Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBE2J2	118424	broad.mit.edu	37	1	1190692	1190692	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1190692C>T	uc001adn.2	-	7	981	c.671G>A	c.(670-672)CGG>CAG	p.R224Q	UBE2J2_uc001adm.2_Missense_Mutation_p.R189Q|UBE2J2_uc001ado.2_Missense_Mutation_p.R240Q|UBE2J2_uc001adp.2_Missense_Mutation_p.R224Q|UBE2J2_uc001adq.2_Missense_Mutation_p.R172Q|UBE2J2_uc001adr.2_Missense_Mutation_p.R172Q|UBE2J2_uc001ads.2_Missense_Mutation_p.R172Q	NM_194458	NP_919440	Q8N2K1	UB2J2_HUMAN	ubiquitin conjugating enzyme E2, J2 isoform 3	224	Cytoplasmic (Potential).			PNLAGLQQANRHHGLLGGALANLFV -> QTSQGSSRPTGT TDSGWRPGELVC (in Ref. 1; AAK52609).	response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		TCCGTGGTGCCGGTTGGCCTG	0.637													31	105	---	---	---	---	PASS
ATAD3A	55210	broad.mit.edu	37	1	1455591	1455591	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1455591G>A	uc001afz.1	+	6	823	c.729G>A	c.(727-729)GCG>GCA	p.A243A	ATAD3A_uc001aga.1_Silent_p.A195A|ATAD3A_uc001agb.1_Silent_p.A116A	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	243	Potential.						ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		AGGCCCGGGCGCGCGCCAAGG	0.672													11	16	---	---	---	---	PASS
MMEL1	79258	broad.mit.edu	37	1	2541243	2541243	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2541243G>A	uc001ajy.2	-	5	534	c.320C>T	c.(319-321)CCG>CTG	p.P107L	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	107	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		TTCCGTGGTCGGGTCCATGTT	0.597													19	66	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6206806	6206806	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6206806C>T	uc001amb.1	-	10	1609	c.1509G>A	c.(1507-1509)CTG>CTA	p.L503L	CHD5_uc001ama.1_5'Flank|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	503	Chromo 1.|Pro-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGATGCCCTCCAGGGGCTTAG	0.647													9	30	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16256134	16256134	+	Silent	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16256134T>C	uc001axk.1	+	11	3603	c.3399T>C	c.(3397-3399)TAT>TAC	p.Y1133Y	SPEN_uc010obp.1_Silent_p.Y1092Y	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1133					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAAAAACTATTGCAGTCTTC	0.408													7	16	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918734	16918734	+	5'UTR	SNP	G	C	C	rs3928093	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918734G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CCTGAACTCAGAGCTGAAAGC	0.453													3	16	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16975516	16975516	+	Intron	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975516C>A	uc009vox.2	+						MST1P2_uc010och.1_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc001azm.3_RNA					Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AACTGCCTGTCTCCCACAGAG	0.607													4	15	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085065	17085065	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085065C>A	uc010ock.1	-	11	1410	c.1410G>T	c.(1408-1410)GAG>GAT	p.E470D	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Missense_Mutation_p.E44D	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						TGCCACACTTCTCAAACTGCA	0.607													8	104	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21031304	21031304	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21031304C>T	uc001bdr.3	-	5	877	c.759G>A	c.(757-759)ACG>ACA	p.T253T	KIF17_uc001bds.3_Silent_p.T253T	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	253	Kinesin-motor.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GCCGCTCGCCCGTGGCCCCGG	0.677													21	87	---	---	---	---	PASS
HNRNPR	10236	broad.mit.edu	37	1	23637376	23637376	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23637376G>A	uc001bgr.3	-	11	1632	c.1473C>T	c.(1471-1473)TAC>TAT	p.Y491Y	HNRNPR_uc001bgo.2_Silent_p.Y101Y|HNRNPR_uc001bgp.3_Silent_p.Y494Y|HNRNPR_uc009vqk.2_Silent_p.Y393Y|HNRNPR_uc001bgs.3_Silent_p.Y390Y|HNRNPR_uc010odw.1_Silent_p.Y453Y|HNRNPR_uc010odx.1_Silent_p.Y331Y|HNRNPR_uc009vql.2_Silent_p.Y352Y	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	491	3; approximate.|3 X 11 AA approximate repeats of D-D-Y-Y- G-Y-D-Y-H-D-Y.|RNA-binding RGG-box.					catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		CATCATAGCCGTAGTAGGGAT	0.398													122	96	---	---	---	---	PASS
ZC3H12A	80149	broad.mit.edu	37	1	37948163	37948163	+	Intron	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37948163C>T	uc001cbb.3	+						ZC3H12A_uc001cbc.1_Missense_Mutation_p.P46S	NM_025079	NP_079355	Q5D1E8	ZC12A_HUMAN	zinc finger CCCH-type containing 12A						angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGCCTGCCCTCCCCGGCCCTC	0.622													20	50	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39878175	39878175	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39878175G>A	uc009vvt.1	+	1	3000	c.2238G>A	c.(2236-2238)CAG>CAA	p.Q746Q	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	610											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCCAGAGCAGGTCTTCCAGG	0.483													37	30	---	---	---	---	PASS
COL9A2	1298	broad.mit.edu	37	1	40775613	40775613	+	Missense_Mutation	SNP	G	C	C	rs140305893		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40775613G>C	uc001cfh.1	-	16	913	c.843C>G	c.(841-843)GAC>GAG	p.D281E	COL9A2_uc001cfi.1_Missense_Mutation_p.D100E	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	281	Triple-helical region 3 (COL3).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GACTCACCTCGTCACCCTTCT	0.557													46	176	---	---	---	---	PASS
PODN	127435	broad.mit.edu	37	1	53546444	53546444	+	Silent	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53546444G>T	uc001cuv.2	+	9	1708	c.1701G>T	c.(1699-1701)GGG>GGT	p.G567G	PODN_uc001cuw.2_Silent_p.G548G|PODN_uc010onr.1_Silent_p.G548G|PODN_uc010ons.1_Silent_p.G425G	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN	podocan	519	LRR 17.				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding			ovary(1)|pancreas(1)	2						TCCCCGAGGGGCTCCCCGAGT	0.512													39	11	---	---	---	---	PASS
ZNHIT6	54680	broad.mit.edu	37	1	86123573	86123573	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86123573C>T	uc001dlh.2	-	9	1463	c.1329G>A	c.(1327-1329)GTG>GTA	p.V443V	ZNHIT6_uc010osc.1_Silent_p.V404V	NM_017953	NP_060423	Q9NWK9	BCD1_HUMAN	zinc finger, HIT type 6	443					box C/D snoRNP assembly|ribosome biogenesis	pre-snoRNP complex	identical protein binding|metal ion binding			large_intestine(1)	1						CTTTCAATACCACATGTAATG	0.299													25	84	---	---	---	---	PASS
GBP1	2633	broad.mit.edu	37	1	89521750	89521750	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89521750C>A	uc001dmx.2	-	8	1537	c.1317G>T	c.(1315-1317)AAG>AAT	p.K439N		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	439					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		GGTCTTGTAGCTTCTGAACAA	0.443													5	300	---	---	---	---	PASS
LRRC8C	84230	broad.mit.edu	37	1	90178326	90178326	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90178326C>G	uc001dnl.3	+	3	439	c.197C>G	c.(196-198)TCT>TGT	p.S66C		NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member	66						endoplasmic reticulum membrane|integral to membrane				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CAGAACCACTCTTCCCTTTCG	0.443													12	34	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117559730	117559730	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117559730C>T	uc010oxb.1	+	5	1305	c.1247C>T	c.(1246-1248)TCT>TTT	p.S416F	CD101_uc009whd.2_Missense_Mutation_p.S416F|CD101_uc010oxc.1_Missense_Mutation_p.S416F|CD101_uc010oxd.1_Missense_Mutation_p.S354F	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	416	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GTGGTCATGTCTACCAAGAAC	0.393													20	72	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152323912	152323912	+	Missense_Mutation	SNP	A	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323912A>C	uc001ezw.3	-	3	6423	c.6350T>G	c.(6349-6351)GTC>GGC	p.V2117G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2117							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGTGAGACCCCTGAGTG	0.532													8	773	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325595	152325595	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325595G>C	uc001ezw.3	-	3	4740	c.4667C>G	c.(4666-4668)TCT>TGT	p.S1556C	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1556							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCATGACCAGAGTAGGAATG	0.483													79	355	---	---	---	---	PASS
RAB13	5872	broad.mit.edu	37	1	153958590	153958590	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153958590G>A	uc001fdt.1	-	1	217	c.123C>T	c.(121-123)ATC>ATT	p.I41I	RAB13_uc001fdu.1_Silent_p.I41I	NM_002870	NP_002861	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family	41	Effector region (By similarity).				cell adhesion|protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	cytoplasmic vesicle membrane|tight junction	GTP binding|GTPase activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CGGGCTCACCGATGGTGGAGA	0.552													9	53	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158263419	158263419	+	3'UTR	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158263419A>G	uc001fru.2	+	6					CD1C_uc001frv.2_3'UTR	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor						antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					TCTAATTtggaatgtttttct	0.159													9	13	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158636180	158636180	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158636180C>T	uc001fst.1	-	16	2345	c.2146G>A	c.(2146-2148)GGG>AGG	p.G716R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	716	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGGCCTTTCCCATAATCCTCA	0.537													38	32	---	---	---	---	PASS
PPOX	5498	broad.mit.edu	37	1	161140556	161140556	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161140556C>T	uc001fyj.2	+	11	1535	c.1245C>T	c.(1243-1245)CAC>CAT	p.H415H	PPOX_uc001fyn.2_Silent_p.H123H|PPOX_uc001fyg.2_Silent_p.H415H|PPOX_uc001fyl.2_Silent_p.H381H|PPOX_uc001fym.2_RNA|PPOX_uc001fyk.2_Silent_p.H253H|PPOX_uc001fyh.2_Silent_p.H253H|PPOX_uc010pkg.1_Silent_p.H253H|PPOX_uc009wuc.1_Silent_p.H216H|PPOX_uc010pkh.1_Silent_p.H160H|PPOX_uc001fyi.2_Silent_p.H253H	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	415					heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity			ovary(1)	1	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCCATCTACACAAGGTAAGTT	0.507									Porphyria_Variegata				40	54	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180794388	180794388	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180794388C>T	uc001goi.2	+	9	1234	c.1042C>T	c.(1042-1044)CCA>TCA	p.P348S	XPR1_uc009wxm.2_Missense_Mutation_p.P348S|XPR1_uc009wxn.2_Missense_Mutation_p.P348S	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor	348	Helical; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0						ATATGTGTATCCACTTGCCCT	0.438													222	172	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181767565	181767565	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181767565G>A	uc001gow.2	+	47	6573	c.6408G>A	c.(6406-6408)GCG>GCA	p.A2136A	CACNA1E_uc009wxs.2_Silent_p.A2024A|CACNA1E_uc009wxt.2_Silent_p.A1405A	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2179	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TTCGACACGCGGGCAGCATCT	0.622													103	70	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190250704	190250704	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190250704G>T	uc001gse.1	-	3	645	c.413C>A	c.(412-414)TCT>TAT	p.S138Y	FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	138						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					CAGAGTAGCAGATAGCAAGAA	0.413													18	82	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196654203	196654203	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196654203G>A	uc001gtj.3	+	7	1040	c.800G>A	c.(799-801)TGT>TAT	p.C267Y	CFH_uc001gti.3_Missense_Mutation_p.C267Y|CFH_uc009wyw.2_Missense_Mutation_p.C267Y|CFH_uc009wyx.2_Missense_Mutation_p.C203Y	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	267	Sushi 5.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						GAAAAATCATGTGATAATCCT	0.289													41	41	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202705488	202705488	+	Silent	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202705488G>C	uc001gyf.2	-	21	3233	c.3117C>G	c.(3115-3117)CTC>CTG	p.L1039L	KDM5B_uc009xag.2_Silent_p.L1075L|KDM5B_uc001gyg.1_Silent_p.L881L	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	1039					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CAAGTTCTATGAGTGTGTCTA	0.423													18	79	---	---	---	---	PASS
ADORA1	134	broad.mit.edu	37	1	203134833	203134833	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134833C>A	uc001gze.1	+	4	1219	c.786C>A	c.(784-786)TCC>TCA	p.S262S	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Silent_p.S262S|ADORA1_uc010pqg.1_Silent_p.S194S|ADORA1_uc009xak.1_Missense_Mutation_p.L188M|ADORA1_uc010pqh.1_Silent_p.S295S	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	262	Extracellular (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)	TCTGCCCGTCCTGCCACAAGC	0.567													5	170	---	---	---	---	PASS
CDK18	5129	broad.mit.edu	37	1	205492699	205492699	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205492699C>T	uc001hcr.2	+	3	438	c.219C>T	c.(217-219)CTC>CTT	p.L73L	CDK18_uc009xbk.1_RNA|CDK18_uc009xbl.1_RNA|CDK18_uc010pri.1_Missense_Mutation_p.L94F|CDK18_uc001hcp.2_Silent_p.L73L|CDK18_uc001hcq.2_Silent_p.L73L|CDK18_uc010prj.1_5'UTR|CDK18_uc001hcs.2_5'UTR|CDK18_uc009xbm.1_5'UTR	NM_212503	NP_997668	Q07002	CDK18_HUMAN	PCTAIRE protein kinase 3 isoform a	71							ATP binding|cyclin-dependent protein kinase activity|protein binding|signal transducer activity			stomach(2)	2						CGGGGCAGCTCTCCCCTGGCG	0.672													3	16	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222737530	222737530	+	Intron	SNP	T	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222737530T>G	uc009xdz.1	-						TAF1A_uc009xdy.1_5'UTR|TAF1A_uc001hni.1_Intron|TAF1A_uc001hnj.2_Intron|TAF1A_uc001hnk.2_Intron	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2						regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		AAATTTCAGCTTACTTTCAAA	0.264													3	63	---	---	---	---	PASS
C1orf198	84886	broad.mit.edu	37	1	231004093	231004093	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231004093G>T	uc001hub.2	-	1	210	c.166C>A	c.(166-168)CCC>ACC	p.P56T	C1orf198_uc001huc.1_Intron|C1orf198_uc001hud.1_Missense_Mutation_p.P18T	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	56											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GCCCACTCGGGCCCGTACTTC	0.577													20	33	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235377119	235377119	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235377119G>A	uc001hwq.2	-	17	2304	c.1806C>T	c.(1804-1806)GTC>GTT	p.V602V	ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Silent_p.V283V	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	602					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CCAAGTAAAGGACCTCTCCAC	0.358													33	185	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33614357	33614357	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33614357C>T	uc002ros.2	+	32	4821	c.4821C>T	c.(4819-4821)CCC>CCT	p.P1607P	LTBP1_uc002rot.2_Silent_p.P1281P|LTBP1_uc002rou.2_Silent_p.P1280P|LTBP1_uc002rov.2_Silent_p.P1227P|LTBP1_uc010ymz.1_Silent_p.P1238P|LTBP1_uc010yna.1_Silent_p.P1185P|LTBP1_uc010ynb.1_Silent_p.P504P	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1606					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGCCGATCCCTACTTCATCC	0.443													29	83	---	---	---	---	PASS
SLC4A5	57835	broad.mit.edu	37	2	74481774	74481774	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74481774C>T	uc002sko.1	-	9	1087	c.1085G>A	c.(1084-1086)CGT>CAT	p.R362H	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.R362H|SLC4A5_uc010ffc.1_Missense_Mutation_p.R362H|SLC4A5_uc002skp.1_Missense_Mutation_p.R298H|SLC4A5_uc002sks.1_Missense_Mutation_p.R362H	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	362	Cytoplasmic (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						TGCAATGGCACGGCCAATTTC	0.363													71	322	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90121946	90121946	+	RNA	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90121946T>C	uc010fhm.2	+	16		c.1815T>C								Parts of antibodies, mostly variable regions.																		AGCAATTATTTAGCCTGGTTT	0.512													123	1	---	---	---	---	PASS
PLEKHB2	55041	broad.mit.edu	37	2	131904340	131904340	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131904340C>T	uc002tsg.3	+	8	1223	c.663C>T	c.(661-663)GTC>GTT	p.V221V	PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Silent_p.V220V|PLEKHB2_uc002tsf.3_Silent_p.V229V|PLEKHB2_uc010zao.1_Silent_p.V171V|PLEKHB2_uc010zap.1_3'UTR|PLEKHB2_uc010zaq.1_3'UTR|PLEKHB2_uc002tsi.3_Silent_p.V262V	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B	221						membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		TATTTTGGGTCTTCTAGGGGC	0.488													51	84	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167263124	167263124	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167263124G>C	uc002udu.1	-	25	4142	c.4015C>G	c.(4015-4017)CTT>GTT	p.L1339V		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1339					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						GGAGGCACAAGGTAGGATCCT	0.423													39	2	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802171	185802171	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802171C>T	uc002uph.2	+	4	2642	c.2048C>T	c.(2047-2049)ACT>ATT	p.T683I		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	683						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GAATACAACACTTATGATACT	0.303													36	1	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187455218	187455218	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187455218C>T	uc002upq.2	+	1	429	c.153C>T	c.(151-153)TTC>TTT	p.F51F	ITGAV_uc010frs.2_Silent_p.F51F	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	51	FG-GAP 1.|Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		ACTTCGGCTTCGCCGTGGATT	0.637													19	25	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189950444	189950444	+	Splice_Site	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189950444C>T	uc002uqk.2	-	10	1019	c.744_splice	c.e10+1	p.M248_splice	COL5A2_uc010frx.2_Intron	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TTGACATTTACCATTGGTCCA	0.403													23	22	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197080609	197080609	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197080609C>A	uc002utm.1	-	28	4770	c.4587G>T	c.(4585-4587)GGG>GGT	p.G1529G	HECW2_uc002utl.1_Silent_p.G1173G	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	1529	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CAGTGATTTTCCCCCATTTCT	0.388													11	23	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198949278	198949278	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949278C>T	uc010fsp.2	+	2	1328	c.1037C>T	c.(1036-1038)ACC>ATC	p.T346I	PLCL1_uc002uuv.3_Missense_Mutation_p.T267I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	346					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CAAGGAGTCACCCATATCACC	0.393													63	4	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220344839	220344839	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220344839C>T	uc010fwg.2	+	25	5319	c.5319C>T	c.(5317-5319)CCC>CCT	p.P1773P		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1773	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ATCAGAGCCCCGTGTCTGGAG	0.617													32	39	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241420353	241420353	+	Splice_Site	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241420353C>T	uc002vyz.1	-	16	3008	c.2779_splice	c.e16+1	p.V927_splice	ANKMY1_uc002vza.1_Splice_Site_p.V703_splice|ANKMY1_uc010fzd.1_Splice_Site_p.V1016_splice|ANKMY1_uc002vzb.1_Splice_Site_p.V688_splice|ANKMY1_uc002vzc.1_Splice_Site_p.V706_splice|ANKMY1_uc002vzd.1_Splice_Site_p.V750_splice	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGCCGACCTACCGATGGCCAC	0.642													39	47	---	---	---	---	PASS
CPNE9	151835	broad.mit.edu	37	3	9768403	9768403	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9768403G>C	uc003bsd.2	+	18	1570	c.1399G>C	c.(1399-1401)GAG>CAG	p.E467Q		NM_153635	NP_705899	Q8IYJ1	CPNE9_HUMAN	copine-like protein	467	VWFA.									ovary(2)	2	Medulloblastoma(99;0.227)					AGCCATGTTTGAGGGTGAGTA	0.542													22	58	---	---	---	---	PASS
NEK10	152110	broad.mit.edu	37	3	27161293	27161293	+	Missense_Mutation	SNP	G	A	A	rs147586444		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27161293G>A	uc010hfk.2	-	14	1484	c.1255C>T	c.(1255-1257)CGT>TGT	p.R419C	NEK10_uc010hfj.2_Missense_Mutation_p.R362C			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;	1107							ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						CCGGATGAACGATGTAATAAA	0.393													30	53	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	55052286	55052286	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55052286G>A	uc003dhf.2	+	35	2977	c.2929G>A	c.(2929-2931)GTC>ATC	p.V977I	CACNA2D3_uc003dhg.1_Missense_Mutation_p.V883I|CACNA2D3_uc003dhh.1_RNA	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	977	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TCCAGCATTCGTCTCTGAGCG	0.488													10	19	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93605209	93605209	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93605209G>A	uc003drb.3	-	11	1635	c.1294C>T	c.(1294-1296)CGG>TGG	p.R432W	PROS1_uc010hoo.2_Missense_Mutation_p.R301W|PROS1_uc003dqz.3_Missense_Mutation_p.R301W	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	432	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TCCACTTTCCGAGGGAATCCT	0.378													98	62	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806804	97806804	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806804G>A	uc011bgs.1	+	1	788	c.788G>A	c.(787-789)CGT>CAT	p.R263H		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATGTATGTGCGTCCTGCATCT	0.428													12	46	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109031405	109031405	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109031405C>T	uc003dxo.2	-	3	415	c.168G>A	c.(166-168)AAG>AAA	p.K56K		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	56						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						GATTGTATTTCTTAGGCTTCT	0.418													46	113	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113374183	113374183	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113374183G>C	uc003eam.2	-	7	6757	c.6346C>G	c.(6346-6348)CCT>GCT	p.P2116A	KIAA2018_uc003eal.2_Missense_Mutation_p.P2060A	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	2116					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						GGATGAGCAGGAGAGTATGGA	0.448													27	67	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122277249	122277249	+	Silent	SNP	C	T	T	rs59755035		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122277249C>T	uc010hri.2	-	3	226	c.81G>A	c.(79-81)CAG>CAA	p.Q27Q	PARP9_uc003eff.3_Intron|PARP9_uc011bjs.1_Intron|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Intron|PARP9_uc003efh.2_Silent_p.Q27Q|PARP9_uc003efj.2_Intron	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	27					cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		CAAAGACTTTCTGAAACAAGA	0.463													24	62	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132407701	132407701	+	Missense_Mutation	SNP	C	T	T	rs119456963		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132407701C>T	uc003epe.1	-	21	2995	c.2918G>A	c.(2917-2919)CGA>CAA	p.R973Q	NPHP3_uc003epd.1_Missense_Mutation_p.R215Q	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	973	TPR 4.		R -> Q (in RHPD).		maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						AGCTGTTTCTCGAATCTCTAA	0.473													33	70	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142183957	142183957	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142183957G>C	uc003eux.3	-	41	7145	c.7023C>G	c.(7021-7023)TTC>TTG	p.F2341L	ATR_uc003euy.1_Missense_Mutation_p.F227L	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2341	PI3K/PI4K.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TCAAGGAATTGAATTCCATTA	0.274								Other_conserved_DNA_damage_response_genes					26	13	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173322753	173322753	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173322753T>C	uc003fio.1	+	3	788	c.365T>C	c.(364-366)ATT>ACT	p.I122T	NLGN1_uc010hww.1_Missense_Mutation_p.I122T|NLGN1_uc003fip.1_Missense_Mutation_p.I122T	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	122	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CAGAATATCATTGATGGCAGA	0.463													74	41	---	---	---	---	PASS
C4orf50	389197	broad.mit.edu	37	4	5966859	5966859	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5966859G>A	uc003git.1	-	6	561	c.471C>T	c.(469-471)CTC>CTT	p.L157L		NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197	157										pancreas(2)|breast(1)	3						CAGGATTCAAGAGGTATGTCT	0.502													16	35	---	---	---	---	PASS
TBC1D1	23216	broad.mit.edu	37	4	38051323	38051323	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38051323G>A	uc003gtb.2	+	11	2057	c.1714G>A	c.(1714-1716)GAC>AAC	p.D572N	TBC1D1_uc011byd.1_Missense_Mutation_p.D572N|TBC1D1_uc010ifd.2_Missense_Mutation_p.D319N|TBC1D1_uc011byf.1_Missense_Mutation_p.D443N	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,	572						nucleus	Rab GTPase activator activity			ovary(1)	1						CCTGTCCAGTGACTCGGAGAG	0.592													46	93	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66467438	66467438	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66467438G>A	uc003hcy.2	-	3	1024	c.831C>T	c.(829-831)AGC>AGT	p.S277S	EPHA5_uc003hcx.2_Silent_p.S208S|EPHA5_uc003hcz.2_Silent_p.S277S|EPHA5_uc011cah.1_Silent_p.S277S|EPHA5_uc011cai.1_Silent_p.S277S|EPHA5_uc003hda.2_Silent_p.S277S	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	277	Extracellular (Potential).|Cys-rich.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						CCCCTTCGGCGCTGCAGTGCA	0.522										TSP Lung(17;0.13)			15	44	---	---	---	---	PASS
FAM175A	84142	broad.mit.edu	37	4	84406257	84406257	+	5'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84406257G>A	uc003hou.2	-	1					FAM175A_uc003hov.2_5'UTR	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98						chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						ACAAGAGGACGAGGGCGGGGC	0.736													4	10	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123171629	123171629	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123171629C>T	uc003ieh.2	+	35	5868	c.5823C>T	c.(5821-5823)ACC>ACT	p.T1941T	KIAA1109_uc003iek.2_Silent_p.T560T	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1941					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ATTCTCCAACCGGCAGTGGCT	0.418													39	59	---	---	---	---	PASS
SPATA5	166378	broad.mit.edu	37	4	124235238	124235238	+	3'UTR	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124235238G>T	uc003iez.3	+	16						NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						ATATATTCAAGATGCTGAAAA	0.308													13	8	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126336818	126336818	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126336818C>T	uc003ifj.3	+	5	6700	c.6700C>T	c.(6700-6702)CGA>TGA	p.R2234*	FAT4_uc011cgp.1_Nonsense_Mutation_p.R532*	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2234	Cadherin 21.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GGCAACAGATCGAGGCAGCAC	0.438													42	78	---	---	---	---	PASS
LARP1B	55132	broad.mit.edu	37	4	128996104	128996104	+	5'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128996104G>C	uc003iga.2	+	3					LARP1B_uc003ifw.1_5'UTR|LARP1B_uc003ifx.2_5'UTR|LARP1B_uc003ify.2_5'UTR|LARP1B_uc003ifz.1_5'UTR	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2								RNA binding				0						TGATTTCAGTGATATGGAGAA	0.294													16	46	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183721343	183721343	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183721343G>A	uc003ivd.1	+	27	7976	c.7939G>A	c.(7939-7941)GCG>ACG	p.A2647T		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	2647	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CGAGGAGGGCGCGCGCCTCTG	0.741													9	2	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1221323	1221323	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1221323C>T	uc003jbw.3	+	11	1652	c.1596C>T	c.(1594-1596)GTC>GTT	p.V532V		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	532	Helical; Name=11; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TCTGGCAAGTCACGTGGCGCG	0.562													12	35	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13737394	13737394	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13737394G>A	uc003jfd.2	-	66	11464	c.11422C>T	c.(11422-11424)CAA>TAA	p.Q3808*	DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3808	Potential.				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAGTTAATTTGAACTTCTGTC	0.423									Kartagener_syndrome				45	154	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13776655	13776655	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13776655G>A	uc003jfd.2	-	55	9308	c.9266C>T	c.(9265-9267)TCG>TTG	p.S3089L		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3089	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CCCCACTGGCGAGAAGCAGAG	0.478									Kartagener_syndrome				23	67	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13913952	13913952	+	Missense_Mutation	SNP	C	T	T	rs150601733		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13913952C>T	uc003jfd.2	-	11	1478	c.1436G>A	c.(1435-1437)CGC>CAC	p.R479H	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	479	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTTGGCAAGGCGTCGGTGAAA	0.368									Kartagener_syndrome				42	40	---	---	---	---	PASS
FBXL7	23194	broad.mit.edu	37	5	15936774	15936774	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15936774C>T	uc003jfn.1	+	4	1436	c.955C>T	c.(955-957)CTG>TTG	p.L319L		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	319	LRR 6.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						CCTGCGCTACCTGGTGATCTA	0.672													17	16	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19839170	19839170	+	5'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19839170G>C	uc003jgc.2	-	2					CDH18_uc003jgd.2_5'UTR|CDH18_uc011cnm.1_5'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GCATTCAAGAGAGAAGCCAGA	0.383													7	4	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078733	22078733	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078733C>T	uc010iuc.2	-	2	511	c.53G>A	c.(52-54)GGT>GAT	p.G18D	CDH12_uc011cno.1_Missense_Mutation_p.G18D|CDH12_uc003jgk.2_Missense_Mutation_p.G18D	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	18					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TGTTAGGAGACCTCCATCAAA	0.453										HNSCC(59;0.17)			53	140	---	---	---	---	PASS
MAP3K1	4214	broad.mit.edu	37	5	56177956	56177956	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56177956C>T	uc003jqw.3	+	14	3430	c.2929C>T	c.(2929-2931)CAA>TAA	p.Q977*		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	977					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TCATCATTCCCAATTAATGTT	0.413													44	34	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96508967	96508967	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96508967C>T	uc003kmz.2	-	5	609	c.499G>A	c.(499-501)GCA>ACA	p.A167T	RIOK2_uc003kna.3_Missense_Mutation_p.A167T	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	167							ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TCATACAATGCCTAAAATGTT	0.333													12	26	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	124080631	124080631	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124080631C>T	uc003ktq.1	-	1	175	c.52G>A	c.(52-54)GAT>AAT	p.D18N	ZNF608_uc003ktr.1_RNA|ZNF608_uc003kts.1_Missense_Mutation_p.D18N|ZNF608_uc003ktt.1_Missense_Mutation_p.D18N	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	18						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TCATAAGTATCAACTGTATTT	0.383													30	69	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140307955	140307955	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140307955C>T	uc003lih.2	+	1	1654	c.1478C>T	c.(1477-1479)TCA>TTA	p.S493L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.S493L	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	493	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGGGCCATCAGCCTCTAGC	0.537													81	42	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161119111	161119111	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161119111C>T	uc003lyu.2	+	8	1329	c.991C>T	c.(991-993)CAG>TAG	p.Q331*	GABRA6_uc003lyv.2_Nonsense_Mutation_p.Q102*	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	331	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TACCAATCTTCAGACACAGAA	0.453										TCGA Ovarian(5;0.080)			62	45	---	---	---	---	PASS
LCP2	3937	broad.mit.edu	37	5	169694131	169694131	+	Intron	SNP	C	A	A	rs150173582	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169694131C>A	uc003man.1	-						LCP2_uc011des.1_5'UTR|LCP2_uc011det.1_Intron|LCP2_uc010jjo.1_Intron	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		cagcaagagccggcactccca	0.204													17	23	---	---	---	---	PASS
LCP2	3937	broad.mit.edu	37	5	169694132	169694132	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169694132G>A	uc003man.1	-						LCP2_uc011des.1_5'UTR|LCP2_uc011det.1_Intron|LCP2_uc010jjo.1_Intron	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		agcaagagccggcactcccaa	0.204													17	22	---	---	---	---	PASS
LCP2	3937	broad.mit.edu	37	5	169694182	169694182	+	Intron	SNP	T	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169694182T>A	uc003man.1	-						LCP2_uc011des.1_5'UTR|LCP2_uc011det.1_Intron|LCP2_uc010jjo.1_Intron	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		atcttcatgttctgcctacaa	0.050													4	12	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32021483	32021483	+	Splice_Site	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32021483C>T	uc003nzl.2	-	25	8670	c.8468_splice	c.e25-1	p.E2823_splice		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor						actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GCTTCATCCTCTGGAGCTGGA	0.587													14	42	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32095973	32095973	+	Silent	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32095973C>G	uc003nzn.2	-	1	45	c.12G>C	c.(10-12)CTG>CTC	p.L4L	ATF6B_uc003nzo.2_Silent_p.L4L|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_Silent_p.L4L	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	4	Cytoplasmic (Potential).|Transcription activation.				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGAGCAGCATCAGCTCCGCCA	0.607													51	30	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32947663	32947663	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32947663G>T	uc003ocn.3	+	11	3601	c.1900G>T	c.(1900-1902)GAG>TAG	p.E634*	BRD2_uc003ocq.3_Nonsense_Mutation_p.E634*|BRD2_uc003ocp.3_Nonsense_Mutation_p.E514*|BRD2_uc010juh.2_Nonsense_Mutation_p.E669*	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	634	Poly-Glu.				spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						TTATGATTCAGAGGAGGAGGA	0.522													10	40	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34008001	34008001	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34008001G>A	uc003oir.3	-	7	1630	c.1460C>T	c.(1459-1461)GCC>GTC	p.A487V	GRM4_uc011dsn.1_Missense_Mutation_p.A440V|GRM4_uc010jvh.2_Missense_Mutation_p.A487V|GRM4_uc010jvi.2_Missense_Mutation_p.A179V|GRM4_uc003oio.2_Missense_Mutation_p.A179V|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.A347V|GRM4_uc003oiq.2_Missense_Mutation_p.A354V|GRM4_uc011dsm.1_Missense_Mutation_p.A318V	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	487	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CTTGTACTCGGCAGAATCGTT	0.567													5	172	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87971008	87971008	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87971008C>T	uc003plm.3	+	8	7702	c.7661C>T	c.(7660-7662)TCA>TTA	p.S2554L		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2554					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAACCAGCATCAGCAGCTGAG	0.373													14	19	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100841696	100841696	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100841696C>T	uc003pqj.3	-	10	1444	c.1237G>A	c.(1237-1239)GAC>AAC	p.D413N	SIM1_uc010kcu.2_Missense_Mutation_p.D413N	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	413	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GAGGCCGTGTCGGTCAAGGGA	0.572													37	21	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102069950	102069950	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102069950A>G	uc003pqp.3	+	2	491	c.242A>G	c.(241-243)CAG>CGG	p.Q81R	GRIK2_uc003pqn.2_Missense_Mutation_p.Q81R|GRIK2_uc003pqo.3_Missense_Mutation_p.Q81R|GRIK2_uc010kcw.2_Missense_Mutation_p.Q81R	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	81	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TATGATACCCAGAAGATAAAC	0.358													55	39	---	---	---	---	PASS
SESN1	27244	broad.mit.edu	37	6	109309805	109309805	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109309805C>G	uc003pst.3	-	9	1425	c.1333G>C	c.(1333-1335)GAA>CAA	p.E445Q	SESN1_uc003psu.2_Missense_Mutation_p.E504Q	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1	445					cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		GTAACCTTTTCAGGAGTGCAA	0.353													27	15	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128134483	128134483	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128134483C>T	uc003qbi.2	-	5	1622	c.1303G>A	c.(1303-1305)GTA>ATA	p.V435I	THEMIS_uc010kfa.2_Missense_Mutation_p.V338I|THEMIS_uc011ebt.1_Missense_Mutation_p.V435I|THEMIS_uc010kfb.2_Missense_Mutation_p.V400I	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	435	CABIT 2.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						ATCACCTCTACAAAACCTCCT	0.433													22	54	---	---	---	---	PASS
KATNA1	11104	broad.mit.edu	37	6	149922846	149922846	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149922846G>C	uc003qmr.1	-	6	817	c.772C>G	c.(772-774)CTT>GTT	p.L258V	KATNA1_uc003qms.2_Missense_Mutation_p.L258V|KATNA1_uc003qmt.2_Missense_Mutation_p.L182V|KATNA1_uc011eed.1_Missense_Mutation_p.L182V	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	258					cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		GCTTTAGCAAGGAGCGTCTTC	0.443													27	49	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152748941	152748941	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152748941C>T	uc010kiw.2	-	38	5589	c.4987G>A	c.(4987-4989)GAA>AAA	p.E1663K	SYNE1_uc003qot.3_Missense_Mutation_p.E1670K|SYNE1_uc003qou.3_Missense_Mutation_p.E1663K|SYNE1_uc010kjb.1_Missense_Mutation_p.E1646K|SYNE1_uc003qow.2_Missense_Mutation_p.E958K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1663	Spectrin 2.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGATAGTTCTTTCTCTAGC	0.418										HNSCC(10;0.0054)			28	54	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170594690	170594690	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170594690G>A	uc003qxm.2	-	6	1299	c.829C>T	c.(829-831)CAG>TAG	p.Q277*		NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	277	Extracellular (Potential).|EGF-like 2.				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CAGCCTTCCTGGCAGTTGCAC	0.627													32	54	---	---	---	---	PASS
C1GALT1	56913	broad.mit.edu	37	7	7278181	7278181	+	Silent	SNP	G	A	A	rs138478625		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7278181G>A	uc010ktn.2	+	3	739	c.516G>A	c.(514-516)ACG>ACA	p.T172T	C1GALT1_uc003sra.2_Silent_p.T172T|C1GALT1_uc010kto.1_Silent_p.T172T	NM_020156	NP_064541	Q9NS00	C1GLT_HUMAN	core 1 synthase,	172	Lumenal (Potential).				angiogenesis|cell differentiation|kidney development	integral to membrane	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity|metal ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		ATGATGACACGTATGTCATAC	0.363													37	56	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24932082	24932082	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24932082C>T	uc003sxf.2	-	2	415	c.10G>A	c.(10-12)GAT>AAT	p.D4N	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Missense_Mutation_p.D4N|OSBPL3_uc003sxh.2_Missense_Mutation_p.D4N|OSBPL3_uc003sxi.2_Missense_Mutation_p.D4N	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	4					lipid transport		lipid binding|protein binding			skin(1)	1						TTCTTCTCATCACTCATCATG	0.478													21	27	---	---	---	---	PASS
TXNDC3	51314	broad.mit.edu	37	7	37901704	37901704	+	Silent	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37901704T>C	uc003tfn.2	+	7	717	c.345T>C	c.(343-345)GAT>GAC	p.D115D		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	115	Thioredoxin.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						ATTTGATCGATGAGGAGAGAA	0.358									Kartagener_syndrome				12	21	---	---	---	---	PASS
ZNF273	10793	broad.mit.edu	37	7	64389174	64389174	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64389174G>A	uc003tto.2	+	4	1544	c.1468G>A	c.(1468-1470)GAA>AAA	p.E490K	ZNF273_uc003ttl.2_Missense_Mutation_p.E425K|ZNF273_uc003ttn.2_Missense_Mutation_p.E425K	NM_021148	NP_066971	Q14593	ZN273_HUMAN	zinc finger protein 273	490	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CAAATGCAATGAATGTGGTAA	0.393													25	54	---	---	---	---	PASS
LOC493754	493754	broad.mit.edu	37	7	66018679	66018679	+	Intron	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66018679T>C	uc010lac.1	-						LOC493754_uc010lad.2_Intron|LOC493754_uc011kdx.1_Intron|LOC493754_uc011kdy.1_RNA|LOC493754_uc011kdz.1_RNA|LOC493754_uc011kea.1_RNA|LOC493754_uc003tvc.3_RNA|LOC493754_uc011keb.1_RNA|LOC493754_uc011kec.1_RNA					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0						CTTTGGTAGATTTCAGTGTAG	0.284													10	18	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66479465	66479465	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66479465C>T	uc003tvn.2	+	5	636	c.487C>T	c.(487-489)CGA>TGA	p.R163*	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	163	Flavodoxin-like.				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				CATTGATTTTCGATTTGGCAA	0.438													53	117	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72865289	72865289	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72865289G>A	uc003tyc.2	-	14	3813	c.3468C>T	c.(3466-3468)ATC>ATT	p.I1156I		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1156					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				GAGCTTCCCGGATTGCTGTCT	0.483													31	51	---	---	---	---	PASS
PTPN12	5782	broad.mit.edu	37	7	77265144	77265144	+	Missense_Mutation	SNP	G	A	A	rs144099562	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77265144G>A	uc003ugh.2	+	15	2211	c.2120G>A	c.(2119-2121)CGA>CAA	p.R707Q	PTPN12_uc011kgp.1_Missense_Mutation_p.R588Q|PTPN12_uc011kgq.1_Missense_Mutation_p.R577Q|PTPN12_uc010lds.2_Missense_Mutation_p.R439Q	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	707						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						AGTCAGGAACGATCTGAACAA	0.313													16	11	---	---	---	---	PASS
ZNF394	84124	broad.mit.edu	37	7	99097605	99097605	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097605G>A	uc003uqs.2	-	1	273	c.112C>T	c.(112-114)CCC>TCC	p.P38S	ZNF394_uc003uqt.2_5'UTR|ZNF394_uc003uqu.1_Missense_Mutation_p.P38S	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394	38					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					ACTTTCACGGGCAAAAGTCCG	0.652													4	94	---	---	---	---	PASS
C7orf43	55262	broad.mit.edu	37	7	99752533	99752533	+	3'UTR	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99752533C>T	uc003utr.2	-	11					C7orf43_uc010lgo.2_3'UTR|C7orf43_uc010lgp.2_3'UTR|C7orf43_uc011kjj.1_3'UTR|C7orf43_uc003uts.2_3'UTR	NM_018275	NP_060745	Q8WVR3	CG043_HUMAN	hypothetical protein LOC55262												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTTCACCCCCGTCTGGGAGG	0.647													15	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100550224	100550224	+	5'Flank	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100550224G>A	uc003uxk.1	+						uc003uxl.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		CACAAATACAGTGACTTCTAT	0.478													62	69	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150696094	150696094	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150696094C>T	uc003wif.2	+	8	1173	c.877C>T	c.(877-879)CTG>TTG	p.L293L	NOS3_uc011kuy.1_Silent_p.L87L|NOS3_uc011kuz.1_Silent_p.L293L|NOS3_uc011kva.1_Silent_p.L293L|NOS3_uc011kvb.1_Silent_p.L293L	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	293	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	GCCCCTGCTGCTGCAGGCCCC	0.652													72	135	---	---	---	---	PASS
CDK5	1020	broad.mit.edu	37	7	150754194	150754194	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150754194C>T	uc003wir.1	-	2	152	c.91G>A	c.(91-93)GCT>ACT	p.A31T	CDK5_uc003wis.1_Missense_Mutation_p.A31T|SLC4A2_uc003wit.3_5'Flank	NM_004935	NP_004926	Q00535	CDK5_HUMAN	cyclin-dependent kinase 5 isoform 1	31	Protein kinase.				activation of pro-apoptotic gene products|blood coagulation|cell division|cell proliferation|embryo development|negative regulation of transcription, DNA-dependent|positive regulation of neuron apoptosis	axon|cytosol|dendrite|growth cone|lamellipodium|membrane|neuromuscular junction|neuronal cell body	acetylcholine receptor activator activity|ATP binding|cyclin-dependent protein kinase activity|ErbB-2 class receptor binding|ErbB-3 class receptor binding|tau-protein kinase activity			lung(1)|central_nervous_system(1)	2		Breast(660;0.159)|Ovarian(593;0.182)	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)		CGTTTCAGAGCCACGATCTCA	0.602													68	183	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962186	151962186	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962186G>T	uc003wla.2	-	8	1340	c.1121C>A	c.(1120-1122)GCG>GAG	p.A374E		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	374	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TGGAGTAACCGCTATATCCAG	0.453			N		medulloblastoma								17	481	---	---	---	---	PASS
RNF32	140545	broad.mit.edu	37	7	156447438	156447438	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156447438G>A	uc003wmo.2	+						RNF32_uc010lql.1_Intron|RNF32_uc010lqm.2_Intron|RNF32_uc003wmp.2_3'UTR|RNF32_uc003wmq.2_Intron|RNF32_uc003wmr.2_Intron|RNF32_uc003wms.2_Intron|RNF32_uc003wmu.2_Intron|RNF32_uc003wmt.2_Intron	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GGGTGAGCTAGAGAGCTCCTG	0.542													27	42	---	---	---	---	PASS
LMBR1	64327	broad.mit.edu	37	7	156476760	156476760	+	3'UTR	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156476760C>A	uc003wmw.3	-	17					LMBR1_uc003wmv.3_3'UTR|LMBR1_uc003wmx.3_3'UTR|LMBR1_uc010lqn.2_3'UTR|LMBR1_uc011kvx.1_3'UTR	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		CAGAAGACGCCGTCTGTGCGT	0.488													4	238	---	---	---	---	PASS
XPO7	23039	broad.mit.edu	37	8	21827081	21827081	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21827081G>A	uc003xaa.3	+	3	355	c.253G>A	c.(253-255)GAT>AAT	p.D85N	XPO7_uc010lti.2_Missense_Mutation_p.D85N|XPO7_uc010ltj.1_RNA|XPO7_uc010ltk.2_Missense_Mutation_p.D86N	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	85	Importin N-terminal.				mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		ACAGCGAATAGATATTCGTAA	0.393													8	8	---	---	---	---	PASS
SLC25A37	51312	broad.mit.edu	37	8	23429029	23429029	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23429029C>T	uc003xdo.2	+	4	831	c.678C>T	c.(676-678)GTC>GTT	p.V226V	SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_RNA|SLC25A37_uc003xdr.1_RNA|uc003xds.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	226					ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		AGGAGCAGGTCAACCCCCACC	0.642													18	22	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61654942	61654942	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61654942C>G	uc003xue.2	+	2	1428	c.951C>G	c.(949-951)AAC>AAG	p.N317K		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	317					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTTACAGTAACCTAAATCAGG	0.418													28	124	---	---	---	---	PASS
CNBD1	168975	broad.mit.edu	37	8	88249313	88249313	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88249313G>T	uc003ydy.2	+	6	792	c.744G>T	c.(742-744)GAG>GAT	p.E248D		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	248										ovary(3)	3						CACTTGCTGAGATGTACCTAC	0.378													37	30	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101078406	101078406	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101078406G>T	uc003yjb.1	-	7	908	c.713C>A	c.(712-714)TCA>TAA	p.S238*	RGS22_uc003yja.1_Nonsense_Mutation_p.S57*|RGS22_uc003yjc.1_Nonsense_Mutation_p.S226*|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	238					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGAAACAGATGAAATAGCTGG	0.343													13	78	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110980444	110980444	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110980444G>T	uc003ynr.3	-	3	1718	c.1376C>A	c.(1375-1377)GCC>GAC	p.A459D	KCNV1_uc010mcw.2_Missense_Mutation_p.A459D	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	459	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TGAGTCAGTGGCTATATTCTT	0.443													16	70	---	---	---	---	PASS
FAM84B	157638	broad.mit.edu	37	8	127569399	127569399	+	Missense_Mutation	SNP	T	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127569399T>G	uc003yrz.1	-	2	520	c.236A>C	c.(235-237)CAC>CCC	p.H79P		NM_174911	NP_777571	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	79						cytoplasm|plasma membrane	protein binding				0	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			TTCCACCTCGTGCAGCCGCGG	0.716													12	16	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18753463	18753463	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18753463G>A	uc003zne.3	+	16	2301	c.2174G>A	c.(2173-2175)CGC>CAC	p.R725H		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	725	TSP type-1 6.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		GCTTGTAACCGCTTTAATTGC	0.512													6	33	---	---	---	---	PASS
KLF9	687	broad.mit.edu	37	9	73002701	73002701	+	Silent	SNP	G	A	A	rs140753874	byFrequency	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73002701G>A	uc004aht.2	-	2	2020	c.726C>T	c.(724-726)AAC>AAT	p.N242N		NM_001206	NP_001197	Q13886	KLF9_HUMAN	Kruppel-like factor 9	242					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTCACAAAGCGTTGGCCAGCG	0.582													26	67	---	---	---	---	PASS
TMEM2	23670	broad.mit.edu	37	9	74324386	74324386	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74324386G>A	uc011lsa.1	-	17	3314	c.2774C>T	c.(2773-2775)TCT>TTT	p.S925F	TMEM2_uc010mos.2_Missense_Mutation_p.S862F|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	925						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GACATTCAGAGAGACCTGACC	0.453													30	42	---	---	---	---	PASS
GNA14	9630	broad.mit.edu	37	9	80038789	80038789	+	3'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80038789G>C	uc004aku.2	-	7						NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						GACATCCTTAGTTCCTGGCAT	0.443													7	12	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116812345	116812345	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116812345G>A	uc004bid.2	+	15	2862	c.2763G>A	c.(2761-2763)GGG>GGA	p.G921G	ZNF618_uc004bic.2_Silent_p.G828G|ZNF618_uc011lxi.1_Silent_p.G888G|ZNF618_uc011lxj.1_Silent_p.G889G|ZNF618_uc010mvb.2_Silent_p.G511G	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	921					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCAGAAGCGGGTGTGTAAATA	0.507													30	75	---	---	---	---	PASS
ANGPTL2	23452	broad.mit.edu	37	9	129854112	129854112	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129854112G>A	uc004bqr.1	-	4	1619	c.1119C>T	c.(1117-1119)TCC>TCT	p.S373S	RALGPS1_uc004bqo.1_Intron|RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron|ANGPTL2_uc010mxg.1_Silent_p.S71S	NM_012098	NP_036230	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2 precursor	373	Fibrinogen C-terminal.				multicellular organismal development|signal transduction	extracellular space	receptor binding				0						CTTTGCGGCCGGACCAGTCCT	0.552													5	317	---	---	---	---	PASS
ENG	2022	broad.mit.edu	37	9	130579405	130579405	+	Intron	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130579405C>T	uc004bsj.3	-						ENG_uc011mam.1_Intron|ENG_uc004bsk.3_Intron|uc004bsl.1_RNA	NM_001114753	NP_001108225	P17813	EGLN_HUMAN	endoglin isoform 1 precursor						artery morphogenesis|BMP signaling pathway|cell adhesion|cell chemotaxis|central nervous system vasculogenesis|chronological cell aging|detection of hypoxia|extracellular matrix disassembly|heart looping|negative regulation of endothelial cell proliferation|negative regulation of nitric-oxide synthase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of protein autophosphorylation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|patterning of blood vessels|positive regulation of BMP signaling pathway|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of systemic arterial blood pressure|positive regulation of transcription from RNA polymerase II promoter|regulation of cell adhesion|regulation of cell proliferation|regulation of transcription, DNA-dependent|regulation of transforming growth factor beta receptor signaling pathway|smooth muscle tissue development|transforming growth factor beta receptor signaling pathway|venous blood vessel morphogenesis|wound healing	cell surface|external side of plasma membrane|extracellular space|membrane fraction	activin binding|galactose binding|glycosaminoglycan binding|protein homodimerization activity|transforming growth factor beta binding|transforming growth factor beta receptor activity|transforming growth factor beta receptor, cytoplasmic mediator activity|transmembrane receptor activity|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding				0						AGAACAAACCCGAGAGACCTG	0.577									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				7	26	---	---	---	---	PASS
FUBP3	8939	broad.mit.edu	37	9	133455140	133455140	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133455140C>T	uc004bzr.1	+	1	181	c.73C>T	c.(73-75)CGG>TGG	p.R25W	LOC100272217_uc011mby.1_5'Flank|FUBP3_uc004bzq.1_RNA|FUBP3_uc010mzd.1_5'UTR|FUBP3_uc004bzs.1_5'UTR	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	25					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		TGCCCTGCACCGGGTCCGGCA	0.642													2	1	---	---	---	---	PASS
ADAMTSL2	9719	broad.mit.edu	37	9	136402526	136402526	+	Splice_Site	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136402526G>A	uc011mdl.1	+	3	648	c.91_splice	c.e3-1	p.D31_splice	ADAMTSL2_uc004cei.2_Splice_Site_p.D31_splice	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN	ADAMTS-like 2 precursor						negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CTCTCACCCAGGACAACAGCC	0.667													41	78	---	---	---	---	PASS
LCN9	392399	broad.mit.edu	37	9	138555250	138555250	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138555250A>G	uc004cgk.1	+	1	83	c.83A>G	c.(82-84)TAC>TGC	p.Y28C		NM_001001676	NP_001001676	Q8WX39	LCN9_HUMAN	lipocalin 9	28						extracellular region	pheromone binding|transporter activity			large_intestine(2)	2		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		CAGAGGAACTACAACGTGGCC	0.627													26	32	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139903823	139903823	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139903823G>A	uc011mem.1	-	44	6971	c.6823C>T	c.(6823-6825)CGG>TGG	p.R2275W	ABCA2_uc011mel.1_Missense_Mutation_p.R2276W|ABCA2_uc004ckl.1_Missense_Mutation_p.R2206W|ABCA2_uc004ckm.1_Missense_Mutation_p.R2306W	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	2275	ABC transporter 2.				cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ccGGCTCACCGGTTCTTCAGG	0.363													7	13	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140901335	140901335	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140901335C>A	uc004cog.2	+	16	2236	c.2091C>A	c.(2089-2091)AAC>AAA	p.N697K	CACNA1B_uc011mfd.1_Missense_Mutation_p.N228K	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	697	Helical; Name=S6 of repeat II; (Potential).|II.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TGTTCGGAAACTGTATCCTTC	0.572													12	13	---	---	---	---	PASS
GDI2	2665	broad.mit.edu	37	10	5827911	5827911	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5827911T>C	uc001iil.3	-	5	782	c.491A>G	c.(490-492)AAG>AGG	p.K164R	GDI2_uc001iim.3_Missense_Mutation_p.K119R|GDI2_uc009xid.2_Missense_Mutation_p.K168R	NM_001494	NP_001485	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2 isoform 1	164					protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity				0						TGTGGTCTTCTTAGGATCAAT	0.373													91	132	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27389293	27389293	+	5'UTR	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27389293C>G	uc001ith.2	-	1					ANKRD26_uc009xku.1_5'UTR	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						CCTCATGTCTCTCTCGGCTCT	0.612													12	46	---	---	---	---	PASS
ZNF248	57209	broad.mit.edu	37	10	38121959	38121959	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38121959G>A	uc001izd.1	-	6	823	c.324C>T	c.(322-324)AAC>AAT	p.N108N	ZNF248_uc009xmc.2_Silent_p.N108N|ZNF248_uc001izb.2_RNA|ZNF248_uc001izc.2_Silent_p.N108N|ZNF248_uc010qeu.1_Silent_p.N108N	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTACTGTTTTGTTGTTGTGGA	0.358													30	106	---	---	---	---	PASS
MARCH5	54708	broad.mit.edu	37	10	94109544	94109544	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94109544G>A	uc001khx.1	+	5	1002	c.670G>A	c.(670-672)GGT>AGT	p.G224S	MARCH5_uc010qno.1_Missense_Mutation_p.G120S	NM_017824	NP_060294	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	224	Helical; (Potential).				cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						TACAATAGTTGGTAAATTGAT	0.383													53	122	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95157003	95157003	+	Splice_Site	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95157003C>T	uc001kin.2	-	15	1457	c.1334_splice	c.e15+1	p.W445_splice	MYOF_uc001kio.2_Splice_Site_p.W445_splice|MYOF_uc001kip.3_Nonsense_Mutation_p.W445*	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TTTCAACTCACCAGTCATATA	0.269													9	38	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106918677	106918677	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106918677C>G	uc001kyi.1	+	11	1884	c.1657C>G	c.(1657-1659)CAA>GAA	p.Q553E		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	553	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCTGCACCTGCAACTCTCTGA	0.463													51	39	---	---	---	---	PASS
DCLRE1A	9937	broad.mit.edu	37	10	115609945	115609945	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115609945C>A	uc001law.2	-	2	1837	c.919G>T	c.(919-921)GAA>TAA	p.E307*		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	307					cell division|mitosis	nucleus	hydrolase activity			skin(2)	2				Epithelial(162;0.0157)|all cancers(201;0.0171)		TGAGTGTCTTCATCACTTTGA	0.398								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					57	98	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124377609	124377609	+	Missense_Mutation	SNP	A	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124377609A>C	uc001lgk.1	+	38	4687	c.4581A>C	c.(4579-4581)CAA>CAC	p.Q1527H	DMBT1_uc001lgl.1_Missense_Mutation_p.Q1517H|DMBT1_uc001lgm.1_Missense_Mutation_p.Q899H|DMBT1_uc009xzz.1_Missense_Mutation_p.Q1527H|DMBT1_uc010qtx.1_Missense_Mutation_p.Q378H|DMBT1_uc009yab.1_Missense_Mutation_p.Q230H|DMBT1_uc009yac.1_5'Flank	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1527	SRCR 12.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCTATACCAAGGCTCCTGGG	0.582													6	592	---	---	---	---	PASS
IFITM5	387733	broad.mit.edu	37	11	299346	299346	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:299346G>C	uc001low.1	-	1	181	c.145C>G	c.(145-147)CTG>GTG	p.L49V		NM_001025295	NP_001020466	A6NNB3	IFM5_HUMAN	interferon induced transmembrane protein 5	49	Helical; (Potential).				multicellular organismal development|regulation of bone mineralization|response to biotic stimulus	integral to membrane|plasma membrane					0		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGGCAACACAGATTCAGGTAG	0.662													4	6	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1269778	1269778	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1269778T>C	uc009ycr.1	+	50	13378	c.13252T>C	c.(13252-13254)TGG>CGG	p.W4418R	MUC5B_uc001ltb.2_Missense_Mutation_p.W3893R	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3890	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCTCCAGTGTGGATCAGCAC	0.652													20	23	---	---	---	---	PASS
TRIM68	55128	broad.mit.edu	37	11	4626603	4626603	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4626603C>T	uc001lzf.1	-	2	370	c.132G>A	c.(130-132)TGG>TGA	p.W44*	TRIM68_uc001lzg.1_5'UTR|TRIM68_uc010qyj.1_Intron|TRIM68_uc009yek.1_Nonsense_Mutation_p.W44*	NM_018073	NP_060543	Q6AZZ1	TRI68_HUMAN	ring finger protein 137	44	RING-type.			W -> R (in Ref. 3; BAG51737).	protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTGGGATCTCCCAGAGTCCAG	0.577													30	49	---	---	---	---	PASS
OR51G2	81282	broad.mit.edu	37	11	4936818	4936818	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4936818C>G	uc001lzr.1	-	1	76	c.76G>C	c.(76-78)GAG>CAG	p.E26Q		NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G,	26	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCATGCGCTCCAGCCCAGGG	0.532													16	67	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5443929	5443929	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5443929C>T	uc010qzd.1	+	1	499	c.499C>T	c.(499-501)CGA>TGA	p.R167*	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTACTCAAGCGACTGCCTTT	0.517													44	150	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6661249	6661249	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6661249C>A	uc001mem.1	-	2	2006	c.1596G>T	c.(1594-1596)ACG>ACT	p.T532T		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	532	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGAGGCAGCCGTAGTGATAA	0.582													37	22	---	---	---	---	PASS
RNF141	50862	broad.mit.edu	37	11	10536558	10536558	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10536558C>T	uc001mis.1	-	6	751	c.598G>A	c.(598-600)GAA>AAA	p.E200K	RNF141_uc009yga.1_RNA	NM_016422	NP_057506	Q8WVD5	RN141_HUMAN	ring finger protein 141	200							zinc ion binding				0				all cancers(16;4.63e-08)|Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.064)		ACCCAAGATTCATTTGCTCCA	0.438													35	47	---	---	---	---	PASS
ABTB2	25841	broad.mit.edu	37	11	34182492	34182492	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34182492G>A	uc001mvl.1	-	11	2027	c.1797C>T	c.(1795-1797)ACC>ACT	p.T599T		NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing	599							DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				GCAAGCCCTCGGTCACCAGCT	0.597													31	31	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49176040	49176040	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49176040G>A	uc001ngy.2	-	16	1889	c.1628C>T	c.(1627-1629)ACA>ATA	p.T543I	FOLH1_uc001ngx.2_5'UTR|FOLH1_uc001ngz.2_Missense_Mutation_p.T543I|FOLH1_uc009yly.2_Missense_Mutation_p.T528I|FOLH1_uc009ylz.2_Missense_Mutation_p.T528I|FOLH1_uc009yma.2_Missense_Mutation_p.T235I	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	543	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	GAATTTGTTTGTTTCCTACAG	0.323													5	14	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982648	57982648	+	Silent	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982648T>C	uc010rkc.1	+	1	432	c.432T>C	c.(430-432)AAT>AAC	p.N144N		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	144	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				ACCCTCTGAATTATACAATTC	0.453													4	130	---	---	---	---	PASS
OR5AN1	390195	broad.mit.edu	37	11	59132285	59132285	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59132285C>T	uc010rks.1	+	1	354	c.354C>T	c.(352-354)GCC>GCT	p.A118A		NM_001004729	NP_001004729	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TCATGACAGCCATGGCTTATG	0.438													5	133	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61026731	61026731	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61026731C>T	uc001nra.2	-	20	2563	c.2284G>A	c.(2284-2286)GCA>ACA	p.A762T	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	762						extracellular region	calcium ion binding			ovary(1)	1						TTGCTGAATGCCACATTTCCG	0.587													21	27	---	---	---	---	PASS
GNG3	2785	broad.mit.edu	37	11	62475847	62475847	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62475847C>G	uc001nuv.2	+	2	355	c.80C>G	c.(79-81)GCC>GGC	p.A27G	BSCL2_uc001nuo.1_5'Flank|BSCL2_uc009yoc.1_5'Flank|BSCL2_uc001nup.2_5'Flank|BSCL2_uc001nuq.1_5'Flank|BSCL2_uc001nur.3_5'Flank|BSCL2_uc009yod.2_Intron|BSCL2_uc001nut.3_Intron|HNRNPUL2_uc001nuu.1_Intron	NM_012202	NP_036334	P63215	GBG3_HUMAN	guanine nucleotide binding protein (G protein),	27					activation of MAPK activity|cellular response to glucagon stimulus|energy reserve metabolic process|synaptic transmission		GTPase activity|signal transducer activity				0						AAGATTGAAGCCAGCTTGTGT	0.522													28	34	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63449017	63449017	+	5'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63449017G>C	uc001nxq.2	+	1					RTN3_uc001nxo.2_5'UTR|RTN3_uc001nxm.2_5'UTR|RTN3_uc001nxn.2_5'UTR|RTN3_uc001nxp.2_5'UTR|RTN3_uc009yov.2_5'UTR|RTN3_uc010rmt.1_RNA|RTN3_uc010rmu.1_5'UTR	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						AAAGGGACTTGAGCGAGCCAG	0.627													7	13	---	---	---	---	PASS
SNX32	254122	broad.mit.edu	37	11	65618824	65618824	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65618824C>G	uc001ofr.2	+	8	862	c.735C>G	c.(733-735)ATC>ATG	p.I245M		NM_152760	NP_689973	Q86XE0	SNX32_HUMAN	sorting nexin 6B	245					cell communication|protein transport		phosphatidylinositol binding				0				READ - Rectum adenocarcinoma(159;0.171)		ATATCCCTATCTCAGCTGCGC	0.562											OREG0021087	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	44	---	---	---	---	PASS
LOC645332	645332	broad.mit.edu	37	11	67559821	67559821	+	3'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67559821G>C	uc001omt.3	-	4					LOC645332_uc001omu.3_3'UTR	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						TCCTGGGCCAGAGGCTAAAAC	0.587													14	34	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	84027997	84027997	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84027997G>A	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Silent_p.T64T	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TGGACCCCCCGGTCCTGTTTG	0.607													48	127	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780634	88780634	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780634G>T	uc001pcq.2	-	1	607	c.407C>A	c.(406-408)TCC>TAC	p.S136Y	GRM5_uc009yvm.2_Missense_Mutation_p.S136Y|GRM5_uc009yvn.1_Missense_Mutation_p.S136Y	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	136	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GGAGCGGAAGGAAGAGGAGGA	0.512													14	25	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89424054	89424054	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424054C>T	uc001pda.2	+	11	1230	c.704C>T	c.(703-705)ACA>ATA	p.T235I		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	235					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CTGTAGGAAACAAACAAATTC	0.318													7	68	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105797580	105797580	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105797580C>T	uc001pix.2	+	13	2407	c.1961C>T	c.(1960-1962)CCC>CTC	p.P654L	GRIA4_uc001piw.2_Missense_Mutation_p.P654L	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	654	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ATGGTCTCTCCCATAGAAAGT	0.418													17	29	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105842684	105842684	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105842684G>A	uc001pix.2	+	15	2784	c.2338G>A	c.(2338-2340)GTC>ATC	p.V780I	GRIA4_uc001piw.2_Intron|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	780	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TGAGGCAGGCGTCTTAGACAA	0.418													10	19	---	---	---	---	PASS
VPS11	55823	broad.mit.edu	37	11	118940031	118940031	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118940031G>C	uc010ryx.1	+	3	355	c.313G>C	c.(313-315)GAT>CAT	p.D105H	VPS11_uc010ryy.1_5'UTR	NM_021729	NP_068375	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11	105					protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TGTTGGAGAAGATGAAGAGGG	0.478													15	41	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900682	123900682	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900682C>T	uc001pzp.1	+	1	353	c.353C>T	c.(352-354)TCC>TTC	p.S118F		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AGGGTCATGTCCTGTGATCGC	0.562													49	94	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128857989	128857989	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128857989G>A	uc009zcp.2	-	12	1185	c.1185C>T	c.(1183-1185)TTC>TTT	p.F395F	ARHGAP32_uc009zcq.1_Silent_p.F355F|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Silent_p.F46F|ARHGAP32_uc001qfb.2_Silent_p.F180F	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	395	Rho-GAP.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						ATCTCTCAATGAATGCTGTGC	0.393													19	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92000	92000	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92000A>T	uc010sdi.1	-	2	338	c.310T>A	c.(310-312)TTG>ATG	p.L104M	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		GGTCCTGGCAACACTCTGGAC	0.572													4	6	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9259153	9259153	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9259153G>A	uc001qvk.1	-	9	1041	c.928C>T	c.(928-930)CAG>TAG	p.Q310*	A2M_uc009zgk.1_Nonsense_Mutation_p.Q160*	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	310					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CTCTTCAGCTGGAAGACCTTG	0.368													3	12	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506383	11506383	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506383C>T	uc001qzw.1	-	4	691	c.654G>A	c.(652-654)AAG>AAA	p.K218K	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	279	12.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTCCTTGTGGCTTTCCTGGAG	0.602													5	135	---	---	---	---	PASS
OR6C76	390326	broad.mit.edu	37	12	55820919	55820919	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55820919G>A	uc010spm.1	+	1	882	c.882G>A	c.(880-882)GTG>GTA	p.V294V		NM_001005183	NP_001005183	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C,	294	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACCAGCAGGTGAAACAAGCAT	0.348													12	25	---	---	---	---	PASS
SILV	6490	broad.mit.edu	37	12	56355231	56355231	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56355231G>A	uc001sip.2	-	3	235	c.204C>T	c.(202-204)CTC>CTT	p.L68L	SILV_uc001siq.2_Silent_p.L68L|SILV_uc010spx.1_Intron|SILV_uc001sir.2_Silent_p.L68L	NM_006928	NP_008859	P40967	PMEL_HUMAN	silver homolog	68					melanin biosynthetic process|melanosome organization	endoplasmic reticulum membrane|extracellular region|Golgi apparatus|integral to membrane|melanosome|multivesicular body membrane|plasma membrane	protein binding				0						TACTGACCTTGAGGGACACTT	0.517													29	64	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56629078	56629078	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56629078T>C	uc010sqj.1	+	7	1029	c.772T>C	c.(772-774)TGT>CGT	p.C258R	SLC39A5_uc010sqi.1_Missense_Mutation_p.C149R|SLC39A5_uc010sqk.1_Missense_Mutation_p.C258R	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	258	Helical; (Potential).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						GGGCACTCTTTGTGGGGATGC	0.617													112	77	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57603647	57603647	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57603647C>T	uc001snd.2	+	80	12901	c.12435C>T	c.(12433-12435)CCC>CCT	p.P4145P		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	4145	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACAAGCAGCCCGAAGGTGGGG	0.632													11	40	---	---	---	---	PASS
R3HDM2	22864	broad.mit.edu	37	12	57662771	57662771	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57662771C>G	uc009zpm.1	-	15	1802	c.1767G>C	c.(1765-1767)CAG>CAC	p.Q589H	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Missense_Mutation_p.Q284H|R3HDM2_uc001snr.2_Missense_Mutation_p.Q316H|R3HDM2_uc001sns.2_Missense_Mutation_p.Q589H|R3HDM2_uc001snt.2_Missense_Mutation_p.Q603H|R3HDM2_uc009zpn.1_Intron	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	589	Gln-rich.					nucleus	nucleic acid binding			ovary(2)	2						TGCTGCTCCTCTGGCTGCTGA	0.582													65	62	---	---	---	---	PASS
FAM71C	196472	broad.mit.edu	37	12	100042274	100042274	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100042274G>C	uc001tgn.2	+	1	744	c.322G>C	c.(322-324)GAA>CAA	p.E108Q	ANKS1B_uc001tge.1_Intron|ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_153364	NP_699195	Q8NEG0	FA71C_HUMAN	hypothetical protein LOC196472	108											0				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		CCAGAAAAGAGAAAGTCCGCC	0.522													24	64	---	---	---	---	PASS
EID3	493861	broad.mit.edu	37	12	104698237	104698237	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104698237C>T	uc001tkw.2	+	1	689	c.525C>T	c.(523-525)TTC>TTT	p.F175F	TXNRD1_uc010swk.1_Intron|TXNRD1_uc010swl.1_Intron|TXNRD1_uc010swm.1_Intron|TXNRD1_uc010swn.1_Intron|TXNRD1_uc010swo.1_Intron|TXNRD1_uc010swp.1_Intron|TXNRD1_uc010swq.1_Intron|TXNRD1_uc001tku.2_Intron|TXNRD1_uc001tko.1_Intron|TXNRD1_uc001tkp.1_Intron|TXNRD1_uc001tkv.1_Intron	NM_001008394	NP_001008395	Q8N140	EID3_HUMAN	EP300 interacting inhibitor of differentiation	175					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus					0						TTGGTTCATTCAAGCTAGAAC	0.423													40	126	---	---	---	---	PASS
FBXO21	23014	broad.mit.edu	37	12	117610323	117610323	+	Silent	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117610323G>C	uc001twk.2	-	7	1005	c.966C>G	c.(964-966)GTC>GTG	p.V322V	FBXO21_uc001twj.2_Silent_p.V322V|FBXO21_uc009zwq.2_Silent_p.V322V	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1	322					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TTGGGAAGTTGACAGGCTCCA	0.493													67	48	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132490706	132490706	+	Silent	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132490706C>G	uc001ujn.2	+	13	3020	c.2985C>G	c.(2983-2985)CTC>CTG	p.L995L	EP400_uc001ujl.2_Silent_p.L994L|EP400_uc001ujm.2_Silent_p.L995L	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1031	Interactions with RUVBL1 and RUVBL2.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ACTTGGTTCTCATCGACTCGC	0.507													29	40	---	---	---	---	PASS
DKFZp686A1627	266695	broad.mit.edu	37	13	19622135	19622135	+	RNA	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19622135C>T	uc001umb.1	-	10		c.3676G>A				NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0						CAACCAGTACCTTTGAACGCC	0.478													10	45	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	19999873	19999873	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19999873G>A	uc001umd.2	-						TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Intron|TPTE2_uc001ume.2_Intron|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Intron	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid							endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ccactctcaggtccctccctc	0.000													68	19	---	---	---	---	PASS
CDK8	1024	broad.mit.edu	37	13	26927985	26927985	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26927985C>A	uc001uqr.1	+	4	450	c.424C>A	c.(424-426)CTG>ATG	p.L142M	CDK8_uc001uqs.1_Missense_Mutation_p.L142M|CDK8_uc001uqt.1_Translation_Start_Site	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	142	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TATTCACTACCTGCATGCTAA	0.403													71	33	---	---	---	---	PASS
LOC220429	220429	broad.mit.edu	37	13	50466754	50466754	+	Silent	SNP	T	C	C	rs60589832	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50466754T>C	uc001vdk.2	+	1	2210	c.2028T>C	c.(2026-2028)GAT>GAC	p.D676D		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						ATGTGCCTGATTCATCTCTCC	0.453													3	1	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113750868	113750868	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113750868G>A	uc001vsu.2	+	29	3386	c.3364G>A	c.(3364-3366)GTC>ATC	p.V1122I	MCF2L_uc001vsq.2_3'UTR|MCF2L_uc010tjr.1_Missense_Mutation_p.V1065I|MCF2L_uc001vsr.2_Missense_Mutation_p.V1069I|MCF2L_uc010tjs.1_Missense_Mutation_p.V1063I	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	1095	SH3.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TTGCAGGTACGTCAGGGACCC	0.736													4	11	---	---	---	---	PASS
C14orf93	60686	broad.mit.edu	37	14	23457182	23457182	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23457182C>T	uc001wib.1	-	6	1437	c.1127G>A	c.(1126-1128)CGC>CAC	p.R376H	C14orf93_uc001wic.1_Missense_Mutation_p.R196H|C14orf93_uc001wid.1_Missense_Mutation_p.R376H|C14orf93_uc001wig.2_Missense_Mutation_p.R376H|C14orf93_uc001wih.2_Missense_Mutation_p.R376H|C14orf93_uc001wie.2_Missense_Mutation_p.R376H|C14orf93_uc001wia.3_Missense_Mutation_p.R376H|C14orf93_uc001wif.2_Missense_Mutation_p.R196H	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor	376						extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		CAGGGAGTTGCGGTACTCACG	0.532													80	86	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23884440	23884440	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884440T>C	uc001wjx.2	-	37	5429	c.5323A>G	c.(5323-5325)ACC>GCC	p.T1775A		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1775	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGGGCGCTGGTGTCCTGCTCC	0.607													13	210	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24792260	24792260	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24792260G>T	uc001wov.2	-	18	2198	c.2192C>A	c.(2191-2193)TCC>TAC	p.S731Y	ADCY4_uc001wow.2_Missense_Mutation_p.S731Y|ADCY4_uc010toh.1_Missense_Mutation_p.S417Y|ADCY4_uc001wox.2_Missense_Mutation_p.S731Y|ADCY4_uc001woy.2_Missense_Mutation_p.S731Y	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	731	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		GAGGGAGCAGGAGAGGAAGCC	0.637													15	42	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29236560	29236560	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29236560C>T	uc001wqe.2	+	1	274	c.75C>T	c.(73-75)CCC>CCT	p.P25P		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	25					axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GCCTGGTGCCCGAGGCGGTCC	0.393													3	12	---	---	---	---	PASS
FAM177A1	283635	broad.mit.edu	37	14	35550231	35550231	+	Missense_Mutation	SNP	G	C	C	rs56876270		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35550231G>C	uc001wsp.2	+	7	898	c.439G>C	c.(439-441)GAA>CAA	p.E147Q	FAM177A1_uc001wsq.2_Missense_Mutation_p.E170Q	NM_001079519	NP_001072987	Q8N128	F177A_HUMAN	hypothetical protein LOC283635 isoform 2	147	Potential.										0						TTTTTAGgaagaagaagaaga	0.299													3	21	---	---	---	---	PASS
FOXA1	3169	broad.mit.edu	37	14	38064224	38064224	+	5'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38064224G>A	uc001wuf.2	-	1					FOXA1_uc010tpz.1_5'Flank	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1						chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TGTGCGAAGCGAcgggcggcc	0.542													10	10	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42361125	42361125	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42361125C>T	uc001wvm.2	+	4	3256	c.2058C>T	c.(2056-2058)GTC>GTT	p.V686V	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	686	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCGATTCTGTCACAGAGGGGC	0.478										HNSCC(30;0.082)			7	40	---	---	---	---	PASS
POLE2	5427	broad.mit.edu	37	14	50154880	50154880	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50154880G>C	uc001wwu.2	-	1	56	c.42C>G	c.(40-42)TTC>TTG	p.F14L	SDCCAG1_uc010anj.1_Intron|POLE2_uc001wwv.2_RNA	NM_002692	NP_002683	P56282	DPOE2_HUMAN	DNA-directed DNA polymerase epsilon 2	14					DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity			ovary(1)|skin(1)	2	all_epithelial(31;0.0021)|Breast(41;0.0124)					CCCGCAACTTGAAGGCGGAGA	0.731													2	6	---	---	---	---	PASS
SLC35F4	341880	broad.mit.edu	37	14	58031040	58031040	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58031040G>A	uc001xdb.1	-	8	1379	c.1379C>T	c.(1378-1380)ACC>ATC	p.T460I	SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_Missense_Mutation_p.T301I	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2						GATGATGATGGTAGCAGCCAG	0.453													11	10	---	---	---	---	PASS
ISM2	145501	broad.mit.edu	37	14	77948949	77948949	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77948949G>A	uc001xtz.2	-	4	763	c.689C>T	c.(688-690)CCC>CTC	p.P230L	ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Missense_Mutation_p.P142L|ISM2_uc010tvl.1_Missense_Mutation_p.P149L	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	230						extracellular region				skin(1)	1						GGGATTGCTGGGCTCAGCCAA	0.622													118	145	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	80327906	80327906	+	Intron	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80327906G>C	uc001xun.2	+						NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Missense_Mutation_p.D505H|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ACCCCAGCCTGATATAGTCTT	0.522													4	19	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94155067	94155067	+	Silent	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94155067C>G	uc001ybv.1	+	43	6701	c.6618C>G	c.(6616-6618)CTC>CTG	p.L2206L	KIAA1409_uc001ybs.1_Silent_p.L2184L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2361						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GGGGACATCTCAAAGTGGGGC	0.507													59	44	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811572	23811572	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811572C>T	uc001ywh.3	+	1	1119	c.643C>T	c.(643-645)CGC>TGC	p.R215C	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.R215C	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	215						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CTACCGGGGCCGCTGGGTTGC	0.592													13	15	---	---	---	---	PASS
OTUD7A	161725	broad.mit.edu	37	15	31851205	31851205	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31851205C>G	uc001zfq.2	-	3	610	c.517G>C	c.(517-519)GAG>CAG	p.E173Q	OTUD7A_uc001zfr.2_Missense_Mutation_p.E173Q|OTUD7A_uc001zfs.1_RNA|OTUD7A_uc010baa.1_Missense_Mutation_p.E173Q	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	173	TRAF-binding (By similarity).					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GTTGCCTGCTCGATCAAGTCC	0.572													15	14	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43724559	43724559	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43724559C>T	uc001zrs.2	-	17	3641	c.3493G>A	c.(3493-3495)GAA>AAA	p.E1165K	TP53BP1_uc010udp.1_Missense_Mutation_p.E1165K|TP53BP1_uc001zrq.3_Missense_Mutation_p.E1170K|TP53BP1_uc001zrr.3_Missense_Mutation_p.E1170K|TP53BP1_uc010udq.1_Missense_Mutation_p.E1170K	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	1165					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GAAACAGTTTCTGGGACCCTC	0.458								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					28	40	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49882012	49882012	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49882012A>G	uc001zxl.2	-	4	592	c.298T>C	c.(298-300)TCT>CCT	p.S100P	C15orf33_uc001zxm.2_Missense_Mutation_p.S100P	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	100										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		AATATTTCAGAGGTGTGGTTT	0.244													10	22	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50550637	50550637	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50550637C>A	uc001zxz.2	-	3	388	c.282G>T	c.(280-282)ATG>ATT	p.M94I	HDC_uc010uff.1_Missense_Mutation_p.M94I|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Missense_Mutation_p.M94I	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	94					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CATCAGCCAGCATGTCTCCTA	0.577													18	39	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51790751	51790751	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51790751G>A	uc002abf.2	-	18	4895	c.4670C>T	c.(4669-4671)TCA>TTA	p.S1557L	DMXL2_uc010ufy.1_Missense_Mutation_p.S1557L|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1557						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ATATTTACCTGAGCAACTCTT	0.373													13	22	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79051641	79051641	+	3'UTR	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79051641C>G	uc002bej.3	-	24						NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GGGAGGAGGTCCCCAGCCTGC	0.512													4	3	---	---	---	---	PASS
WDR24	84219	broad.mit.edu	37	16	735981	735981	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:735981C>A	uc002ciz.1	-	5	2221	c.1461G>T	c.(1459-1461)CTG>CTT	p.L487L	JMJD8_uc002ciw.1_5'Flank|JMJD8_uc002cix.1_5'Flank|JMJD8_uc002ciy.1_5'Flank	NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	617										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)				CCATATCCTTCAGGTTGAAAC	0.652													4	96	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	822685	822685	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:822685G>A	uc002cjz.1	-	12	2422	c.2422C>T	c.(2422-2424)CGG>TGG	p.R808W		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	457	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						TTGGCTCACCGGAGCTCCTGG	0.667													3	4	---	---	---	---	PASS
RPS2	6187	broad.mit.edu	37	16	2012182	2012182	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2012182G>A	uc002cnn.2	-	6	987	c.799C>T	c.(799-801)CAG>TAG	p.Q267*	RPS2_uc010bsa.1_RNA|RPS2_uc002cnl.2_Nonsense_Mutation_p.Q209*|RPS2_uc002cnm.2_RNA|RPS2_uc002cno.2_Nonsense_Mutation_p.Q267*|SNHG9_uc002cnr.2_5'Flank	NM_002952	NP_002943	P15880	RS2_HUMAN	ribosomal protein S2	267					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	fibroblast growth factor 1 binding|fibroblast growth factor 3 binding|RNA binding|structural constituent of ribosome				0						GTGAACTCCTGATAGGGAGAC	0.512													15	56	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2149701	2149701	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2149701C>A	uc002cos.1	-	30	10203	c.9994G>T	c.(9994-9996)GTT>TTT	p.V3332F	PKD1_uc002cot.1_Missense_Mutation_p.V3332F|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	3332	Helical; (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GGATAGACAACCACGCTGGAC	0.637													3	20	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3142561	3142561	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3142561G>A	uc002ctv.1	-	1	301	c.213C>T	c.(211-213)CCC>CCT	p.P71P	ZSCAN10_uc002cty.1_Intron|ZSCAN10_uc002ctw.1_Nonsense_Mutation_p.Q79*|ZSCAN10_uc002ctx.1_5'UTR	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	71	SCAN box.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CCGCGTGGCTGGGCTCCCGGT	0.682													2	0	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3613170	3613170	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3613170C>T	uc010btn.2	-	5	2179	c.1768G>A	c.(1768-1770)GGG>AGG	p.G590R		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	590					I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GCCAGGGCCCCGCTCTCCATG	0.697													4	7	---	---	---	---	PASS
SLC7A5P2	387254	broad.mit.edu	37	16	21531585	21531585	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21531585G>A	uc002djd.2	-	1	181	c.102C>T	c.(100-102)GGC>GGT	p.G34G	uc002diq.3_Intron|LOC100271836_uc002dja.2_RNA|LOC100271836_uc002djb.2_RNA	NR_002594				RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;												0						CCGGCGCCGCGCCGTCCGCGC	0.731													5	14	---	---	---	---	PASS
ARHGAP17	55114	broad.mit.edu	37	16	24990327	24990327	+	Splice_Site	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24990327C>T	uc002dnb.2	-	2	147	c.54_splice	c.e2-1	p.R18_splice	ARHGAP17_uc002dnc.2_Splice_Site_p.R18_splice|ARHGAP17_uc010vcf.1_Splice_Site|ARHGAP17_uc002dng.1_Splice_Site_p.R18_splice	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		TTTCTCAGCTCTGTGGGAAAA	0.308													15	19	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30734385	30734385	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30734385C>A	uc002dze.1	+	24	4379	c.3994C>A	c.(3994-3996)CGG>AGG	p.R1332R	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.R1127R|SRCAP_uc010bzz.1_Silent_p.R902R	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1332	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCCAGCACCCCGGCCTCCGAG	0.602													4	159	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57250884	57250884	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57250884A>G	uc002elb.2	+	8	1116	c.838A>G	c.(838-840)AAT>GAT	p.N280D	RSPRY1_uc002elc.2_Missense_Mutation_p.N280D|RSPRY1_uc002eld.2_Missense_Mutation_p.N280D	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	280						extracellular region	zinc ion binding			ovary(1)	1						GTCCTGGGCTAATGATCCTGA	0.393													40	170	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74445808	74445808	+	Intron	SNP	T	C	C	rs146209466	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74445808T>C	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR|CLEC18B_uc010vmv.1_Intron	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						GGGTcaggagtgagctggtca	0.294													4	27	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84118642	84118642	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84118642G>C	uc002fhi.2	-	10	1734	c.1232C>G	c.(1231-1233)TCA>TGA	p.S411*		NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	411	Serine protease.|Lumenal (Potential).				cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						ACTGGTCCCTGAGAGGGCCCG	0.602											OREG0023982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	95	---	---	---	---	PASS
USP10	9100	broad.mit.edu	37	16	84793807	84793807	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84793807C>T	uc002fii.2	+	8	1622	c.1480C>T	c.(1480-1482)CGC>TGC	p.R494C	USP10_uc010voe.1_Missense_Mutation_p.R498C|USP10_uc010vof.1_Missense_Mutation_p.R56C|USP10_uc002fij.2_Missense_Mutation_p.R20C	NM_005153	NP_005144	Q14694	UBP10_HUMAN	ubiquitin specific protease 10	494					DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						GAGGGATATTCGCCCTGGAGC	0.413													5	23	---	---	---	---	PASS
FOXF1	2294	broad.mit.edu	37	16	86545073	86545073	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86545073C>A	uc002fjl.2	+	1	941	c.898C>A	c.(898-900)CTG>ATG	p.L300M	uc002fjk.1_5'Flank	NM_001451	NP_001442	Q12946	FOXF1_HUMAN	forkhead box F1	300					branching involved in open tracheal system development|cardiac left ventricle morphogenesis|embryonic ectodermal digestive tract morphogenesis|endocardial cushion development|in utero embryonic development|lung vasculature development|midgut development|pancreas development|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|ureter development|venous blood vessel development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0						GGCCAACCCCCTGTCCGGCAG	0.706													9	5	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89924757	89924757	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89924757C>G	uc002foz.1	+	8	1166	c.1114C>G	c.(1114-1116)CTG>GTG	p.L372V	SPIRE2_uc010civ.1_Missense_Mutation_p.L287V|SPIRE2_uc010ciw.1_Missense_Mutation_p.L372V|SPIRE2_uc002fpa.1_Missense_Mutation_p.L324V|SPIRE2_uc010cix.1_Missense_Mutation_p.L239V	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	372					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		GTTTGGCTCTCTGCCCTGCAT	0.622													60	229	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	3143961	3143961	+	5'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3143961G>A	uc002fvf.2	+	1										SubName: Full=Olfactory receptor OR17-1;																		GTTACAGAAAGTTGGGGGAAT	0.393													18	19	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577114C>T	uc002gim.2	-	8	1018	c.824G>A	c.(823-825)TGT>TAT	p.C275Y	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.C275Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C143Y|TP53_uc010cng.1_Missense_Mutation_p.C143Y|TP53_uc002gii.1_Missense_Mutation_p.C143Y|TP53_uc010cnh.1_Missense_Mutation_p.C275Y|TP53_uc010cni.1_Missense_Mutation_p.C275Y|TP53_uc002gij.2_Missense_Mutation_p.C275Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	275	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> S (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C275Y(44)|p.C275F(34)|p.C275G(7)|p.C275W(7)|p.0?(7)|p.C275R(6)|p.C275C(4)|p.C275fs*70(2)|p.C275fs*31(2)|p.?(2)|p.C275S(2)|p.R273_C275delRVC(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.C275*(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.A276fs*29(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGACAGGCACAAACACGCAC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			57	0	---	---	---	---	PASS
SCO1	6341	broad.mit.edu	37	17	10600714	10600714	+	Silent	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10600714C>G	uc002gmr.3	-	1	172	c.111G>C	c.(109-111)GCG>GCC	p.A37A	SCO1_uc002gms.3_Silent_p.A37A|C17orf48_uc002gmt.2_5'Flank|C17orf48_uc002gmu.2_5'Flank|C17orf48_uc002gmv.2_5'Flank	NM_004589	NP_004580	O75880	SCO1_HUMAN	cytochrome oxidase deficient homolog 1	37					cellular copper ion homeostasis|copper ion transport|generation of precursor metabolites and energy|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0						GCAAGACTCTCGCAGTCCCCT	0.672													19	2	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26098034	26098034	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26098034T>C	uc002gzu.2	-	15	1978	c.1714A>G	c.(1714-1716)ATG>GTG	p.M572V	NOS2_uc010crh.1_Missense_Mutation_p.M572V|NOS2_uc010wab.1_Intron	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	572	Flavodoxin-like.				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	TACTTATCCATGCAGACAACC	0.617													28	11	---	---	---	---	PASS
PHF12	57649	broad.mit.edu	37	17	27233884	27233884	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27233884C>T	uc002hdg.1	-	14	3200	c.2670G>A	c.(2668-2670)CAG>CAA	p.Q890Q	PHF12_uc010wbb.1_Silent_p.Q872Q	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	890					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TGATGACACTCTGCACTTTGG	0.542													113	52	---	---	---	---	PASS
RNF135	84282	broad.mit.edu	37	17	29311659	29311659	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29311659G>A	uc002hfz.2	+	2	533	c.397G>A	c.(397-399)GAA>AAA	p.E133K	RNF135_uc002hga.2_Missense_Mutation_p.E133K|RNF135_uc010csm.2_Missense_Mutation_p.E133K|RNF135_uc002hgb.2_Intron	NM_032322	NP_115698	Q8IUD6	RN135_HUMAN	ring finger protein 135 isoform 1	133	Potential.				innate immune response|negative regulation of type I interferon production|positive regulation of interferon-beta production|regulation of innate immune response	cytosol	protein binding|ribonucleoprotein binding|ubiquitin-protein ligase activity|zinc ion binding	p.?(1)		skin(2)	2		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				GAGCATCACAGAAGTTGCTCA	0.478													32	96	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36482906	36482906	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36482906G>A	uc002hpz.2	-	11	6567	c.6546C>T	c.(6544-6546)GTC>GTT	p.V2182V		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	2182	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CCCCAGGGCAGACTGCCTCCT	0.592													35	116	---	---	---	---	PASS
FBXL20	84961	broad.mit.edu	37	17	37457256	37457256	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37457256C>G	uc010wed.1	-	4	453	c.232G>C	c.(232-234)GAG>CAG	p.E78Q	FBXL20_uc002hrt.2_Missense_Mutation_p.E78Q|FBXL20_uc010cvu.2_Missense_Mutation_p.E78Q	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	78	LRR 1.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			AATTATACCTCAATATCCCTC	0.393													14	46	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37650822	37650822	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37650822A>G	uc010cvv.2	+	5	2880	c.2294A>G	c.(2293-2295)GAG>GGG	p.E765G	CDK12_uc010wef.1_Missense_Mutation_p.E764G|CDK12_uc002hrw.3_Missense_Mutation_p.E765G	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	765	Protein kinase.				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AATGAGAAAGAGGGCTTCCCA	0.299										TCGA Ovarian(9;0.13)			10	42	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587576	43587576	+	Intron	SNP	A	G	G	rs2684618		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587576A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						tctgaaaagaaaagaaaaaaa	0.154													3	18	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49043574	49043574	+	3'UTR	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49043574A>G	uc002itc.2	-	30					SPAG9_uc002itb.2_3'UTR|SPAG9_uc002itd.2_3'UTR|SPAG9_uc002ita.2_3'UTR	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			AAAAGGATAGAGGGAAAATAA	0.393													3	113	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56395743	56395743	+	Silent	SNP	G	A	A	rs138887181		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56395743G>A	uc002ivx.3	-	14	2641	c.1770C>T	c.(1768-1770)CTC>CTT	p.L590L	BZRAP1_uc010dcs.2_Silent_p.L530L|BZRAP1_uc010wnt.1_Silent_p.L590L	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	590						mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGACCCCAGTGAGAGTGGCAG	0.627													24	75	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65907526	65907526	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65907526G>A	uc002jgf.2	+	11	3587	c.3526G>A	c.(3526-3528)GAA>AAA	p.E1176K	BPTF_uc002jge.2_Missense_Mutation_p.E1302K	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1302					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCGGAGCCCAGAAACAAAATG	0.388													41	16	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71391324	71391324	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71391324G>A	uc010dfm.2	-	25	3562	c.3562C>T	c.(3562-3564)CAG>TAG	p.Q1188*	SDK2_uc002jjt.3_Nonsense_Mutation_p.Q347*|SDK2_uc010dfn.2_Nonsense_Mutation_p.Q867*	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1188	Extracellular (Potential).|Fibronectin type-III 6.				cell adhesion	integral to membrane				ovary(2)	2						ACCACCGTCTGGCTCCAGGGC	0.662													11	6	---	---	---	---	PASS
TMC8	147138	broad.mit.edu	37	17	76136924	76136924	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76136924G>A	uc002jup.2	+	16	2294	c.1912G>A	c.(1912-1914)GAG>AAG	p.E638K	TMC8_uc002juq.2_Missense_Mutation_p.E415K	NM_152468	NP_689681	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	638	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GCAGGTTCAGGAGAAGTGGCA	0.672									Epidermodysplasia_Verruciformis_Familial_Clustering_of				11	6	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76457697	76457697	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76457697C>T	uc010dhp.1	-	3	490	c.268G>A	c.(268-270)GAG>AAG	p.E90K	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTCTCGGCCTCGATGCCGACC	0.542													6	17	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78831777	78831777	+	Intron	SNP	A	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78831777A>T	uc002jyt.1	+						RPTOR_uc010wuf.1_3'UTR|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CTGCGTTTCCAGCCTGCCCTT	0.662													9	2	---	---	---	---	PASS
NOTUM	147111	broad.mit.edu	37	17	79910997	79910997	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79910997T>C	uc010wvg.1	-	11	1603	c.1331A>G	c.(1330-1332)CAC>CGC	p.H444R		NM_178493	NP_848588	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog precursor	444						extracellular region	hydrolase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GGGGTTGCAGTGGGGCCAGGG	0.647													28	24	---	---	---	---	PASS
ASPSCR1	79058	broad.mit.edu	37	17	79973232	79973232	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79973232G>A	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Silent_p.R545R|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GGACAGGCCGGGTAGGCTGCC	0.682			T	TFE3	alveolar soft part sarcoma								14	34	---	---	---	---	PASS
DCXR	51181	broad.mit.edu	37	17	79993797	79993797	+	3'UTR	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79993797G>T	uc002kdg.2	-	8						NM_016286	NP_057370	Q7Z4W1	DCXR_HUMAN	dicarbonyl/L-xylulose reductase						D-xylose metabolic process|glucose metabolic process|protein homotetramerization|xylulose metabolic process	membrane	binding|L-xylulose reductase (NADP+) activity				0	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			TTGGGGGTAGGATGAGCACGG	0.602													11	36	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9254812	9254812	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9254812G>A	uc002knv.2	+	9	1804	c.1547G>A	c.(1546-1548)AGA>AAA	p.R516K	ANKRD12_uc002knw.2_Missense_Mutation_p.R493K|ANKRD12_uc002knx.2_Missense_Mutation_p.R493K|ANKRD12_uc010dkx.1_Missense_Mutation_p.R223K	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	516						nucleus				ovary(2)|central_nervous_system(1)	3						GAAAAGACCAGAGAGGAGGGG	0.259													29	52	---	---	---	---	PASS
APCDD1	147495	broad.mit.edu	37	18	10471657	10471657	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10471657C>T	uc002kom.3	+	3	727	c.373C>T	c.(373-375)CGG>TGG	p.R125W		NM_153000	NP_694545	Q8J025	APCD1_HUMAN	adenomatosis polyposis coli down-regulated 1	125	Extracellular (Potential).				hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)		TCTCATCATCCGGGGCAAGAT	0.547													21	92	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13621234	13621234	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13621234G>A	uc002ksa.2	+	5	968	c.300G>A	c.(298-300)CCG>CCA	p.P100P	C18orf1_uc002ksb.2_Silent_p.P100P|C18orf1_uc002kse.2_Silent_p.P63P|C18orf1_uc002ksf.2_Silent_p.P63P|C18orf1_uc002ksg.1_Silent_p.P23P|C18orf1_uc002ksh.1_Silent_p.P42P|C18orf1_uc002ksi.1_Silent_p.P42P	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1	100	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		TCAACCGCCCGAACCAGAGCC	0.622													33	94	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28956922	28956922	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28956922G>A	uc002kwq.2	+	1	183	c.48G>A	c.(46-48)ATG>ATA	p.M16I	DSG4_uc002kwr.2_Missense_Mutation_p.M16I	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	16					homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCATTCTAATGGTAAGTAGAA	0.408													7	40	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1807231	1807231	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1807231G>A	uc002ltw.2	-	6	785	c.551C>T	c.(550-552)TCG>TTG	p.S184L	ATP8B3_uc002ltv.2_Missense_Mutation_p.S131L|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002lty.1_5'Flank|ATP8B3_uc002ltz.1_Missense_Mutation_p.S131L	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	184	Helical; (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTACTGAGCGAGAACCAGGG	0.642													52	89	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8131009	8131009	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8131009C>T	uc002mjf.2	-	63	8245	c.8224G>A	c.(8224-8226)GTC>ATC	p.V2742I	FBN3_uc002mje.2_Missense_Mutation_p.V538I	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2742						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TTTCCGCGGACGATGACGTAG	0.687													27	55	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9025599	9025599	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9025599G>A	uc002mkp.2	-	15	37059	c.36855C>T	c.(36853-36855)ACC>ACT	p.T12285T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12287	SEA 2.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACCTGAGCAAGGTCAATCTGC	0.522													14	48	---	---	---	---	PASS
RAB8A	4218	broad.mit.edu	37	19	16222537	16222537	+	5'UTR	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16222537C>T	uc002ndn.3	+	1					RAB8A_uc002ndm.1_5'UTR|RAB8A_uc010xpc.1_5'UTR	NM_005370	NP_005361	P61006	RAB8A_HUMAN	mel transforming oncogene						cilium assembly|Golgi vesicle fusion to target membrane|protein transport|small GTPase mediated signal transduction|vesicle docking involved in exocytosis	Golgi apparatus|nonmotile primary cilium|perinuclear region of cytoplasm|plasma membrane	GTP binding|protein binding			skin(1)	1						GCTCCGCGCTCCGCTCGCCCC	0.726													17	8	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31047980	31047980	+	Intron	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31047980G>A	uc002nsu.1	+						ZNF536_uc010edd.1_Intron|ZNF536_uc002nsv.2_RNA	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AACGATTAGGGGATGTGGCCC	0.398													26	66	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35828735	35828735	+	Missense_Mutation	SNP	G	A	A	rs138631884		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35828735G>A	uc010edt.2	+	5	873	c.796G>A	c.(796-798)GAG>AAG	p.E266K	CD22_uc010xst.1_Missense_Mutation_p.E94K|CD22_uc010edu.2_Missense_Mutation_p.E266K|CD22_uc010edv.2_Missense_Mutation_p.E266K|CD22_uc002nzb.3_Intron|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	266	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	CATGACCTGCGAGGTCAGCAG	0.577													28	49	---	---	---	---	PASS
YIF1B	90522	broad.mit.edu	37	19	38795474	38795474	+	3'UTR	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38795474C>T	uc002ohz.2	-	8					YIF1B_uc002ohw.2_3'UTR|YIF1B_uc002ohx.2_3'UTR|YIF1B_uc010xtx.1_3'UTR|YIF1B_uc010xty.1_3'UTR|YIF1B_uc002oia.2_3'UTR|YIF1B_uc002ohy.2_3'UTR|C19orf33_uc002ohu.1_Intron|C19orf33_uc002ohv.1_Intron	NM_001039672	NP_001034761	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B isoform 5							integral to membrane					0	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TCCCTGCCCTCGGCCCCACAG	0.582													34	109	---	---	---	---	PASS
ADCK4	79934	broad.mit.edu	37	19	41206375	41206375	+	Intron	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41206375G>C	uc002oor.2	-						ADCK4_uc002oop.1_5'UTR|ADCK4_uc002ooq.1_Intron	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			GAAGGAAAGGGAGGAAGGGGA	0.607													5	24	---	---	---	---	PASS
CEACAM4	1089	broad.mit.edu	37	19	42132050	42132050	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42132050C>A	uc002orh.1	-	2	460	c.349G>T	c.(349-351)GCA>TCA	p.A117S	CEACAM4_uc010xwd.1_Missense_Mutation_p.A117S	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion	117	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction					0						TAGGATCCTGCGTCCTCCAGG	0.527													70	187	---	---	---	---	PASS
ZNF224	7767	broad.mit.edu	37	19	44611292	44611292	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44611292C>T	uc002oyh.1	+	6	1281	c.979C>T	c.(979-981)CAG>TAG	p.Q327*	uc002oyi.2_RNA	NM_013398	NP_037530	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	327	C2H2-type 6.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				GAGCTTTCGTCAGAGATCAGC	0.428													33	125	---	---	---	---	PASS
ZNF296	162979	broad.mit.edu	37	19	45579562	45579562	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45579562C>T	uc002pao.2	-	1	127	c.70G>A	c.(70-72)GAG>AAG	p.E24K	GEMIN7_uc002pap.1_5'Flank|GEMIN7_uc002paq.1_5'Flank|GEMIN7_uc002par.1_5'Flank	NM_145288	NP_660331	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	24					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATTTCCATCTCGTCGTCTGGG	0.607													13	38	---	---	---	---	PASS
RSPH6A	81492	broad.mit.edu	37	19	46314063	46314063	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46314063A>G	uc002pdm.2	-	2	829	c.686T>C	c.(685-687)CTG>CCG	p.L229P	RSPH6A_uc002pdl.2_5'UTR	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	229						intracellular				ovary(1)|central_nervous_system(1)	2						CCGCTGGTTCAGGATCTTGGT	0.542													3	71	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51136047	51136047	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51136047G>A	uc002pst.2	-	2	804	c.170C>T	c.(169-171)TCG>TTG	p.S57L	SYT3_uc002psv.2_Missense_Mutation_p.S57L|SYT3_uc010ycd.1_Missense_Mutation_p.S57L	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	57	Helical; (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CACGATGACCGACAGCAGGCT	0.572													28	74	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56466880	56466880	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56466880G>A	uc002qmh.2	+	3	1527	c.1456G>A	c.(1456-1458)GCC>ACC	p.A486T	NLRP8_uc010etg.2_Missense_Mutation_p.A486T	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	486	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GGGAGTCACCGCCTTCCTTGG	0.488													7	143	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57641980	57641980	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641980C>T	uc002qny.2	+	4	2293	c.1937C>T	c.(1936-1938)CCA>CTA	p.P646L		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	646					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGGAGCTTCCAGTGGCTGAC	0.507													22	27	---	---	---	---	PASS
ZNF419	79744	broad.mit.edu	37	19	58004247	58004247	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58004247G>A	uc002qov.2	+	5	562	c.322G>A	c.(322-324)GAG>AAG	p.E108K	ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Missense_Mutation_p.E109K|ZNF419_uc010etz.1_Missense_Mutation_p.E96K|ZNF419_uc010eua.1_Missense_Mutation_p.E95K|ZNF419_uc002qow.2_Missense_Mutation_p.E76K|ZNF419_uc010eub.1_Missense_Mutation_p.E63K|ZNF419_uc010euc.1_Missense_Mutation_p.E62K	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		AGCCGAGGCTGAGGAGGCTCC	0.468													55	53	---	---	---	---	PASS
ZNF135	7694	broad.mit.edu	37	19	58574893	58574893	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58574893C>T	uc010yhq.1	+	4	336	c.240C>T	c.(238-240)CCC>CCT	p.P80P	ZNF135_uc002qre.2_Silent_p.P80P|ZNF135_uc002qrd.1_Silent_p.P38P|ZNF135_uc002qrf.2_Silent_p.P38P|ZNF135_uc002qrg.2_Silent_p.P38P|ZNF135_uc010yhr.1_5'UTR	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	80					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CTAGACTTCCCCAAGGCGTGT	0.567													36	44	---	---	---	---	PASS
MZF1	7593	broad.mit.edu	37	19	59082675	59082675	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59082675C>G	uc002qto.2	-	2	643	c.82G>C	c.(82-84)GAG>CAG	p.E28Q	LOC100131691_uc002qtm.2_Intron|MZF1_uc002qtn.2_Missense_Mutation_p.E28Q|MZF1_uc010euu.1_Missense_Mutation_p.E69Q	NM_198055	NP_932172	P28698	MZF1_HUMAN	zinc finger protein 42 isoform 2	28					viral reproduction	nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		CCCTCCTCCTCAGAGTCCTCT	0.642													36	52	---	---	---	---	PASS
NRSN2	80023	broad.mit.edu	37	20	334124	334124	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:334124G>A	uc002wdi.3	+	4	998	c.460G>A	c.(460-462)GAA>AAA	p.E154K	NRSN2_uc002wdj.2_RNA|NRSN2_uc002wdl.2_Intron	NM_024958	NP_079234	Q9GZP1	NRSN2_HUMAN	neurensin 2	154						integral to membrane|plasma membrane|transport vesicle					0		all_cancers(10;0.0834)				CTTGGACCCCGAAGCCGACAG	0.622													45	113	---	---	---	---	PASS
CST5	1473	broad.mit.edu	37	20	23856727	23856727	+	3'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23856727G>A	uc002wtr.1	-	3						NM_001900	NP_001891	P28325	CYTD_HUMAN	cystatin D precursor							extracellular region	cysteine-type endopeptidase inhibitor activity|protein binding				0						GGCGCATGAGGAGACCTCCCC	0.617													13	11	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33582027	33582027	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33582027C>G	uc002xbi.1	+	25	2741	c.2649C>G	c.(2647-2649)TTC>TTG	p.F883L		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	841						membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AGCTCTTTTTCAAGATGAAGC	0.647													52	189	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33874706	33874706	+	Missense_Mutation	SNP	G	A	A	rs141772980		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33874706G>A	uc010zux.1	-	4	1994	c.1876C>T	c.(1876-1878)CGG>TGG	p.R626W	EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Missense_Mutation_p.R281W	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	626										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GTCTGCCGCCGCTCATCTGGT	0.627													53	56	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39798838	39798838	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39798838G>A	uc002xjp.1	+	24	2858	c.2737G>A	c.(2737-2739)GCC>ACC	p.A913T	PLCG1_uc002xjo.1_Missense_Mutation_p.A913T|PLCG1_uc010zwe.1_Missense_Mutation_p.A539T|PLCG1_uc010ggf.2_Missense_Mutation_p.A237T	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	913	PH 2; second part.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				GGATGTTGCTGCCGACTCACA	0.612													28	116	---	---	---	---	PASS
CTSA	5476	broad.mit.edu	37	20	44521121	44521121	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44521121G>C	uc002xqj.3	+	5	916	c.442G>C	c.(442-444)GAG>CAG	p.E148Q	NEURL2_uc002xqg.1_5'Flank|CTSA_uc002xqh.2_Missense_Mutation_p.E166Q|CTSA_uc002xqi.2_RNA|CTSA_uc010zxi.1_Missense_Mutation_p.E149Q|CTSA_uc002xqk.3_Missense_Mutation_p.E148Q	NM_001127695	NP_001121167	P10619	PPGB_HUMAN	cathepsin A isoform b precursor	148					intracellular protein transport|proteolysis	endoplasmic reticulum|lysosome|nucleus	enzyme activator activity|protein binding|serine-type carboxypeptidase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TAATGACACTGAGGTGAGTCT	0.552													52	48	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47242457	47242457	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47242457C>T	uc002xtw.1	-	40	4969	c.4946G>A	c.(4945-4947)CGC>CAC	p.R1649H	PREX1_uc002xtv.1_Missense_Mutation_p.R946H	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1649					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTGGCAGAGGCGGTAGAGGCT	0.587													5	20	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62195200	62195200	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62195200C>T	uc002yfm.2	-	9	5867	c.4975G>A	c.(4975-4977)GGC>AGC	p.G1659S	PRIC285_uc002yfl.1_Missense_Mutation_p.G1090S	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	1659					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			GAGTAGTGGCCGCCCTGCTGC	0.711													6	10	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11049513	11049513	+	3'UTR	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11049513G>T	uc002yit.1	-	4						NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGGAGTAACCGCTGTATCCAG	0.458													7	122	---	---	---	---	PASS
SAMSN1	64092	broad.mit.edu	37	21	15870854	15870854	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15870854T>C	uc002yju.1	-	7	910	c.828A>G	c.(826-828)ATA>ATG	p.I276M	SAMSN1_uc010gky.1_Missense_Mutation_p.I108M|SAMSN1_uc002yjv.1_Missense_Mutation_p.I344M	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	276	SAM.				negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GACTCTCTTTTATATCTTTTA	0.323													24	67	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19868214	19868214	+	Silent	SNP	C	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19868214C>A	uc011ahc.1	-	13	1146	c.1113G>T	c.(1111-1113)GCG>GCT	p.A371A	TXNRD2_uc002zql.1_Silent_p.A125A|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Silent_p.A370A|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Silent_p.A21A	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	371					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					CGGCCATGATCGCTATGGGTG	0.622													12	26	---	---	---	---	PASS
TCN2	6948	broad.mit.edu	37	22	31011460	31011460	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31011460G>A	uc003aip.1	+	5	911	c.753G>A	c.(751-753)CAG>CAA	p.Q251Q	TCN2_uc003aiq.1_Silent_p.Q247Q|TCN2_uc003air.1_Silent_p.Q224Q	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor	251					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGCATTACAGGTGGGAAAGA	0.607													44	24	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36889754	36889754	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36889754G>A	uc003apn.3	-	7	1829	c.1721C>T	c.(1720-1722)CCG>CTG	p.P574L	FOXRED2_uc003apm.3_Missense_Mutation_p.P126L|FOXRED2_uc003apo.3_Missense_Mutation_p.P574L|FOXRED2_uc003app.3_Missense_Mutation_p.P574L	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	574					ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						GTGCCCGATCGGGGCAGTCCA	0.557													9	37	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36889755	36889755	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36889755G>A	uc003apn.3	-	7	1828	c.1720C>T	c.(1720-1722)CCG>TCG	p.P574S	FOXRED2_uc003apm.3_Missense_Mutation_p.P126S|FOXRED2_uc003apo.3_Missense_Mutation_p.P574S|FOXRED2_uc003app.3_Missense_Mutation_p.P574S	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	574					ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						TGCCCGATCGGGGCAGTCCAG	0.562													10	37	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3239495	3239495	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3239495T>C	uc004crg.3	-	5	4388	c.4231A>G	c.(4231-4233)AAA>GAA	p.K1411E		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1411	LRR 7.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCAAGCTCTTTAAGAAGGGGA	0.502													30	29	---	---	---	---	PASS
S100G	795	broad.mit.edu	37	X	16669143	16669143	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16669143A>T	uc004cxn.1	+	2	68	c.14A>T	c.(13-15)AAG>ATG	p.K5M	CTPS2_uc004cxk.2_Intron|CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_004057	NP_004048	P29377	S100G_HUMAN	calbindin 3	5							calcium ion binding|vitamin D binding				0	Hepatocellular(33;0.0997)					AGTACTAAAAAGTCTCCTGAG	0.383													32	132	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29973758	29973758	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29973758C>T	uc004dby.2	+	11	2420	c.1912C>T	c.(1912-1914)CTG>TTG	p.L638L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	638	Cytoplasmic (Potential).|Interaction with NCS1.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TACCGGCACCCTGCCTCTTAC	0.502													15	31	---	---	---	---	PASS
FTHL17	53940	broad.mit.edu	37	X	31089732	31089732	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31089732C>G	uc004dcl.1	-	1	442	c.339G>C	c.(337-339)CAG>CAC	p.Q113H		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	113	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						CCAGCAGGCTCTGGTTGACGT	0.602													47	128	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149314	34149314	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149314C>T	uc004ddg.2	-	1	1115	c.1082G>A	c.(1081-1083)CGT>CAT	p.R361H		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	361										ovary(4)|central_nervous_system(1)	5						TAGGCGGAGACGGGACACTCC	0.647													16	55	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44929219	44929219	+	Silent	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44929219A>G	uc004dge.3	+	17	2694	c.2319A>G	c.(2317-2319)CTA>CTG	p.L773L	KDM6A_uc010nhk.2_Silent_p.L739L|KDM6A_uc011mkz.1_Silent_p.L825L|KDM6A_uc011mla.1_Silent_p.L728L|KDM6A_uc011mlb.1_Silent_p.L780L|KDM6A_uc011mlc.1_Silent_p.L477L|KDM6A_uc011mld.1_Silent_p.L412L	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	773					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						CAGGTTTACTAAGTTCAGACA	0.478			D|N|F|S		renal|oesophageal SCC|MM								22	25	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962089	73962089	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962089G>C	uc004eby.2	-	3	2920	c.2303C>G	c.(2302-2304)TCA>TGA	p.S768*		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	768					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GGAACTGTTTGATGTCCCAGG	0.423													19	64	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76764097	76764097	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76764097C>G	uc004ecp.3	-	35	7443	c.7211G>C	c.(7210-7212)TGT>TCT	p.C2404S	ATRX_uc004ecq.3_Missense_Mutation_p.C2366S|ATRX_uc004eco.3_Missense_Mutation_p.C2189S	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2404					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TCGCTGAACACAGCTGATTAA	0.403			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						121	155	---	---	---	---	PASS
CYSLTR1	10800	broad.mit.edu	37	X	77528135	77528135	+	3'UTR	SNP	T	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77528135T>C	uc004edb.2	-	3					CYSLTR1_uc010nma.2_3'UTR|CYSLTR1_uc010nmb.2_3'UTR	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1						elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity			ovary(1)	1					Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	ATTTGtaaaatattaagtaaa	0.254													7	5	---	---	---	---	PASS
SH3BGRL	6451	broad.mit.edu	37	X	80552787	80552787	+	3'UTR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80552787G>C	uc004eef.2	+	4					SH3BGRL_uc011mqs.1_RNA|SH3BGRL_uc010nml.2_RNA|SH3BGRL_uc010nmm.2_3'UTR|SH3BGRL_uc010nmn.2_3'UTR	NM_003022	NP_003013	O75368	SH3L1_HUMAN	SH3 domain binding glutamic acid-rich protein							cytoplasm|nucleus	SH3 domain binding|SH3/SH2 adaptor activity			ovary(1)	1		all_lung(315;5.94e-05)				TTATAAAATAGCAGAATTAGC	0.323													13	28	---	---	---	---	PASS
GPRASP2	114928	broad.mit.edu	37	X	101969725	101969725	+	5'UTR	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101969725C>T	uc004ejk.2	+	4					GPRASP2_uc004ejl.2_5'UTR|GPRASP2_uc004ejm.2_5'UTR|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting							cytoplasm	protein binding			ovary(1)	1						agaaacaaacctgtgacagat	0.080													32	28	---	---	---	---	PASS
BHLHB9	80823	broad.mit.edu	37	X	102004206	102004206	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102004206G>C	uc010nog.2	+	4	854	c.283G>C	c.(283-285)GAG>CAG	p.E95Q	BHLHB9_uc011mrq.1_Missense_Mutation_p.E95Q|BHLHB9_uc011mrr.1_Missense_Mutation_p.E95Q|BHLHB9_uc011mrs.1_Missense_Mutation_p.E95Q|BHLHB9_uc011mrt.1_Missense_Mutation_p.E95Q|BHLHB9_uc004ejo.2_Missense_Mutation_p.E95Q|BHLHB9_uc011mru.1_Missense_Mutation_p.E95Q|BHLHB9_uc011mrv.1_Missense_Mutation_p.E95Q	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	95						cytoplasm|nucleus	binding			ovary(2)	2						GGCTGGGAATGAGTCCACCAG	0.512													18	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	106846053	106846053	+	IGR	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106846053G>T								CXorf41 (358581 upstream) : PRPS1 (25601 downstream)																							CTGGCTGCCCGGCTGGACACC	0.637													14	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	107037530	107037530	+	IGR	SNP	G	C	C			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107037530G>C								TSC22D3 (18328 upstream) : MID2 (31554 downstream)																							TTCAGTGGCCGTAAATTTCAG	0.433													10	42	---	---	---	---	PASS
NXT2	55916	broad.mit.edu	37	X	108780101	108780101	+	5'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108780101G>A	uc004eof.1	+	1					NXT2_uc004eoe.1_Intron|NXT2_uc004eog.1_5'Flank	NM_018698	NP_061168	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2						mRNA transport|protein transport	cytoplasm|nucleus				ovary(1)	1						GAGAGAATGGGAGGGTGGAAA	0.532													7	10	---	---	---	---	PASS
KLHL13	90293	broad.mit.edu	37	X	117053608	117053608	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117053608A>G	uc004eql.2	-	4	508	c.446T>C	c.(445-447)ATT>ACT	p.I149T	KLHL13_uc004eqk.2_Missense_Mutation_p.I98T|KLHL13_uc011mtn.1_Intron|KLHL13_uc011mto.1_Missense_Mutation_p.I143T|KLHL13_uc011mtp.1_Missense_Mutation_p.I151T|KLHL13_uc004eqm.2_Missense_Mutation_p.I98T|KLHL13_uc011mtq.1_Missense_Mutation_p.I133T	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	149	BTB.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						AATGAAATCAATAATTTTCCT	0.353													55	88	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118223343	118223343	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118223343A>G	uc004era.3	-	11	1850	c.1850T>C	c.(1849-1851)ATG>ACG	p.M617T		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	617										ovary(4)|skin(1)	5						TCTCCTTCCCATGTCATCTTT	0.463													41	36	---	---	---	---	PASS
SH2D1A	4068	broad.mit.edu	37	X	123504041	123504041	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123504041C>T	uc004euf.3	+	3	562	c.217C>T	c.(217-219)CAT>TAT	p.H73Y	SH2D1A_uc004euh.3_Missense_Mutation_p.H73Y|SH2D1A_uc004eug.3_Intron|SH2D1A_uc010nqw.2_Intron|SH2D1A_uc004eui.3_RNA|SH2D1A_uc010nqx.2_Intron	NM_002351	NP_002342	O60880	SH21A_HUMAN	SH2 domain protein 1A isoform 1	73	SH2.				cell-cell signaling|cellular defense response	cytoplasm	SH3/SH2 adaptor activity				0						ACCTGGGGTACATAAAAGATA	0.368									X-linked_Lymphoproliferative_syndrome				65	112	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129149014	129149014	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129149014C>T	uc004evb.1	+	4	2380	c.2266C>T	c.(2266-2268)CAA>TAA	p.Q756*	BCORL1_uc010nrd.1_Nonsense_Mutation_p.Q658*	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	756					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						CATCATTGATCAAGGAGAGCC	0.602													28	83	---	---	---	---	PASS
MIR424	494336	broad.mit.edu	37	X	133680727	133680727	+	RNA	SNP	T	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133680727T>A	hsa-mir-424|MI0001446	-			c.15T>A			MGC16121_uc011mvm.1_5'Flank|MGC16121_uc004exm.2_5'Flank|MIR503_hsa-mir-503|MI0003188_5'Flank|uc011mvn.1_5'Flank|MGC16121_uc011mvo.1_RNA																	0						CATGAATTGCTGCTGTATCCC	0.562													11	18	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134987445	134987445	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134987445G>T	uc004ezh.2	+	5	515	c.348G>T	c.(346-348)AGG>AGT	p.R116S	SAGE1_uc010nry.1_Missense_Mutation_p.R85S|SAGE1_uc011mvv.1_Missense_Mutation_p.R116S	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	116										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GTGAAGAGAGGATGGAAAATG	0.463													20	96	---	---	---	---	PASS
LDOC1	23641	broad.mit.edu	37	X	140271220	140271220	+	5'UTR	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140271220G>A	uc004fbj.2	-	1						NM_012317	NP_036449	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1						negative regulation of cell proliferation	nucleus	protein binding				0	Acute lymphoblastic leukemia(192;7.65e-05)					GAACGGCCTGGAAGGACAGGA	0.622													17	19	---	---	---	---	PASS
SPANXN3	139067	broad.mit.edu	37	X	142596840	142596840	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142596840G>A	uc004fbw.2	-	2	318	c.230C>T	c.(229-231)TCC>TTC	p.S77F		NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN	SPANX-N3 protein	77										ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGATTGATGGAGTTCTCTTG	0.393													115	132	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148037678	148037678	+	Silent	SNP	C	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148037678C>T	uc004fcp.2	+	11	2582	c.2103C>T	c.(2101-2103)GGC>GGT	p.G701G	AFF2_uc004fcq.2_Silent_p.G691G|AFF2_uc004fcr.2_Silent_p.G662G|AFF2_uc011mxb.1_Silent_p.G666G|AFF2_uc004fcs.2_Silent_p.G668G|AFF2_uc011mxc.1_Silent_p.G342G	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	701					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGCCTGGCAAGATTGTGC	0.502													39	165	---	---	---	---	PASS
MTM1	4534	broad.mit.edu	37	X	149809883	149809883	+	Nonsense_Mutation	SNP	C	T	T	rs132630306		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149809883C>T	uc004fef.3	+	8	746	c.670C>T	c.(670-672)CGA>TGA	p.R224*	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Nonsense_Mutation_p.R187*|MTM1_uc011mxz.1_Nonsense_Mutation_p.R109*|MTM1_uc010nte.2_Nonsense_Mutation_p.R92*	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	224	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GTCCCGAAATCGAATTCCAGT	0.438													25	106	---	---	---	---	PASS
CD99L2	83692	broad.mit.edu	37	X	149963917	149963917	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149963917G>T	uc004fel.2	-	5	438	c.320C>A	c.(319-321)ACC>AAC	p.T107N	CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Missense_Mutation_p.T58N|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	107	Extracellular (Potential).				cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGCTCTGGTGGTTACTGGCCT	0.517													44	193	---	---	---	---	PASS
OPN1MW	2652	broad.mit.edu	37	X	153496064	153496064	+	Silent	SNP	G	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153496064G>A	uc004fkd.2	+	5	874	c.792G>A	c.(790-792)AAG>AAA	p.K264K		NM_000513	NP_000504	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive	264	Cytoplasmic.				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGCAGAGAAGGAAGTGACGC	0.582													37	109	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	100288464	100288466	+	IGR	DEL	ACC	-	-	rs79614284		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100288464_100288466delACC								FRRS1 (57115 upstream) : AGL (27174 downstream)																							tacctcctctacctcctctacct	0.059													6	4	---	---	---	---	
NEK2	4751	broad.mit.edu	37	1	211840578	211840579	+	Intron	DEL	AA	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211840578_211840579delAA	uc001hir.1	-						NEK2_uc001hiq.1_Intron|NEK2_uc001his.3_Intron	NM_002497	NP_002488	P51955	NEK2_HUMAN	NIMA-related kinase 2						cell division|centrosome separation|G2/M transition of mitotic cell cycle|meiosis|protein autophosphorylation|regulation of mitosis	centrosome|condensed chromosome kinetochore|cytosol|nucleolus	ATP binding|metal ion binding|protein binding|protein phosphatase binding|protein serine/threonine kinase activity			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		CTTTCTCTTTAAAAAGAGAATG	0.361													195	39	---	---	---	---	
MRPL30	51263	broad.mit.edu	37	2	99779612	99779612	+	Intron	DEL	A	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779612delA	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						ATTGTATGTCAAAAAAAAACC	0.289													5	6	---	---	---	---	
FIGN	55137	broad.mit.edu	37	2	164466194	164466201	+	Frame_Shift_Del	DEL	AATGGCTG	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466194_164466201delAATGGCTG	uc002uck.1	-	3	2452_2459	c.2141_2148delCAGCCATT	c.(2140-2148)TCAGCCATTfs	p.S714fs		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	714_716						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GGCTGGGCATAATGGCTGAAAGGTCTGT	0.495													5	35	---	---	---	---	
RBM44	375316	broad.mit.edu	37	2	238738204	238738205	+	Intron	INS	-	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238738204_238738205insT	uc002vxi.3	+							NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44								nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		CTGTAAGTAGCTTTGTAGAATA	0.386													6	45	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32762384	32762387	+	Intron	DEL	TTCC	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32762384_32762387delTTCC	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						tttccttcttttccttccttcctt	0.059													4	2	---	---	---	---	
CSPG5	10675	broad.mit.edu	37	3	47619021	47619040	+	Frame_Shift_Del	DEL	AGAAGCTGGGCTCAGCTTGT	-	-	rs35863063	byFrequency	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47619021_47619040delAGAAGCTGGGCTCAGCTTGT	uc003crp.3	-	2	652_671	c.476_495delACAAGCTGAGCCCAGCTTCT	c.(475-495)GACAAGCTGAGCCCAGCTTCTfs	p.D159fs	CSPG5_uc003crn.2_Frame_Shift_Del_p.D21fs|CSPG5_uc003cro.3_Frame_Shift_Del_p.D159fs|CSPG5_uc011bbb.1_Frame_Shift_Del_p.D21fs	NM_006574	NP_006565	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan	159_165	Extracellular (Potential).				cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGGGGAGTTCAGAAGCTGGGCTCAGCTTGTCGCCGGGGGT	0.659													28	22	---	---	---	---	
PRKAR2A	5576	broad.mit.edu	37	3	48831588	48831588	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48831588delT	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148	P13861	KAP2_HUMAN	cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		ttttcttttcttttttttttt	0.129													4	2	---	---	---	---	
KPNA4	3840	broad.mit.edu	37	3	160219811	160219812	+	3'UTR	DEL	TA	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219811_160219812delTA	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			tatatatatgtatatatatata	0.302													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25042989	25042989	+	IGR	DEL	T	-	-	rs35642561		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25042989delT								LGI2 (10575 upstream) : SEPSECS (78639 downstream)																							tctttcttgcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25497596	25497597	+	IGR	INS	-	TTCC	TTCC			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25497596_25497597insTTCC								ANAPC4 (77477 upstream) : SLC34A2 (159838 downstream)																							tctcatttcatttccttccttc	0.064													4	2	---	---	---	---	
TEC	7006	broad.mit.edu	37	4	48178033	48178034	+	Intron	DEL	TG	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48178033_48178034delTG	uc003gxz.2	-							NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						GACAGGAAACTGTAATGTCAAA	0.401													32	13	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183268148	183268149	+	Intron	INS	-	G	G	rs138363616	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183268148_183268149insG	uc003ivd.1	+						ODZ3_uc010irv.1_Intron	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		GTTGACTCCGCGGGGGGGGATG	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20095674	20095675	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs59909046		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20095674_20095675insAAGAAAGG								CDH18 (107367 upstream) : None (None downstream)																							gaaagaaaggaaagaaaggaag	0.054													4	5	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31840576	31840576	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31840576delT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TCCAGAGGTCTTTTTTTTTTT	0.289													9	6	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20955922	20955922	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20955922delT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CTCCTTCACATTTTTTTTTTG	0.383													203	8	---	---	---	---	
C6orf223	221416	broad.mit.edu	37	6	43970504	43970509	+	In_Frame_Del	DEL	GCGGCG	-	-	rs72369323		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43970504_43970509delGCGGCG	uc003own.2	+	4	388_393	c.370_375delGCGGCG	c.(370-375)GCGGCGdel	p.AA130del	uc003owm.1_Intron|C6orf223_uc003owo.2_In_Frame_Del_p.AA110del	NM_153246	NP_694978	Q8N319	CF223_HUMAN	hypothetical protein LOC221416	130_131	Ala-rich.										0	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			GGTAGAGCGCgcggcggcggcggcgg	0.636													6	4	---	---	---	---	
XKR5	389610	broad.mit.edu	37	8	6679301	6679302	+	Intron	DEL	CA	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6679301_6679302delCA	uc003wqp.2	-						XKR5_uc003wqq.2_Intron|XKR5_uc003wqr.1_Intron	NM_207411	NP_997294	Q6UX68	XKR5_HUMAN	XK-related protein 5a							integral to membrane					0			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TGCATTGGTGcacacacacaca	0.287													4	2	---	---	---	---	
IL33	90865	broad.mit.edu	37	9	6254568	6254568	+	Intron	DEL	T	-	-	rs10975521		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6254568delT	uc003zjt.2	+						IL33_uc011lmg.1_Intron|IL33_uc011lmh.1_Intron|IL33_uc003zju.1_Intron	NM_033439	NP_254274	O95760	IL33_HUMAN	interleukin 33 precursor						positive regulation of chemokine secretion|positive regulation of inflammatory response|positive regulation of macrophage activation|positive regulation of transcription from RNA polymerase II promoter	extracellular space	cytokine activity				0		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		AAAAAAAAAATTTATCTATAT	0.358													4	2	---	---	---	---	
GKAP1	80318	broad.mit.edu	37	9	86354664	86354664	+	Intron	DEL	A	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86354664delA	uc004amy.2	-						GKAP1_uc004amz.2_Intron	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a						signal transduction	Golgi apparatus					0						GCCACCCTGTAAAAAAAAAAA	0.343													46	11	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94984623	94984623	+	Intron	DEL	A	-	-	rs71511611		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94984623delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	actcagtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	118436755	118436756	+	IGR	DEL	CT	-	-	rs79877379		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118436755_118436756delCT								DEC1 (271832 upstream) : C9orf27 (213790 downstream)																							cctttctttcctctctctctct	0.030													4	2	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27434230	27434231	+	Intron	INS	-	A	A	rs117799729		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27434230_27434231insA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						AAAAAAAAAACAAAAAAAAAAC	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38368813	38368813	+	IGR	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38368813delT								ZNF33A (14787 upstream) : ZNF37A (14462 downstream)																							cttttttttcttttttttttt	0.224													4	2	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60273190	60273193	+	Intron	DEL	CGGC	-	-	rs10571555		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60273190_60273193delCGGC	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CTCCAGCCTACGGCCGGCCGGTTT	0.667													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	105010919	105010921	+	Intron	DEL	CAC	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105010919_105010921delCAC	uc001kwr.2	-											Homo sapiens, clone IMAGE:5199023, mRNA.																		ccaccaccatcaccaccaccacc	0.000													6	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4159297	4159298	+	Intron	INS	-	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4159297_4159298insG	uc001lyw.3	+						RRM1_uc009yej.2_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron|RRM1_uc010qyd.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	gctggccgggcgggggctgacc	0.089													4	2	---	---	---	---	
E2F8	79733	broad.mit.edu	37	11	19247567	19247569	+	Intron	DEL	GAG	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19247567_19247569delGAG	uc001mpm.2	-						E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Intron	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CTGGCTCCTAGAGGAGAATACCC	0.542													8	4	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89125143	89125146	+	Intron	DEL	TTCT	-	-	rs140065127		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89125143_89125146delTTCT	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ccttccttccttctttccttcctt	0.211													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27287821	27287821	+	IGR	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27287821delT								C12orf71 (52366 upstream) : STK38L (109257 downstream)																							GGATTATTCCTTTTTTTGTTC	0.328													4	4	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31231624	31231624	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31231624delT	uc001rjt.1	+						DDX11_uc010sjw.1_Intron|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TATTAAAGtcttttttttttt	0.184										Multiple Myeloma(12;0.14)			4	2	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110240772	110240772	+	Intron	DEL	C	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110240772delC	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CCCCGTGGCACCCCTGCCCAG	0.592													18	27	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91233373	91233373	+	Intron	DEL	A	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91233373delA	uc001xyp.2	-							NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				TTTATataccaaaaaaaaaaa	0.224													4	2	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104053846	104053846	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104053846delT	uc010tyd.1	+						C14orf153_uc001ynl.3_Intron|C14orf153_uc010tyc.1_Intron	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				tctttttttcttttttttttt	0.129													3	3	---	---	---	---	
CCNB2	9133	broad.mit.edu	37	15	59407214	59407215	+	Intron	INS	-	A	A			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59407214_59407215insA	uc002afz.2	+						CCNB2_uc010bge.2_Intron	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2						cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						CTTTGGGGACTAAAAAGGGAAG	0.396													12	7	---	---	---	---	
IREB2	3658	broad.mit.edu	37	15	78758544	78758544	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78758544delT	uc002bdr.2	+						IREB2_uc010unb.1_Intron|IREB2_uc002bdq.2_Intron	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2								4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		CTAATGTGCGTTTTTTTTTAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79045474	79045474	+	RNA	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79045474delT	uc002bei.2	+	2		c.151delT								Homo sapiens similar to TBC1 domain family, member 2B, mRNA (cDNA clone IMAGE:40132505), partial cds.																		CAGTATCTCCTTTGGGGACCT	0.612													4	2	---	---	---	---	
GOT2	2806	broad.mit.edu	37	16	58767917	58767918	+	Intron	DEL	GT	-	-	rs143852021		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58767917_58767918delGT	uc002eof.1	-						GOT2_uc010vim.1_Intron	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor						aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	TGGCAGAAAAGTGTGTGTGTGT	0.639													4	2	---	---	---	---	
FNDC8	54752	broad.mit.edu	37	17	33449007	33449007	+	Intron	DEL	T	-	-	rs67915235		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33449007delT	uc002hix.2	+						RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank|RAD51L3_uc002hiw.1_5'Flank|RAD51L3_uc002hiv.1_5'Flank|RAD51L3_uc010ctl.1_5'Flank|RAD51L3_uc010ctm.1_5'Flank	NM_017559	NP_060029	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8											ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		ccttccttccttttttttttt	0.065													5	4	---	---	---	---	
ATXN7L3	56970	broad.mit.edu	37	17	42274145	42274146	+	Intron	INS	-	AA	AA	rs146489725		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42274145_42274146insAA	uc002iga.2	-						ATXN7L3_uc010wiv.1_5'Flank|ATXN7L3_uc002ifz.2_Intron	NM_001098833	NP_001092303	Q14CW9	AT7L3_HUMAN	ataxin 7-like 3 isoform b						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|metal ion binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		gaatccatctcaaaaaaaaaaa	0.153													9	4	---	---	---	---	
SEPT4	5414	broad.mit.edu	37	17	56603934	56603935	+	Intron	INS	-	AC	AC	rs9891939		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56603934_56603935insAC	uc002iwm.1	-						SEPT4_uc002iwk.1_Intron|SEPT4_uc010wnw.1_Intron|SEPT4_uc002iwl.1_5'UTR|SEPT4_uc002iwn.1_Intron|SEPT4_uc002iwo.1_Intron|SEPT4_uc002iwp.1_Intron|SEPT4_uc010wnx.1_Intron|SEPT4_uc010wny.1_Intron|SEPT4_uc010dcy.1_Intron	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1						apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					cacacacacaaacacacacaca	0.421													6	3	---	---	---	---	
INTS2	57508	broad.mit.edu	37	17	59974795	59974795	+	Intron	DEL	T	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59974795delT	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						TAGAAACACCTTTTTTTTTTT	0.303													5	3	---	---	---	---	
ASF1B	55723	broad.mit.edu	37	19	14247338	14247339	+	5'UTR	INS	-	G	G	rs140252988	by1000genomes	TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14247338_14247339insG	uc002mye.2	-	1					uc002myf.2_5'Flank	NM_018154	NP_060624	Q9NVP2	ASF1B_HUMAN	anti-silencing function 1B						cell differentiation|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus					0						CTGGGTCCGGTGGGGTCAGTGG	0.708													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53703995	53703995	+	IGR	DEL	T	-	-	rs113703393		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53703995delT								ZNF665 (7376 upstream) : ZNF677 (34643 downstream)																							TGTTTCCCCCttttttttttt	0.229													4	2	---	---	---	---	
SLC9A8	23315	broad.mit.edu	37	20	48500760	48500761	+	Intron	INS	-	G	G			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48500760_48500761insG	uc002xuv.1	+						SLC9A8_uc010zym.1_Intron|SLC9A8_uc010gic.2_3'UTR|SLC9A8_uc010gid.2_Intron	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8							Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			cacacacacacacacacacaca	0.183													4	2	---	---	---	---	
CBS	875	broad.mit.edu	37	21	44474239	44474240	+	Intron	INS	-	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44474239_44474240insT	uc002zcu.2	-						CBS_uc002zcs.1_Intron|CBS_uc002zct.2_Intron|CBS_uc002zcw.3_Intron|CBS_uc002zcv.2_Intron	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase						cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	GGCTGTGttccttttttttttt	0.356													4	2	---	---	---	---	
PPM1F	9647	broad.mit.edu	37	22	22277273	22277273	+	3'UTR	DEL	C	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22277273delC	uc002zvp.1	-	8					PPM1F_uc011aik.1_3'UTR	NM_014634	NP_055449	P49593	PPM1F_HUMAN	protein phosphatase 1F						apoptosis|protein dephosphorylation	protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(2)|large_intestine(1)|breast(1)|kidney(1)	5	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		CCACCATCTGCCCGCCACCCA	0.652													7	5	---	---	---	---	
CDKL5	6792	broad.mit.edu	37	X	18660407	18660407	+	Intron	DEL	C	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18660407delC	uc004cym.2	+						CDKL5_uc004cyn.2_Intron|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5						neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					TTTGCGGGTGCCCCCCAAAAT	0.368													7	5	---	---	---	---	
MAGEB4	4115	broad.mit.edu	37	X	30260833	30260833	+	Frame_Shift_Del	DEL	C	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30260833delC	uc004dcb.2	+	1	665	c.581delC	c.(580-582)ACCfs	p.T194fs	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	194	MAGE.									ovary(1)	1						AGTGCCTGGACCCTTCCAAGG	0.522													64	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48155373	48155373	+	3'UTR	DEL	C	-	-			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48155373delC	uc010nib.1	-	8						NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		TGAACACTTGCTTTCACTTGC	0.448													38	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128740973	128740980	+	IGR	DEL	AAGGAAGT	-	-	rs72146220		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128740973_128740980delAAGGAAGT								OCRL (14445 upstream) : APLN (38346 downstream)																							ggaaagaaggaaggaagtaaggaaggaa	0.091													4	2	---	---	---	---	
SPANXC	64663	broad.mit.edu	37	X	140357857	140357858	+	Intron	INS	-	T	T			TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140357857_140357858insT	uc004fbl.2	-									Q9NY87	SPNXC_HUMAN	Homo sapiens nuclear-associated protein SPAN-Xa (SPANX) mRNA, complete cds.							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					ttctctttttcttttttttttc	0.366													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150192021	150192022	+	IGR	INS	-	T	T	rs34005723		TCGA-C4-A0EZ-01	TCGA-C4-A0EZ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150192021_150192022insT								HMGB3 (32775 upstream) : GPR50 (153037 downstream)																							ACTGTCAATTCTTTTTTTTTTT	0.223													3	3	---	---	---	---	
