor	95					angiogenesis|axon guidance|cell adhesion|endosome to lysosome transport|negative regulation of cell cycle|platelet activation|positive regulation of angiogenesis|protein transport|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|transformed cell apoptosis	cytosol|late endosome membrane|nucleus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)|lung(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)		TGGAGAACATCCCCGAGAAGT	0.617													43	91	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27664633	27664633	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27664633C>T	uc002rko.2	+	19	2394	c.1562C>T	c.(1561-1563)GCC>GTC	p.A521V	NRBP1_uc002rkq.2_Missense_Mutation_p.A520V|NRBP1_uc002rkp.2_Missense_Mutation_p.A521V|NRBP1_uc002rkr.2_Missense_Mutation_p.A312V|KRTCAP3_uc002rks.2_5'Flank|KRTCAP3_uc010ylr.1_5'Flank|KRTCAP3_uc002rkt.2_5'Flank	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	521					ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					TTCAATTTTGCCAGGAACAGT	0.572													4	221	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50724504	50724504	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724504C>G	uc010fbq.2	-	14	4443	c.2966G>C	c.(2965-2967)GGA>GCA	p.G989A	NRXN1_uc002rxb.3_Missense_Mutation_p.G621A|NRXN1_uc002rxe.3_Missense_Mutation_p.G949A|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	138	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAAGTCATTTCCATCCCCACT	0.353													5	63	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98504542	98504542	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98504542T>C	uc002syh.3	-	4	561	c.332A>G	c.(331-333)GAG>GGG	p.E111G	TMEM131_uc010yvg.1_RNA	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	111						integral to membrane				ovary(4)|central_nervous_system(2)	6						CATTGGTGGCTCAAATCGTAT	0.333													3	32	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173825863	173825863	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173825863A>G	uc002uhv.3	+	8	792	c.605A>G	c.(604-606)AAG>AGG	p.K202R	RAPGEF4_uc002uhu.2_Missense_Mutation_p.K202R|RAPGEF4_uc002uhw.3_Missense_Mutation_p.K58R|RAPGEF4_uc010zec.1_Missense_Mutation_p.K49R|RAPGEF4_uc010zed.1_Missense_Mutation_p.K31R|RAPGEF4_uc010zee.1_Missense_Mutation_p.K49R|RAPGEF4_uc010fqo.2_Missense_Mutation_p.K31R|RAPGEF4_uc010zef.1_5'UTR|RAPGEF4_uc010zeg.1_Missense_Mutation_p.K29R|RAPGEF4_uc010fqp.1_5'UTR|RAPGEF4_uc010zeh.1_5'UTR	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	202					blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			CCTTCAGAGAAGATCCTCAGA	0.413													8	80	---	---	---	---	PASS
FKBP7	51661	broad.mit.edu	37	2	179343067	179343067	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179343067C>T	uc002umk.2	-	1	289	c.160G>A	c.(160-162)GAC>AAC	p.D54N	FKBP7_uc002umm.2_Missense_Mutation_p.D54N|FKBP7_uc002uml.2_RNA|FKBP7_uc010zff.1_Missense_Mutation_p.D50N|PLEKHA3_uc002umn.2_5'Flank	NM_181342	NP_851939	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7 isoform a precursor	54	PPIase FKBP-type.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TTTAGTAGGTCTCCCTTCTTG	0.473													8	78	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179462331	179462331	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179462331C>T	uc010zfg.1	-	243	49998	c.49774G>A	c.(49774-49776)GTC>ATC	p.V16592I	uc002umo.2_RNA|uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.V10287I|TTN_uc010zfi.1_Missense_Mutation_p.V10220I|TTN_uc010zfj.1_Missense_Mutation_p.V10095I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17519							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGAATAGACGCCTTGATGG	0.398													3	39	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182387015	182387015	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182387015A>G	uc002unu.2	+	18	2783	c.2020A>G	c.(2020-2022)ACT>GCT	p.T674A	ITGA4_uc010frj.1_Missense_Mutation_p.T156A|ITGA4_uc002unv.2_5'UTR	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	674	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	ATATGAAACGACTCTACATGT	0.363													4	83	---	---	---	---	PASS
DNAJB2	3300	broad.mit.edu	37	2	220147644	220147644	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220147644G>A	uc002vkx.1	+	6	675	c.438G>A	c.(436-438)GGG>GGA	p.G146G	DNAJB2_uc002vkw.1_Silent_p.G146G|DNAJB2_uc002vky.2_5'UTR|DNAJB2_uc010zlb.1_5'UTR	NM_006736	NP_006727	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	146					ER-associated protein catabolic process|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of inclusion body assembly|negative regulation of protein deubiquitination|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding|response to unfolded protein	inclusion body	heat shock protein binding|Hsp70 protein binding|polyubiquitin binding|proteasome binding|protein binding|unfolded protein binding				0		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTTCCCTGGGCACTCCGGTA	0.562													4	45	---	---	---	---	PASS
HTR2B	3357	broad.mit.edu	37	2	231978470	231978470	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231978470T>G	uc002vro.2	-	3	1031	c.526A>C	c.(526-528)ATT>CTT	p.I176L	PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron|PSMD1_uc002vrn.1_Intron|HTR2B_uc010fxv.2_Intron	NM_000867	NP_000858	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B	176	Helical; Name=4; (By similarity).				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cardiac muscle hypertrophy|cellular response to calcium ion|cellular response to temperature stimulus|cGMP biosynthetic process|embryonic morphogenesis|ERK1 and ERK2 cascade|G-protein coupled receptor internalization|heart morphogenesis|intestine smooth muscle contraction|negative regulation of apoptosis|negative regulation of autophagy|neural crest cell migration|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|phosphorylation|positive regulation of cell division|positive regulation of cytokine production|positive regulation of cytokine secretion|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAP kinase activity|positive regulation of nitric-oxide synthase activity|protein kinase C signaling cascade|regulation of behavior|release of sequestered calcium ion into cytosol|response to drug|vasoconstriction	cytoplasm|integral to membrane|plasma membrane	calcium channel activity|drug binding|G-protein alpha-subunit binding|phosphatidylinositol phospholipase C activity|Ras GTPase activator activity|serotonin binding|serotonin receptor activity				0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Chlorprothixene(DB01239)|Eletriptan(DB00216)|Fenfluramine(DB00574)|Methotrimeprazine(DB01403)|Minaprine(DB00805)|Quetiapine(DB01224)|Sumatriptan(DB00669)|Tegaserod(DB01079)|Triflupromazine(DB00508)	ACCACTGTAATCTTGATGAAT	0.428													14	202	---	---	---	---	PASS
ARL4C	10123	broad.mit.edu	37	2	235405159	235405159	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235405159G>A	uc002vvn.2	-	1	535	c.72C>T	c.(70-72)GCC>GCT	p.A24A	ARL4C_uc002vvm.3_Silent_p.A24A	NM_005737	NP_005728	P56559	ARL4C_HUMAN	ADP-ribosylation factor-like 4C	24	GTP (By similarity).				endocytic recycling|small GTPase mediated signal transduction	cytoplasm|filopodium|nucleus|plasma membrane	alpha-tubulin binding|GTP binding|GTPase activity			skin(1)	1		Breast(86;0.000596)|Renal(207;0.00339)|all_lung(227;0.00354)|all_hematologic(139;0.0494)|Lung NSC(271;0.0496)|Lung SC(224;0.164)|all_neural(83;0.173)		Epithelial(121;2.6e-19)|BRCA - Breast invasive adenocarcinoma(100;0.000296)|Lung(119;0.002)|LUSC - Lung squamous cell carcinoma(224;0.0048)		TGGTCTTGCCGGCCGAGTCCA	0.597													3	34	---	---	---	---	PASS
SGOL1	151648	broad.mit.edu	37	3	20225210	20225210	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20225210C>G	uc003cbs.2	-	3	416	c.229G>C	c.(229-231)GAA>CAA	p.E77Q	SGOL1_uc003cbr.2_Missense_Mutation_p.E77Q|SGOL1_uc010hfa.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbt.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbu.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbv.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbw.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbx.2_Missense_Mutation_p.E77Q|SGOL1_uc003cby.2_Missense_Mutation_p.E77Q|SGOL1_uc003cbz.2_Missense_Mutation_p.E77Q|SGOL1_uc003cca.2_Missense_Mutation_p.E77Q|SGOL1_uc003ccb.2_Missense_Mutation_p.E77Q|SGOL1_uc003ccc.2_Missense_Mutation_p.E77Q	NM_001012410	NP_001012410	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 isoform A2	77	Potential.|Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding				0						TCTTGGGCTTCTTTCACTTTG	0.338													14	105	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42680096	42680096	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42680096C>T	uc003clo.2	+	13	3047	c.2900C>T	c.(2899-2901)TCG>TTG	p.S967L	NKTR_uc003clm.1_Missense_Mutation_p.S714L|NKTR_uc003clp.2_Missense_Mutation_p.S714L|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Missense_Mutation_p.S857L|NKTR_uc003clr.1_Missense_Mutation_p.S714L|NKTR_uc003cls.2_Missense_Mutation_p.S667L	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	967					protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TGTTCCAATTCGGAAAACAAT	0.408													5	70	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	54930865	54930865	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54930865G>A	uc003dhf.2	+	26	2384	c.2336G>A	c.(2335-2337)GGG>GAG	p.G779E	CACNA2D3_uc003dhg.1_Missense_Mutation_p.G685E|CACNA2D3_uc003dhh.1_RNA|uc003dhk.1_RNA	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	779	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CAGATTCCAGGGAGCTTCGTC	0.557													4	93	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78685192	78685192	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78685192G>C	uc003dqe.2	-	23	3312	c.3104C>G	c.(3103-3105)TCA>TGA	p.S1035*	ROBO1_uc003dqb.2_Nonsense_Mutation_p.S996*|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Nonsense_Mutation_p.S990*|ROBO1_uc010hoh.2_Nonsense_Mutation_p.S227*|ROBO1_uc011bgl.1_Nonsense_Mutation_p.S607*	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1035	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATAAACAGTTGACTCAGGGAG	0.378													4	41	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100948226	100948226	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100948226C>G	uc003duq.1	-	17	3834	c.3631G>C	c.(3631-3633)GAG>CAG	p.E1211Q	IMPG2_uc011bhe.1_Missense_Mutation_p.E1074Q|IMPG2_uc010hpj.1_RNA	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1211	Cytoplasmic (Potential).|Hyaluronan-binding motif involved in chondroitin sulfate A- and C-binding motif (By similarity).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						TTTCCCACCTCTCTGGAAAGC	0.532													7	38	---	---	---	---	PASS
FBXO40	51725	broad.mit.edu	37	3	121341105	121341105	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121341105G>A	uc003eeg.2	+	3	1039	c.829G>A	c.(829-831)GAC>AAC	p.D277N		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	277					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)		GAAGCAGCAGGACGTTCGTAC	0.483													6	42	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124103672	124103672	+	Intron	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124103672C>A	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron|KALRN_uc003ehh.1_5'UTR	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TTGACTTTGCCTCACTGTTGT	0.612													4	36	---	---	---	---	PASS
SLC41A3	54946	broad.mit.edu	37	3	125735625	125735625	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125735625T>G	uc003eij.2	-	7	1065	c.839A>C	c.(838-840)AAG>ACG	p.K280T	SLC41A3_uc003eii.2_Missense_Mutation_p.K254T|SLC41A3_uc003eil.2_Missense_Mutation_p.K280T|SLC41A3_uc003eik.2_Missense_Mutation_p.K244T|SLC41A3_uc011bkh.1_Missense_Mutation_p.K163T|SLC41A3_uc010hsd.1_Missense_Mutation_p.K295T	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1	280						integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		CTTCAGGATCTTCACGATGGG	0.587													3	57	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140397214	140397214	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140397214G>A	uc003eto.1	+	1	334	c.143G>A	c.(142-144)CGG>CAG	p.R48Q		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	48	Cys-rich.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						AAAGATGAGCGGAACTGCCAG	0.537													10	158	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155545984	155545984	+	3'UTR	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155545984C>G	uc003fan.3	-	6					SLC33A1_uc003fao.1_3'UTR	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter						cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GCTAGAATGTCCAGTAGCATA	0.313													4	104	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160146645	160146645	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160146645G>C	uc003fdh.2	+	18	2823	c.2710G>C	c.(2710-2712)GAC>CAC	p.D904H	IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Missense_Mutation_p.D879H|SMC4_uc003fdj.2_Missense_Mutation_p.D904H|SMC4_uc010hwd.2_Missense_Mutation_p.D904H|SMC4_uc003fdl.2_Missense_Mutation_p.D607H	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes	904	Potential.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGCCCAACAAGACAAACTTGA	0.378													6	90	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71200994	71200994	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71200994G>C	uc003hff.2	+	1	324	c.238G>C	c.(238-240)GAT>CAT	p.D80H		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	80						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				ATCAGAAGATGATATGGGGAC	0.373													5	71	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90872768	90872768	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90872768G>T	uc003hst.2	+	7	3202	c.3131G>T	c.(3130-3132)AGC>ATC	p.S1044I	MMRN1_uc010iku.2_Missense_Mutation_p.S347I|MMRN1_uc011cds.1_Missense_Mutation_p.S786I	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	1044	EGF-like.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GAGTATTCAAGCTGTAGTCGG	0.383													5	53	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123160717	123160717	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123160717C>G	uc003ieh.2	+	27	3925	c.3880C>G	c.(3880-3882)CAG>GAG	p.Q1294E	KIAA1109_uc003iei.1_Missense_Mutation_p.Q1047E|KIAA1109_uc010ins.1_Missense_Mutation_p.Q637E|KIAA1109_uc003iek.2_5'UTR	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1294					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						TCCTAATACTCAGGATAAGTC	0.403													22	40	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9122934	9122934	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9122934C>T	uc003jek.2	-	14	2327	c.1615G>A	c.(1615-1617)GTG>ATG	p.V539M		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	539	Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						TGCCCATCCACGGTGAGATTC	0.517													66	59	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629200	9629200	+	3'UTR	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629200T>G	uc003jem.1	-	1						NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1						chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						CAGGCATGGGTAAATCATTGA	0.433													19	71	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13753535	13753535	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13753535T>A	uc003jfd.2	-	63	10721	c.10679A>T	c.(10678-10680)AAC>ATC	p.N3560I	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3560					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAGATTTAGGTTCTTTCCAAA	0.378									Kartagener_syndrome				10	241	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13823473	13823473	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13823473C>T	uc003jfd.2	-	40	6628	c.6586G>A	c.(6586-6588)GAG>AAG	p.E2196K		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2196					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GGTTCATCCTCATCAATCTAA	0.368									Kartagener_syndrome				11	156	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86645099	86645099	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86645099C>T	uc003kiw.2	+	8	1289	c.1171C>T	c.(1171-1173)CGG>TGG	p.R391W	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Missense_Mutation_p.R214W|RASA1_uc011ctv.1_Missense_Mutation_p.R224W|RASA1_uc011ctw.1_Missense_Mutation_p.R225W|RASA1_uc010jaw.2_Missense_Mutation_p.R213W	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	391	SH2 2.				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACTTTATTTCCGGACCAATGA	0.358													4	54	---	---	---	---	PASS
CHSY3	337876	broad.mit.edu	37	5	129520760	129520760	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129520760A>G	uc003kvd.2	+	3	1925	c.1925A>G	c.(1924-1926)GAA>GGA	p.E642G		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	642	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GAGAACTTTGAAAACATGTGT	0.403													4	69	---	---	---	---	PASS
REEP2	51308	broad.mit.edu	37	5	137780945	137780945	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137780945G>A	uc003lcz.2	+	6	562	c.440G>A	c.(439-441)CGC>CAC	p.R147H	REEP2_uc003lda.2_Missense_Mutation_p.R149H|REEP2_uc011cyt.1_Missense_Mutation_p.R108H	NM_016606	NP_057690	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	147						integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GAGAAGCTCCGCAGCTTCAGC	0.692													5	56	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140167956	140167956	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140167956T>A	uc003lhb.2	+	1	2081	c.2081T>A	c.(2080-2082)GTG>GAG	p.V694E	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.V694E	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	694	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGCGCTGGTGGATGTCAAC	0.677													4	86	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741601	140741601	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741601C>T	uc003ljs.1	+	1	1899	c.1899C>T	c.(1897-1899)GGC>GGT	p.G633G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Silent_p.G633G|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	633	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCTTGGGCGACAGGGACG	0.687													10	16	---	---	---	---	PASS
COL23A1	91522	broad.mit.edu	37	5	177677073	177677073	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177677073C>A	uc003mje.2	-	18	1406	c.1048G>T	c.(1048-1050)GAT>TAT	p.D350Y	COL23A1_uc010jkt.2_Missense_Mutation_p.D232Y	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	350	Extracellular (Potential).|Collagen-like 3.|Gly-rich.					collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTCTCTCCATCGATTCCTGGG	0.458													3	39	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180057288	180057288	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180057288C>T	uc003mma.3	-	4	529	c.450G>A	c.(448-450)AGG>AGA	p.R150R	FLT4_uc003mlz.3_Silent_p.R150R|FLT4_uc003mmb.1_5'Flank|FLT4_uc011dgy.1_Silent_p.R150R|FLT4_uc011dgz.1_Silent_p.R150R|FLT4_uc011dha.1_Missense_Mutation_p.G134E	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	150	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TGGCGTCCTTCCTGTTGACCA	0.632									Congenital_Hereditary_Lymphedema				14	30	---	---	---	---	PASS
TUBB	203068	broad.mit.edu	37	6	30691914	30691914	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30691914C>T	uc003nrl.2	+	4	1202	c.1075C>T	c.(1075-1077)CGT>TGT	p.R359C	TUBB_uc003nrk.1_Missense_Mutation_p.R359C|TUBB_uc011dmq.1_Missense_Mutation_p.R287C	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta	359					cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	CATCCCACCTCGTGGCCTCAA	0.532													20	67	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	100966000	100966000	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100966000C>T	uc003pqk.2	-	38	6123	c.5794G>A	c.(5794-5796)GCA>ACA	p.A1932T		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1932	SEC63 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CCCTGGTTTGCAGCCACGTCC	0.478													4	43	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108193031	108193031	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108193031C>T	uc003psc.3	-	21	2429	c.2160G>A	c.(2158-2160)AAG>AAA	p.K720K	SEC63_uc003psb.3_Silent_p.K547K	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	720	Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CTGGCACAGGCTTAGCCTCAT	0.418													8	93	---	---	---	---	PASS
IYD	389434	broad.mit.edu	37	6	150713566	150713566	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150713566C>G	uc003qnu.1	+	3	596	c.456C>G	c.(454-456)ATC>ATG	p.I152M	IYD_uc003qnv.1_Missense_Mutation_p.I152M|IYD_uc003qnw.1_RNA|IYD_uc003qnx.1_Missense_Mutation_p.I152M|IYD_uc010kik.1_Missense_Mutation_p.I70M	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2	152	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TTCGAAAGATCATTGAGGAGG	0.522													8	65	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163984654	163984654	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163984654C>T	uc003qui.2	+	6	1388	c.837C>T	c.(835-837)CCC>CCT	p.P279P	QKI_uc003que.2_Silent_p.P279P|QKI_uc003quf.2_Silent_p.P279P|QKI_uc003qug.2_Silent_p.P279P|QKI_uc003quh.2_Silent_p.P271P|QKI_uc003quj.2_Silent_p.P271P	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	279	SH3-binding.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		CTCCAGGGCCCGAAGCTGGTT	0.478													15	64	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													3	43	---	---	---	---	PASS
FAM126A	84668	broad.mit.edu	37	7	23016375	23016375	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23016375C>A	uc003svm.3	-	6	722	c.467G>T	c.(466-468)GGT>GTT	p.G156V	FAM126A_uc003svn.3_Missense_Mutation_p.G12V|FAM126A_uc011jyr.1_Missense_Mutation_p.G122V	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	156						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1						TTTTGACAAACCATGCTGGGA	0.418													6	73	---	---	---	---	PASS
SCRN1	9805	broad.mit.edu	37	7	29963492	29963492	+	3'UTR	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29963492C>G	uc010kvp.2	-	7					SCRN1_uc011jzy.1_3'UTR|SCRN1_uc003tak.2_3'UTR|SCRN1_uc011jzz.1_3'UTR|SCRN1_uc011kaa.1_3'UTR|SCRN1_uc011jzw.1_3'UTR|SCRN1_uc011jzx.1_3'UTR	NM_001145515	NP_001138987	Q12765	SCRN1_HUMAN	secernin 1 isoform c						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2						TCATTTTACTCAAACAGGAGA	0.398													3	120	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43508602	43508602	+	Silent	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43508602C>G	uc003tid.1	+	16	3602	c.2997C>G	c.(2995-2997)CGC>CGG	p.R999R	HECW1_uc011kbi.1_Silent_p.R965R	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	999					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						ATTTTGAACGCTACCAGCACA	0.542													3	68	---	---	---	---	PASS
CPA2	1358	broad.mit.edu	37	7	129908841	129908841	+	Silent	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129908841A>G	uc003vpq.2	+	2	163	c.144A>G	c.(142-144)GAA>GAG	p.E48E	CPA2_uc011kpc.1_Silent_p.E48E	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor	48					proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					AGGCTCAAGAACATCTCCAGG	0.373													4	62	---	---	---	---	PASS
ZNF282	8427	broad.mit.edu	37	7	148895707	148895707	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148895707A>C	uc003wfm.2	+	2	553	c.448A>C	c.(448-450)AAG>CAG	p.K150Q	ZNF282_uc011kun.1_Missense_Mutation_p.K150Q|ZNF282_uc003wfn.2_Missense_Mutation_p.K90Q|ZNF282_uc003wfo.2_Missense_Mutation_p.K90Q	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	150					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CATGGAGAGCAAGTGGGCCGT	0.622													3	95	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8185379	8185379	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8185379G>A	uc003wsh.3	-	4	2913	c.2913C>T	c.(2911-2913)CTC>CTT	p.L971L		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	971							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						CGCCCATGAAGAGGTCCTCAC	0.562													6	37	---	---	---	---	PASS
FBXO16	157574	broad.mit.edu	37	8	28304779	28304779	+	Missense_Mutation	SNP	C	G	G	rs149234031	byFrequency	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28304779C>G	uc003xgu.2	-	7	850	c.752G>C	c.(751-753)AGA>ACA	p.R251T	ZNF395_uc003xgt.2_5'UTR|FBXO16_uc003xgv.2_Missense_Mutation_p.R238T|FBXO16_uc003xgw.2_Missense_Mutation_p.R238T	NM_172366	NP_758954	Q8IX29	FBX16_HUMAN	F-box only protein 16	251										ovary(1)	1		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		CATTTGGTTTCTTTTTCTTCT	0.353													29	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	30210428	30210428	+	3'UTR	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30210428C>A	uc003xhz.2	+	1										SubName: Full=Class IVb beta tubulin;																		ATGATGGCTGCCTGTGACCCC	0.592													4	45	---	---	---	---	PASS
ADHFE1	137872	broad.mit.edu	37	8	67357557	67357557	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67357557C>T	uc003xwb.3	+	6	492	c.458C>T	c.(457-459)GCA>GTA	p.A153V	ADHFE1_uc003xwd.3_RNA|ADHFE1_uc003xwc.3_Missense_Mutation_p.A105V|ADHFE1_uc003xwe.3_RNA|ADHFE1_uc003xwf.3_Intron|ADHFE1_uc011les.1_Missense_Mutation_p.A83V|ADHFE1_uc011leq.1_Intron|ADHFE1_uc011ler.1_Intron	NM_144650	NP_653251	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	153					2-oxoglutarate metabolic process|molecular hydrogen transport	mitochondrial matrix	hydroxyacid-oxoacid transhydrogenase activity|metal ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			AATCTGTATGCATCCAGCCCT	0.488													10	142	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100844794	100844794	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100844794C>G	uc003yiv.2	+	52	9714	c.9603C>G	c.(9601-9603)AGC>AGG	p.S3201R	VPS13B_uc003yiw.2_Missense_Mutation_p.S3176R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3201					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGTGCTGGAGCCTGCCAGCTA	0.502													5	94	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133584686	133584686	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133584686G>T	uc003ytk.2	-	12	1343	c.1269C>A	c.(1267-1269)CAC>CAA	p.H423Q	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	423						cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CAGGGAATGAGTGCTTGCTAG	0.378													8	208	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135615035	135615035	+	Silent	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135615035G>T	uc003yup.2	-	6	1102	c.927C>A	c.(925-927)GCC>GCA	p.A309A	ZFAT_uc003yun.2_Silent_p.A297A|ZFAT_uc003yuo.2_Silent_p.A297A|ZFAT_uc010meh.2_Silent_p.A297A|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Silent_p.A297A|ZFAT_uc010mej.2_Silent_p.A247A|ZFAT_uc003yur.2_Silent_p.A297A	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	309	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TGGCCTTGATGGCACTGGCAT	0.562													5	49	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13162702	13162702	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13162702G>A	uc010mia.1	-	22	3404	c.3347C>T	c.(3346-3348)TCA>TTA	p.S1116L	MPDZ_uc010mhx.2_Missense_Mutation_p.S8L|MPDZ_uc011lmm.1_Missense_Mutation_p.S8L|MPDZ_uc003zkz.3_Intron|MPDZ_uc010mhy.2_Missense_Mutation_p.S1116L|MPDZ_uc010mhz.2_Missense_Mutation_p.S1116L|MPDZ_uc011lmn.1_Missense_Mutation_p.S1116L|MPDZ_uc003zlb.3_Missense_Mutation_p.S1116L	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1116					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		GCCAGTGTATGAAGAAAAAAT	0.378													18	6	---	---	---	---	PASS
HEMGN	55363	broad.mit.edu	37	9	100692795	100692795	+	Silent	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100692795T>G	uc004axy.2	-	3	990	c.882A>C	c.(880-882)ACA>ACC	p.T294T	HEMGN_uc004axz.2_Silent_p.T294T	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	294					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				AAAGGCCTTCTGTCTCAGCTA	0.383													7	219	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104314697	104314697	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104314697G>A	uc004bbn.2	+	13	1653	c.1563G>A	c.(1561-1563)CAG>CAA	p.Q521Q		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	521	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		CCCTCCTGCAGTCCCAGTCTA	0.498													9	234	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114176711	114176711	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114176711C>T	uc004bfe.1	-	20	2519	c.2519G>A	c.(2518-2520)GGA>GAA	p.G840E	KIAA0368_uc010muc.1_Missense_Mutation_p.G662E	NM_001080398	NP_001073867			KIAA0368 protein												0						ATTCCTACCTCCAACACCTGC	0.413													7	64	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131755675	131755675	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131755675G>C	uc004bws.1	+	26	2862	c.2840G>C	c.(2839-2841)GGC>GCC	p.G947A	NUP188_uc004bwu.2_Missense_Mutation_p.G290A	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	947					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						GGCAGTGATGGCTCAAAGGTA	0.522													3	42	---	---	---	---	PASS
POMT1	10585	broad.mit.edu	37	9	134381814	134381814	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134381814A>G	uc004cav.2	+	4	456	c.254A>G	c.(253-255)AAT>AGT	p.N85S	POMT1_uc011mci.1_Missense_Mutation_p.N85S|POMT1_uc004cax.2_Missense_Mutation_p.N85S|POMT1_uc011mcj.1_Missense_Mutation_p.I3V|POMT1_uc004cau.2_Missense_Mutation_p.N85S|POMT1_uc004caw.2_Missense_Mutation_p.N31S|POMT1_uc011mck.1_5'UTR|POMT1_uc011mcl.1_5'UTR|POMT1_uc011mcm.1_Silent_p.Q49Q	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	85	Helical; (Potential).				multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		TTCGATGGCAATTTTTTGTGG	0.264													10	238	---	---	---	---	PASS
TTF1	7270	broad.mit.edu	37	9	135276961	135276961	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135276961G>A	uc004cbl.2	-	2	1300	c.1248C>T	c.(1246-1248)AGC>AGT	p.S416S	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	416					negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CAAAGAGTGTGCTCTCAGAGT	0.463													5	88	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137619185	137619185	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137619185A>T	uc004cfe.2	+	5	1110	c.728A>T	c.(727-729)GAC>GTC	p.D243V		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	243	Nonhelical region.|Laminin G-like.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TACAGCCCTGACTGTGACACC	0.532													7	68	---	---	---	---	PASS
FBXW5	54461	broad.mit.edu	37	9	139837920	139837920	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139837920C>A	uc004cjx.2	-	3	383	c.232G>T	c.(232-234)GAC>TAC	p.D78Y	FBXW5_uc010nbx.2_5'Flank|FBXW5_uc004cjy.2_5'UTR|FBXW5_uc004cjz.2_5'UTR|C8G_uc004cka.2_5'Flank	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	78							catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGCACCGTGTCATACAGCCGC	0.657													10	16	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070116	141070116	+	Missense_Mutation	SNP	G	A	A	rs142836124	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070116G>A	uc004com.2	+	3	275	c.14G>A	c.(13-15)CGC>CAC	p.R5H	TUBBP5_uc010ncq.2_Missense_Mutation_p.R119H					RecName: Full=Putative tubulin beta-4q chain;												0						GACTCTGTGCGCTCGGGGCCC	0.687													5	56	---	---	---	---	PASS
CUL2	8453	broad.mit.edu	37	10	35360158	35360158	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35360158C>T	uc001ixv.2	-	2	298	c.88G>A	c.(88-90)GTC>ATC	p.V30I	CUL2_uc009xma.2_5'UTR|CUL2_uc010qer.1_Missense_Mutation_p.V49I|CUL2_uc001ixw.2_Missense_Mutation_p.V30I|CUL2_uc010qes.1_Missense_Mutation_p.V30I	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	30					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						GCTCTTTCGACGTATTCCAAC	0.358													12	70	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71149006	71149006	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71149006G>A	uc001jpl.3	+	14	2090	c.1989G>A	c.(1987-1989)ATG>ATA	p.M663I	HK1_uc001jpg.3_Missense_Mutation_p.M651I|HK1_uc001jph.3_Missense_Mutation_p.M667I|HK1_uc001jpi.3_Missense_Mutation_p.M667I|HK1_uc001jpj.3_Missense_Mutation_p.M698I|HK1_uc001jpk.3_Missense_Mutation_p.M662I|HK1_uc009xqd.2_Missense_Mutation_p.M541I	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI	663	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						GCACCATGATGACCTGTGCTT	0.527													3	15	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72292376	72292376	+	Splice_Site	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72292376G>T	uc001jrd.3	+	6	915	c.634_splice	c.e6-1	p.I212_splice		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						CCTCCCTCTAGATCCACGACT	0.597													4	70	---	---	---	---	PASS
C10orf54	64115	broad.mit.edu	37	10	73521607	73521607	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73521607G>A	uc001jsd.2	-	2	400	c.259C>T	c.(259-261)CGG>TGG	p.R87W	CDH23_uc001jrx.3_Intron|C10orf54_uc001jse.2_5'UTR|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Missense_Mutation_p.R87W	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24 precursor	87	Ig-like.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3						CGGATGGGCCGGCGCTCTGAG	0.652													3	43	---	---	---	---	PASS
ECD	11319	broad.mit.edu	37	10	74896575	74896575	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74896575C>T	uc001jtn.2	-	13	1834	c.1591G>A	c.(1591-1593)GAA>AAA	p.E531K	ECD_uc009xqx.2_Missense_Mutation_p.E564K|ECD_uc009xqy.2_Missense_Mutation_p.E488K|ECD_uc001jto.2_Missense_Mutation_p.E230K	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1	531					regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					GAAGCCTCTTCGCCAGGTTCG	0.448													9	165	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108459108	108459108	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108459108G>A	uc001kym.2	-	9	1285	c.1277C>T	c.(1276-1278)GCG>GTG	p.A426V	SORCS1_uc001kyl.2_Missense_Mutation_p.A426V|SORCS1_uc009xxs.2_Missense_Mutation_p.A426V|SORCS1_uc001kyn.1_Missense_Mutation_p.A426V|SORCS1_uc001kyo.2_Missense_Mutation_p.A426V	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	426	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TTCTTGGACCGCTGCGAACAC	0.478													5	34	---	---	---	---	PASS
TRUB1	142940	broad.mit.edu	37	10	116731913	116731913	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116731913G>C	uc001lcd.2	+	6	677	c.616G>C	c.(616-618)GAT>CAT	p.D206H	TRUB1_uc010qsl.1_Missense_Mutation_p.D108H	NM_139169	NP_631908	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase homolog 1	206					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding				0		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		ATTAAAGAAAGATGGACAAAG	0.413													21	34	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121677504	121677504	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121677504G>C	uc001leu.1	+	9	1773	c.1701G>C	c.(1699-1701)ATG>ATC	p.M567I	SEC23IP_uc010qtc.1_Missense_Mutation_p.M356I|SEC23IP_uc009xzk.1_5'Flank	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	567					Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		CACTCTTTATGAGTCGGAACC	0.363													10	82	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	3877560	3877560	+	Silent	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3877560C>G	uc001lyv.2	+	1	628	c.60C>G	c.(58-60)GGC>GGG	p.G20G	STIM1_uc009yef.2_Silent_p.G20G	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	20					activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		TGCACCAGGGCCAGAGCCTCA	0.602													3	63	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6661191	6661191	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6661191C>T	uc001mem.1	-	2	2064	c.1654G>A	c.(1654-1656)GAT>AAT	p.D552N		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	552	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCCACCATCTGTGGCCACC	0.547													13	82	---	---	---	---	PASS
PPFIBP2	8495	broad.mit.edu	37	11	7642183	7642183	+	Silent	SNP	C	T	T	rs150433585		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7642183C>T	uc001mfj.3	+	7	1024	c.636C>T	c.(634-636)CTC>CTT	p.L212L	PPFIBP2_uc010rbb.1_Silent_p.L135L|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Silent_p.L135L|PPFIBP2_uc010rbd.1_Silent_p.L54L|PPFIBP2_uc010rbe.1_Silent_p.L100L|PPFIBP2_uc001mfl.3_Silent_p.L69L	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	212	Potential.				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGCAAGAGCTCAGGCACCTCA	0.423													36	29	---	---	---	---	PASS
CDCA5	113130	broad.mit.edu	37	11	64846850	64846850	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64846850T>A	uc001ocp.2	-	5	818	c.653A>T	c.(652-654)AAG>ATG	p.K218M		NM_080668	NP_542399	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5	218					cell division|double-strand break repair|G1/S transition of mitotic cell cycle|mitotic chromosome condensation|mitotic metaphase plate congression|mitotic sister chromatid cohesion|regulation of cohesin localization to chromatin	cytoplasm|nuclear chromatin|plasma membrane	chromatin binding|identical protein binding				0						TTTCTTCTTCTTACGTTTCTG	0.567													4	50	---	---	---	---	PASS
PRCP	5547	broad.mit.edu	37	11	82549509	82549509	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82549509C>G	uc001ozs.2	-	8	1307	c.1194G>C	c.(1192-1194)TGG>TGC	p.W398C	PRCP_uc001ozr.2_Missense_Mutation_p.W419C	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	398					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						GTCTCACACCCCACTGTTGAA	0.418													11	31	---	---	---	---	PASS
CASP4	837	broad.mit.edu	37	11	104825573	104825573	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104825573G>A	uc001pid.1	-	2	236	c.163C>T	c.(163-165)CGG>TGG	p.R55W	CASP4_uc001pib.1_5'UTR|CASP4_uc009yxg.1_5'UTR|CASP4_uc010rux.1_Missense_Mutation_p.R55W|CASP4_uc010ruy.1_Missense_Mutation_p.R55W	NM_001225	NP_001216	P49662	CASP4_HUMAN	caspase 4 isoform alpha precursor	55	CARD.				apoptosis|induction of apoptosis|proteolysis	intracellular	cysteine-type endopeptidase activity|protein binding			lung(2)|ovary(1)|skin(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		GCCATGACCCGAACTTTGTCT	0.388													9	86	---	---	---	---	PASS
C11orf87	399947	broad.mit.edu	37	11	109294575	109294575	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109294575C>T	uc001pkn.2	+	2	590	c.216C>T	c.(214-216)TTC>TTT	p.F72F	C11orf87_uc010rwb.1_5'Flank	NM_207645	NP_997528	Q6NUJ2	CK087_HUMAN	hypothetical protein LOC399947 precursor	72	Helical; (Potential).					integral to membrane				ovary(2)	2						CCCTCATCTTCTGCCTCATCG	0.572													8	71	---	---	---	---	PASS
OR6T1	219874	broad.mit.edu	37	11	123813872	123813872	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123813872A>G	uc010sab.1	-	1	674	c.674T>C	c.(673-675)GTT>GCT	p.V225A		NM_001005187	NP_001005187	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GGCCCTGAGAACAGTGGCAAG	0.527													6	47	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132306671	132306671	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132306671G>A	uc001qgs.2	-	5	717	c.667C>T	c.(667-669)CCT>TCT	p.P223S	OPCML_uc001qgu.2_Missense_Mutation_p.P216S|OPCML_uc010sck.1_Missense_Mutation_p.P223S|OPCML_uc001qgt.2_Missense_Mutation_p.P222S|OPCML_uc010scl.1_Missense_Mutation_p.P182S	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	223	Ig-like C2-type 3.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		ATATAGGGAGGATCTGTGGGA	0.393													3	20	---	---	---	---	PASS
KCNA1	3736	broad.mit.edu	37	12	5020706	5020706	+	Silent	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5020706C>A	uc001qnh.2	+	2	1267	c.162C>A	c.(160-162)ACC>ACA	p.T54T		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	54					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGCTCAAGACCCTGGCGCAGT	0.637													23	50	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22015990	22015990	+	Splice_Site	SNP	T	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22015990T>A	uc001rfi.1	-	18	2258	c.2238_splice	c.e18-1	p.S746_splice	ABCC9_uc001rfh.2_Splice_Site_p.S746_splice|ABCC9_uc001rfj.1_Splice_Site_p.S710_splice	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CTGTTCCTACTGAAAAATGAA	0.318													4	44	---	---	---	---	PASS
BTG1	694	broad.mit.edu	37	12	92539324	92539324	+	5'UTR	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92539324C>A	uc001tby.3	-	1					BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	NM_001731	NP_001722	P62324	BTG1_HUMAN	B-cell translocation protein 1						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				gggcggcgtgcgggggcggcc	0.473			T	MYC	BCLL								15	5	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114832589	114832589	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114832589G>T	uc001tvo.2	-	6	1115	c.620C>A	c.(619-621)CCT>CAT	p.P207H	TBX5_uc001tvp.2_Missense_Mutation_p.P207H|TBX5_uc001tvq.2_Missense_Mutation_p.P157H|TBX5_uc010syv.1_Missense_Mutation_p.P207H	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	207	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CGCAGTCTCAGGAAAGACGTG	0.463													5	281	---	---	---	---	PASS
RNFT2	84900	broad.mit.edu	37	12	117274059	117274059	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117274059T>C	uc009zwn.2	+	10	1405	c.1172T>C	c.(1171-1173)TTC>TCC	p.F391S	RNFT2_uc001twb.3_Missense_Mutation_p.F391S|RNFT2_uc001twa.3_Missense_Mutation_p.F301S|RNFT2_uc001twc.3_Missense_Mutation_p.F139S	NM_001109903	NP_001103373	Q96EX2	RNFT2_HUMAN	transmembrane protein 118 isoform 1	391	Extracellular (Potential).|RING-type.					integral to membrane	zinc ion binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CAGGCCGAGTTCCGAGAGCCT	0.602													3	6	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124816920	124816920	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124816920C>G	uc010tay.1	-	45	7035	c.6879G>C	c.(6877-6879)AAG>AAC	p.K2293N	NCOR2_uc010taz.1_Missense_Mutation_p.K2277N|NCOR2_uc010tax.1_Missense_Mutation_p.K404N	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1	2294					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TCTCTTGCTTCTTGGACTTGA	0.587											OREG0022237	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	111	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23906256	23906256	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23906256C>G	uc001uon.2	-	10	12348	c.11759G>C	c.(11758-11760)AGC>ACC	p.S3920T	SACS_uc001uoo.2_Missense_Mutation_p.S3773T|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3920					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACTAAGATGCTTGACTTTAC	0.438													9	147	---	---	---	---	PASS
SOHLH2	54937	broad.mit.edu	37	13	36744906	36744906	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36744906G>C	uc001uvj.2	-	10	1108	c.1019C>G	c.(1018-1020)TCA>TGA	p.S340*	SOHLH2_uc010tei.1_Nonsense_Mutation_p.S417*	NM_017826	NP_060296	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic	340					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		AGCATTCTCTGAGGCGGAGCT	0.398													5	95	---	---	---	---	PASS
NEK5	341676	broad.mit.edu	37	13	52661488	52661488	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52661488C>T	uc001vge.2	-	15	1518	c.1378G>A	c.(1378-1380)GAA>AAA	p.E460K		NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	460							ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		TCCTTCATTTCGTTTTTCCTA	0.393													21	74	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75936294	75936294	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75936294G>A	uc001vjl.1	-	2	1295	c.948C>T	c.(946-948)TGC>TGT	p.C316C	TBC1D4_uc010aer.2_Silent_p.C316C|TBC1D4_uc010aes.2_Silent_p.C316C	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	316	PID 2.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TGACACTGCTGCACCGAGACC	0.637													5	46	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103484016	103484016	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103484016G>C	uc001vpu.1	+	6	1125	c.1003G>C	c.(1003-1005)GCA>CCA	p.A335P	BIVM_uc001vps.2_Missense_Mutation_p.A335P|BIVM_uc010agc.2_Missense_Mutation_p.A106P|BIVM_uc001vpv.2_Missense_Mutation_p.A106P	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	Error:Variant_position_missing_in_P28715_after_alignment					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TGGCTTCGAAGCAACCCCTGT	0.318			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				3	66	---	---	---	---	PASS
OR6S1	341799	broad.mit.edu	37	14	21109226	21109226	+	Missense_Mutation	SNP	C	G	G	rs150042729		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21109226C>G	uc001vxv.1	-	1	625	c.625G>C	c.(625-627)GTC>CTC	p.V209L		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		GATACAATGACGAGGGAGGCC	0.572													5	98	---	---	---	---	PASS
EAPP	55837	broad.mit.edu	37	14	34985629	34985629	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34985629C>G	uc001wsd.1	-	6	854	c.745G>C	c.(745-747)GAT>CAT	p.D249H		NM_018453	NP_060923	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	249					negative regulation of transcription elongation from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of transcription elongation from RNA polymerase II promoter	Golgi apparatus|nucleus|plasma membrane				ovary(1)	1	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		TCTTCCACATCTGTCTCTGCC	0.448													9	195	---	---	---	---	PASS
EAPP	55837	broad.mit.edu	37	14	34985718	34985718	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34985718C>G	uc001wsd.1	-	6	765	c.656G>C	c.(655-657)AGA>ACA	p.R219T		NM_018453	NP_060923	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	219					negative regulation of transcription elongation from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of transcription elongation from RNA polymerase II promoter	Golgi apparatus|nucleus|plasma membrane				ovary(1)	1	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		GGCTTTATATCTTAGAACCTC	0.388													9	143	---	---	---	---	PASS
NF1P1	440225	broad.mit.edu	37	15	21134248	21134248	+	RNA	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21134248C>G	uc001ytv.1	-	2		c.258G>C								Human NF1-related locus DNA in A9 mouse DNA background.												0						ATAGGGAGCTCTCCTTGATCA	0.433													3	25	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55841124	55841124	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55841124C>T	uc010bfl.1	-	2	175	c.119G>A	c.(118-120)CGC>CAC	p.R40H	PYGO1_uc002adf.1_Missense_Mutation_p.R40H	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	40	Nuclear localization signal (Potential).				Wnt receptor signaling pathway	nucleus	zinc ion binding	p.R40C(1)		ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		ATTTGCCTTGCGCTTTTTCTT	0.368													4	51	---	---	---	---	PASS
GOLGA6A	342096	broad.mit.edu	37	15	74365122	74365122	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74365122G>T	uc002axa.1	-	13	1503	c.1462C>A	c.(1462-1464)CTA>ATA	p.L488I		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	488	Potential.										0						TGGGTCTCTAGCTGTTGGTTC	0.612													7	55	---	---	---	---	PASS
C15orf42	90381	broad.mit.edu	37	15	90167478	90167478	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90167478A>T	uc002boe.2	+	20	3937	c.3937A>T	c.(3937-3939)ACC>TCC	p.T1313S	C15orf42_uc010upv.1_RNA	NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	1313	Pro-rich.				cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GAAACTGTTTACCTCTCCTTT	0.433													5	178	---	---	---	---	PASS
ST8SIA2	8128	broad.mit.edu	37	15	92977602	92977602	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92977602T>A	uc002bra.2	+	3	442	c.287T>A	c.(286-288)ATC>AAC	p.I96N	ST8SIA2_uc002brb.2_Missense_Mutation_p.I75N	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide	96	Lumenal (Potential).				axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TCTCTGAGGATCAGGTACTGG	0.453													18	55	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516350	102516350	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516350G>A	uc002cdi.2	+	11	2096	c.676G>A	c.(676-678)GGA>AGA	p.G226R	WASH3P_uc002cdl.2_Missense_Mutation_p.G226R|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G226R|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						CTCTGGGAAAGGACCTGGGGC	0.622													2	1	---	---	---	---	PASS
ZNF598	90850	broad.mit.edu	37	16	2052220	2052220	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2052220C>T	uc002cof.1	-	7	897	c.882G>A	c.(880-882)TCG>TCA	p.S294S	ZNF598_uc002coe.1_5'UTR	NM_178167	NP_835461	Q86UK7	ZN598_HUMAN	zinc finger protein 598	294						intracellular	zinc ion binding			lung(1)|breast(1)	2						CGTTCCGGCGCGAGTGCCGTG	0.692													4	15	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27761348	27761348	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27761348G>C	uc002dow.2	+	16	3091	c.3067G>C	c.(3067-3069)GCC>CCC	p.A1023P		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1023										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TATTTTACCAGCCTATGGGAA	0.532													4	43	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28993242	28993242	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28993242C>T	uc010vdi.1	+	8	970	c.830C>T	c.(829-831)TCC>TTC	p.S277F	uc010vct.1_Intron|SPNS1_uc002drx.2_Missense_Mutation_p.S204F|SPNS1_uc002dsa.2_Missense_Mutation_p.S277F|SPNS1_uc002drz.2_Intron|SPNS1_uc010byp.2_Intron|SPNS1_uc010byq.1_Missense_Mutation_p.S209F|LAT_uc010vdj.1_5'Flank	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	277					lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GTCCTGTCTTCCCTGGGCTTC	0.632											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	77	---	---	---	---	PASS
DOC2A	8448	broad.mit.edu	37	16	30017490	30017490	+	3'UTR	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30017490G>A	uc002dvm.2	-	11					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|DOC2A_uc002dvl.2_3'UTR|DOC2A_uc002dvn.2_3'UTR|DOC2A_uc010vef.1_RNA|DOC2A_uc002dvo.2_3'UTR|DOC2A_uc002dvp.2_3'UTR|DOC2A_uc002dvq.2_3'UTR	NM_003586	NP_003577	Q14183	DOC2A_HUMAN	double C2-like domains, alpha						nervous system development|regulation of calcium ion-dependent exocytosis	cell junction|lysosome|synaptic vesicle membrane|synaptosome	calcium-dependent phospholipid binding|protein binding|transporter activity			ovary(2)	2						GGCCTGTGCCGGGACACTGCT	0.657													4	7	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65016031	65016031	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016031T>G	uc002eoi.2	-	8	1607	c.1173A>C	c.(1171-1173)GAA>GAC	p.E391D	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Missense_Mutation_p.E391D|CDH11_uc010vin.1_Missense_Mutation_p.E265D|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	391	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TTTCTTGGACTTCGTGGATGT	0.498			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			6	90	---	---	---	---	PASS
DHX33	56919	broad.mit.edu	37	17	5365692	5365692	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5365692C>G	uc002gca.2	-	3	627	c.625G>C	c.(625-627)GTG>CTG	p.V209L	DHX33_uc002gbz.2_5'Flank|DHX33_uc002gcb.2_Missense_Mutation_p.V36L|DHX33_uc010clf.2_Intron	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	209	Helicase ATP-binding.					nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						GCTTTCACCACTCCAAAGAGC	0.463													4	56	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7226379	7226379	+	Silent	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7226379C>A	uc002gga.1	-	15	2488	c.2481G>T	c.(2479-2481)GCG>GCT	p.A827A	NEURL4_uc002ggb.1_Silent_p.A827A|NEURL4_uc002ggc.1_Silent_p.A173A	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	827	NHR 4.						protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						CTGTGCCCAGCGCATCCAGGT	0.602													7	39	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40642597	40642597	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40642597T>G	uc002hzr.2	+	11	1283	c.1116T>G	c.(1114-1116)TAT>TAG	p.Y372*	ATP6V0A1_uc002hzq.2_Nonsense_Mutation_p.Y372*|ATP6V0A1_uc002hzs.2_Nonsense_Mutation_p.Y379*|ATP6V0A1_uc010wgj.1_Nonsense_Mutation_p.Y329*|ATP6V0A1_uc010wgk.1_Nonsense_Mutation_p.Y329*|ATP6V0A1_uc010cyg.2_Nonsense_Mutation_p.Y18*|ATP6V0A1_uc010wgl.1_Nonsense_Mutation_p.Y231*	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	372	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		AGTTTACCTATGGCTTTCAGA	0.373													13	122	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40652912	40652912	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40652912T>C	uc002hzr.2	+	16	2034	c.1867T>C	c.(1867-1869)TCT>CCT	p.S623P	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.S623P|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.S630P|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.S580P|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.S580P|ATP6V0A1_uc010cyg.2_Missense_Mutation_p.S269P|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.S482P	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	623	Helical; (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CTACCCAGAGTCTGGTTATTC	0.438													7	134	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41244840	41244840	+	Missense_Mutation	SNP	C	G	G	rs80357717		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41244840C>G	uc002icq.2	-	10	2940	c.2708G>C	c.(2707-2709)TGT>TCT	p.C903S	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.C832S|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.C856S|BRCA1_uc002ict.2_Missense_Mutation_p.C903S|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.C903S|BRCA1_uc002ide.1_Missense_Mutation_p.C734S|BRCA1_uc010cyy.1_Missense_Mutation_p.C903S|BRCA1_uc010whs.1_Missense_Mutation_p.C903S|BRCA1_uc010cyz.2_Missense_Mutation_p.C856S|BRCA1_uc010cza.2_Missense_Mutation_p.C877S|BRCA1_uc010wht.1_Missense_Mutation_p.C607S	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	903					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTTTTGTTCACATTCAAAAGT	0.403			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			12	96	---	---	---	---	PASS
COIL	8161	broad.mit.edu	37	17	55027860	55027860	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55027860G>A	uc002iuu.2	-	2	774	c.743C>T	c.(742-744)TCG>TTG	p.S248L		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	248	2 X 4 AA repeats of A-R-N-S.|Ser/Thr-rich.					Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)					TTCAGACTCCGAGGAGGAACT	0.428													8	124	---	---	---	---	PASS
SLC16A6	9120	broad.mit.edu	37	17	66267519	66267519	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66267519G>A	uc002jgz.1	-	5	970	c.782C>T	c.(781-783)CCG>CTG	p.P261L	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Missense_Mutation_p.P261L	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	261	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GTCGGCCTTCGGCTCCAGTTC	0.468													4	96	---	---	---	---	PASS
THOC1	9984	broad.mit.edu	37	18	252549	252549	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:252549G>C	uc002kkj.3	-	9	707	c.667C>G	c.(667-669)CCA>GCA	p.P223A	THOC1_uc002kkk.3_RNA|THOC1_uc002kkl.2_Missense_Mutation_p.P223A	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1	223					apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CACGTTGTTGGAGCTTCCTCG	0.398													12	100	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39584404	39584404	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39584404C>T	uc002lap.2	+	10	1127	c.1069C>T	c.(1069-1071)CCG>TCG	p.P357S	PIK3C3_uc010xcl.1_Missense_Mutation_p.P294S	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	357					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						AAAATGGAAGCCGATGGATGT	0.463										TSP Lung(28;0.18)			3	42	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9085813	9085813	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085813G>C	uc002mkp.2	-	1	6206	c.6002C>G	c.(6001-6003)TCA>TGA	p.S2001*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2001	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATATGGAGTTGACTGTGTCTG	0.468													9	70	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941848	22941848	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941848T>G	uc010xrh.1	-	5	590	c.590A>C	c.(589-591)GAA>GCA	p.E197A		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCCACATTCTTCACATTTATA	0.363													5	50	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39086328	39086328	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39086328C>A	uc002oix.1	-	28	2329	c.2221G>T	c.(2221-2223)GGA>TGA	p.G741*	MAP4K1_uc002oiw.1_Nonsense_Mutation_p.G328*|MAP4K1_uc002oiy.1_Nonsense_Mutation_p.G741*	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	741	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTGCGAAGTCCCCGGACTGGG	0.592													11	52	---	---	---	---	PASS
FBXO27	126433	broad.mit.edu	37	19	39516069	39516069	+	Silent	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39516069C>G	uc002okh.2	-	6	916	c.834G>C	c.(832-834)GTG>GTC	p.V278V		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	278	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GACGGACTCGCACGATCACAC	0.587													6	113	---	---	---	---	PASS
SAMD4B	55095	broad.mit.edu	37	19	39866391	39866391	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39866391G>C	uc002olb.2	+	7	1804	c.769G>C	c.(769-771)GGG>CGG	p.G257R	SAMD4B_uc002ola.2_Missense_Mutation_p.G257R	NM_018028	NP_060498	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	257							protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			AGAGGAGCTTGGGGCCCGGGC	0.647													30	151	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43585371	43585371	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43585371G>T	uc002ovi.2	-	2	185	c.92C>A	c.(91-93)CCC>CAC	p.P31H	PSG6_uc010xwk.1_Intron|PSG2_uc002ovr.2_Missense_Mutation_p.P31H|PSG2_uc002ovq.3_Missense_Mutation_p.P31H|PSG2_uc010eiq.1_Missense_Mutation_p.P31H|PSG2_uc002ovs.3_Missense_Mutation_p.P31H|PSG2_uc002ovt.3_Missense_Mutation_p.P31H			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	31					female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GGCAGTGGTGGGCAGGTTCCA	0.498													5	219	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49641521	49641521	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49641521T>G	uc002pmr.2	+	16	2245	c.1913T>G	c.(1912-1914)GTG>GGG	p.V638G	PPFIA3_uc010yai.1_Intron|PPFIA3_uc010yaj.1_Intron|PPFIA3_uc002pms.2_Missense_Mutation_p.V506G	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	638	Potential.					cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GAGAGTCGGGTGTCCAGCTCT	0.647													4	22	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56467116	56467116	+	Silent	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56467116C>T	uc002qmh.2	+	3	1763	c.1692C>T	c.(1690-1692)AAC>AAT	p.N564N	NLRP8_uc010etg.2_Silent_p.N564N	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	564						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GTTTTCTGAACGAGGCCTGCG	0.473													4	74	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	A	A	rs7266938	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625877G>A	uc010ztl.1	+	2	63	c.31G>A	c.(31-33)GCC>ACC	p.A11T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GTACAGAATCGCCCTGAAATC	0.353													4	65	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10998299	10998299	+	RNA	SNP	G	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10998299G>C	uc002yis.1	-	11		c.1954C>G						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTCAGGACTAGATTCTGATTT	0.373													8	111	---	---	---	---	PASS
BACH1	571	broad.mit.edu	37	21	30699117	30699117	+	Silent	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30699117T>G	uc002ynj.2	+	3	1087	c.972T>G	c.(970-972)TCT>TCG	p.S324S	BACH1_uc002ynk.2_Silent_p.S324S|BACH1_uc002ynl.2_RNA	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor	324						nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						ATTCTTTGTCTCTTTTACACA	0.413													10	266	---	---	---	---	PASS
KRTAP24-1	643803	broad.mit.edu	37	21	31655055	31655055	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31655055C>T	uc002ynv.2	-	1	222	c.196G>A	c.(196-198)GGT>AGT	p.G66S		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	66						keratin filament	structural molecule activity				0						GGTGCTTCACCGTAGGATTCT	0.522													6	84	---	---	---	---	PASS
DRG1	4733	broad.mit.edu	37	22	31816285	31816285	+	Silent	SNP	G	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31816285G>A	uc003aku.2	+	5	587	c.456G>A	c.(454-456)CTG>CTA	p.L152L		NM_004147	NP_004138	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	152	G.				multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1						TGGATGTCCTGAAACCTTTGG	0.408													8	107	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23411961	23411961	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23411961G>T	uc004dal.3	+	3	2334	c.2326G>T	c.(2326-2328)GTT>TTT	p.V776F		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	776					cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						ATCCACATTTGTTCTGGGCAA	0.373													5	59	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67940175	67940175	+	Silent	SNP	A	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67940175A>C	uc004dxa.2	+	7	2091	c.1719A>C	c.(1717-1719)CCA>CCC	p.P573P	STARD8_uc004dxb.2_Silent_p.P653P|STARD8_uc004dxc.3_Silent_p.P573P	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	573	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TTGGGGTGCCACCCCTCATCC	0.577													4	4	---	---	---	---	PASS
SLC6A14	11254	broad.mit.edu	37	X	115573895	115573895	+	Silent	SNP	A	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115573895A>G	uc004eqi.2	+	4	491	c.387A>G	c.(385-387)ACA>ACG	p.T129T	SLC6A14_uc011mtm.1_Intron	NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	129	Helical; Name=3; (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	TTTTTGTGACAATCTATTACA	0.303													13	79	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123556134	123556134	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123556134C>G	uc004euj.2	-	23	4502	c.4438G>C	c.(4438-4440)GAC>CAC	p.D1480H	ODZ1_uc011muj.1_Missense_Mutation_p.D1486H|ODZ1_uc010nqy.2_Missense_Mutation_p.D1487H	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1480	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GAAAAACAGTCACAGTTTGGA	0.438													9	46	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125685222	125685222	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685222T>G	uc004eul.2	-	1	1621	c.1370A>C	c.(1369-1371)AAC>ACC	p.N457T		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	457										skin(3)|ovary(1)	4						GCCTGCATAGTTCCCATGGAG	0.542													4	59	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16372283	16372283	+	Intron	DEL	T	-	-	rs67016480		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372283delT	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGGGGGGTGCTCTGGGTG	0.358													5	5	---	---	---	---	
PPT1	5538	broad.mit.edu	37	1	40557554	40557554	+	Intron	DEL	G	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40557554delG	uc001cfb.2	-						PPT1_uc010ojf.1_Intron|PPT1_uc010ojg.1_Intron|PPT1_uc009vwa.2_Intron	NM_000310	NP_000301	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1 isoform 1						brain development|cofactor metabolic process|cofactor transport|DNA fragmentation involved in apoptotic nuclear change|lysosomal lumen acidification|membrane raft organization|negative regulation of cell growth|negative regulation of neuron apoptosis|neuron development|pinocytosis|positive regulation of pinocytosis|positive regulation of receptor-mediated endocytosis|protein depalmitoylation|protein transport|receptor-mediated endocytosis|regulation of synapse structure and activity|sphingolipid catabolic process|visual perception	axon|cytosol|Golgi apparatus|lysosome|membrane fraction|membrane raft|nucleus|synaptic vesicle	palmitoyl-(protein) hydrolase activity|palmitoyl-CoA hydrolase activity			ovary(1)	1	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			aaaaaaaaaagaaaagaaaTT	0.164													5	3	---	---	---	---	
MAGOH	4116	broad.mit.edu	37	1	53692911	53692915	+	Intron	DEL	TGAGG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53692911_53692915delTGAGG	uc001cvf.1	-						MAGOH_uc010ont.1_Intron	NM_002370	NP_002361	P61326	MGN_HUMAN	mago-nashi homolog						mRNA 3'-end processing|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|exon-exon junction complex|nuclear speck	protein binding|RNA binding				0						cggtatattatgaggtaatttaaat	0.132													2	5	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242226	67242227	+	Intron	DEL	AT	-	-	rs72385752		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242226_67242227delAT	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						CATATTCTACATATAtgtgtgt	0.248													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855840	148855842	+	IGR	DEL	GGT	-	-	rs60282471		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855840_148855842delGGT								NBPF16 (97529 upstream) : LOC645166 (72444 downstream)																							aagccgcggcggtggcggcggag	0.335													10	5	---	---	---	---	
RGS16	6004	broad.mit.edu	37	1	182569291	182569292	+	3'UTR	INS	-	TT	TT	rs10649643		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182569291_182569292insTT	uc001gpl.3	-	5						NM_002928	NP_002919	O15492	RGS16_HUMAN	regulator of G-protein signalling 16						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(1)	1						GCTGGAGCGCAttttttttttt	0.515													5	3	---	---	---	---	
KLHDC8A	55220	broad.mit.edu	37	1	205320730	205320732	+	Intron	DEL	CAA	-	-	rs143420341		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205320730_205320732delCAA	uc001hcf.1	-						KLHDC8A_uc010prg.1_Intron|KLHDC8A_uc001hcg.1_Intron	NM_018203	NP_060673	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A											ovary(1)	1	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTGTAATAGTCaaaaaaaaaaaa	0.187													4	5	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766826	206766827	+	Intron	DEL	GA	-	-	rs113332386		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766826_206766827delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagcgcgagagagagaga	0.213													4	2	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113147931	113147933	+	Intron	DEL	ATG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113147931_113147933delATG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						gttaacaataatgatgatgatga	0.123													4	2	---	---	---	---	
HSPD1	3329	broad.mit.edu	37	2	198360213	198360214	+	Intron	INS	-	T	T	rs13432424		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198360213_198360214insT	uc002uui.2	-						HSPD1_uc002uuj.2_Intron|HSPD1_uc010zgx.1_Intron|HSPD1_uc010fsm.2_5'UTR|HSPD1_uc002uuk.2_Intron	NM_002156	NP_002147	P10809	CH60_HUMAN	chaperonin						'de novo' protein folding|activation of caspase activity|B cell cytokine production|B cell proliferation|chaperone-mediated protein complex assembly|interspecies interaction between organisms|isotype switching to IgG isotypes|MyD88-dependent toll-like receptor signaling pathway|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of interferon-alpha production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of macrophage activation|positive regulation of T cell activation|positive regulation of T cell mediated immune response to tumor cell|protein maturation|protein refolding|protein stabilization|response to unfolded protein|T cell activation	cell surface|coated pit|coated vesicle|cytosol|early endosome|extracellular space|lipopolysaccharide receptor complex|mitochondrial inner membrane|mitochondrial matrix|stored secretory granule	ATP binding|ATPase activity|cell surface binding|chaperone binding|DNA replication origin binding|lipopolysaccharide binding|p53 binding|single-stranded DNA binding				0			Epithelial(96;0.225)			AAAAAAAAAAAttttttttttt	0.124													6	3	---	---	---	---	
SYN2	6854	broad.mit.edu	37	3	12046124	12046126	+	In_Frame_Del	DEL	AGC	-	-	rs76272937		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12046124_12046126delAGC	uc003bwm.2	+	1	263_265	c.99_101delAGC	c.(97-102)CAACCG>CAG	p.P40del	SYN2_uc003bwl.1_In_Frame_Del_p.P40del	NM_133625	NP_598328	Q92777	SYN2_HUMAN	synapsin II isoform IIa	40					neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2						AGCCCCAGCAAGCGCCGAcgccg	0.345													5	3	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183643628	183643629	+	Intron	INS	-	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183643628_183643629insT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			tcttttctttcttttttttttt	0.104													4	3	---	---	---	---	
AHRR	57491	broad.mit.edu	37	5	304350	304353	+	Intron	DEL	GACG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:304350_304353delGACG	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|PDCD6_uc003jat.1_Intron|PDCD6_uc003jau.1_Intron	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			AGTATCGGCAGACGGACCAACCTG	0.402													137	7	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73142411	73142412	+	Intron	INS	-	T	T	rs142259999	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73142411_73142412insT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CATATGAACTATTTTTTTGAGA	0.287													5	3	---	---	---	---	
CMYA5	202333	broad.mit.edu	37	5	79054469	79054472	+	Intron	DEL	TATG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79054469_79054472delTATG	uc003kgc.2	+							NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5							perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACTTTTATACTATGTATTTCTGTA	0.235													6	6	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94877399	94877400	+	Intron	INS	-	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94877399_94877400insA	uc003klb.2	-						TTC37_uc010jbf.1_Intron	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						ACAAATGTTTGAAAAAAAAAAA	0.277													5	4	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31239271	31239275	+	Intron	DEL	ATCCA	-	-	rs72558142		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31239271_31239275delATCCA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_5'UTR|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_Intron|HLA-B_uc003ntf.2_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						GGTTCCGCAGATCCACCTTGGGGTG	0.683													9	9	---	---	---	---	
LOC153910	153910	broad.mit.edu	37	6	142860298	142860299	+	Intron	INS	-	T	T	rs143051118	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142860298_142860299insT	uc003qjc.1	-						LOC153910_uc010khg.1_Intron	NR_027312				Homo sapiens cDNA FLJ31371 fis, clone NB9N42000196.												0						ttaggccagtatttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64532708	64532709	+	Intron	INS	-	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64532708_64532709insA	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		AAATGGGGACCAAAAAAAAAAA	0.351													4	2	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91726612	91726613	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91726612_91726613insA	uc003ulg.2	+	41	10564_10565	c.10339_10340insA	c.(10339-10341)GAAfs	p.E3447fs	AKAP9_uc003ulf.2_Frame_Shift_Ins_p.E3439fs|AKAP9_uc003uli.2_Frame_Shift_Ins_p.E3070fs|AKAP9_uc003ulj.2_Frame_Shift_Ins_p.E1217fs|AKAP9_uc003ull.2_Frame_Shift_Ins_p.E343fs	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3451	Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCAGAAGCAAGAACTAGAACGA	0.376			T	BRAF	papillary thyroid								23	19	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197800	102197800	+	Intron	DEL	G	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197800delG	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						ttttttttttgtgtgtgtgtg	0.254													4	2	---	---	---	---	
AASS	10157	broad.mit.edu	37	7	121754958	121754958	+	Intron	DEL	A	-	-	rs56052527	byFrequency	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121754958delA	uc003vka.2	-						AASS_uc011knu.1_Intron|AASS_uc011knv.1_Intron|AASS_uc003vkb.2_Intron|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor						protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	ATAAAATTTTAAAAAaaaaag	0.045													4	3	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41566186	41566187	+	Intron	DEL	AC	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41566186_41566187delAC	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_5'Flank|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			tccaaggattacacacacacac	0.188													155	7	---	---	---	---	
ATAD2	29028	broad.mit.edu	37	8	124382377	124382377	+	Intron	DEL	A	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124382377delA	uc003yqh.3	-						ATAD2_uc011lii.1_Intron|ATAD2_uc003yqi.3_Intron|ATAD2_uc003yqj.2_Intron	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ATCTACTCCTAAAAAAAAAAA	0.299													26	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67331359	67331359	+	IGR	DEL	T	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67331359delT								AQP7P1 (41867 upstream) : FAM27B (461571 downstream)																							CATGATGGGGTTGGGGGGGAA	0.393													7	7	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97220946	97220947	+	Intron	INS	-	A	A	rs141945511	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97220946_97220947insA	uc004aur.2	+						HIATL1_uc011luh.1_Intron	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				AGATATGTCTTAACTTTGTTCA	0.337													3	3	---	---	---	---	
SEC16A	9919	broad.mit.edu	37	9	139341530	139341530	+	Intron	DEL	A	-	-	rs35600321		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139341530delA	uc004chx.2	-						SEC16A_uc004chp.2_5'Flank|SEC16A_uc004chq.2_Intron|SEC16A_uc011mea.1_Intron|SEC16A_uc004chr.2_Intron|SEC16A_uc004chs.2_Intron|SEC16A_uc004cht.2_Intron|SEC16A_uc004chu.2_Intron|SEC16A_uc004chv.3_Intron|SEC16A_uc004chw.2_Intron|SEC16A_uc010nbn.2_Intron	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CAGGCAAATCAAAAAAAAAAC	0.493													6	3	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													6	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	17951300	17951301	+	Intron	INS	-	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17951300_17951301insT	uc001ipk.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						Gtttttataaattttttttttt	0.297													4	2	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141655	32141657	+	Intron	DEL	TTC	-	-	rs146488179	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141655_32141657delTTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				CAACAAAAAAttctttttttttt	0.113													4	2	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32307648	32307649	+	Intron	INS	-	A	A	rs144717631	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32307648_32307649insA	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TGCTGTCTTTCaaaaaaaaaat	0.178													3	3	---	---	---	---	
VDAC2	7417	broad.mit.edu	37	10	76989625	76989625	+	Intron	DEL	T	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76989625delT	uc001jwz.2	+						VDAC2_uc010qld.1_Intron|VDAC2_uc001jxa.2_Intron|VDAC2_uc010qle.1_Intron	NM_003375	NP_003366	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2							mitochondrial nucleoid|mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	ttttctttgcttttttttttt	0.179													4	2	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133961636	133961637	+	Intron	INS	-	TGAACA	TGAACA	rs141683861	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961636_133961637insTGAACA	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACACAAAGCCCtgaacatgaac	0.495													4	3	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3789650	3789651	+	Intron	INS	-	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3789650_3789651insA	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_Intron|NUP98_uc001lyk.1_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		gactccatctcaaaaaaaaaaa	0.144			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								6	3	---	---	---	---	
ACCN2	41	broad.mit.edu	37	12	50453038	50453039	+	Intron	INS	-	C	C	rs144549190	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50453038_50453039insC	uc001rvw.2	+						ACCN2_uc001rvv.2_Intron|ACCN2_uc009zln.2_Intron|ACCN2_uc009zlo.2_Intron	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal						calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	CCACCCCCAAACCTGCCACTCA	0.614													8	4	---	---	---	---	
USP30	84749	broad.mit.edu	37	12	109519423	109519424	+	Intron	INS	-	GC	GC			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109519423_109519424insGC	uc010sxi.1	+						USP30_uc001tnu.3_Intron|USP30_uc001tnw.3_5'Flank	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						cacgcacgcatgcgcgcacaca	0.252													4	2	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													4	4	---	---	---	---	
MSI1	4440	broad.mit.edu	37	12	120801065	120801065	+	Intron	DEL	C	-	-	rs34243955		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120801065delC	uc001tye.1	-							NM_002442	NP_002433	O43347	MSI1H_HUMAN	musashi 1						nervous system development	cytoplasm|nucleus	nucleotide binding			central_nervous_system(2)|breast(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTTTAAAGGCCCCCCCCCCG	0.677													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19985459	19985461	+	IGR	DEL	TGG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19985459_19985461delTGG								LOC100101938 (66346 upstream) : TPTE2 (11560 downstream)																							atgtttctgttggtgatggatgg	0.192													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																							GATGTGGAATATGATGAAGGAGA	0.369													4	3	---	---	---	---	
IGDCC3	9543	broad.mit.edu	37	15	65623124	65623125	+	Intron	INS	-	TCTA	TCTA	rs150339477	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623124_65623125insTCTA	uc002aos.2	-						IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule											ovary(3)	3						CCAGTGGAAGCTCTATCTTTCT	0.569													3	4	---	---	---	---	
RSL1D1	26156	broad.mit.edu	37	16	11940251	11940252	+	Intron	INS	-	A	A			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11940251_11940252insA	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron|RSL1D1_uc010buw.2_Intron	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						gactccatctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307102	7307103	+	Intron	DEL	CA	-	-	rs150135032	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307102_7307103delCA	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				CGAGAAAGGGCACCCCCCCCCC	0.624													11	5	---	---	---	---	
TMEM97	27346	broad.mit.edu	37	17	26653991	26653991	+	3'UTR	DEL	T	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26653991delT	uc002hat.2	+	3						NM_014573	NP_055388	Q5BJF2	TMM97_HUMAN	transmembrane protein 97						cholesterol homeostasis|regulation of cell growth	integral to membrane|lysosome|nuclear membrane|plasma membrane|rough endoplasmic reticulum	protein binding				0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CCTTCTTCCAttttttttttt	0.249													13	6	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49350959	49350960	+	Intron	INS	-	T	T	rs71355748		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49350959_49350960insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTATGTTATTGTTTTTTTTTTT	0.238													5	3	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													5	3	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67197934	67197935	+	Intron	INS	-	T	T			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67197934_67197935insT	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TATATTTATAAttttttttttt	0.134													5	3	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626922	73626923	+	Intron	INS	-	TGT	TGT	rs56158987		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626922_73626923insTGT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTCATCTGTGGGGGGGGGGGG	0.649								Other_identified_genes_with_known_or_suspected_DNA_repair_function					8	4	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3741135	3741136	+	Intron	INS	-	C	C			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3741135_3741136insC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				caccaccaccacatcaccatca	0.000													3	3	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11517666	11517667	+	Intron	INS	-	T	T	rs5827125		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11517666_11517667insT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						GCTCTCTTAAAttttttttttt	0.020													6	3	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													5	5	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074205	62074207	+	Intron	DEL	CAC	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074205_62074207delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccaccatc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114442	11114442	+	IGR	DEL	A	-	-	rs5842456		TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114442delA								BAGE (15505 upstream) : None (None downstream)																							TGCTTAGGTTAAATTTTTTTT	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21112411	21112411	+	IGR	DEL	G	-	-	rs1829338	by1000genomes	TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112411delG								None (None upstream) : None (None downstream)																							aacaaggagagaaaaaaaaaA	0.154													6	3	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													4	2	---	---	---	---	
TMEM184B	25829	broad.mit.edu	37	22	38626692	38626692	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A20W-01	TCGA-BT-A20W-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38626692delG	uc003avf.1	-	5	732	c.508delC	c.(508-510)CTGfs	p.L170fs	TMEM184B_uc003avg.1_Frame_Shift_Del_p.L170fs|TMEM184B_uc003avh.1_Frame_Shift_Del_p.L104fs|TMEM184B_uc010gxl.1_RNA	NM_012264	NP_036396	Q9Y519	T184B_HUMAN	transmembrane protein 184B	170						integral to membrane					0	Melanoma(58;0.045)					CAGAACCTCAGAAATCCGATG	0.607													13	7	---	---	---	---	
