Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCDC27	148870	broad.mit.edu	37	1	3672130	3672130	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3672130C>T	uc001akv.2	+	3	633	c.552C>T	c.(550-552)GAC>GAT	p.D184D		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	184										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CGAACGTGGACGGTGAGGGAG	0.647													21	228	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7798119	7798119	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7798119C>G	uc001aoi.2	+	16	3966	c.3759C>G	c.(3757-3759)TTC>TTG	p.F1253L	CAMTA1_uc010nzv.1_Missense_Mutation_p.F340L|CAMTA1_uc001aok.3_Missense_Mutation_p.F296L|CAMTA1_uc001aoj.2_Missense_Mutation_p.F209L	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1253					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTGAGTACTTCCAGACAAGGC	0.488													26	103	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11596720	11596720	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11596720C>T	uc001ash.3	+	21	4294	c.4156C>T	c.(4156-4158)CTG>TTG	p.L1386L		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1386	Cytoplasmic (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TAAGATTCCCCTGCCCGCAGG	0.672													3	10	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16914278	16914278	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16914278C>G	uc009vos.1	-	10	1396	c.508G>C	c.(508-510)GAG>CAG	p.E170Q	NBPF1_uc009vot.1_5'Flank|NBPF1_uc001ayz.1_5'Flank|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	170	NBPF 1.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTCATCCTCATCTTCGTCA	0.428													9	497	---	---	---	---	PASS
PADI4	23569	broad.mit.edu	37	1	17690129	17690129	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17690129G>A	uc001baj.2	+	16	1899	c.1871G>A	c.(1870-1872)GGC>GAC	p.G624D		NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	624					chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	GAGCCACTGGGCCTCCAGTGC	0.617													7	47	---	---	---	---	PASS
SRRM1	10250	broad.mit.edu	37	1	24993374	24993374	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24993374C>A	uc001bjm.2	+	13	1921	c.1697C>A	c.(1696-1698)CCT>CAT	p.P566H	SRRM1_uc010oel.1_Missense_Mutation_p.P578H|SRRM1_uc009vrh.1_Missense_Mutation_p.P539H|SRRM1_uc009vri.1_Missense_Mutation_p.P495H|SRRM1_uc010oem.1_RNA	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	566	Pro-rich.|Necessary for speckles and matrix localization.|Arg-rich.|Ser-rich.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCCGCCCCTCCTCCTCGACGG	0.537													5	75	---	---	---	---	PASS
SRRM1	10250	broad.mit.edu	37	1	24993386	24993386	+	Missense_Mutation	SNP	G	T	T	rs78787676	byFrequency	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24993386G>T	uc001bjm.2	+	13	1933	c.1709G>T	c.(1708-1710)CGC>CTC	p.R570L	SRRM1_uc010oel.1_Missense_Mutation_p.R582L|SRRM1_uc009vrh.1_Missense_Mutation_p.R543L|SRRM1_uc009vri.1_Missense_Mutation_p.R499L|SRRM1_uc010oem.1_RNA	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	570	Pro-rich.|Necessary for speckles and matrix localization.|Arg-rich.|Ser-rich.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCTCGACGGCGCAGGACTCCC	0.532													5	77	---	---	---	---	PASS
LSM10	84967	broad.mit.edu	37	1	36859515	36859515	+	Silent	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36859515G>C	uc001cao.1	-	2	366	c.216C>G	c.(214-216)CTC>CTG	p.L72L		NM_032881	NP_116270	Q969L4	LSM10_HUMAN	LSM10, U7 small nuclear RNA associated	72					histone mRNA metabolic process|mRNA processing|RNA splicing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	Cajal body|U7 snRNP	histone pre-mRNA DCP binding|protein binding				0		Myeloproliferative disorder(586;0.0393)				CTGTCACAAAGAGGTCATCCA	0.552													21	83	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84373315	84373315	+	Missense_Mutation	SNP	G	A	A	rs143330409		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84373315G>A	uc001djc.2	-	16	2212	c.1816C>T	c.(1816-1818)CGG>TGG	p.R606W	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_RNA|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	606					cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GAGATGGACCGAGGGCAGCTG	0.468													5	34	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254													5	82	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158736452	158736452	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158736452G>T	uc010piq.1	-	1	21	c.21C>A	c.(19-21)AGC>AGA	p.S7R		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					CTGCTACCTGGCTCCAGTTCC	0.463													10	37	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160098715	160098715	+	Intron	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160098715G>A	uc001fvc.2	+						ATP1A2_uc001fvb.2_Intron|ATP1A2_uc010piz.1_3'UTR|ATP1A2_uc001fvd.2_Intron|ATP1A2_uc009wtg.1_Intron	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GTGAGTGGTTGAGATAAAGGC	0.592													3	12	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171086316	171086316	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171086316C>T	uc001ghi.2	+	9	1444	c.1333C>T	c.(1333-1335)CCC>TCC	p.P445S	FMO3_uc001ghh.2_Missense_Mutation_p.P445S|FMO3_uc010pmb.1_Missense_Mutation_p.P425S|FMO3_uc010pmc.1_Missense_Mutation_p.P382S	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	445				KP -> T (in Ref. 1; AAA86284).	xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGGGGCAAAGCCCAACATCCC	0.483													39	51	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175067712	175067712	+	Silent	SNP	C	T	T	rs150075962	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175067712C>T	uc001gkl.1	+	9	2213	c.2100C>T	c.(2098-2100)GCC>GCT	p.A700A	TNN_uc010pmx.1_Silent_p.A611A	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	700	Fibronectin type-III 5.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCAAGAAGGCCGACACCAAGG	0.572													33	91	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202710600	202710600	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202710600C>T	uc001gyf.2	-	19	2956	c.2840G>A	c.(2839-2841)GGG>GAG	p.G947E	KDM5B_uc009xag.2_Missense_Mutation_p.G983E|KDM5B_uc001gyg.1_Missense_Mutation_p.G789E	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	947					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CGGGGCCAGCCCTACCCCTAG	0.547													35	61	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248570286	248570286	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570286C>T	uc010pzm.1	+	1	991	c.991C>T	c.(991-993)CTC>TTC	p.L331F		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	331	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTACACCATTCTCACACCCAT	0.527													60	210	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27917614	27917614	+	3'UTR	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27917614A>G	uc002rlk.3	+	14						NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),							cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					GGGATAATGTATCAAATTGAA	0.378													45	43	---	---	---	---	PASS
ASB3	51130	broad.mit.edu	37	2	53992709	53992709	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53992709T>C	uc002rxg.1	-	2	136	c.1A>G	c.(1-3)ATG>GTG	p.M1V	ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Missense_Mutation_p.M39V|ASB3_uc010yoo.1_Missense_Mutation_p.M1V|CHAC2_uc002rxk.1_5'Flank|uc002rxj.1_5'Flank	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3	1					intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTAAAATCCATTTGTTTGACC	0.443													16	107	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74043846	74043846	+	Silent	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74043846G>T	uc002sjr.1	+	3	2617	c.2496G>T	c.(2494-2496)GTG>GTT	p.V832V		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	832										ovary(2)	2						CCACTGCTGTGACCAGTCTCC	0.493													9	69	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79312181	79312181	+	3'UTR	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79312181C>A	uc002sny.2	-	6						NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor						cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						TTTTATTTTTCAGGGCTCTAG	0.433													7	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90212007	90212007	+	RNA	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90212007G>A	uc010fhm.2	+	26		c.3431G>A								Parts of antibodies, mostly variable regions.																		CCCTGTCTTTGTCTCCAGGGG	0.512													5	57	---	---	---	---	PASS
FAHD2B	151313	broad.mit.edu	37	2	97749407	97749407	+	3'UTR	SNP	C	T	T	rs79549240		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97749407C>T	uc002sxm.2	-	8						NM_199336	NP_955368	Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing								hydrolase activity|metal ion binding				0						CTGGCACCTGCCCACACCTGC	0.597													4	15	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179597433	179597433	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179597433A>G	uc010zfg.1	-	53	12847	c.12623T>C	c.(12622-12624)TTT>TCT	p.F4208S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.F869S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5135							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAGTTACAAAACTGGGTGG	0.403													11	13	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227953429	227953429	+	Silent	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227953429G>T	uc010zlt.1	-	22	2217	c.1563C>A	c.(1561-1563)GGC>GGA	p.G521G		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	521	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TTCCAAGCCAGCCAGGGAGCC	0.587													111	71	---	---	---	---	PASS
MFF	56947	broad.mit.edu	37	2	228194378	228194378	+	5'UTR	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228194378A>G	uc002vos.2	+	3					MFF_uc002vot.2_Intron|MFF_uc002vou.2_5'UTR|MFF_uc002vov.2_Intron|MFF_uc002vow.2_Intron|MFF_uc002vox.2_Intron|MFF_uc002voy.2_5'UTR|MFF_uc002voz.2_Intron	NM_020194	NP_064579	Q9GZY8	MFF_HUMAN	mitochondrial fission factor							integral to membrane|mitochondrial outer membrane				large_intestine(1)	1						TCAAATGTGTAGGGGAATTGT	0.318													3	34	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13669333	13669333	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13669333C>T	uc011avb.1	+	10	2417	c.2292C>T	c.(2290-2292)GAC>GAT	p.D764D	FBLN2_uc011auz.1_Silent_p.D790D|FBLN2_uc011ava.1_Silent_p.D811D|FBLN2_uc011avc.1_Silent_p.D811D	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	764	EGF-like 4; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCGCTGCAGACGTGGATGAGT	0.652													12	24	---	---	---	---	PASS
ITGA9	3680	broad.mit.edu	37	3	37826549	37826549	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37826549G>C	uc003chd.2	+	26	2922	c.2869G>C	c.(2869-2871)GGG>CGG	p.G957R		NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	957	Extracellular (Potential).				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AATAGCTCATGGGAACCCAGA	0.562													21	67	---	---	---	---	PASS
PLXNB1	5364	broad.mit.edu	37	3	48453976	48453976	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48453976G>A	uc003csw.2	-	26	5178	c.4908C>T	c.(4906-4908)TAC>TAT	p.Y1636Y	PLXNB1_uc003cst.2_Silent_p.Y86Y|PLXNB1_uc003csu.2_Silent_p.Y1453Y|PLXNB1_uc003csx.2_Silent_p.Y1636Y	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	1636	Cytoplasmic (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGATGCCACGTAGGCACGGT	0.572													18	58	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48605196	48605196	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605196C>A	uc003ctz.2	-	107	7931	c.7930G>T	c.(7930-7932)GGA>TGA	p.G2644*		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2644	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCAGCTTCTCCCTGCAGGCAT	0.672													54	139	---	---	---	---	PASS
RBM6	10180	broad.mit.edu	37	3	50114585	50114585	+	3'UTR	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50114585T>C	uc003cyc.2	+	21					RBM6_uc003cyd.2_3'UTR|RBM6_uc003cye.2_3'UTR|RBM6_uc011bdi.1_3'UTR|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ACAAGTTCCATGGGATACAAC	0.368													17	57	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66430809	66430809	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66430809A>G	uc003dmx.2	-	19	3174	c.3160T>C	c.(3160-3162)TAC>CAC	p.Y1054H	SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Missense_Mutation_p.Y674H|LRIG1_uc003dmw.2_Missense_Mutation_p.Y720H|LRIG1_uc010hnz.2_Missense_Mutation_p.Y770H|LRIG1_uc010hoa.2_Missense_Mutation_p.Y1031H	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	1054	Cytoplasmic (Potential).					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		ACAAGCAAGTACTGGGCTTCC	0.567													38	131	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100364943	100364943	+	Silent	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100364943T>C	uc003duc.2	+	9	1369	c.1101T>C	c.(1099-1101)TTT>TTC	p.F367F	GPR128_uc011bhc.1_Silent_p.F68F	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	367	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						ACATGGTCTTTAGTCCAAAGG	0.378													29	51	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	120973778	120973778	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120973778A>T	uc003eec.3	+	16	1618	c.1478A>T	c.(1477-1479)AAA>ATA	p.K493I	STXBP5L_uc011bji.1_Missense_Mutation_p.K493I	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	493					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AAAACTTCAAAAGTGTTTGAA	0.348													11	21	---	---	---	---	PASS
WDR5B	54554	broad.mit.edu	37	3	122134390	122134390	+	5'UTR	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122134390A>T	uc003efa.1	-	1						NM_019069	NP_061942	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B											ovary(3)	3				GBM - Glioblastoma multiforme(114;0.0704)		CTGAAGCTCCAAGTTAGCAGG	0.507													33	94	---	---	---	---	PASS
KIAA1257	57501	broad.mit.edu	37	3	128629127	128629127	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128629127G>A	uc003elg.1	-	8					ACAD9_uc003ela.3_Intron|ACAD9_uc011bks.1_Intron|ACAD9_uc003elb.2_Intron|ACAD9_uc003eld.1_Intron|ACAD9_uc003ele.2_Intron|uc003elf.1_3'UTR	NM_020741	NP_065792	Q9ULG3	K1257_HUMAN	hypothetical protein LOC57501												0						GTGGCCGTGGGAGGGTCTGTG	0.587													3	4	---	---	---	---	PASS
ACPP	55	broad.mit.edu	37	3	132050577	132050577	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132050577G>A	uc010htp.2	+	3	393	c.303G>A	c.(301-303)CAG>CAA	p.Q101Q	ACPP_uc003eon.3_Silent_p.Q101Q|ACPP_uc003eop.3_Silent_p.Q101Q	NM_001099	NP_001090	P15309	PPAP_HUMAN	acid phosphatase, prostate short isoform	101						extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1						AACATGAACAGGCAAGTTGGG	0.348													8	21	---	---	---	---	PASS
PFN2	5217	broad.mit.edu	37	3	149684111	149684111	+	3'UTR	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149684111G>C	uc003ext.1	-	3					PFN2_uc003exs.1_Intron|PFN2_uc003exu.1_Intron|PFN2_uc011bnu.1_Intron	NM_053024	NP_444252	P35080	PROF2_HUMAN	profilin 2 isoform a						actin cytoskeleton organization|regulation of actin polymerization or depolymerization	actin cytoskeleton|cytoplasm	actin binding|phosphatidylinositol-4,5-bisphosphate binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGGGAGGGCAGAAAGAAAGAC	0.448													30	96	---	---	---	---	PASS
ZNF639	51193	broad.mit.edu	37	3	179050893	179050893	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179050893C>T	uc003fjq.1	+	5	629	c.286C>T	c.(286-288)CAC>TAC	p.H96Y	ZNF639_uc003fjr.1_Missense_Mutation_p.H96Y	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639	96					initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			aattctagaccacactgcctT	0.119													7	13	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72399971	72399971	+	Missense_Mutation	SNP	G	A	A	rs150967020		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72399971G>A	uc003hfy.2	+	18	2425	c.2308G>A	c.(2308-2310)GTT>ATT	p.V770I	SLC4A4_uc010iic.2_Missense_Mutation_p.V770I|SLC4A4_uc010iib.2_Missense_Mutation_p.V770I|SLC4A4_uc003hfz.2_Missense_Mutation_p.V770I|SLC4A4_uc003hgc.3_Missense_Mutation_p.V726I|SLC4A4_uc010iid.2_5'UTR	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	770	Interaction with CA4.|Extracellular (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			AGGTTGGTTCGTTCCACCGTT	0.423													19	32	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128632073	128632073	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128632073C>T	uc003ifk.1	+	14	2445	c.2375C>T	c.(2374-2376)ACA>ATA	p.T792I	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	792										ovary(1)	1						TTAAGACTGACATCTGGTCCT	0.333													48	30	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144134859	144134859	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144134859G>A	uc003ijb.2	+	9	2264	c.1730G>A	c.(1729-1731)CGT>CAT	p.R577H	USP38_uc003ija.3_Missense_Mutation_p.R577H|USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	577					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					GAGACCCCTCGTACAAGTGAC	0.413													7	43	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153253770	153253770	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153253770C>T	uc003ims.2	-	6	1112	c.963G>A	c.(961-963)TGG>TGA	p.W321*	FBXW7_uc011cii.1_Nonsense_Mutation_p.W321*|FBXW7_uc003imt.2_Nonsense_Mutation_p.W321*|FBXW7_uc011cih.1_Nonsense_Mutation_p.W145*|FBXW7_uc003imq.2_Nonsense_Mutation_p.W241*|FBXW7_uc003imr.2_Nonsense_Mutation_p.W203*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	321	F-box.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATTTCTCTCTCCAGAGAAGGT	0.393			Mis|N|D|F		colorectal|endometrial|T-ALL								32	19	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3600249	3600249	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3600249C>A	uc003jde.2	+	2	1239	c.1187C>A	c.(1186-1188)GCT>GAT	p.A396D		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	396						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						GGCGTTGGCGCTCCCCACGCC	0.662													6	47	---	---	---	---	PASS
GUSBP1	728411	broad.mit.edu	37	5	21459679	21459679	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21459679C>T	uc010iub.2	+	1	91	c.11C>T	c.(10-12)TCT>TTT	p.S4F	GUSBP1_uc011cnn.1_Intron|GUSBP1_uc003jgh.3_RNA|GUSBP1_uc003jgf.3_Missense_Mutation_p.S4F|GUSBP1_uc003jgg.3_RNA	NR_027028				SubName: Full=Putative uncharacterized protein GUSBL2;												0						ATGGAGCGCTCTGGGCCCAGC	0.632											OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	111	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45303773	45303773	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45303773G>A	uc003jok.2	-	6	1571	c.1546C>T	c.(1546-1548)CAA>TAA	p.Q516*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	516	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACACCGTGTTGAATGAAATAC	0.388													10	116	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71494957	71494957	+	Silent	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71494957C>G	uc003kbw.3	+	5	6016	c.5775C>G	c.(5773-5775)ACC>ACG	p.T1925T	MAP1B_uc010iyw.1_Silent_p.T1942T|MAP1B_uc010iyx.1_Silent_p.T1799T|MAP1B_uc010iyy.1_Silent_p.T1799T	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1925	MAP1B 3.					microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCTATGAGACCATTGGGAAAA	0.463													8	71	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96518898	96518898	+	5'UTR	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96518898C>T	uc003kmz.2	-	1					RIOK2_uc003kna.3_5'UTR	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1								ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TTCCCCATGGCGGCCCCAGTC	0.582													36	140	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137761206	137761206	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137761206G>T	uc003lcy.1	+	17	4546	c.4346G>T	c.(4345-4347)AGG>ATG	p.R1449M	KDM3B_uc010jew.1_Missense_Mutation_p.R1105M|KDM3B_uc011cys.1_Missense_Mutation_p.R481M	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1449					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						GTGAACTGCAGGAACTGTGCT	0.448													33	111	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137891640	137891640	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137891640C>T	uc003ldf.2	-	17					HSPA9_uc003lde.2_3'UTR	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGTAAAAAGACTGAAGTTCGC	0.338													16	13	---	---	---	---	PASS
MATR3	9782	broad.mit.edu	37	5	138650265	138650265	+	Intron	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138650265A>G	uc003ldu.2	+						MATR3_uc010jfb.2_Intron|MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Intron|MATR3_uc003ldx.2_Intron|MATR3_uc010jfc.2_Intron|MATR3_uc003ldy.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Intron|MATR3_uc003lea.2_Intron|MATR3_uc003leb.2_5'UTR|MATR3_uc003lec.2_5'UTR	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGTACAGCCTATGATACTGCA	0.338													3	16	---	---	---	---	PASS
PCDHB17	54661	broad.mit.edu	37	5	140537610	140537610	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140537610G>A	uc003lis.2	+	1						NR_001280				SubName: Full=Protocadherin-psi1;												0						CCCTGAGGCGGCCCCGGCCCA	0.687													44	134	---	---	---	---	PASS
OR10C1	442194	broad.mit.edu	37	6	29408490	29408490	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29408490G>A	uc011dlp.1	+	1	698	c.698G>A	c.(697-699)CGC>CAC	p.R233H	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTTGCGGGCCGCCGCAAGGCC	0.587													32	313	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33663645	33663645	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33663645G>A	uc011drk.1	+	58					C6orf125_uc003oez.1_RNA	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3						activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GGGTTGGGTGGCCCAGCCAGC	0.642													3	5	---	---	---	---	PASS
GPR111	222611	broad.mit.edu	37	6	47649716	47649716	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47649716A>T	uc010jzj.1	+	6	1422	c.1421A>T	c.(1420-1422)CAA>CTA	p.Q474L	GPR111_uc010jzk.1_Missense_Mutation_p.Q406L|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	474	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GTCTGGAGCCAAGTGACAAAG	0.448													68	63	---	---	---	---	PASS
OLIG3	167826	broad.mit.edu	37	6	137815405	137815405	+	5'UTR	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137815405C>A	uc003qhp.1	-	1						NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		TGCCCAGGAACCCACTTCTCC	0.522													3	10	---	---	---	---	PASS
AHR	196	broad.mit.edu	37	7	17378759	17378759	+	Missense_Mutation	SNP	G	T	T	rs138430398		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17378759G>T	uc011jxz.1	+	10	1923	c.1310G>T	c.(1309-1311)GGA>GTA	p.G437V	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	437					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					GGCACTAGTGGAAAAGACTCT	0.438													35	65	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31912954	31912954	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31912954A>G	uc003tcm.1	-	6	1029	c.560T>C	c.(559-561)TTT>TCT	p.F187S	PDE1C_uc003tcn.1_Missense_Mutation_p.F187S|PDE1C_uc003tco.1_Missense_Mutation_p.F247S|PDE1C_uc003tcr.2_Missense_Mutation_p.F187S|PDE1C_uc003tcs.2_Missense_Mutation_p.F187S	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	187					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			ATAGAAAATAAATTTCAGTGC	0.398													25	32	---	---	---	---	PASS
SEMA3A	10371	broad.mit.edu	37	7	83675657	83675657	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83675657T>A	uc003uhz.2	-	6	965	c.650A>T	c.(649-651)GAT>GTT	p.D217V		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	217	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						CCACCTGGAATCATGCTGCTC	0.428													17	139	---	---	---	---	PASS
ZKSCAN5	23660	broad.mit.edu	37	7	99117480	99117480	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99117480C>T	uc003uqv.2	+	4	708	c.584C>T	c.(583-585)CCC>CTC	p.P195L	ZKSCAN5_uc010lfx.2_Missense_Mutation_p.P195L|ZKSCAN5_uc003uqw.2_Missense_Mutation_p.P195L|ZKSCAN5_uc003uqx.2_Intron|ZKSCAN5_uc003uqy.2_5'UTR	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	195					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CCTTCCCTTCCCCTGAAGGAC	0.532													28	91	---	---	---	---	PASS
FBXO24	26261	broad.mit.edu	37	7	100189393	100189393	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100189393C>T	uc003uvm.1	+	4	719	c.426C>T	c.(424-426)ACC>ACT	p.T142T	FBXO24_uc010lha.1_RNA|FBXO24_uc003uvl.1_Silent_p.T128T|FBXO24_uc003uvn.1_5'UTR|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Silent_p.T180T|FBXO24_uc011kka.1_Silent_p.T130T	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	142						ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TCTTGCCCACCAAGGATCACG	0.607													41	66	---	---	---	---	PASS
ACHE	43	broad.mit.edu	37	7	100491629	100491629	+	Silent	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100491629G>T	uc003uxd.2	-	1	381	c.225C>A	c.(223-225)CCC>CCA	p.P75P	ACHE_uc003uxe.2_Silent_p.P75P|ACHE_uc003uxf.2_Silent_p.P75P|ACHE_uc003uxg.2_Silent_p.P75P|ACHE_uc003uxh.2_Silent_p.P75P|ACHE_uc003uxi.2_Silent_p.P75P|ACHE_uc003uxj.1_Silent_p.P194P	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	75					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	GAAAGCGACGGGGTCCCATGG	0.647													4	61	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103243875	103243875	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103243875A>G	uc003vca.2	-	24	3369	c.3209T>C	c.(3208-3210)ATG>ACG	p.M1070T	RELN_uc010liz.2_Missense_Mutation_p.M1070T	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1070					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AAAATCTGACATAATTGTGGA	0.507													31	93	---	---	---	---	PASS
RNF133	168433	broad.mit.edu	37	7	122338738	122338738	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122338738C>G	uc003vkj.1	-	1	471	c.235G>C	c.(235-237)GAG>CAG	p.E79Q	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN	ring finger protein 133	79	PA.					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding			skin(1)	1						ATTTTTCCCTCTGGTGGCACT	0.448													38	94	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41615618	41615618	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41615618G>A	uc003xok.2	-	2	149	c.65C>T	c.(64-66)TCA>TTA	p.S22L	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.S22L|ANK1_uc003xoj.2_Missense_Mutation_p.S22L|ANK1_uc003xol.2_Missense_Mutation_p.S22L|ANK1_uc003xom.2_Missense_Mutation_p.S55L	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	22	89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAAGTTACCTGATCTTGCTGC	0.507													63	297	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121457679	121457679	+	5'UTR	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121457679A>T	uc003ypc.1	+	1					MRPL13_uc003ypa.2_5'Flank|MRPL13_uc010mdf.2_5'Flank|MTBP_uc003ypb.1_5'UTR|MTBP_uc011lie.1_RNA	NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53						cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			GTGGAAGCCGAGACCTAAAGT	0.557													85	76	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131861957	131861957	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131861957G>C	uc003ytd.3	-	10	2559	c.2303C>G	c.(2302-2304)CCC>CGC	p.P768R	ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	768					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAGGATGAGGGGCAAACATTT	0.473										HNSCC(32;0.087)			15	41	---	---	---	---	PASS
LRRC14	9684	broad.mit.edu	37	8	145748840	145748840	+	3'UTR	SNP	A	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145748840A>C	uc003zdk.1	+	4					LRRC24_uc003zdm.2_Intron|LRRC24_uc003zdn.2_Intron|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_Intron	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14												0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGCTGCTAAAACAGCCTGTGC	0.612													10	28	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145770746	145770746	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145770746C>T	uc003zdt.1	-	7	2963	c.2408G>A	c.(2407-2409)CGC>CAC	p.R803H	ARHGAP39_uc011llk.1_Missense_Mutation_p.R803H|ARHGAP39_uc003zds.1_Missense_Mutation_p.R803H	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	803	MyTH4.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						CTCCCAGCCGCGGGCCAGGCT	0.662													10	99	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37746199	37746199	+	Silent	SNP	C	T	T	rs147765962		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37746199C>T	uc004aag.1	+	16	4214	c.4170C>T	c.(4168-4170)ACC>ACT	p.T1390T	FRMPD1_uc004aah.1_Silent_p.T1390T	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1390						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		GCTGCACCACCGCACCCCTGT	0.662													66	71	---	---	---	---	PASS
C9orf41	138199	broad.mit.edu	37	9	77642968	77642968	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77642968C>T	uc004ajq.2	-	1	343	c.190G>A	c.(190-192)GAG>AAG	p.E64K	C9orf41_uc011lsi.1_RNA	NM_152420	NP_689633	Q8N4J0	CI041_HUMAN	hypothetical protein LOC138199	64										ovary(1)|skin(1)	2						CAGAAGTGCTCACGCTCAAGC	0.557													4	10	---	---	---	---	PASS
C9orf41	138199	broad.mit.edu	37	9	77642970	77642970	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77642970C>T	uc004ajq.2	-	1	341	c.188G>A	c.(187-189)CGT>CAT	p.R63H	C9orf41_uc011lsi.1_RNA	NM_152420	NP_689633	Q8N4J0	CI041_HUMAN	hypothetical protein LOC138199	63										ovary(1)|skin(1)	2						GAAGTGCTCACGCTCAAGCCT	0.557													4	10	---	---	---	---	PASS
GCNT1	2650	broad.mit.edu	37	9	79118499	79118499	+	Missense_Mutation	SNP	A	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79118499A>C	uc010mpf.2	+	3	1543	c.1202A>C	c.(1201-1203)AAG>ACG	p.K401T	GCNT1_uc010mpg.2_Missense_Mutation_p.K401T|GCNT1_uc010mph.2_Missense_Mutation_p.K401T|GCNT1_uc004akf.3_Missense_Mutation_p.K401T|GCNT1_uc010mpi.2_Missense_Mutation_p.K401T|GCNT1_uc004akh.3_Missense_Mutation_p.K401T	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	401	Lumenal (Potential).|Catalytic (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						TTTGCCAATAAGTTTGACGTG	0.488													19	142	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88272367	88272367	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88272367G>A	uc011ltd.1	-	9	925	c.892C>T	c.(892-894)CTG>TTG	p.L298L	AGTPBP1_uc011ltc.1_Silent_p.L196L|AGTPBP1_uc010mqc.2_Silent_p.L298L|AGTPBP1_uc011lte.1_Silent_p.L350L	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	298					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						GTATTATACAGAATTTTCATC	0.289													7	52	---	---	---	---	PASS
CDK20	23552	broad.mit.edu	37	9	90584799	90584799	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90584799C>A	uc004apr.2	-	6	905	c.599G>T	c.(598-600)GGG>GTG	p.G200V	CDK20_uc004aps.2_Missense_Mutation_p.G179V|CDK20_uc004apt.2_Missense_Mutation_p.G192V|CDK20_uc004apu.2_Intron	NM_001039803	NP_001034892	Q8IZL9	CDK20_HUMAN	cell cycle related kinase isoform 3	200	Protein kinase.				cell division|multicellular organismal development	cilium|mitochondrion|nucleus	ATP binding|cyclin-dependent protein kinase activity			skin(1)	1						AAGGGGGGACCCATTCAACAG	0.577													60	103	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121557048	121557048	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121557048A>G	uc001leo.2	+	8	1110	c.944A>G	c.(943-945)CAT>CGT	p.H315R		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	315	SAC.						phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		CAGTTGATTCATGTTCATAAT	0.423													12	16	---	---	---	---	PASS
OR2AG2	338755	broad.mit.edu	37	11	6789447	6789447	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6789447C>T	uc001meq.1	-	1	742	c.742G>A	c.(742-744)GTC>ATC	p.V248I		NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG,	248	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AACATCCCGACCACAATCAGG	0.483													23	17	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587220	55587220	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587220A>T	uc010rin.1	+	1	115	c.115A>T	c.(115-117)ACT>TCT	p.T39S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CTACAATGTCACTGTGCTAGG	0.453													102	101	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60265167	60265167	+	Intron	SNP	A	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60265167A>C	uc001npr.2	+						MS4A12_uc009ynb.2_3'UTR	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						TCTGAACGTTATTCTGAAATT	0.299													6	2	---	---	---	---	PASS
TMEM123	114908	broad.mit.edu	37	11	102272686	102272686	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102272686G>A	uc001pha.2	-	3	830	c.409C>T	c.(409-411)CAC>TAC	p.H137Y	TMEM123_uc009yxc.2_Missense_Mutation_p.H118Y	NM_052932	NP_443164	Q8N131	PORIM_HUMAN	transmembrane protein 123 precursor	137	Thr-rich.|Extracellular (Potential).				oncosis	external side of plasma membrane|integral to membrane	receptor activity			breast(2)	2	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		GAACTATTGTGGGTTACGGTC	0.373													939	45	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7656275	7656275	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7656275G>A	uc001qsz.3	-	1	140	c.12C>T	c.(10-12)CTC>CTT	p.L4L	CD163_uc001qta.3_Silent_p.L4L|CD163_uc009zfw.2_Silent_p.L4L	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	4					acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						GCACCATTCTGAGTTTGCTCA	0.318													10	68	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21997778	21997778	+	Silent	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21997778A>G	uc001rfi.1	-	25	3188	c.3168T>C	c.(3166-3168)ACT>ACC	p.T1056T	ABCC9_uc001rfh.2_Silent_p.T1056T|ABCC9_uc001rfj.1_Silent_p.T1020T	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1056	ABC transmembrane type-1 2.|Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TCCATTCTACAGTGAGGGATG	0.418													53	69	---	---	---	---	PASS
CAPRIN2	65981	broad.mit.edu	37	12	30873763	30873763	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30873763C>A	uc001rji.1	-	12	2881	c.2130G>T	c.(2128-2130)ATG>ATT	p.M710I	CAPRIN2_uc001rjf.1_Missense_Mutation_p.M507I|CAPRIN2_uc001rjg.1_Missense_Mutation_p.M377I|CAPRIN2_uc001rjh.1_Missense_Mutation_p.M710I|CAPRIN2_uc001rjj.1_Missense_Mutation_p.M377I|CAPRIN2_uc001rjk.3_Missense_Mutation_p.M710I|CAPRIN2_uc001rjl.3_Intron|CAPRIN2_uc001rjm.1_Intron	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	710					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTCTGAGGTCATAAACTCTG	0.378													36	118	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242218	31242218	+	Intron	SNP	A	G	G	rs4081648		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242218A>G	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCCCTCCCTGACCTGGCCGGC	0.597										Multiple Myeloma(12;0.14)			3	15	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40499322	40499322	+	Missense_Mutation	SNP	A	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40499322A>C	uc010skm.1	-	1	340	c.289T>G	c.(289-291)TAT>GAT	p.Y97D	SLC2A13_uc001rmf.2_Missense_Mutation_p.Y97D	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	97	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				CCGGTGTCATAGCCAAACAGG	0.592										HNSCC(50;0.14)			6	3	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41421677	41421677	+	Missense_Mutation	SNP	G	A	A	rs143121881		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41421677G>A	uc001rmm.1	+	22	2842	c.2729G>A	c.(2728-2730)AGG>AAG	p.R910K	CNTN1_uc001rmn.1_Missense_Mutation_p.R899K	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	910	Fibronectin type-III 4.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CAGCCTCCAAGGATCATCAGT	0.393													49	26	---	---	---	---	PASS
ACVRL1	94	broad.mit.edu	37	12	52307405	52307405	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52307405G>A	uc001rzj.2	+	4	659	c.376G>A	c.(376-378)GTG>ATG	p.V126M	ACVRL1_uc001rzk.2_Missense_Mutation_p.V126M|ACVRL1_uc010snm.1_Intron	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	126	Helical; (Potential).				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CCTGGGCCCCGTGCTGGCCTT	0.682									Hereditary_Hemorrhagic_Telangiectasia				24	10	---	---	---	---	PASS
ATP5B	506	broad.mit.edu	37	12	57039660	57039660	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57039660G>C	uc001slr.2	-	1	193	c.88C>G	c.(88-90)CAG>GAG	p.Q30E	SNORD59B_uc001sls.1_5'Flank|SNORD59A_uc001slt.1_5'Flank	NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	30					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						AGTAAGAGCTGAGCTGGGGGC	0.657													3	13	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39261504	39261504	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39261504G>T	uc001uwv.2	+	1	332	c.23G>T	c.(22-24)GGG>GTG	p.G8V		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	8					cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGGACTCCCGGGTTATCCTCG	0.582													7	4	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	48947629	48947629	+	Splice_Site	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48947629G>T	uc001vcb.2	+	12	1381	c.1215_splice	c.e12+1	p.N405_splice	RB1_uc010act.1_Splice_Site_p.N106_splice	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(14)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTATTTTAACGTAAGCCATAT	0.264		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			66	54	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76427232	76427232	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76427232G>T	uc001vjv.2	+	25	4430	c.3670G>T	c.(3670-3672)GAA>TAA	p.E1224*	LMO7_uc010thv.1_Nonsense_Mutation_p.E1175*|LMO7_uc010thw.1_Nonsense_Mutation_p.E1101*	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	1509						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTTCAGAGGCGAATCTTTAGA	0.378													27	81	---	---	---	---	PASS
BMP4	652	broad.mit.edu	37	14	54418914	54418914	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54418914C>A	uc001xal.3	-	2	214	c.27G>T	c.(25-27)ATG>ATT	p.M9I	BMP4_uc010aoh.2_Missense_Mutation_p.M9I|BMP4_uc001xao.3_Missense_Mutation_p.M9I|BMP4_uc001xan.3_Missense_Mutation_p.M9I	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	9					activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						ATAAAACGACCATCAGCATTC	0.493													42	65	---	---	---	---	PASS
ANGEL1	23357	broad.mit.edu	37	14	77275517	77275517	+	Silent	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77275517T>C	uc001xsv.2	-	2	647	c.534A>G	c.(532-534)CCA>CCG	p.P178P	ANGEL1_uc010tvf.1_Intron	NM_015305	NP_056120	Q9UNK9	ANGE1_HUMAN	angel homolog 1	178										ovary(2)|central_nervous_system(1)|skin(1)	4			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CCAACACCGCTGGGTCCTCTT	0.652													15	37	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25925012	25925012	+	Missense_Mutation	SNP	C	A	A	rs141308074		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25925012C>A	uc010ayu.2	-	21	4082	c.3976G>T	c.(3976-3978)GCT>TCT	p.A1326S		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1326	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CGTCCCTGAGCAAAGGTCTCT	0.597													50	50	---	---	---	---	PASS
MAP2K1	5604	broad.mit.edu	37	15	66777338	66777338	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66777338T>A	uc010bhq.2	+	7	1179	c.704T>A	c.(703-705)CTC>CAC	p.L235H	MAP2K1_uc010ujp.1_Missense_Mutation_p.L213H	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	235	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						CCAGAAAGACTCCAGGGGACT	0.517									Cardiofaciocutaneous_syndrome				86	143	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76225291	76225291	+	Missense_Mutation	SNP	T	G	G	rs150074021		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76225291T>G	uc002bbk.2	+	7	1165	c.1060T>G	c.(1060-1062)TTA>GTA	p.L354V	FBXO22_uc002bbl.2_Missense_Mutation_p.L250V|FBXO22OS_uc002bbm.1_RNA	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	354					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						TAGTGTTCCCTTATTCGGCTT	0.408													49	87	---	---	---	---	PASS
ST20	400410	broad.mit.edu	37	15	80191455	80191455	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80191455C>T	uc002bez.3	-	3	738	c.58G>A	c.(58-60)GTA>ATA	p.V20I	ST20_uc002bfa.3_Missense_Mutation_p.V20I|MTHFS_uc002bex.3_5'Flank	NM_001100879	NP_001094349	Q9HBF5	ST20_HUMAN	cervical cancer suppressor-1	20											0						AGCTTCTTTACAAAGCCATTT	0.318													18	44	---	---	---	---	PASS
CLUAP1	23059	broad.mit.edu	37	16	3556338	3556338	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3556338C>G	uc002cvk.1	+	3	247	c.142C>G	c.(142-144)CCC>GCC	p.P48A	CLUAP1_uc002cvj.1_Missense_Mutation_p.P48A|CLUAP1_uc002cvl.1_Missense_Mutation_p.P48A	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	48						nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						TAGATATGAGCCCCAGACTGA	0.483													80	48	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3788647	3788647	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3788647C>T	uc002cvv.2	-	26	4511	c.4307G>A	c.(4306-4308)AGT>AAT	p.S1436N	CREBBP_uc002cvw.2_Missense_Mutation_p.S1398N	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1436	Cys/His-rich.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAAATGAATACTATCCAGATA	0.423			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				33	11	---	---	---	---	PASS
CP110	9738	broad.mit.edu	37	16	19547561	19547561	+	Silent	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19547561C>G	uc002dgl.3	+	4	817	c.570C>G	c.(568-570)ACC>ACG	p.T190T	CP110_uc002dgk.3_Silent_p.T190T			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;	190	CEP97 binding.				centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						TTCCAAAGACCTCTTCAGCAA	0.393													126	66	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20337750	20337750	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20337750G>C	uc002dgv.2	-	2	87	c.4C>G	c.(4-6)CCT>GCT	p.P2A	GP2_uc002dgw.2_Missense_Mutation_p.P2A|GP2_uc002dgx.2_Missense_Mutation_p.P2A|GP2_uc002dgy.2_Missense_Mutation_p.P2A	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	2						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						ATAAGGTGAGGCATGCAGGTC	0.498													68	30	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53967950	53967950	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53967950G>A	uc002ehr.2	+	8	1515	c.1293G>A	c.(1291-1293)AGG>AGA	p.R431R	FTO_uc010vha.1_Silent_p.R135R|FTO_uc010cbz.2_Silent_p.R32R|FTO_uc002ehs.2_RNA	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	431					DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TGGAACAAAGGAATGAAATCT	0.428													4	64	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68842337	68842337	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68842337C>T	uc002ewg.1	+	4	522	c.398C>T	c.(397-399)TCT>TTT	p.S133F	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.S133F	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	133					adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GCCTCCGTTTCTGGAATCCAA	0.478			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				51	78	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70917863	70917863	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70917863G>A	uc002ezr.2	-	59	10064	c.9936C>T	c.(9934-9936)GCC>GCT	p.A3312A		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3313										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				AAAGAATGCCGGCAGGGTGGA	0.488													13	59	---	---	---	---	PASS
IL17C	27189	broad.mit.edu	37	16	88706603	88706603	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88706603C>T	uc002fla.2	+	3						NM_013278	NP_037410	Q9P0M4	IL17C_HUMAN	interleukin 17C precursor						cell surface receptor linked signaling pathway|cell-cell signaling|inflammatory response	extracellular space|soluble fraction	cytokine activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0477)		CTGGGCATTCCCCGTGTCTGG	0.547													11	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21730916	21730916	+	Missense_Mutation	SNP	G	T	T	rs111245273	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21730916G>T	uc002gyy.3	+	2	343	c.218G>T	c.(217-219)CGG>CTG	p.R73L						SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GTCCTGCGTCGGAGAGGTGGT	0.552													4	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	34235862	34235862	+	RNA	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34235862C>T	uc010ctx.1	-	1		c.1092G>A								Homo sapiens cDNA FLJ43944 fis, clone TESTI4014392.																		GTTGAGGTCTCCTCCATGGTT	0.463													6	66	---	---	---	---	PASS
KRT32	3882	broad.mit.edu	37	17	39623211	39623211	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39623211C>T	uc002hwr.2	-	1	428	c.367G>A	c.(367-369)GAG>AAG	p.E123K		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	123	Coil 1A.|Rod.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)				CTCTCCAGCTCCGCATTCTCC	0.572													49	148	---	---	---	---	PASS
GFAP	2670	broad.mit.edu	37	17	42984646	42984646	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42984646G>A	uc002ihq.2	-	9						NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1							cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				CAGCAGAGGCGGAGCAACTAT	0.637													4	36	---	---	---	---	PASS
TLK2	11011	broad.mit.edu	37	17	60673977	60673977	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60673977G>C	uc010ddp.2	+	18	1826	c.1558G>C	c.(1558-1560)GAG>CAG	p.E520Q	TLK2_uc002izx.3_Missense_Mutation_p.E346Q|TLK2_uc002izz.3_Missense_Mutation_p.E498Q|TLK2_uc002jaa.3_Missense_Mutation_p.E466Q|TLK2_uc010wpd.1_Missense_Mutation_p.E466Q	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	520	Protein kinase.				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						GATTCATAAAGAGCTGGATCA	0.373													40	118	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6876136	6876136	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6876136G>C	uc010wzi.1	+	9	926	c.688G>C	c.(688-690)GAG>CAG	p.E230Q	ARHGAP28_uc002knc.2_Missense_Mutation_p.E355Q|ARHGAP28_uc002knd.2_Missense_Mutation_p.E248Q|ARHGAP28_uc002kne.2_Missense_Mutation_p.E248Q|ARHGAP28_uc002knf.2_Missense_Mutation_p.E239Q			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	230					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				CTAGTTTTTTGAGAAAGTTGA	0.318													9	96	---	---	---	---	PASS
DSC3	1825	broad.mit.edu	37	18	28576944	28576944	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28576944G>C	uc002kwj.3	-	15	2461	c.2306C>G	c.(2305-2307)TCA>TGA	p.S769*	DSC3_uc002kwi.3_Nonsense_Mutation_p.S769*	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	769	Cytoplasmic (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TTTCATTCCTGATCCCATAGT	0.433													22	64	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50450132	50450132	+	Silent	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50450132C>A	uc002lfe.1	+	4	1340	c.753C>A	c.(751-753)GCC>GCA	p.A251A	DCC_uc010xdr.1_Silent_p.A99A	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	251	Extracellular (Potential).|Ig-like C2-type 3.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATGTAGTAGCCATTGAAGGAA	0.418													35	53	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	51013172	51013172	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51013172G>A	uc002lfe.1	+	26	4329	c.3742G>A	c.(3742-3744)GTG>ATG	p.V1248M	DCC_uc010dpf.1_Missense_Mutation_p.V883M	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	1248	Cytoplasmic (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGCAGCTGTCGTGAGCGCCAT	0.488													67	94	---	---	---	---	PASS
C19orf28	126321	broad.mit.edu	37	19	3550991	3550991	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3550991G>A	uc002lxz.2	-	2	670	c.500C>T	c.(499-501)ACG>ATG	p.T167M	C19orf28_uc002lxw.2_Missense_Mutation_p.T167M|C19orf28_uc002lxx.2_Missense_Mutation_p.T167M|C19orf28_uc002lxy.2_Missense_Mutation_p.T158M	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	167					transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGAGTGCCGTGAGCTCCAC	0.557													23	15	---	---	---	---	PASS
CCL25	6370	broad.mit.edu	37	19	8122718	8122718	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8122718G>C	uc002mjd.2	+	4	359	c.359G>C	c.(358-360)GGA>GCA	p.G120A	CCL25_uc002mjc.3_Missense_Mutation_p.G119A|CCL25_uc010dvy.1_Missense_Mutation_p.W75C	NM_005624	NP_005615	O15444	CCL25_HUMAN	small inducible cytokine A25 precursor	120					chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response	extracellular space|soluble fraction	CCR10 chemokine receptor binding|chemokine activity|hormone activity				0						ttgagttctggaaactccaag	0.000													17	68	---	---	---	---	PASS
ZNF714	148206	broad.mit.edu	37	19	21300901	21300901	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21300901G>A	uc002npo.3	+	6	1794	c.1434G>A	c.(1432-1434)GAG>GAA	p.E478E	ZNF714_uc002npl.2_Silent_p.E323E|ZNF714_uc010ecp.1_Silent_p.E429E|ZNF714_uc002npn.2_RNA	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	478					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATACTGGAGAGAAATCTTACA	0.308													14	42	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22362431	22362431	+	3'UTR	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22362431C>A	uc002nqs.1	-	3						NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GGCTTTTCCTCCAGTATGAAT	0.378													4	6	---	---	---	---	PASS
NFKBID	84807	broad.mit.edu	37	19	36387690	36387690	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36387690A>T	uc002oci.1	-	6	770	c.196T>A	c.(196-198)TAT>AAT	p.Y66N	NFKBID_uc002och.1_5'Flank|NFKBID_uc002ocj.1_Missense_Mutation_p.Y81N	NM_139239	NP_640332	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene	66	ANK 1.				inflammatory response	nucleus					0						GCCGCAGCATATGCCGCCCAG	0.473													20	25	---	---	---	---	PASS
FAM98C	147965	broad.mit.edu	37	19	38893808	38893808	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38893808G>A	uc002oin.1	+	1	34	c.15G>A	c.(13-15)AAG>AAA	p.K5K	FAM98C_uc002oio.1_Silent_p.K5K|FAM98C_uc010xtz.1_Silent_p.K5K	NM_174905	NP_777565	Q17RN3	FA98C_HUMAN	hypothetical protein LOC147965	5										skin(1)	1	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGCGGTGAAGGCGGAAGCGT	0.726													4	22	---	---	---	---	PASS
LRFN1	57622	broad.mit.edu	37	19	39798886	39798886	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39798886C>A	uc002okw.2	-	2	1703	c.1703G>T	c.(1702-1704)CGC>CTC	p.R568L		NM_020862	NP_065913	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III	568	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane				ovary(2)	2	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CTTGACGCGGCGGCTGTCCCC	0.682													3	18	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44514476	44514476	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44514476C>G	uc002oyb.1	+	5	536	c.285C>G	c.(283-285)ATC>ATG	p.I95M		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	95	KRNB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				GCCAGCAAATCTGGGAACAAA	0.468													10	62	---	---	---	---	PASS
ZNF211	10520	broad.mit.edu	37	19	58152819	58152819	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58152819T>C	uc002qpq.2	+	3	1145	c.965T>C	c.(964-966)TTT>TCT	p.F322S	ZNF211_uc010yhb.1_Missense_Mutation_p.F326S|ZNF211_uc002qpp.2_Missense_Mutation_p.F335S|ZNF211_uc002qpr.2_Missense_Mutation_p.F386S|ZNF211_uc002qps.2_Missense_Mutation_p.F387S|ZNF211_uc002qpt.2_Missense_Mutation_p.F334S|ZNF211_uc010yhc.1_Missense_Mutation_p.F334S|ZNF211_uc010yhd.1_Missense_Mutation_p.F261S|ZNF211_uc010yhe.1_Missense_Mutation_p.F313S	NM_198855	NP_942152	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 2	322	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGGAAATCGTTTAGTCAGATA	0.418													49	75	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													7	20	---	---	---	---	PASS
PTPRA	5786	broad.mit.edu	37	20	2968459	2968459	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2968459G>A	uc010zqb.1	+	6					PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_5'UTR|PTPRA_uc002whn.2_Intron|PTPRA_uc002who.2_5'UTR			P18433	PTPRA_HUMAN	SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						GGGTTCCCTGGTTGGATTCCA	0.552													12	13	---	---	---	---	PASS
ProSAPiP1	9762	broad.mit.edu	37	20	3147630	3147630	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3147630C>T	uc002wia.1	-	1	1578	c.180G>A	c.(178-180)GGG>GGA	p.G60G	ProSAPiP1_uc002wib.1_Silent_p.G60G	NM_014731	NP_055546	O60299	PRIP1_HUMAN	ProSAPiP1 protein	60	Poly-Gly.					cell junction|cytoplasm|postsynaptic density|postsynaptic membrane				pancreas(1)	1						TGCCCCCACCCCCTGTGCGGG	0.716													11	19	---	---	---	---	PASS
CD93	22918	broad.mit.edu	37	20	23066316	23066316	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23066316C>T	uc002wsv.2	-	1	662	c.514G>A	c.(514-516)GGA>AGA	p.G172R		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	172	Extracellular (Potential).|C-type lectin.				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					ATGTTACTTCCGGGGGAGCCT	0.652													12	111	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39992445	39992445	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39992445A>T	uc002xjy.1	-	3	571	c.347T>A	c.(346-348)CTC>CAC	p.L116H		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	116	EMI.					proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				ACGCCAGGCGAGGTCTGTCAC	0.617													61	136	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44640354	44640354	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44640354G>A	uc002xqz.2	+	6	984	c.965G>A	c.(964-966)CGG>CAG	p.R322Q		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	322	Fibronectin type-II 2.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	AACTACGACCGGGACAAGCTC	0.627											OREG0025989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	28	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57473912	57473912	+	Intron	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57473912G>A	uc002xzw.2	+						GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_Intron|GNAS_uc002xzx.2_Intron|GNAS_uc010gjr.2_Intron|GNAS_uc002xzy.2_Intron|GNAS_uc002yaa.2_Intron|GNAS_uc010zzt.1_Intron|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_5'UTR	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas						activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTGATGGTTGAGGAATGTAG	0.512			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			19	85	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11021155	11021155	+	3'UTR	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11021155A>G	uc002yit.1	-	9					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACACAACCGTAGTGTGCATAG	0.338													4	142	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34926719	34926719	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34926719A>G	uc002yse.1	+	3	5231	c.5182A>G	c.(5182-5184)ATT>GTT	p.I1728V	SON_uc002ysb.1_Missense_Mutation_p.I1728V|SON_uc002ysc.2_Missense_Mutation_p.I1728V|SON_uc002ysd.2_Missense_Mutation_p.I719V|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.I719V	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1728					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						TATTGAGGATATTAATGAAGC	0.433													78	150	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47783573	47783573	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47783573C>G	uc002zji.3	+	14	2440	c.2333C>G	c.(2332-2334)GCT>GGT	p.A778G	PCNT_uc002zjj.2_Missense_Mutation_p.A660G	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	778	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AGAGAAAAGGCTGAATCCGAG	0.463													15	149	---	---	---	---	PASS
POTEH	23784	broad.mit.edu	37	22	16279260	16279260	+	Silent	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16279260T>C	uc010gqp.2	-	4	1015	c.963A>G	c.(961-963)AAA>AAG	p.K321K	POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Silent_p.K40K|POTEH_uc002zlj.1_Silent_p.K156K	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	321	ANK 5.									skin(1)	1						CCACTTGCTGTTTTTGCTCAT	0.323													32	446	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22782206	22782206	+	RNA	SNP	C	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22782206C>A	uc011aim.1	+	63		c.6498C>A								Parts of antibodies, mostly variable regions.												0						CCAGGTATCTCCTGTACTACT	0.522													31	81	---	---	---	---	PASS
SLC5A4	6527	broad.mit.edu	37	22	32647856	32647856	+	Silent	SNP	G	A	A			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32647856G>A	uc003ami.2	-	3	215	c.213C>T	c.(211-213)GGC>GGT	p.G71G		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	71	Helical; (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						AGAGAGAGGCGCCCATCTGGA	0.438													44	35	---	---	---	---	PASS
TMEM47	83604	broad.mit.edu	37	X	34657461	34657461	+	Silent	SNP	G	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34657461G>T	uc004ddh.2	-	2	529	c.270C>A	c.(268-270)GCC>GCA	p.A90A	TMEM47_uc010ngs.2_RNA	NM_031442	NP_113630	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47	90	Helical; (Potential).					integral to membrane				lung(1)	1						TGAGAATGATGGCAGCGCCGC	0.448													8	7	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39933138	39933138	+	Silent	SNP	T	C	C			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39933138T>C	uc004den.3	-	4	1753	c.1461A>G	c.(1459-1461)CTA>CTG	p.L487L	BCOR_uc004dep.3_Silent_p.L487L|BCOR_uc004deo.3_Silent_p.L487L|BCOR_uc004dem.3_Silent_p.L487L|BCOR_uc004deq.3_Silent_p.L487L	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	487					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CTGGAGGAGATAGTGTTTCTT	0.512													44	18	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	152994806	152994806	+	Silent	SNP	C	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152994806C>T	uc004fif.2	+	2	1419	c.1020C>T	c.(1018-1020)AGC>AGT	p.S340S		NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	340	ABC transmembrane type-1.|Helical; (Potential).				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGTGTGGAGCGCCTCGGGCC	0.597													14	110	---	---	---	---	PASS
KCNAB2	8514	broad.mit.edu	37	1	6100503	6100506	+	Intron	DEL	GTCT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6100503_6100506delGTCT	uc009vlv.1	+						KCNAB2_uc001alv.1_Intron|KCNAB2_uc001alw.1_Intron|KCNAB2_uc001alx.1_Intron|KCNAB2_uc001alu.2_Intron	NM_003636	NP_003627	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		TGATCCCAGAGTCTCCCGGCCAAA	0.412													5	7	---	---	---	---	
CLSTN1	22883	broad.mit.edu	37	1	9815024	9815024	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9815024delT	uc001aqh.2	-						CLSTN1_uc001aqi.2_Intron|CLSTN1_uc010oag.1_Intron	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1						homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		cctccaagtgtttacaatcta	0.174													3	4	---	---	---	---	
HPCA	3208	broad.mit.edu	37	1	33354910	33354922	+	Intron	DEL	CAGGGCCCGGCAG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33354910_33354922delCAGGGCCCGGCAG	uc001bwh.2	+							NM_002143	NP_002134	P84074	HPCA_HUMAN	hippocalcin								actin binding|calcium ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATGCCAGGCACAGGGCCCGGCAgcttgcaccca	0.343													33	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34789523	34789523	+	IGR	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34789523delT								C1orf94 (104794 upstream) : MIR552 (345677 downstream)																							ccttccttccttccttccttc	0.025													5	3	---	---	---	---	
CLSPN	63967	broad.mit.edu	37	1	36204402	36204402	+	Intron	DEL	T	-	-	rs66781105		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36204402delT	uc001bzi.2	-						CLSPN_uc009vux.2_Intron	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AACTGTTTGCttttttttttt	0.184													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36872149	36872150	+	IGR	INS	-	CCTT	CCTT	rs142502292	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36872149_36872150insCCTT								LSM10 (8656 upstream) : OSCP1 (11358 downstream)																							ttctttccctcccttccttcct	0.084													3	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62613794	62613794	+	Intron	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62613794delA	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						cactgtctttaaaaaaaaaaa	0.005													4	2	---	---	---	---	
NBPF7	343505	broad.mit.edu	37	1	120379737	120379738	+	Intron	INS	-	A	A	rs67014534		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120379737_120379738insA	uc010oxk.1	-							NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		tctcaaaaaagaaaaaaaaaga	0.144													5	3	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATGTCTCCACCCCCCCCCCA	0.527													5	3	---	---	---	---	
CRP	1401	broad.mit.edu	37	1	159684166	159684166	+	Intron	DEL	C	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159684166delC	uc001ftw.2	-						CRP_uc001ftx.1_Intron|CRP_uc001fty.1_5'Flank	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor						acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	TTAGACCCCACCCCCATACCT	0.418													24	9	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169256356	169256357	+	Intron	INS	-	A	A	rs146291925	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169256356_169256357insA	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_3'UTR	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					AATCCACAAAGAAAAGACAAAT	0.342													3	6	---	---	---	---	
LHX9	56956	broad.mit.edu	37	1	197881675	197881675	+	Frame_Shift_Del	DEL	C	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197881675delC	uc001gui.1	+	1	41	c.14delC	c.(13-15)ACCfs	p.T5fs	LHX9_uc009wzc.1_RNA	NM_001014434	NP_001014434	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 2	Error:Variant_position_missing_in_Q9NQ69_after_alignment					motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						CTGAACGGTACCACTCTAGAG	0.567													139	91	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198804351	198804354	+	IGR	DEL	AAGG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198804351_198804354delAAGG								PTPRC (77806 upstream) : MIR181B1 (23648 downstream)																							ggaatgaatcaaggaaggaaggaa	0.000													4	2	---	---	---	---	
OR13G1	441933	broad.mit.edu	37	1	247835572	247835572	+	Frame_Shift_Del	DEL	G	-	-	rs117404602	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247835572delG	uc001idi.1	-	1	772	c.772delC	c.(772-774)CGCfs	p.R258fs		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAAGCAGGGCGGATATAGGTG	0.463													70	62	---	---	---	---	
MBOAT2	129642	broad.mit.edu	37	2	9022779	9022789	+	Intron	DEL	TCATTTGAAAT	-	-	rs138317674	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9022779_9022789delTCATTTGAAAT	uc002qzg.1	-						MBOAT2_uc010yix.1_Intron	NM_138799	NP_620154	Q6ZWT7	MBOA2_HUMAN	O-acyltransferase (membrane bound) domain						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATTACTTTCCTCATTTGAAATTCATGCTATT	0.346													11	7	---	---	---	---	
DNAJC27	51277	broad.mit.edu	37	2	25180058	25180059	+	Intron	DEL	AG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180058_25180059delAG	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						GGCGGGGGACAGAGAGAAGATT	0.441													93	8	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61483709	61483709	+	Intron	DEL	A	-	-	rs34025877		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61483709delA	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AATGCTCAGCaaaaaaatttt	0.244													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90048090	90048091	+	Intron	DEL	CA	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90048090_90048091delCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		cacacacactcacacacacaca	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90475355	90475362	+	IGR	DEL	TCCTTCCT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90475355_90475362delTCCTTCCT								None (None upstream) : None (None downstream)																							ccttccttcctccttccttccttccttc	0.048													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92195739	92195742	+	IGR	DEL	AGGA	-	-	rs11694625		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92195739_92195742delAGGA								FKSG73 (65245 upstream) : None (None downstream)																							ggagggaaagaggaaggaaggaag	0.049													4	2	---	---	---	---	
FAM126B	285172	broad.mit.edu	37	2	201846351	201846351	+	Frame_Shift_Del	DEL	G	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201846351delG	uc002uws.3	-	12	1423	c.1235delC	c.(1234-1236)CCAfs	p.P412fs	FAM126B_uc002uwu.2_Frame_Shift_Del_p.P386fs|FAM126B_uc002uwv.2_Frame_Shift_Del_p.P412fs	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	412						intracellular				ovary(1)	1						AAGATCAGTTGGTTGCTGTAC	0.478													67	9	---	---	---	---	
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tgtgtgtgtgtgtgtctctctctctctctctctctctctctctctc	0.226													5	4	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	242007465	242007465	+	Intron	DEL	A	-	-	rs145826495	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242007465delA	uc002wah.1	+						SNED1_uc002wai.1_Intron|SNED1_uc002waj.1_Intron|SNED1_uc002wak.2_Intron	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TGTGGACTGTACCACCTGCCG	0.652													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	31496045	31496047	+	IGR	DEL	GAG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31496045_31496047delGAG								GADL1 (559892 upstream) : STT3B (78444 downstream)																							CTCTTTTGATGAGGACTTTGCAC	0.478													19	13	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	62204700	62204706	+	Intron	DEL	GCTGGCC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62204700_62204706delGCTGGCC	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GGGGCCAGATGCTGGCCAGGTTTTGCT	0.551													111	17	---	---	---	---	
ATP1B3	483	broad.mit.edu	37	3	141632860	141632861	+	Intron	INS	-	A	A	rs147422245	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141632860_141632861insA	uc003eug.1	+						ATP1B3_uc011bne.1_Intron|ATP1B3_uc003euh.1_Intron	NM_001679	NP_001670	P54709	AT1B3_HUMAN	Na+/K+ -ATPase beta 3 subunit						ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity				0						GTTTATATGGCAAAAAAAAGAG	0.327													7	5	---	---	---	---	
EHHADH	1962	broad.mit.edu	37	3	184971824	184971833	+	5'UTR	DEL	CCGAGGGCAC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184971824_184971833delCCGAGGGCAC	uc003fpf.2	-	1					EHHADH_uc011brs.1_5'UTR	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl							peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	TCCTCTATCACCGAGGGCACCTCTGCCTCT	0.681													33	7	---	---	---	---	
CRMP1	1400	broad.mit.edu	37	4	5884959	5884960	+	Intron	INS	-	TTCCTTCC	TTCCTTCC			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5884959_5884960insTTCCTTCC	uc003gip.2	-						CRMP1_uc003gin.1_Intron|CRMP1_uc003giq.2_Intron|CRMP1_uc003gir.2_Intron|CRMP1_uc003gis.2_Intron	NM_001313	NP_001304	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 2						axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		Gcctgcctgctttccttccttc	0.262													6	5	---	---	---	---	
STIM2	57620	broad.mit.edu	37	4	27009063	27009063	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27009063delT	uc003gsh.3	+						STIM2_uc003gsg.3_Intron|STIM2_uc010iex.2_Intron|STIM2_uc010iey.2_Intron	NM_020860	NP_065911	Q9P246	STIM2_HUMAN	stromal interaction molecule 2						activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)				TTAAAATAGCTTTTTTTTTTT	0.169													4	3	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531131	68531132	+	Intron	INS	-	T	T	rs72340884		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531131_68531132insT	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CCAGCATAGTGtttttttttgt	0.243													6	3	---	---	---	---	
GYPE	2996	broad.mit.edu	37	4	144826703	144826704	+	5'UTR	INS	-	ACCAAAG	ACCAAAG			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144826703_144826704insACCAAAG	uc003ijj.2	-	1					GYPE_uc010ion.2_RNA|GYPE_uc003ijk.3_5'UTR	NM_198682	NP_941391	P15421	GLPE_HUMAN	glycophorin E precursor							integral to plasma membrane					0	all_hematologic(180;0.158)					GCAAAAAAACTACCAAAGACAA	0.441													19	7	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58287553	58287556	+	Intron	DEL	AAAC	-	-	rs3840337		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58287553_58287556delAAAC	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	GAAAAAAAAAAAACCCCAATTAAT	0.319													4	2	---	---	---	---	
CRHBP	1393	broad.mit.edu	37	5	76264841	76264842	+	3'UTR	DEL	CA	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76264841_76264842delCA	uc003ker.2	+	7						NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein						female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		CGcacgcgcgcacacacacaca	0.292													4	2	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1546840	1546840	+	5'Flank	DEL	T	-	-	rs111819550		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1546840delT	uc003skn.2	-						INTS1_uc003skq.2_5'Flank	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GTCAttattcttttttttttt	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114529295	114529298	+	IGR	DEL	CTTA	-	-	rs35079458	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114529295_114529298delCTTA								FOXP2 (198203 upstream) : MDFIC (32911 downstream)																							tccttccttccttaacagttttgc	0.000													2	5	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25708397	25708397	+	Intron	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25708397delA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		tgcagggattaaaaaaaaaaa	0.050													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	69015997	69015998	+	Intron	DEL	CA	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69015997_69015998delCA	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						tccgtgaccccacatatgcctg	0.000													116	92	---	---	---	---	
SULF1	23213	broad.mit.edu	37	8	70515423	70515424	+	Intron	DEL	AC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70515423_70515424delAC	uc010lza.1	+						SULF1_uc003xyd.2_Intron|SULF1_uc003xye.2_Intron|SULF1_uc003xyf.2_Intron|SULF1_uc003xyg.2_Intron|SULF1_uc003xyh.1_Intron	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor						apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GTGCCCCTTTACAGAGTCCCAC	0.540													366	99	---	---	---	---	
MRPL13	28998	broad.mit.edu	37	8	121426426	121426427	+	Intron	DEL	GT	-	-	rs139055716		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121426426_121426427delGT	uc003ypa.2	-						MRPL13_uc010mdf.2_Intron	NM_014078	NP_054797	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13						translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TACTTCATAAGTGTTAAAAAAA	0.208													5	3	---	---	---	---	
DENND3	22898	broad.mit.edu	37	8	142175564	142175564	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142175564delT	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003yvz.1_Intron	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			ctacttcttcttttttttttt	0.189													6	3	---	---	---	---	
RNF20	56254	broad.mit.edu	37	9	104307274	104307275	+	Intron	INS	-	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104307274_104307275insT	uc004bbn.2	+							NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20						histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGCCTATCATATCATAGGGGAT	0.391													34	11	---	---	---	---	
SARDH	1757	broad.mit.edu	37	9	136550476	136550477	+	Intron	INS	-	G	G	rs9409845	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136550476_136550477insG	uc004cep.3	-						SARDH_uc004ceo.2_Intron|SARDH_uc011mdn.1_Intron|SARDH_uc011mdo.1_Intron|SARDH_uc004cen.2_Intron	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor						glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GGAAAGGCCCCGGGGACCTGCC	0.525													5	3	---	---	---	---	
FAM21A	387680	broad.mit.edu	37	10	51855357	51855359	+	Splice_Site	DEL	AGG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51855357_51855359delAGG	uc001jjb.2	+	15	1323	c.1241_splice	c.e15-1	p.G414_splice	FAM21A_uc001jja.1_Splice_Site_p.G166_splice|FAM21A_uc010qhi.1_Splice_Site_p.G414_splice|FAM21A_uc010qhj.1_Splice_Site_p.G414_splice|FAM21B_uc009xoq.2_Splice_Site_p.G326_splice	NM_001005751	NP_001005751	Q641Q2	FA21A_HUMAN	hypothetical protein LOC387680						retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						TTCCACCCACAGGAGACACGGAT	0.512													38	17	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60273190	60273193	+	Intron	DEL	CGGC	-	-	rs10571555		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60273190_60273193delCGGC	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CTCCAGCCTACGGCCGGCCGGTTT	0.667													4	2	---	---	---	---	
C10orf27	219793	broad.mit.edu	37	10	72541523	72541532	+	Intron	DEL	CCCTCTGCTC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72541523_72541532delCCCTCTGCTC	uc001jrj.1	-						C10orf27_uc010qjm.1_Intron|C10orf27_uc009xqh.1_Intron|C10orf27_uc010qjn.1_Intron|C10orf27_uc009xqi.1_Intron|C10orf27_uc010qjo.1_Intron|C10orf27_uc009xqj.1_Intron|C10orf27_uc010qjp.1_Intron	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph						cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						TAGTGATACTCCCTCTGCTCCCACCCCAAC	0.600													30	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	93426744	93426744	+	IGR	DEL	C	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93426744delC								PPP1R3C (33886 upstream) : TNKS2 (131407 downstream)																							GAGGGGGCCTCCAATTCCTGC	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	98510681	98510682	+	IGR	DEL	AA	-	-	rs3179754		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98510681_98510682delAA								PIK3AP1 (30402 upstream) : MIR607 (77744 downstream)																							GTTAATTCCTaaaaaaaaaaaa	0.233													4	2	---	---	---	---	
VWA2	340706	broad.mit.edu	37	10	116014989	116014989	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116014989delT	uc001lbl.1	+						VWA2_uc001lbk.1_Intron|VWA2_uc009xyf.1_Intron	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2							extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)		catctttttcttttttttttt	0.000													6	3	---	---	---	---	
OR52K1	390036	broad.mit.edu	37	11	4510227	4510227	+	Frame_Shift_Del	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4510227delT	uc001lza.1	+	1	97	c.97delT	c.(97-99)TTCfs	p.F33fs		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTCCATCCCCTTCTGCTTTGC	0.498													63	99	---	---	---	---	
CALCB	797	broad.mit.edu	37	11	15096530	15096533	+	Intron	DEL	AGGA	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15096530_15096533delAGGA	uc001mlx.1	+						CALCB_uc009ygr.1_Intron	NM_000728	NP_000719	P10092	CALCB_HUMAN	calcitonin-related polypeptide, beta precursor						cellular calcium ion homeostasis|signal transduction|vasodilation	extracellular region|soluble fraction	neuropeptide hormone activity				0						AGCAGAGACCAGGAAGCCTGGCTG	0.652											OREG0020793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89771845	89771846	+	Intron	DEL	TT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89771845_89771846delTT	uc010rua.1	+							NM_020358	NP_065091			ring finger protein 18																		ATCTTTCTTCTTTTTTTTTTTT	0.351													0	6	---	---	---	---	
YAP1	10413	broad.mit.edu	37	11	102056738	102056738	+	Intron	DEL	C	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102056738delC	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron|YAP1_uc010rup.1_5'Flank	NM_001130145	NP_001123617	P46937	YAP1_HUMAN	Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TTTTTTTTTTCTGTATTATAG	0.338													589	7	---	---	---	---	
TMEM123	114908	broad.mit.edu	37	11	102269328	102269328	+	3'UTR	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102269328delA	uc001pha.2	-	5					TMEM123_uc009yxc.2_3'UTR	NM_052932	NP_443164	Q8N131	PORIM_HUMAN	transmembrane protein 123 precursor						oncosis	external side of plasma membrane|integral to membrane	receptor activity			breast(2)	2	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		CACCCCAGCCAAAAAAAAAAA	0.388													64	9	---	---	---	---	
MMP12	4321	broad.mit.edu	37	11	102738795	102738796	+	Frame_Shift_Ins	INS	-	T	T	rs68192524		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102738795_102738796insT	uc001phk.2	-	5	674_675	c.629_630insA	c.(628-630)ACCfs	p.T210fs		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	210					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	AGGAACAAGTGGTGCCTAAGAA	0.416													221	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134310566	134310567	+	Intron	INS	-	CCCG	CCCG			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134310566_134310567insCCCG	uc001qhs.2	+											Homo sapiens cDNA FLJ37762 fis, clone BRHIP2024347, weakly similar to GALECTIN-3.																		tcatccgtccatccacccatcc	0.000													4	3	---	---	---	---	
USP5	8078	broad.mit.edu	37	12	6973255	6973287	+	In_Frame_Del	DEL	GGCTCCACAAGCGCAGCAGCCGACCCCCCTCCT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6973255_6973287delGGCTCCACAAGCGCAGCAGCCGACCCCCCTCCT	uc001qri.3	+	17	2199_2231	c.2140_2172delGGCTCCACAAGCGCAGCAGCCGACCCCCCTCCT	c.(2140-2172)GGCTCCACAAGCGCAGCAGCCGACCCCCCTCCTdel	p.GSTSAAADPPP714del	USP5_uc001qrh.3_In_Frame_Del_p.GSTSAAADPPP691del	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	714_724	UBA 2.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding	p.D698N(1)		lung(2)|breast(1)|skin(1)	4						TAGTGGGCCGGGCTCCACAAGCGCAGCAGCCGACCCCCCTCCTGAGGACTGTG	0.635													188	7	---	---	---	---	
AVPR1A	552	broad.mit.edu	37	12	63543915	63543926	+	In_Frame_Del	DEL	GGTACCCAAGAT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63543915_63543926delGGTACCCAAGAT	uc001sro.1	-	1	2665_2676	c.691_702delATCTTGGGTACC	c.(691-702)ATCTTGGGTACCdel	p.ILGT231del		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	231_234	Helical; Name=5; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	AGCCGTAGCAGGTACCCAAGATGACCACGGGC	0.632													74	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92266794	92266795	+	IGR	DEL	GT	-	-	rs10546470		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92266794_92266795delGT								DCN (689988 upstream) : BTG1 (112071 downstream)																							attgctgTTCgtgtgtgtgtgt	0.114													3	4	---	---	---	---	
USP30	84749	broad.mit.edu	37	12	109490426	109490427	+	5'UTR	INS	-	CGGCGG	CGGCGG	rs140371213	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109490426_109490427insCGGCGG	uc010sxi.1	+	1					USP30_uc001tnu.3_Intron	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						ATCCCTCGGTCcggcggcggcg	0.589													5	3	---	---	---	---	
VPS33A	65082	broad.mit.edu	37	12	122745915	122745919	+	Frame_Shift_Del	DEL	TCAAC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122745915_122745919delTCAAC	uc001ucd.2	-	4	485_489	c.372_376delGTTGA	c.(370-378)CGGTTGAAGfs	p.R124fs	VPS33A_uc001ucc.2_RNA|VPS33A_uc001uce.2_Frame_Shift_Del_p.R124fs	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A	124_126					lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CCCAGATCCTTCAACCGCTGTTCGC	0.473													131	55	---	---	---	---	
NEK3	4752	broad.mit.edu	37	13	52707832	52707832	+	Frame_Shift_Del	DEL	C	-	-	rs34488913	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52707832delC	uc001vgi.2	-	17	1664	c.1429delG	c.(1429-1431)GAGfs	p.E477fs	NEK3_uc001vgg.2_Frame_Shift_Del_p.E454fs|NEK3_uc001vgh.2_Frame_Shift_Del_p.E481fs|NEK3_uc010tgx.1_RNA|NEK3_uc010tgy.1_Frame_Shift_Del_p.E460fs	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a	477					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TACGTGTCCTCCTCATCTAGC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111293683	111293684	+	IGR	INS	-	ATCG	ATCG	rs138202676	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111293683_111293684insATCG								CARKD (1343 upstream) : CARS2 (73 downstream)																							TACTTCACTCAATCGACGGTGA	0.525													4	3	---	---	---	---	
OSGEP	55644	broad.mit.edu	37	14	20922564	20922593	+	Intron	DEL	GTGCCTGTAACTCTTCTAGTCATCAGCCTT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20922564_20922593delGTGCCTGTAACTCTTCTAGTCATCAGCCTT	uc001vxf.2	-						APEX1_uc001vxg.2_5'Flank|APEX1_uc001vxh.2_5'Flank|APEX1_uc001vxi.2_5'Flank|APEX1_uc001vxj.2_5'Flank	NM_017807	NP_060277	Q9NPF4	OSGEP_HUMAN	O-sialoglycoprotein endopeptidase						proteolysis|tRNA processing		metal ion binding|metalloendopeptidase activity|protein binding				0	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		ccacgtccaagtgcctgtaactcttctagtcatcagccttgtgacgttaa	0.257													31	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38996477	38996477	+	IGR	DEL	G	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38996477delG								CLEC14A (270903 upstream) : SEC23A (504646 downstream)																							gaggtgggaaggagggagaga	0.134													4	2	---	---	---	---	
RTN1	6252	broad.mit.edu	37	14	60096966	60096966	+	Intron	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60096966delA	uc001xen.1	-						RTN1_uc001xem.1_Intron|RTN1_uc001xek.1_Intron|RTN1_uc001xel.1_Intron|RTN1_uc010apl.1_Intron	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GGGTGGGGTTAAAAAAAAAAA	0.398													6	4	---	---	---	---	
ERH	2079	broad.mit.edu	37	14	69847046	69847046	+	3'UTR	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69847046delA	uc001xlc.2	-	4						NM_004450	NP_004441	P84090	ERH_HUMAN	enhancer of rudimentary homolog						cell cycle|pyrimidine nucleoside metabolic process	midbody	protein binding				0				all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		ATGTTTAAGTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
MAP3K9	4293	broad.mit.edu	37	14	71267150	71267150	+	Intron	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71267150delA	uc001xmm.2	-						MAP3K9_uc001xml.2_Intron	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CTAGACTGCTAAAAAAAAAAG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103770193	103770193	+	IGR	DEL	A	-	-	rs35374634		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103770193delA								TNFAIP2 (166417 upstream) : EIF5 (30300 downstream)																							accccacctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22567080	22567096	+	IGR	DEL	CAATGACAACAATAGTG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22567080_22567096delCAATGACAACAATAGTG								MIR1268 (53800 upstream) : GOLGA8DP (135189 downstream)																							AAGACGAGGACAATGACAACAATAGTGCCACCACAGA	0.433													203	49	---	---	---	---	
WDR93	56964	broad.mit.edu	37	15	90260276	90260277	+	Intron	INS	-	T	T	rs148200475		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90260276_90260277insT	uc002boj.2	+						WDR93_uc010bnr.2_Intron	NM_020212	NP_064597	Q6P2C0	WDR93_HUMAN	WD repeat domain 93						electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ctttttctttcttttttttttt	0.079													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	7969874	7969877	+	IGR	DEL	GAAG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7969874_7969877delGAAG								A2BP1 (206534 upstream) : TMEM114 (649626 downstream)																							aggaaggaaagaaggaaggaagga	0.172													4	2	---	---	---	---	
VPS35	55737	broad.mit.edu	37	16	46696529	46696532	+	Intron	DEL	CTTG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46696529_46696532delCTTG	uc002eef.3	-						VPS35_uc002eed.2_Intron|VPS35_uc002eee.2_Intron	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				tgcaccctctcttgagagccacag	0.196													18	15	---	---	---	---	
SMTNL2	342527	broad.mit.edu	37	17	4510756	4510756	+	Frame_Shift_Del	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4510756delT	uc002fyf.1	+	8	1427	c.1360delT	c.(1360-1362)TACfs	p.Y454fs	SMTNL2_uc002fye.2_Frame_Shift_Del_p.Y310fs|uc002fyg.1_5'Flank	NM_001114974	NP_001108446	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2 isoform 1	454	CH.										0				READ - Rectum adenocarcinoma(115;0.0325)		CCAGTCGCTGTACAACCACCT	0.612													91	117	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10223573	10223574	+	Intron	INS	-	A	A	rs151170040	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10223573_10223574insA	uc002gmk.1	-						MYH13_uc010vve.1_Intron	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GCAAATAGATTAAAAAAAAATA	0.361													9	8	---	---	---	---	
USP22	23326	broad.mit.edu	37	17	20918991	20918991	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20918991delT	uc002gym.3	-						USP22_uc002gyn.3_Intron|USP22_uc002gyl.3_Intron	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22						cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						CACGAGTGCATACACTCGCTT	0.517													2	8	---	---	---	---	
ATAD5	79915	broad.mit.edu	37	17	29171765	29171766	+	Intron	INS	-	AAAAA	AAAAA	rs66504576		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29171765_29171766insAAAAA	uc002hfs.1	+						ATAD5_uc002hft.1_Intron	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5						response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				gactccatctcaaaaaaaaaaa	0.119													41	7	---	---	---	---	
HCRT	3060	broad.mit.edu	37	17	40336501	40336503	+	In_Frame_Del	DEL	GCA	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40336501_40336503delGCA	uc002hzc.1	-	2	152_154	c.65_67delTGC	c.(64-69)CTGCCG>CCG	p.L22del		NM_001524	NP_001515	O43612	OREX_HUMAN	orexin precursor	22					neuropeptide signaling pathway	cell junction|extracellular region|rough endoplasmic reticulum|synaptic vesicle					0		all_cancers(22;1.39e-06)|all_epithelial(22;9.98e-06)|Breast(137;0.000143)|Ovarian(249;0.0221)|Myeloproliferative disorder(1115;0.0255)|Colorectal(1115;0.069)		BRCA - Breast invasive adenocarcinoma(366;0.124)		AGCGCGGgcggcagcagcagcag	0.606													8	4	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	TG	TG	rs142406301	by1000genomes	TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626918_73626919insTG	uc010dgl.2	-	12	1742	c.1586_splice	c.e12-1	p.D529_splice	RECQL5_uc010dgk.2_Splice_Site_p.D502_splice|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other_identified_genes_with_known_or_suspected_DNA_repair_function					10	5	---	---	---	---	
DSC3	1825	broad.mit.edu	37	18	28581515	28581515	+	Intron	DEL	G	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28581515delG	uc002kwj.3	-						DSC3_uc002kwi.3_Intron	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein						homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CCTAAATTTTGAAATGAGTTT	0.254													31	11	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43468063	43468063	+	Intron	DEL	T	-	-	rs1075748		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43468063delT	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						ACTGAttttcttttttttttt	0.144													4	2	---	---	---	---	
ATP8B1	5205	broad.mit.edu	37	18	55328853	55328858	+	Intron	DEL	GTGTGC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55328853_55328858delGTGTGC	uc002lgw.2	-						uc002lgu.1_Intron|uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1						ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				gtatatatatgtgtgcgtgtgtatgt	0.097									Byler_disease				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	19946168	19946168	+	IGR	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19946168delA								ZNF506 (13608 upstream) : ZNF253 (30546 downstream)																							AGAATGCGGGAAAGCCTTTAA	0.403													26	13	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45767748	45767749	+	Intron	INS	-	A	A	rs79255924		TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45767748_45767749insA	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_5'Flank			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		aactccatctcaaaaaaaaaaa	0.228													7	4	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14674077	14674078	+	IGR	DEL	TG	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14674077_14674078delTG								C21orf99 (183508 upstream) : POTED (308420 downstream)																							CTGGGCtgtttgtgtgtgtgtg	0.267													4	2	---	---	---	---	
CLDN14	23562	broad.mit.edu	37	21	37860564	37860565	+	Intron	INS	-	T	T			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37860564_37860565insT	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550	O95500	CLD14_HUMAN	claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0						tccttccttccttccttccctc	0.010													3	3	---	---	---	---	
CABIN1	23523	broad.mit.edu	37	22	24480374	24480374	+	Intron	DEL	T	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24480374delT	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						gtaGTGCAGATTTTTTTTTTT	0.184													3	4	---	---	---	---	
CSNK1E	1454	broad.mit.edu	37	22	38696882	38696883	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38696882_38696883delGC	uc003avj.2	-	5	672_673	c.411_412delGC	c.(409-414)GGGCTGfs	p.G137fs	CSNK1E_uc003avk.2_Frame_Shift_Del_p.G137fs|CSNK1E_uc003avl.1_RNA|CSNK1E_uc003avm.1_Frame_Shift_Del_p.G137fs|CSNK1E_uc003avo.2_Frame_Shift_Del_p.G137fs|CSNK1E_uc003avp.1_Frame_Shift_Del_p.G137fs|CSNK1E_uc003avq.1_Frame_Shift_Del_p.G137fs	NM_152221	NP_689407	P49674	KC1E_HUMAN	casein kinase 1 epsilon	137_138	Protein kinase.				DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)					TTCTTCCCCAGCCCCATGAGGA	0.569													68	72	---	---	---	---	
CACNA1F	778	broad.mit.edu	37	X	49089732	49089749	+	Splice_Site	DEL	GAAGGATTCTCTCACCTT	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49089732_49089749delGAAGGATTCTCTCACCTT	uc004dnb.2	-	1	87	c.25_splice	c.e1+1	p.D9_splice	CACNA1F_uc010nip.2_Splice_Site_p.D9_splice|CCDC22_uc011mna.1_5'Flank|CCDC22_uc004dnc.1_5'Flank|CCDC22_uc004dnd.1_5'Flank	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	TGCAGGGATGGAAGGATTCTCTCACCTTTCCCGCCTTC	0.578													26	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	133301110	133301110	+	IGR	DEL	A	-	-			TCGA-C4-A0F0-01	TCGA-C4-A0F0-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133301110delA								GPC3 (181444 upstream) : MIR363 (2298 downstream)																							TGAAATGTTCAAAAAAAAAAA	0.269													4	2	---	---	---	---	
