Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MRPL20	55052	broad.mit.edu	37	1	1337719	1337719	+	Intron	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1337719G>C	uc001afo.3	-						LOC148413_uc001afn.1_RNA	NM_017971	NP_060441	Q9BYC9	RM20_HUMAN	mitochondrial ribosomal protein L20 precursor								protein binding|rRNA binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGCTCAGGAAGAACCCAGCTG	0.572													5	16	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11561631	11561631	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11561631G>T	uc001ash.3	+	2	720	c.582G>T	c.(580-582)AAG>AAT	p.K194N	PTCHD2_uc001asi.1_Missense_Mutation_p.K194N	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	194	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CGGCTCAAAAGCCCACAGCCA	0.697													8	12	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16375484	16375484	+	Intron	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16375484C>T	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron|CLCNKB_uc001axy.3_Silent_p.L6L	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCTCCCCTCCTGTCTGTCC	0.657													7	21	---	---	---	---	PASS
ATP13A2	23400	broad.mit.edu	37	1	17330838	17330838	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17330838G>A	uc001baa.2	-	6	736	c.546C>T	c.(544-546)TTC>TTT	p.F182F	ATP13A2_uc001bab.2_Silent_p.F177F|ATP13A2_uc001bac.2_Silent_p.F177F	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	182	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TGACCTGGTAGAAGGCTTGCT	0.433													7	31	---	---	---	---	PASS
C1orf38	9473	broad.mit.edu	37	1	28212380	28212380	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28212380G>A	uc001bpc.3	+	6	1907	c.1879G>A	c.(1879-1881)GAT>AAT	p.D627N	C1orf38_uc001boz.2_3'UTR|C1orf38_uc001bpa.2_3'UTR|C1orf38_uc010ofn.1_Missense_Mutation_p.D431N|C1orf38_uc010ofo.1_Missense_Mutation_p.D498N	NM_001105556	NP_001099026	Q5TEJ8	THMS2_HUMAN	basement membrane-induced gene isoform 3	627	Asp/Glu-rich.				cell adhesion|inflammatory response					ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;2.52e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTGCAGATGATGATGAACA	0.299													21	62	---	---	---	---	PASS
TINAGL1	64129	broad.mit.edu	37	1	32043028	32043028	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32043028C>T	uc001bta.2	+	2	405	c.279C>T	c.(277-279)CTC>CTT	p.L93L	TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Silent_p.L93L|TINAGL1_uc010ogj.1_Silent_p.L93L|TINAGL1_uc010ogk.1_Silent_p.L93L	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	93	SMB.				endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		ACTTCTGCCTCGGCGTGCCAC	0.607													60	162	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32264127	32264127	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32264127G>T	uc001bts.1	-	8	2002	c.1944C>A	c.(1942-1944)CTC>CTA	p.L648L	SPOCD1_uc001btt.2_Translation_Start_Site|SPOCD1_uc001btu.2_Silent_p.L648L|SPOCD1_uc001btv.2_Silent_p.L141L|SPOCD1_uc001btw.1_Translation_Start_Site	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	648	TFIIS central.				transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TCAGGTCCCAGAGGGCTGCCT	0.642													14	58	---	---	---	---	PASS
CYP4Z2P	163720	broad.mit.edu	37	1	47325196	47325196	+	RNA	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47325196C>G	uc001cqo.1	-	9		c.1372G>C				NR_002788				Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar to CYTOCHROME P450 4A1 (EC 1.14.15.3).												0						TTCTCCCTCTCTGGGAAATAA	0.438													5	6	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101194673	101194673	+	Silent	SNP	T	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101194673T>C	uc001dti.2	+	5	1059	c.939T>C	c.(937-939)TTT>TTC	p.F313F	VCAM1_uc001dtj.2_Intron|VCAM1_uc010ouj.1_Silent_p.F251F	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	313	Ig-like C2-type 4.|Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGAAACCATTTACTGTTGAGA	0.413													13	31	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109806818	109806818	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109806818G>A	uc001dxa.3	+	10	5181	c.5120G>A	c.(5119-5121)GGA>GAA	p.G1707E		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1707	Extracellular (Potential).|Laminin G-like 2.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTGGCACTGGGAGCCAGCGGG	0.667											OREG0013632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	94	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109806952	109806952	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109806952G>A	uc001dxa.3	+	10	5315	c.5254G>A	c.(5254-5256)GGC>AGC	p.G1752S		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1752	Extracellular (Potential).|Laminin G-like 2.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGGGCCAGCCGGCGGTGTGGC	0.667											OREG0013632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	111	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144903050	144903050	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144903050G>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Missense_Mutation_p.H733Y	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTTGTGATGAATTCGCACA	0.522			T	PDGFRB	MPD								36	181	---	---	---	---	PASS
POLR3C	10623	broad.mit.edu	37	1	145608196	145608196	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145608196C>T	uc001eoh.2	-	4	662	c.501G>A	c.(499-501)GAG>GAA	p.E167E	NBPF10_uc001emp.3_Intron|RNF115_uc001eoj.2_5'Flank|RNF115_uc001eok.2_5'Flank|RNF115_uc009wiy.2_5'Flank|POLR3C_uc001eog.2_Silent_p.E180E|POLR3C_uc001eoi.2_RNA|POLR3C_uc009wix.2_Silent_p.E167E	NM_006468	NP_006459	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	167					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GGTCTGAATTCTCAGTGGTAG	0.478													30	187	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152193724	152193724	+	Missense_Mutation	SNP	A	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152193724A>T	uc001ezt.1	-	3	457	c.381T>A	c.(379-381)TTT>TTA	p.F127L		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	127	1.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGAATGACTAAAAGAGGATT	0.438													55	297	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	168034939	168034939	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168034939G>C	uc001gew.2	+	16	2520	c.2278G>C	c.(2278-2280)GAT>CAT	p.D760H	DCAF6_uc001gev.2_Missense_Mutation_p.D780H|DCAF6_uc001gex.2_Missense_Mutation_p.D851H|DCAF6_uc010plk.1_Missense_Mutation_p.D820H|DCAF6_uc001gey.2_Missense_Mutation_p.D633H|DCAF6_uc001gez.2_Missense_Mutation_p.D65H	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	760	WD 7.				positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TCTGGAAGCTGATAATCATGT	0.443													48	36	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201056980	201056980	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201056980G>A	uc001gvv.2	-	7	1205	c.978C>T	c.(976-978)CTC>CTT	p.L326L		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	326	I.|Helical; Name=S6 of repeat I; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GCACCAGGTTGAGGATGAAGA	0.393													11	81	---	---	---	---	PASS
MFSD4	148808	broad.mit.edu	37	1	205548822	205548822	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205548822G>A	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Silent_p.E3E	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GAATGGAGGAGAAGGGGGAGG	0.582													42	115	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207314560	207314560	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207314560C>T	uc001hfo.2	+	10	1577	c.1383C>T	c.(1381-1383)GTC>GTT	p.V461V		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	461	Sushi 7.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ACATTCTGGTCGGACAGGCGA	0.413													27	112	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222826648	222826648	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222826648G>C	uc001hnl.2	+	15	4297	c.4288G>C	c.(4288-4290)GAT>CAT	p.D1430H	MIA3_uc009xea.1_Missense_Mutation_p.D1207H|MIA3_uc001hnm.2_Missense_Mutation_p.D308H	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1430	Cytoplasmic (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		AGGTGGAAATGATTCAGATGA	0.418													16	56	---	---	---	---	PASS
NID1	4811	broad.mit.edu	37	1	236208952	236208952	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236208952G>C	uc001hxo.2	-	3	659	c.557C>G	c.(556-558)TCT>TGT	p.S186C	NID1_uc009xgd.2_Missense_Mutation_p.S186C	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	186	NIDO.				cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	GCTGGAATCAGAGGAGGCTAG	0.413													17	65	---	---	---	---	PASS
KCNS3	3790	broad.mit.edu	37	2	18112633	18112633	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18112633C>T	uc002rcv.2	+	3	809	c.358C>T	c.(358-360)CGC>TGC	p.R120C	KCNS3_uc002rcw.2_Missense_Mutation_p.R120C	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel	120	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CTGCAGCAATCGCTACCAGGA	0.507													40	133	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21239390	21239390	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21239390C>T	uc002red.2	-	21	3381	c.3253G>A	c.(3253-3255)GAG>AAG	p.E1085K		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1085					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GTTTTGCCCTCAGTAGATTCA	0.453													24	59	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21250702	21250702	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21250702C>T	uc002red.2	-	14	2193	c.2065G>A	c.(2065-2067)GAG>AAG	p.E689K		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	689					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACACTTACCTCGATGAGGTCA	0.433													18	54	---	---	---	---	PASS
TP53I3	9540	broad.mit.edu	37	2	24305998	24305998	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24305998G>A	uc002rey.1	-	3	223	c.163C>T	c.(163-165)CCA>TCA	p.P55S	LOC375190_uc002rew.2_Intron|TP53I3_uc002rex.1_Missense_Mutation_p.P55S|TP53I3_uc002rez.1_Missense_Mutation_p.P55S|TP53I3_uc010ykk.1_Silent_p.L4L	NM_147184	NP_671713	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	55					induction of apoptosis by oxidative stress|NADP metabolic process		NADPH binding|NADPH:quinone reductase activity|protein homodimerization activity|quinone binding|zinc ion binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGCTCCTGGAGGTGGGTCA	0.562													60	145	---	---	---	---	PASS
TRMT61B	55006	broad.mit.edu	37	2	29072852	29072852	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29072852C>T	uc002rmm.2	-	7					SPDYA_uc002rmj.2_3'UTR|SPDYA_uc002rmk.2_3'UTR|TRMT61B_uc002rmn.2_3'UTR|TRMT61B_uc010ezk.2_RNA	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B								tRNA (adenine-N1-)-methyltransferase activity				0						TACAAAATGTCAAACTAACTG	0.303													9	19	---	---	---	---	PASS
AFTPH	54812	broad.mit.edu	37	2	64779737	64779737	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64779737G>C	uc002sdc.2	+	1	1161	c.1129G>C	c.(1129-1131)GAT>CAT	p.D377H	AFTPH_uc002scz.2_Missense_Mutation_p.D377H|AFTPH_uc002sda.2_Missense_Mutation_p.D377H|AFTPH_uc002sdb.2_Missense_Mutation_p.D377H	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a	377					protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						TAAAACTTCTGATGATGAAGT	0.348													30	78	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74273845	74273845	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74273845G>C	uc002skb.3	+	1	396	c.396G>C	c.(394-396)ATG>ATC	p.M132I	TET3_uc010fez.1_Missense_Mutation_p.M132I	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	132							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GGCATGGTATGAAACCACCCA	0.632													5	106	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98737802	98737802	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98737802C>T	uc002syo.2	+	5	847	c.583C>T	c.(583-585)CCT>TCT	p.P195S	VWA3B_uc010yvh.1_Missense_Mutation_p.P45S|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_5'UTR|VWA3B_uc002sym.2_Missense_Mutation_p.P195S|VWA3B_uc002syn.1_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	195										ovary(3)|large_intestine(2)|skin(1)	6						AAATGCTACTCCTGTGACCGA	0.537													15	44	---	---	---	---	PASS
NCK2	8440	broad.mit.edu	37	2	106471515	106471515	+	5'UTR	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106471515G>C	uc002tdg.2	+	3					NCK2_uc002tdh.2_5'UTR|NCK2_uc002tdi.2_5'UTR	NM_003581	NP_003572	O43639	NCK2_HUMAN	NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2						AGGACTCCATGAAAGATGACA	0.488													20	49	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112766049	112766049	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112766049C>G	uc002thk.1	+	14	2079	c.1957C>G	c.(1957-1959)CTA>GTA	p.L653V	MERTK_uc002thl.1_Missense_Mutation_p.L477V	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	653	Protein kinase.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						CATTCGACTTCTAGGTACTTC	0.488													25	52	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													2	11	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158165235	158165235	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158165235G>C	uc002tzg.2	+	9	2932	c.2677G>C	c.(2677-2679)GAA>CAA	p.E893Q	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	893	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CTTTCATCCAGAACTGGTAAG	0.408													22	52	---	---	---	---	PASS
UPP2	151531	broad.mit.edu	37	2	158980394	158980394	+	Silent	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158980394C>G	uc002tzp.2	+	6	992	c.798C>G	c.(796-798)CTC>CTG	p.L266L	UPP2_uc002tzo.2_Silent_p.L323L	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a	266					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						TGTGTGGACTCTGTGGTCTAA	0.388													36	102	---	---	---	---	PASS
INPP1	3628	broad.mit.edu	37	2	191227381	191227381	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191227381G>A	uc002ury.3	+	4	933	c.233G>A	c.(232-234)GGA>GAA	p.G78E	INPP1_uc010fsb.2_Missense_Mutation_p.G78E|INPP1_uc002urx.3_Missense_Mutation_p.G78E	NM_001128928	NP_001122400	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	78					signal transduction		inositol-1,4-bisphosphate 1-phosphatase activity|metal ion binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)		Lithium(DB01356)	AATATTTTTGGAGAAGAATCC	0.303													22	73	---	---	---	---	PASS
MOGAT1	116255	broad.mit.edu	37	2	223553091	223553091	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223553091G>T	uc010fws.1	+	2	171	c.123G>T	c.(121-123)ATG>ATT	p.M41I	MOGAT1_uc010fwt.1_Missense_Mutation_p.M1I	NM_058165	NP_477513	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	41	Helical; (Potential).				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			breast(1)	1		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		TCACTGTGATGCTGATCATAC	0.473													5	12	---	---	---	---	PASS
SLC16A14	151473	broad.mit.edu	37	2	230902218	230902218	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230902218C>T	uc002vqd.1	-	5	1774	c.1411G>A	c.(1411-1413)GAT>AAT	p.D471N	FBXO36_uc010fxi.1_Intron	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid	471	Cytoplasmic (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		AAGGAAAAATCATATTTTTGC	0.333													32	42	---	---	---	---	PASS
UGT1A3	54659	broad.mit.edu	37	2	234638460	234638460	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234638460C>A	uc002vuy.2	+	1	688	c.688C>A	c.(688-690)CCT>ACT	p.P230T	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Missense_Mutation_p.P230T	NM_019093	NP_061966	P35503	UD13_HUMAN	UDP glycosyltransferase 1 family, polypeptide A3	230					flavonoid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TTTTTCTGCTCCTTATGCAAG	0.468													86	263	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235962412	235962412	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235962412G>A	uc002vvp.2	+	6	3237	c.2844G>A	c.(2842-2844)CTG>CTA	p.L948L	SH3BP4_uc010fym.2_Silent_p.L930L|SH3BP4_uc002vvq.2_Silent_p.L948L	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	948					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TGGACGTTCTGAGAGCAGCCG	0.597													75	176	---	---	---	---	PASS
LRRN1	57633	broad.mit.edu	37	3	3887565	3887565	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3887565T>A	uc003bpt.3	+	2	2001	c.1240T>A	c.(1240-1242)TTA>ATA	p.L414I	SUMF1_uc003bps.1_Intron	NM_020873	NP_065924	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1 precursor	414	LRRCT.|Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		GAAGGAAGTTTTAATCCAGGA	0.488													39	93	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11354786	11354786	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11354786G>C	uc003bwc.2	+	6	537	c.420G>C	c.(418-420)AAG>AAC	p.K140N	ATG7_uc003bwd.2_Missense_Mutation_p.K140N|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	140					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						AGGATCTAAAGAAGTACCACT	0.373													14	63	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19492801	19492801	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19492801A>G	uc003cbk.1	+	10	1925	c.1730A>G	c.(1729-1731)TAT>TGT	p.Y577C	KCNH8_uc011awe.1_3'UTR|KCNH8_uc010hex.1_Missense_Mutation_p.Y38C|KCNH8_uc011awf.1_3'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	577	cNMP.|Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						CCGGGGGAGTATCTGCTGCGT	0.512													30	68	---	---	---	---	PASS
SGOL1	151648	broad.mit.edu	37	3	20218129	20218129	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20218129C>T	uc003cbs.2	-	5	626	c.439G>A	c.(439-441)GAA>AAA	p.E147K	SGOL1_uc003cbr.2_Missense_Mutation_p.E147K|SGOL1_uc010hfa.2_Missense_Mutation_p.E147K|SGOL1_uc003cbt.2_Missense_Mutation_p.E147K|SGOL1_uc003cbu.2_Missense_Mutation_p.E147K|SGOL1_uc003cbv.2_Missense_Mutation_p.E147K|SGOL1_uc003cbw.2_Missense_Mutation_p.E147K|SGOL1_uc003cbx.2_Missense_Mutation_p.E147K|SGOL1_uc003cby.2_Missense_Mutation_p.E147K|SGOL1_uc003cbz.2_Missense_Mutation_p.E147K|SGOL1_uc003cca.2_Missense_Mutation_p.E147K|SGOL1_uc003ccb.2_Missense_Mutation_p.E147K|SGOL1_uc003ccc.2_Missense_Mutation_p.E147K	NM_001012410	NP_001012410	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 isoform A2	147	Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding				0						CCTGGAAGTTCAGTTTCTTCA	0.254													11	46	---	---	---	---	PASS
GLB1	2720	broad.mit.edu	37	3	33038825	33038825	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33038825C>A	uc003cfi.1	-	16	1863	c.1746G>T	c.(1744-1746)TGG>TGT	p.W582C	GLB1_uc003cfh.1_Missense_Mutation_p.W552C|GLB1_uc003cfj.1_Missense_Mutation_p.W451C|GLB1_uc011axk.1_Missense_Mutation_p.W630C	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein	582					carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				AGCCATTAATCCAGACCTGGC	0.597													18	40	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37035075	37035075	+	Missense_Mutation	SNP	G	A	A	rs63750081		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37035075G>A	uc003cgl.2	+	1	97	c.37G>A	c.(37-39)GAG>AAG	p.E13K	MLH1_uc011aye.1_5'Flank|EPM2AIP1_uc003cgk.2_5'Flank|MLH1_uc011ayb.1_5'UTR|MLH1_uc010hge.2_Missense_Mutation_p.E13K|MLH1_uc003cgn.3_5'Flank|MLH1_uc011ayc.1_5'Flank|MLH1_uc011ayd.1_5'Flank|MLH1_uc003cgo.2_5'Flank	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	13					mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding			large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						GCGGCTGGACGAGACAGTGGT	0.567		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				25	75	---	---	---	---	PASS
VIPR1	7433	broad.mit.edu	37	3	42576579	42576579	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42576579G>A	uc003clf.2	+	11	1247	c.1123G>A	c.(1123-1125)GTC>ATC	p.V375I	VIPR1_uc011azl.1_Missense_Mutation_p.V327I|VIPR1_uc011azm.1_Missense_Mutation_p.V165I|VIPR1_uc011azn.1_Missense_Mutation_p.V348I|VIPR1_uc003clg.2_Missense_Mutation_p.V20I	NM_004624	NP_004615	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	375	Helical; Name=7; (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)		CTTTGAGCTCGTCGTGGGGTC	0.498													64	167	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48698816	48698816	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48698816T>A	uc003cul.2	-	1	1533	c.1252A>T	c.(1252-1254)ATG>TTG	p.M418L	CELSR3_uc003cuf.1_Missense_Mutation_p.M488L	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	418	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACGGCCACCATCGTGGTGGCC	0.662													17	56	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48698817	48698817	+	Silent	SNP	C	T	T	rs111946927		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48698817C>T	uc003cul.2	-	1	1532	c.1251G>A	c.(1249-1251)ACG>ACA	p.T417T	CELSR3_uc003cuf.1_Silent_p.T487T	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	417	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGGCCACCATCGTGGTGGCCG	0.657													17	56	---	---	---	---	PASS
C3orf71	646450	broad.mit.edu	37	3	48956327	48956327	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48956327C>T	uc010hkk.1	-	1	492	c.256G>A	c.(256-258)GAC>AAC	p.D86N	ARIH2_uc003cvb.2_5'UTR|ARIH2_uc003cvc.2_5'UTR	NM_001123040	NP_001116512	Q8N7S6	CC071_HUMAN	hypothetical protein LOC646450	86						integral to membrane					0						TGACCGGCGTCGGCCCGCCGC	0.721													5	9	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49166159	49166159	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49166159C>G	uc003cwe.2	-	14	2124	c.1825G>C	c.(1825-1827)GAG>CAG	p.E609Q	LAMB2_uc003cwf.1_Missense_Mutation_p.E609Q	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	609	Laminin IV type B.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACCAGGAACTCCAGGGTCTGA	0.607													47	105	---	---	---	---	PASS
SRPRB	58477	broad.mit.edu	37	3	133534474	133534474	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133534474G>A	uc003epx.1	+	5	467	c.451G>A	c.(451-453)GAG>AAG	p.E151K		NM_021203	NP_067026	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, beta	151						endoplasmic reticulum membrane|integral to membrane	GTP binding|protein binding|receptor activity			ovary(1)	1						ATTCCAGCGAGAGGTGAAAGA	0.433													216	164	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142231262	142231262	+	Silent	SNP	T	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142231262T>G	uc003eux.3	-	27	4814	c.4692A>C	c.(4690-4692)ATA>ATC	p.I1564I		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1564					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						CTTGGGTATTTATGGTATGCT	0.353								Other_conserved_DNA_damage_response_genes					49	166	---	---	---	---	PASS
EIF2A	83939	broad.mit.edu	37	3	150264703	150264703	+	Intron	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150264703G>T	uc003eya.2	+						SERP1_uc003exy.2_5'Flank|SERP1_uc003exz.2_RNA|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCGAGGAGCCGGGGAGTCTGA	0.512													3	47	---	---	---	---	PASS
SUCNR1	56670	broad.mit.edu	37	3	151599155	151599155	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151599155C>T	uc003ezf.1	+	3	923	c.824C>T	c.(823-825)TCC>TTC	p.S275F		NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	275	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	GTCATCAACTCCTTTTACATT	0.473													154	131	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154018909	154018909	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154018909G>C	uc003ezy.3	-	10	1306	c.1225C>G	c.(1225-1227)CCA>GCA	p.P409A	DHX36_uc010hvq.2_Missense_Mutation_p.P409A|DHX36_uc003ezz.3_Missense_Mutation_p.P409A	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	409						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTTGTTCTGGAACATACCTA	0.294													37	134	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219829	160219829	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219829C>T	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			tatatatatacacacacacat	0.313													8	48	---	---	---	---	PASS
ACTL6A	86	broad.mit.edu	37	3	179291159	179291159	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179291159G>A	uc003fjw.2	+	4	453	c.280G>A	c.(280-282)GAA>AAA	p.E94K	ACTL6A_uc003fjx.2_Missense_Mutation_p.E52K|ACTL6A_uc003fjy.2_Missense_Mutation_p.E52K	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1	94					chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			TATTCTAGTTGAAGACTGGGA	0.343													27	120	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179460036	179460036	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179460036G>A	uc003fkh.2	+	12	1513	c.1432G>A	c.(1432-1434)GAA>AAA	p.E478K	USP13_uc003fkf.2_Missense_Mutation_p.E478K	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	478					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TTTTTTGGTGGAAGAACGCAT	0.488													17	117	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186509493	186509493	+	Intron	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186509493C>G	uc003fqz.2	-						RFC4_uc011bsc.1_Intron|RFC4_uc011bsd.1_Silent_p.L274L	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		AAAAGAAATTCAGAATATCCA	0.279													90	85	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186954017	186954017	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186954017G>A	uc003frh.1	-						MASP1_uc003fri.2_Nonsense_Mutation_p.Q548*|MASP1_uc003frj.2_Nonsense_Mutation_p.Q517*	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TTGTAGTTTTGGATGTTGAAG	0.582													129	86	---	---	---	---	PASS
CRIPAK	285464	broad.mit.edu	37	4	1389009	1389009	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1389009G>T	uc003gdf.2	+	1	3670	c.710G>T	c.(709-711)GGA>GTA	p.G237V		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	237	6.				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCGATGCGGAGTGCCCGCC	0.677													24	156	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2701583	2701583	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2701583G>C	uc010icl.2	+	17	3162	c.2811G>C	c.(2809-2811)AAG>AAC	p.K937N	FAM193A_uc010ick.2_Missense_Mutation_p.K1137N|FAM193A_uc003gfd.2_Missense_Mutation_p.K937N|FAM193A_uc011bvm.1_Missense_Mutation_p.K959N|FAM193A_uc011bvn.1_Missense_Mutation_p.K937N|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.K791N	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	937	Poly-Lys.									ovary(3)	3						AAAAGAAGAAGAAGGAGAGGC	0.383													28	74	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13602850	13602850	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13602850C>T	uc003gmz.1	-	10	5791	c.5674G>A	c.(5674-5676)GAA>AAA	p.E1892K	BOD1L_uc010idr.1_Missense_Mutation_p.E1229K	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1892							DNA binding			ovary(5)|breast(1)	6						CCTTCACTTTCTTCTCCTAAC	0.483													41	105	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15569099	15569099	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15569099C>T	uc010idv.2	+	26	3527	c.3282C>T	c.(3280-3282)CTC>CTT	p.L1094L	CC2D2A_uc003gnx.2_Silent_p.L1045L|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	1094	C2.				cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						ACTACCCCCTCGGCCAGGTGA	0.493													14	50	---	---	---	---	PASS
TLR10	81793	broad.mit.edu	37	4	38777082	38777082	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38777082C>T	uc003gti.2	-	2	509	c.130G>A	c.(130-132)GCA>ACA	p.A44T	TLR10_uc003gtj.2_Missense_Mutation_p.A44T|TLR10_uc003gtk.2_Missense_Mutation_p.A44T	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	44	Extracellular (Potential).|LRR 1.				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						GTCAAGTCTGCGGGAACCTTT	0.448													19	42	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55961077	55961077	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55961077T>A	uc003has.2	-	21	3165	c.2863A>T	c.(2863-2865)ATC>TTC	p.I955F	KDR_uc003hat.1_Missense_Mutation_p.I955F	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	955	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TCCACAGGGATTGCTCCAACG	0.463			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			24	61	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55961105	55961105	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55961105G>A	uc003has.2	-	21	3137	c.2835C>T	c.(2833-2835)TTC>TTT	p.F945F	KDR_uc003hat.1_Silent_p.F945F	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	945	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TCCCTTGACGGAATCGTGCCC	0.433			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			20	48	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94693231	94693231	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94693231A>G	uc011cdt.1	+	16	2864	c.2606A>G	c.(2605-2607)GAC>GGC	p.D869G	GRID2_uc011cdu.1_Missense_Mutation_p.D774G	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	869	Cytoplasmic (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	CTCCAGGATGACAAGGAAATT	0.383													18	67	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110890162	110890162	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110890162G>C	uc003hzy.3	+	11	2063	c.1611G>C	c.(1609-1611)GAG>GAC	p.E537D	EGF_uc011cfu.1_Missense_Mutation_p.E495D|EGF_uc011cfv.1_Missense_Mutation_p.E537D	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	537	LDL-receptor class B 6.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	AGTGGATAGAGAGAGCTAATA	0.403													28	70	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114158306	114158306	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114158306A>G	uc003ibe.3	+	6	747	c.647A>G	c.(646-648)CAC>CGC	p.H216R	ANK2_uc003ibd.3_Missense_Mutation_p.H195R|ANK2_uc003ibf.3_Missense_Mutation_p.H216R|ANK2_uc003ibc.2_Missense_Mutation_p.H192R|ANK2_uc011cgb.1_Missense_Mutation_p.H231R	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	216	ANK 6.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAGAATGACCACAATGCTGAC	0.483													64	155	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	C	C	rs149680468		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247289G>C	uc003ims.2	-	10	1662	c.1513C>G	c.(1513-1515)CGC>GGC	p.R505G	FBXW7_uc011cii.1_Missense_Mutation_p.R505G|FBXW7_uc003imt.2_Missense_Mutation_p.R505G|FBXW7_uc011cih.1_Missense_Mutation_p.R329G|FBXW7_uc003imq.2_Missense_Mutation_p.R425G|FBXW7_uc003imr.2_Missense_Mutation_p.R387G	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	505	WD 4.		R -> L (in an ovarian cancer cell line).		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R505C(36)|p.R505L(6)|p.R505G(4)|p.R425C(2)|p.R425G(2)|p.R266G(2)|p.R505H(2)|p.R505S(1)|p.R505P(1)|p.R266C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			Mis|N|D|F		colorectal|endometrial|T-ALL								15	58	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156723403	156723403	+	Intron	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156723403C>T	uc003ipc.2	+						GUCY1B3_uc011cio.1_Intron|GUCY1B3_uc011cip.1_Intron|GUCY1B3_uc003ipd.2_Intron|GUCY1B3_uc010iqf.2_Intron|GUCY1B3_uc010iqg.2_Missense_Mutation_p.T333M|GUCY1B3_uc011ciq.1_Intron	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		AAAGTACAAACGACACTGATG	0.378													9	6	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3601184	3601184	+	3'UTR	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3601184G>T	uc003jde.2	+	4						NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						TTTGCGGGGGGGAGGGGGGAG	0.557													11	30	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38407204	38407204	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38407204G>A	uc003jlc.1	+	8	1427	c.1103G>A	c.(1102-1104)CGA>CAA	p.R368Q	EGFLAM_uc003jlb.1_Missense_Mutation_p.R368Q|EGFLAM_uc003jle.1_Missense_Mutation_p.R134Q|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	368	EGF-like 1.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					GGGGGCTCGCGATGCCAGTGC	0.552													22	52	---	---	---	---	PASS
IL6ST	3572	broad.mit.edu	37	5	55247891	55247891	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55247891C>G	uc003jqq.2	-	13	1820	c.1565G>C	c.(1564-1566)GGA>GCA	p.G522A	IL6ST_uc010iwb.2_Missense_Mutation_p.G461A|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Missense_Mutation_p.G233A|IL6ST_uc003jqr.2_3'UTR|IL6ST_uc010iwe.1_5'Flank	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1	522	Extracellular (Potential).|Fibronectin type-III 5.				interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AACAGTAGGTCCTTTGGAAGG	0.348			O		hepatocellular ca								25	49	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82817190	82817190	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82817190G>A	uc003kii.3	+	7	3421	c.3065G>A	c.(3064-3066)AGA>AAA	p.R1022K	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.R1022K|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1022	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GAAACTATGAGAACAACAAAA	0.433													18	44	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90106172	90106172	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90106172G>A	uc003kju.2	+	74	15191	c.15095G>A	c.(15094-15096)GGG>GAG	p.G5032E	GPR98_uc003kjt.2_Missense_Mutation_p.G2738E|GPR98_uc003kjw.2_Missense_Mutation_p.G693E	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5032	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGACTATTTGGGTTCCACAGC	0.403													8	18	---	---	---	---	PASS
RFESD	317671	broad.mit.edu	37	5	94989768	94989768	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94989768G>A	uc003klf.2	+	3	1395	c.3G>A	c.(1-3)ATG>ATA	p.M1I	RFESD_uc003klg.2_Missense_Mutation_p.M54I|RFESD_uc011cun.1_Missense_Mutation_p.M54I|SPATA9_uc010jbh.1_Intron|SPATA9_uc003klh.1_Intron|SPATA9_uc003kli.1_Intron	NM_173362	NP_775498	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing isoform 2	1							2 iron, 2 sulfur cluster binding|metal ion binding|oxidoreductase activity				0		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		CAACTAGCATGAATCTTGATG	0.373													14	47	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102526629	102526629	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102526629C>T	uc003kod.3	+	29	3958	c.3439C>T	c.(3439-3441)CTT>TTT	p.L1147F	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.L1126F|PPIP5K2_uc003kof.2_Missense_Mutation_p.L329F	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	1147					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						GGATGAATTTCTTGCTTCCAT	0.373													33	72	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102537353	102537353	+	3'UTR	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102537353G>C	uc003kod.3	+	31					PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_3'UTR|PPIP5K2_uc003kof.2_3'UTR	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						GCAGAAGCTGGAACTTTTTAT	0.279													4	14	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153181955	153181955	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153181955G>A	uc003lva.3	+	15	2790	c.2425G>A	c.(2425-2427)GTG>ATG	p.V809M	GRIA1_uc003luy.3_Missense_Mutation_p.V809M|GRIA1_uc003luz.3_Missense_Mutation_p.V714M|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.V729M|GRIA1_uc011dcx.1_Missense_Mutation_p.V740M|GRIA1_uc011dcy.1_Missense_Mutation_p.V819M|GRIA1_uc011dcz.1_Missense_Mutation_p.V819M	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	809	Helical; (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGTGGCAGGCGTGTTCTACAT	0.413													45	101	---	---	---	---	PASS
GPRIN1	114787	broad.mit.edu	37	5	176025548	176025548	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176025548C>A	uc003meo.1	-	2	1463	c.1288G>T	c.(1288-1290)GGA>TGA	p.G430*		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	430						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTGGCTTTCCTGAGCACATG	0.517													4	156	---	---	---	---	PASS
MSH5	4439	broad.mit.edu	37	6	31727896	31727896	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31727896C>A	uc003nwv.1	+	19	1794	c.1715C>A	c.(1714-1716)ACC>AAC	p.T572N	MSH5_uc003nwt.1_Missense_Mutation_p.T589N|MSH5_uc003nwu.1_Missense_Mutation_p.T572N|MSH5_uc003nww.1_Missense_Mutation_p.T572N|MSH5_uc003nwx.1_Missense_Mutation_p.T589N|MSH5_uc011dof.1_Missense_Mutation_p.T271N|MSH5_uc003nwy.1_Missense_Mutation_p.T246N|MSH5_uc003nwz.3_RNA|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	572					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						TGTGCCCGAACCTTTGTGCCC	0.532								Direct_reversal_of_damage|MMR					78	169	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31838641	31838641	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31838641G>A	uc010jti.2	-	10	951	c.885C>T	c.(883-885)TTC>TTT	p.F295F	SLC44A4_uc011dol.1_Silent_p.F219F|SLC44A4_uc011dom.1_Silent_p.F253F	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	295	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	GGTTGGTGGTGAAACCCAGCT	0.662													39	95	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79727268	79727268	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79727268G>A	uc003pir.2	-	11	1253	c.1027C>T	c.(1027-1029)CAT>TAT	p.H343Y	PHIP_uc011dyp.1_Missense_Mutation_p.H343Y	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	343	WD 4.				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CGAATAATATGATCTGTGCTT	0.323													18	39	---	---	---	---	PASS
C6orf165	154313	broad.mit.edu	37	6	88136336	88136336	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88136336G>C	uc003plv.2	+	8	1025	c.933G>C	c.(931-933)AAG>AAC	p.K311N	C6orf165_uc003plw.2_Missense_Mutation_p.K123N|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.K311N	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	311										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TAAAATCAAAGATAGCGGTCC	0.363													15	37	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90468570	90468570	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90468570G>A	uc003pnn.1	-	18	2686	c.2570C>T	c.(2569-2571)TCT>TTT	p.S857F	MDN1_uc003pno.1_Missense_Mutation_p.S275F	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	857					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAGGGATCCAGAAGATCCTTC	0.473													13	40	---	---	---	---	PASS
ASF1A	25842	broad.mit.edu	37	6	119226948	119226948	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119226948G>A	uc011ebn.1	+	3	694	c.357G>A	c.(355-357)GAG>GAA	p.E119E		NM_014034	NP_054753	Q9Y294	ASF1A_HUMAN	ASF1 anti-silencing function 1 homolog A	119	Interaction with histone H3, CHAF1B, and HIRA.				chromatin modification|DNA repair|loss of chromatin silencing|nucleosome assembly|transcription, DNA-dependent	chromatin remodeling complex	chromatin binding|histone binding				0		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0633)|OV - Ovarian serous cystadenocarcinoma(136;0.188)		AATATACTGAGACAGAATTAA	0.323													33	73	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152650896	152650896	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152650896C>G	uc010kiw.2	-	78	15526	c.14924G>C	c.(14923-14925)GGA>GCA	p.G4975A	SYNE1_uc003qot.3_Missense_Mutation_p.G4904A|SYNE1_uc003qou.3_Missense_Mutation_p.G4975A|SYNE1_uc010kiz.2_Missense_Mutation_p.G730A	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4975	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGGATGTCTCCATCCAGCTC	0.463										HNSCC(10;0.0054)			48	134	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167755005	167755005	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167755005G>A	uc003qvs.1	+	3	1705	c.1617G>A	c.(1615-1617)CCG>CCA	p.P539P	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	539					protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGACCTCCCCGTGTGTCCTGT	0.542													40	77	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	169064768	169064768	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169064768G>A	uc003qws.1	+	12	1320	c.1300G>A	c.(1300-1302)GCT>ACT	p.A434T	SMOC2_uc003qwr.1_Missense_Mutation_p.A445T|SMOC2_uc011egu.1_Missense_Mutation_p.A111T	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	434				A -> V (in Ref. 6; AAH47583).	signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CAGAGGTCATGCTGAAAGTAC	0.299													16	43	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5662766	5662766	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5662766C>G	uc003soy.1	-	17	2516	c.2326G>C	c.(2326-2328)GAG>CAG	p.E776Q	RNF216_uc010ksz.1_Missense_Mutation_p.E398Q|RNF216_uc010kta.1_Missense_Mutation_p.E398Q|RNF216_uc011jwj.1_Missense_Mutation_p.E398Q|RNF216_uc003sox.1_Missense_Mutation_p.E833Q	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	776	Pro-rich.				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TGCACCTTCTCCACAGGCTTC	0.577													23	66	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5663694	5663694	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5663694C>A	uc003soy.1	-	16	2464	c.2274G>T	c.(2272-2274)AAG>AAT	p.K758N	RNF216_uc010ksz.1_Missense_Mutation_p.K380N|RNF216_uc010kta.1_Missense_Mutation_p.K380N|RNF216_uc011jwj.1_Missense_Mutation_p.K380N|RNF216_uc003sox.1_Missense_Mutation_p.K815N	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	758	Potential.				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TGCCTCCATTCTTTCTTTTCT	0.537													10	21	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5663714	5663714	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5663714C>T	uc003soy.1	-	16	2444	c.2254G>A	c.(2254-2256)GAA>AAA	p.E752K	RNF216_uc010ksz.1_Missense_Mutation_p.E374K|RNF216_uc010kta.1_Missense_Mutation_p.E374K|RNF216_uc011jwj.1_Missense_Mutation_p.E374K|RNF216_uc003sox.1_Missense_Mutation_p.E809K	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	752	Potential.				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TGTTCCTCTTCAGCCTCCTTC	0.547													9	21	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18975511	18975511	+	Silent	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18975511C>G	uc003suh.2	+	22	2915	c.2874C>G	c.(2872-2874)CTC>CTG	p.L958L	HDAC9_uc003sue.2_Silent_p.L958L|HDAC9_uc003sui.2_Silent_p.L961L|HDAC9_uc003suj.2_Silent_p.L917L|HDAC9_uc003suk.2_Silent_p.L206L	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	958	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GACATGATCTCACAGCCATCT	0.433													68	143	---	---	---	---	PASS
CDCA7L	55536	broad.mit.edu	37	7	21945945	21945945	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21945945C>A	uc010kuk.2	-	6	1003	c.883G>T	c.(883-885)GAA>TAA	p.E295*	CDCA7L_uc003sve.3_Nonsense_Mutation_p.E261*|CDCA7L_uc010kul.2_Nonsense_Mutation_p.E249*|CDCA7L_uc003svf.3_Nonsense_Mutation_p.E294*	NM_018719	NP_061189	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like isoform 1	295					positive regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus					0						TAAAACTCTTCCGCAAATTTA	0.483													54	145	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77885323	77885323	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77885323C>T	uc003ugx.2	-	10	2238	c.1984G>A	c.(1984-1986)GTA>ATA	p.V662I	MAGI2_uc003ugy.2_Missense_Mutation_p.V662I|MAGI2_uc010ldx.1_Missense_Mutation_p.V271I|MAGI2_uc010ldy.1_Missense_Mutation_p.V271I|MAGI2_uc011kgr.1_Missense_Mutation_p.V494I|MAGI2_uc011kgs.1_Missense_Mutation_p.V499I	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	662	PDZ 3.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATATCCACTACTTCTGTATGG	0.438													12	26	---	---	---	---	PASS
ZKSCAN1	7586	broad.mit.edu	37	7	99621928	99621928	+	Missense_Mutation	SNP	G	A	A	rs148037051		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99621928G>A	uc003usk.1	+	3	797	c.578G>A	c.(577-579)CGA>CAA	p.R193Q	ZKSCAN1_uc003usj.2_Missense_Mutation_p.R192Q|ZKSCAN1_uc003usl.1_Missense_Mutation_p.R157Q|ZKSCAN1_uc003usm.1_Intron	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	193					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.R193Q(1)		ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TTACAGTCACGAGGTAAGAAG	0.488													14	37	---	---	---	---	PASS
AGFG2	3268	broad.mit.edu	37	7	100151098	100151098	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100151098C>G	uc003uvf.2	+	4	696	c.560C>G	c.(559-561)TCA>TGA	p.S187*	AGFG2_uc003uvg.1_Intron|AGFG2_uc010lgy.2_Missense_Mutation_p.Q49E	NM_006076	NP_006067	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	187					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			central_nervous_system(1)	1						CCGTCTCTCTCAGTTGCTGCC	0.542													32	102	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124404704	124404704	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124404704G>T	uc003vli.2	-	1	978	c.327C>A	c.(325-327)CCC>CCA	p.P109P		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	109	Extracellular (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						GAGGTCCCGGGGGTCCGGCTG	0.726													24	48	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127255253	127255253	+	Intron	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127255253G>C	uc010lld.1	-						PAX4_uc003vmf.2_Missense_Mutation_p.S4C|PAX4_uc003vmg.1_Intron|PAX4_uc003vmh.2_Missense_Mutation_p.S4C	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4						cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						AGACTTACTGGACCAGGCCAT	0.572													14	31	---	---	---	---	PASS
STRA8	346673	broad.mit.edu	37	7	134927560	134927560	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134927560C>A	uc011kpx.1	+	3	286	c.286C>A	c.(286-288)CAT>AAT	p.H96N		NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8	96	Potential.				DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						GGCAAAGAGTCATATTCCAGA	0.483													20	71	---	---	---	---	PASS
TBXAS1	6916	broad.mit.edu	37	7	139655334	139655334	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139655334G>A	uc011kqv.1	+	8	921	c.757G>A	c.(757-759)GAG>AAG	p.E253K	TBXAS1_uc003vvh.2_Missense_Mutation_p.E207K|TBXAS1_uc010lne.2_Missense_Mutation_p.E139K|TBXAS1_uc011kqu.1_Missense_Mutation_p.E158K|TBXAS1_uc003vvi.2_Missense_Mutation_p.E207K|TBXAS1_uc003vvj.2_Missense_Mutation_p.E207K|TBXAS1_uc011kqw.1_Missense_Mutation_p.E187K	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	206	Cytoplasmic (Potential).				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GCAGGCCCCTGAGGATCCCTT	0.577													50	124	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143096402	143096402	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143096402C>T	uc003wcz.2	-	5	1027	c.940G>A	c.(940-942)GAG>AAG	p.E314K		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	314	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TGGCCGCTCTCACAGGTACAG	0.657													47	87	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143096426	143096426	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143096426C>T	uc003wcz.2	-	5	1003	c.916G>A	c.(916-918)GAG>AAG	p.E306K		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	306	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GTGGCCCCCTCAGACTCAGCA	0.657													32	75	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148484186	148484186	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148484186G>A	uc010lpg.2	+	13	1979	c.1453G>A	c.(1453-1455)GAA>AAA	p.E485K	CUL1_uc003wey.2_Missense_Mutation_p.E485K|CUL1_uc003wez.2_Missense_Mutation_p.E375K|CUL1_uc003wfa.2_Missense_Mutation_p.E146K	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	485					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGACGATGCCGAAGCCAGCAT	0.398													21	54	---	---	---	---	PASS
ZNF282	8427	broad.mit.edu	37	7	148910990	148910990	+	Intron	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148910990C>T	uc003wfm.2	+						ZNF282_uc011kun.1_Intron|ZNF282_uc003wfn.2_3'UTR|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		GTCCTCTTCTCAGCTCACCCC	0.493													7	14	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149512401	149512401	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149512401C>T	uc010lpk.2	+	76	10721	c.10721C>T	c.(10720-10722)TCC>TTC	p.S3574F		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3574					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCAGCTCTCCCAGGACGGG	0.721													6	17	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151855998	151855998	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151855998C>A	uc003wla.2	-	44	11839	c.11620G>T	c.(11620-11622)GAG>TAG	p.E3874*	MLL3_uc003wkz.2_Nonsense_Mutation_p.E2935*|MLL3_uc003wkx.2_5'Flank|MLL3_uc003wky.2_Nonsense_Mutation_p.E1383*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	3874					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCTTGTTTCTCCTCTTCGTCC	0.448			N		medulloblastoma								102	276	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151860062	151860062	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151860062G>A	uc003wla.2	-	43	10819	c.10600C>T	c.(10600-10602)CAG>TAG	p.Q3534*	MLL3_uc003wkz.2_Nonsense_Mutation_p.Q2595*|MLL3_uc003wky.2_Nonsense_Mutation_p.Q1043*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	3534					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CCATGTCCCTGCTTCACAGAA	0.488			N		medulloblastoma								52	106	---	---	---	---	PASS
IKBKB	3551	broad.mit.edu	37	8	42177314	42177314	+	Intron	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42177314G>T	uc003xow.1	+						IKBKB_uc010lxh.1_3'UTR|IKBKB_uc011lco.1_Intron|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_Intron|IKBKB_uc011lcp.1_Intron|IKBKB_uc011lcq.1_Intron|IKBKB_uc010lxi.1_Intron|IKBKB_uc011lcr.1_Intron	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta						anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	CAGCTGAAAAGAGGCCAAGAG	0.488											OREG0018747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	5	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76465276	76465276	+	Splice_Site	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76465276G>A	uc003yaq.2	+	6	619	c.349_splice	c.e6-1	p.I117_splice	HNF4G_uc003yar.2_Splice_Site_p.I154_splice	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CTTAATACTAGATCTCAGTCT	0.348													18	67	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100403871	100403871	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100403871G>A	uc003yiv.2	+	21	3132	c.3021G>A	c.(3019-3021)AAG>AAA	p.K1007K	VPS13B_uc003yiw.2_Silent_p.K1007K|VPS13B_uc003yiu.1_Silent_p.K1007K|VPS13B_uc003yix.1_Silent_p.K477K	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1007					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTTGGCAAAGCAGCAATCAT	0.388													18	103	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143436064	143436064	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143436064G>A	uc003ywk.2	-	2	140	c.22C>T	c.(22-24)CGT>TGT	p.R8C	TSNARE1_uc011lju.1_Missense_Mutation_p.R8C|TSNARE1_uc003ywj.2_Missense_Mutation_p.R8C|TSNARE1_uc003ywl.3_Missense_Mutation_p.R8C	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	8					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCACCTCCACGGGCGATGGAT	0.612													25	135	---	---	---	---	PASS
ZNF517	340385	broad.mit.edu	37	8	146033636	146033636	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146033636C>T	uc003zed.1	+	5	1442	c.1335C>T	c.(1333-1335)CTC>CTT	p.L445L	ZNF517_uc010mgd.1_Silent_p.L351L|ZNF517_uc003zee.1_RNA|ZNF517_uc011llm.1_Silent_p.L351L|ZNF517_uc003zef.1_Intron	NM_213605	NP_998770	Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	445	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			ACTACCGGCTCCACAGCGGCG	0.682													11	13	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20720513	20720513	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20720513C>T	uc003zog.1	+	6	630	c.267C>T	c.(265-267)CTC>CTT	p.L89L		NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	89						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		ATGGGATACTCAACTTGATTC	0.408													92	101	---	---	---	---	PASS
RGP1	9827	broad.mit.edu	37	9	35752111	35752111	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35752111C>T	uc011lpf.1	+	8	1062	c.921C>T	c.(919-921)CTC>CTT	p.L307L	GBA2_uc003zxw.2_5'Flank|GBA2_uc011lpc.1_5'Flank|GBA2_uc011lpd.1_5'Flank|RGP1_uc011lpe.1_Silent_p.L347L	NM_001080496	NP_001073965	Q92546	RGP1_HUMAN	RGP1 retrograde golgi transport homolog	307										ovary(1)	1	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAATCCCTCTCAGCTCCACCC	0.567													24	16	---	---	---	---	PASS
RGP1	9827	broad.mit.edu	37	9	35752709	35752709	+	Silent	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35752709C>G	uc011lpf.1	+	9	1155	c.1014C>G	c.(1012-1014)CTC>CTG	p.L338L	GBA2_uc011lpd.1_5'Flank|RGP1_uc011lpe.1_Silent_p.L378L	NM_001080496	NP_001073965	Q92546	RGP1_HUMAN	RGP1 retrograde golgi transport homolog	338										ovary(1)	1	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GATTGGTACTCCTACCCCCTG	0.498													22	20	---	---	---	---	PASS
ZNF189	7743	broad.mit.edu	37	9	104170392	104170392	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104170392C>G	uc004bbh.1	+	3	618	c.342C>G	c.(340-342)TTC>TTG	p.F114L	ZNF189_uc004bbg.1_Missense_Mutation_p.F72L|ZNF189_uc004bbi.1_Missense_Mutation_p.F100L|ZNF189_uc011lvk.1_Missense_Mutation_p.F99L	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	114					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				GAGGGATCTTCCTATGGGAAA	0.378													22	16	---	---	---	---	PASS
PHF19	26147	broad.mit.edu	37	9	123620306	123620306	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123620306C>T	uc004bks.1	-	15	1912	c.1659G>A	c.(1657-1659)GAG>GAA	p.E553E	PHF19_uc011lyf.1_Silent_p.E344E|PHF19_uc004bkr.2_RNA	NM_015651	NP_056466	Q5T6S3	PHF19_HUMAN	PHD finger protein 19 isoform a	553					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|breast(1)	2						CCTGGTACTTCTCCCCACAGG	0.572													53	36	---	---	---	---	PASS
SNAPC4	6621	broad.mit.edu	37	9	139273744	139273744	+	Silent	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139273744G>C	uc004chh.2	-	21	2544	c.2535C>G	c.(2533-2535)CTC>CTG	p.L845L		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	845					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTTTGGGAAGAGGTGGCCTG	0.637													13	17	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7708859	7708859	+	5'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7708859G>A	uc001ijq.2	-	1					ITIH5_uc001ijr.1_5'UTR	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GGAGCATGGCGGGGCGAGGGC	0.687													10	11	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30602779	30602779	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30602779C>T	uc001iva.3	-	9	1571	c.1508G>A	c.(1507-1509)CGA>CAA	p.R503Q	MTPAP_uc001ivb.3_Missense_Mutation_p.R633Q	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	503					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						GGCACTTTCTCGGGCCAAATC	0.428													57	141	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32345013	32345013	+	5'UTR	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32345013C>G	uc001iwe.3	-	1						NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				AGGCAGCAGTCAGCTGCGCCG	0.731													3	7	---	---	---	---	PASS
DUPD1	338599	broad.mit.edu	37	10	76797697	76797697	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76797697C>T	uc001jwq.1	-	3	560	c.560G>A	c.(559-561)CGG>CAG	p.R187Q		NM_001003892	NP_001003892	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase	187	Tyrosine-protein phosphatase.					cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)	2	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CAAAAAGCCCCGGTTCGGGAG	0.642													32	87	---	---	---	---	PASS
MINPP1	9562	broad.mit.edu	37	10	89268152	89268152	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89268152G>C	uc001keu.2	+	2	1147	c.697G>C	c.(697-699)GAG>CAG	p.E233Q	MINPP1_uc009xtf.1_RNA|MINPP1_uc001kev.2_Missense_Mutation_p.E233Q	NM_004897	NP_004888	Q9UNW1	MINP1_HUMAN	multiple inositol polyphosphate histidine	233					bone mineralization|polyphosphate metabolic process	endoplasmic reticulum lumen	acid phosphatase activity|bisphosphoglycerate 3-phosphatase activity|multiple inositol-polyphosphate phosphatase activity|phosphohistidine phosphatase activity			urinary_tract(1)	1		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		TGATCACTGTGAGAAGTTTTT	0.313													23	38	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96162368	96162368	+	5'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96162368C>T	uc001kjr.2	+	1						NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CACCCACCCCCAGATGGTGGG	0.697													11	33	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96162370	96162370	+	5'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96162370G>A	uc001kjr.2	+	1						NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CCCACCCCCAGATGGTGGGTC	0.697													15	28	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801973	120801973	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801973C>T	uc001ldu.2	-	19	3205	c.3059G>A	c.(3058-3060)CGA>CAA	p.R1020Q	EIF3A_uc010qsu.1_Missense_Mutation_p.R986Q|EIF3A_uc009xzg.1_Missense_Mutation_p.R59Q	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1020	Asp-rich.|10.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATCCAGTCCTCGTCTAGGTGG	0.587													87	212	---	---	---	---	PASS
MMP21	118856	broad.mit.edu	37	10	127461263	127461263	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127461263C>A	uc001liu.2	-	3	754	c.754G>T	c.(754-756)GCC>TCC	p.A252S		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	252					proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AGGCGCCAGGCGTGTGCAAAC	0.642													3	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134671235	134671235	+	Silent	SNP	C	T	T	rs146998210	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134671235C>T	uc010qux.1	-	31	4611	c.4611G>A	c.(4609-4611)GCG>GCA	p.A1537A		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CCAGGCCATACGCTTCCAAGT	0.473													8	23	---	---	---	---	PASS
IRF7	3665	broad.mit.edu	37	11	612784	612784	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:612784C>A	uc001lqh.2	-	11	1743	c.1373G>T	c.(1372-1374)TGC>TTC	p.C458F	IRF7_uc009ycb.2_Missense_Mutation_p.C352F|IRF7_uc010qwf.1_Missense_Mutation_p.C457F|IRF7_uc001lqf.2_Missense_Mutation_p.C165F|IRF7_uc010qwg.1_Missense_Mutation_p.C165F|IRF7_uc001lqg.2_Missense_Mutation_p.C471F|IRF7_uc001lqi.2_Missense_Mutation_p.C429F|IRF7_uc010qwh.1_Missense_Mutation_p.C165F	NM_001572	NP_001563	Q92985	IRF7_HUMAN	interferon regulatory factor 7 isoform a	458					interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of interferon-alpha production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGCACTCGGCACAGCCAGGG	0.672													22	52	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28090880	28090880	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28090880C>G	uc001msc.2	-	11	1698	c.1516G>C	c.(1516-1518)GAT>CAT	p.D506H		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	506					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GTATTCTCATCAAATTGCTTC	0.413													24	58	---	---	---	---	PASS
FJX1	24147	broad.mit.edu	37	11	35640755	35640755	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35640755G>A	uc001mwh.2	+	1	1021	c.571G>A	c.(571-573)GAG>AAG	p.E191K		NM_014344	NP_055159	Q86VR8	FJX1_HUMAN	four jointed box 1 precursor	191						extracellular space					0	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				GATTCAGGGCGAGGCCCTGTC	0.731													3	5	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43356859	43356859	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43356859G>A	uc010rfh.1	+	12	1483	c.1310G>A	c.(1309-1311)AGC>AAC	p.S437N	API5_uc010rfg.1_Missense_Mutation_p.S426N|API5_uc001mxf.2_Missense_Mutation_p.S437N|API5_uc010rfi.1_Missense_Mutation_p.S383N|API5_uc001mxg.2_Missense_Mutation_p.S311N	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	437					anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						TCTTATAAGAGCACAGTAACA	0.383													38	74	---	---	---	---	PASS
CELF1	10658	broad.mit.edu	37	11	47493672	47493672	+	Intron	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47493672A>G	uc001nfl.2	-						CELF1_uc001nfk.1_5'Flank|CELF1_uc001nfm.2_Intron|CELF1_uc001nfn.2_Intron|CELF1_uc001nfo.1_Intron|CELF1_uc010rhm.1_Intron|CELF1_uc001nfp.2_Intron|CELF1_uc001nfq.1_Intron|CELF1_uc001nfr.1_3'UTR	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN	CUG triplet repeat, RNA-binding protein 1						embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3						AGTGGCAGGGATCAGGGTCCA	0.562													12	93	---	---	---	---	PASS
OR8K3	219473	broad.mit.edu	37	11	56086697	56086697	+	Missense_Mutation	SNP	T	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56086697T>A	uc010rjf.1	+	1	915	c.915T>A	c.(913-915)AAT>AAA	p.N305K		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					GGACATGGAATAACTTATGTA	0.328													9	31	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982373	57982373	+	Missense_Mutation	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982373A>G	uc010rkc.1	+	1	157	c.157A>G	c.(157-159)ATT>GTT	p.I53V		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	53	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				GGTCACTGTGATTGGGAACGG	0.448													4	154	---	---	---	---	PASS
BEST1	7439	broad.mit.edu	37	11	61729849	61729849	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61729849C>G	uc001nss.2	+	10	1803	c.1223C>G	c.(1222-1224)TCA>TGA	p.S408*	BEST1_uc010rlq.1_3'UTR|BEST1_uc010rlr.1_3'UTR|BEST1_uc010rls.1_Nonsense_Mutation_p.S36*|BEST1_uc001nsr.2_Nonsense_Mutation_p.S348*|BEST1_uc009ynt.2_RNA|BEST1_uc010rlt.1_Nonsense_Mutation_p.S348*|BEST1_uc001nst.2_Nonsense_Mutation_p.S321*|BEST1_uc010rlu.1_3'UTR|BEST1_uc010rlv.1_Nonsense_Mutation_p.S302*	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1	408	Cytoplasmic (Potential).				response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						AGGGCAAACTCAAGGACCAAA	0.577													22	62	---	---	---	---	PASS
METTL12	751071	broad.mit.edu	37	11	62433975	62433975	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62433975G>A	uc001nug.1	+	3	434	c.175G>A	c.(175-177)GAA>AAA	p.E59K	C11orf48_uc001nue.2_Intron|C11orf48_uc001nuf.2_Intron|METTL12_uc001nuh.2_Silent_p.T100T|METTL12_uc010rmc.1_RNA	NM_001043229	NP_001036694	A8MUP2	MTL12_HUMAN	methyltransferase like 12 precursor	59						mitochondrion	methyltransferase activity				0						TGGATACGACGAAGTCCAGGG	0.612													50	93	---	---	---	---	PASS
TAF6L	10629	broad.mit.edu	37	11	62554783	62554783	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62554783C>T	uc001nvc.2	+	11					TMEM179B_uc001nvd.3_5'Flank	NM_006473	NP_006464	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II						chromatin remodeling|histone H3 acetylation|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	histone deacetylase complex|STAGA complex	DNA binding|protein binding|transcription coactivator activity			ovary(3)	3						GTGGCCCCTTCGTTCCTTGTA	0.652											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	32	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70281229	70281229	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70281229C>T	uc001opv.3	+	18	1820	c.1614C>T	c.(1612-1614)TAC>TAT	p.Y538Y	CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_Silent_p.Y501Y|CTTN_uc010rqm.1_Intron|CTTN_uc001opx.2_Silent_p.Y222Y	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	538	SH3.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		AGGGCCGGTACGGGCTCTTCC	0.617													32	58	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93778916	93778916	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93778916C>T	uc001pep.2	+	2	405	c.248C>T	c.(247-249)ACG>ATG	p.T83M		NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	83	Plastocyanin-like 1.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AGACGCTTCACGGATGGAACC	0.453													11	34	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118376454	118376454	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118376454C>T	uc001pta.2	+	27	9861	c.9838C>T	c.(9838-9840)CGA>TGA	p.R3280*	MLL_uc001ptb.2_Nonsense_Mutation_p.R3283*	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3280					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TTCATCTCACCGAACTGTCCC	0.433			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								49	70	---	---	---	---	PASS
OR10S1	219873	broad.mit.edu	37	11	123848195	123848195	+	Silent	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123848195G>C	uc001pzm.1	-	1	204	c.204C>G	c.(202-204)CTC>CTG	p.L68L		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TGGGTAAGCTGAGGTGAGAGT	0.542													7	35	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294748	124294748	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294748G>A	uc010sak.1	-	1	20	c.20C>T	c.(19-21)TCC>TTC	p.S7F		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGTCACTGAGGAGCTGTTTCT	0.483													6	17	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125891384	125891384	+	Silent	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125891384G>C	uc009zbw.2	-	3	236	c.108C>G	c.(106-108)CTC>CTG	p.L36L	CDON_uc001qdc.3_Silent_p.L36L|CDON_uc001qdd.3_RNA|CDON_uc009zbx.2_Silent_p.L36L	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	36	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		GGACAGCAGAGAGCGGCTCAG	0.448													16	33	---	---	---	---	PASS
FOXM1	2305	broad.mit.edu	37	12	2967845	2967845	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2967845C>T	uc001qlf.2	-	9	2516	c.2251G>A	c.(2251-2253)GAC>AAC	p.D751N	uc001qld.2_Intron|FOXM1_uc001qle.2_Missense_Mutation_p.D789N|FOXM1_uc001qlg.2_Missense_Mutation_p.D736N|FOXM1_uc009zea.2_Missense_Mutation_p.D736N|FOXM1_uc009zeb.2_Missense_Mutation_p.D735N	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	751					cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			TTGATGTTGTCAGGGCCCAGT	0.577													26	62	---	---	---	---	PASS
DYRK4	8798	broad.mit.edu	37	12	4722727	4722727	+	Silent	SNP	G	A	A	rs143171709		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4722727G>A	uc001qmx.2	+	13	1531	c.1371G>A	c.(1369-1371)ACG>ACA	p.T457T	DYRK4_uc001qmy.1_Silent_p.T456T|DYRK4_uc001qmz.1_Silent_p.T170T|DYRK4_uc001qna.1_Silent_p.T93T|DYRK4_uc010ser.1_Silent_p.T94T	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	457						Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			ATAGCCCCACGAAGCATGTTC	0.473													20	66	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7045608	7045608	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7045608C>G	uc001qrw.1	+	5	1415	c.1178C>G	c.(1177-1179)TCT>TGT	p.S393C	ATN1_uc001qrx.1_Missense_Mutation_p.S393C|ATN1_uc001qry.1_Missense_Mutation_p.S392C	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	393	Poly-Ser.				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						tcttcctcctcttcctctgcc	0.448													24	65	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32138214	32138214	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32138214G>A	uc001rks.2	+	4	4739	c.4325G>A	c.(4324-4326)AGA>AAA	p.R1442K	C12orf35_uc001rkt.2_5'Flank	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	1442										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			AAATTTAGTAGAATTCTAACT	0.358													32	99	---	---	---	---	PASS
TMEM117	84216	broad.mit.edu	37	12	44781901	44781901	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44781901G>A	uc001rod.2	+	8	1057	c.991G>A	c.(991-993)GGG>AGG	p.G331R	TMEM117_uc001roe.2_Missense_Mutation_p.G227R|TMEM117_uc009zkc.2_3'UTR	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	331						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		TCATGAATATGGGCAATATAT	0.368													19	29	---	---	---	---	PASS
DBX2	440097	broad.mit.edu	37	12	45410035	45410035	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45410035G>A	uc001rok.1	-	4						NM_001004329	NP_001004329	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		ACTATTAAGCGTTCTTTTAAA	0.423													20	30	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49424159	49424159	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49424159G>A	uc001rta.3	-	42	13903	c.13903C>T	c.(13903-13905)CAG>TAG	p.Q4635*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4635					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ATCTTCTGCTGCACCGATGGG	0.627			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			5	12	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49722836	49722836	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49722836C>T	uc001rtx.3	+	9	1185	c.1018C>T	c.(1018-1020)CTG>TTG	p.L340L	TROAP_uc009zlh.2_Silent_p.L340L|TROAP_uc001rty.2_Silent_p.L48L	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	340					cell adhesion	cytoplasm				ovary(1)	1						CCCTCCAACTCTGGTTTGTGT	0.627													5	151	---	---	---	---	PASS
MYL2	4633	broad.mit.edu	37	12	111348834	111348834	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111348834G>A	uc001try.3	-	7					MYL2_uc001trx.3_3'UTR	NM_000432	NP_000423	P10916	MLRV_HUMAN	slow cardiac myosin regulatory light chain 2						cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1						ATGAGGGCAGGGACCACTCTG	0.582													18	63	---	---	---	---	PASS
CCDC60	160777	broad.mit.edu	37	12	119942996	119942996	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119942996G>T	uc001txe.2	+	7	1236	c.771G>T	c.(769-771)GTG>GTT	p.V257V	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	257										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TGATCTCTGTGAACCCTGGCT	0.577													86	274	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122992836	122992836	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122992836C>T	uc001ucr.2	-	8	1110	c.964G>A	c.(964-966)GCT>ACT	p.A322T	RSRC2_uc001uco.2_Missense_Mutation_p.A91T|RSRC2_uc001ucp.2_Missense_Mutation_p.A263T|RSRC2_uc001ucq.2_Missense_Mutation_p.A90T|RSRC2_uc001ucs.2_Missense_Mutation_p.A91T|RSRC2_uc001uct.2_Missense_Mutation_p.A274T|RSRC2_uc001ucu.2_Missense_Mutation_p.A323T	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	322										ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		GGATTAACAGCGGCTGGGTTA	0.448													20	97	---	---	---	---	PASS
DENR	8562	broad.mit.edu	37	12	123253605	123253605	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123253605C>A	uc001uda.2	+	8	713	c.577C>A	c.(577-579)CTT>ATT	p.L193I	DENR_uc010tag.1_Intron|DENR_uc001udb.2_Missense_Mutation_p.L147I	NM_003677	NP_003668	O43583	DENR_HUMAN	density-regulated protein	193							protein binding|translation initiation factor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.28e-05)|Epithelial(86;6.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.199)		CATCGAAGATCTTGGAGAAGT	0.318													45	133	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28897021	28897021	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28897021C>T	uc001usb.3	-	21	3144	c.2859G>A	c.(2857-2859)AAG>AAA	p.K953K	FLT1_uc010aap.2_5'Flank|FLT1_uc010aaq.2_Silent_p.K78K|FLT1_uc001usa.3_Silent_p.K171K	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	953	Cytoplasmic (Potential).|Protein kinase.				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GTCTTGGTTTCTTGCCTTGTT	0.493													66	151	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35619479	35619479	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35619479C>T	uc001uvb.2	+	5	870	c.664C>T	c.(664-666)CAG>TAG	p.Q222*		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	222						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGTTCTTAATCAGATGCCACA	0.323													7	14	---	---	---	---	PASS
ENOX1	55068	broad.mit.edu	37	13	43935581	43935581	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43935581G>A	uc001uza.3	-	6	516	c.216C>T	c.(214-216)ATC>ATT	p.I72I	ENOX1_uc001uzb.3_Silent_p.I72I|ENOX1_uc001uzc.3_Silent_p.I72I|ENOX1_uc010tfm.1_5'Flank	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	72					electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		CTGGGACACAGATTGAGTCTG	0.413													20	52	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50306520	50306520	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50306520C>G	uc001vdj.2	-	6	785	c.370G>C	c.(370-372)GAA>CAA	p.E124Q		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	124	ARM 2.				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		TCATCCCTTTCTAGACATTTG	0.308													25	64	---	---	---	---	PASS
EDDM3B	64184	broad.mit.edu	37	14	21238299	21238299	+	5'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21238299C>T	uc001vyd.2	+	2						NM_022360	NP_071755	P56851	EP3B_HUMAN	human epididymis-specific 3 beta precursor						spermatid development	extracellular region				ovary(1)	1						CAGGCGGCCCCGGTGACTGAG	0.512													21	28	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51226630	51226630	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51226630C>T	uc001wym.2	-	17	2535	c.2344G>A	c.(2344-2346)GAG>AAG	p.E782K	NIN_uc001wyi.2_Missense_Mutation_p.E782K|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.E782K|NIN_uc010tqp.1_Missense_Mutation_p.E788K|NIN_uc001wyo.2_Missense_Mutation_p.E782K	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	782	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CTTAACTCCTCTTTCTCAAGA	0.507			T	PDGFRB	MPD								111	223	---	---	---	---	PASS
SLC38A6	145389	broad.mit.edu	37	14	61486269	61486269	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61486269C>A	uc001xfg.1	+	5	490	c.374C>A	c.(373-375)GCA>GAA	p.A125E	SLC38A6_uc001xfh.1_Missense_Mutation_p.A125E|SLC38A6_uc001xfi.2_RNA|SLC38A6_uc001xfj.1_RNA|SLC38A6_uc001xfk.2_RNA|SLC38A6_uc010trz.1_Missense_Mutation_p.A102E	NM_153811	NP_722518	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	125	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TTGGTGGTGGCAGGCACCATA	0.313													44	105	---	---	---	---	PASS
SMOC1	64093	broad.mit.edu	37	14	70459181	70459181	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70459181G>A	uc001xls.1	+	6	827	c.574G>A	c.(574-576)GAT>AAT	p.D192N	SMOC1_uc001xlt.1_Missense_Mutation_p.D192N	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	192					cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GCCGGTGTTCGATGGAGATGG	0.413													11	67	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88934319	88934319	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88934319C>T	uc001xwv.3	-	19					PTPN21_uc010twc.1_3'UTR	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						GCCTGTGCTTCGCACGTTTCC	0.567													26	47	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88934332	88934332	+	3'UTR	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88934332C>T	uc001xwv.3	-	19					PTPN21_uc010twc.1_3'UTR	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						ACGTTTCCTTCAGCGTGCCGC	0.552													36	53	---	---	---	---	PASS
C14orf159	80017	broad.mit.edu	37	14	91681828	91681828	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91681828G>A	uc001xzb.2	+	15	2397	c.1629G>A	c.(1627-1629)CTG>CTA	p.L543L	C14orf159_uc001xyx.2_Silent_p.L491L|C14orf159_uc001xyw.2_Silent_p.L548L|C14orf159_uc001xzc.2_Silent_p.L543L|C14orf159_uc001xza.2_Silent_p.L548L|C14orf159_uc001xyv.2_Silent_p.L508L|C14orf159_uc001xyz.2_Silent_p.L419L|C14orf159_uc001xze.2_Silent_p.L543L	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a	543						mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		GTCAGTACCTGAGGAAAGCAG	0.567													44	126	---	---	---	---	PASS
GPR68	8111	broad.mit.edu	37	14	91700960	91700960	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91700960G>A	uc001xzg.2	-	2	776	c.435C>T	c.(433-435)ATC>ATT	p.I145I	GPR68_uc001xzh.2_Silent_p.I155I	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	145	Helical; Name=4; (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		CCTTGGCCCAGATGACCACGC	0.627													12	29	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92506013	92506013	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92506013C>T	uc001xzy.2	-	1	805	c.17G>A	c.(16-18)GGG>GAG	p.G6E	TRIP11_uc001xzz.3_RNA	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	6					transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		GCCGAGGCCCCCAAGCCAGGA	0.577			T	PDGFRB	AML								6	15	---	---	---	---	PASS
PLD4	122618	broad.mit.edu	37	14	105397201	105397201	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105397201G>A	uc001ypu.1	+	7	981	c.840G>A	c.(838-840)CAG>CAA	p.Q280Q	PLD4_uc010tyl.1_Silent_p.Q287Q	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	280					lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	CCTGGCCTCAGAACTTCTCAT	0.567													68	156	---	---	---	---	PASS
BUB1B	701	broad.mit.edu	37	15	40500941	40500941	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40500941G>A	uc001zkx.3	+	16	2325	c.2113G>A	c.(2113-2115)GAG>AAG	p.E705K		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	705					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TCAAATTCCTGAGAAACTAGA	0.423			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				15	57	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41388034	41388034	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41388034G>A	uc001zni.2	-	3	449	c.236C>T	c.(235-237)TCA>TTA	p.S79L	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	79	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						ACCAAGCAATGAATTTGGAGG	0.433													27	71	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41657737	41657737	+	Silent	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41657737G>C	uc001zns.3	+	7	1028	c.798G>C	c.(796-798)CTG>CTC	p.L266L	NUSAP1_uc001znq.3_Silent_p.L71L|NUSAP1_uc001znr.3_Silent_p.L265L|NUSAP1_uc010bce.2_Silent_p.L266L|NUSAP1_uc001znt.3_Silent_p.L251L|NUSAP1_uc001znv.3_Silent_p.L264L|NUSAP1_uc001znu.3_Silent_p.L265L|NUSAP1_uc010ucw.1_Silent_p.L242L|NUSAP1_uc001znw.3_Silent_p.L70L	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	266	Interaction with microtubules (By similarity).				cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CCTTGGGTCTGAAGGGGTCAC	0.502													5	26	---	---	---	---	PASS
LIPC	3990	broad.mit.edu	37	15	58861007	58861007	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58861007C>G	uc010bga.1	+	11	2089	c.1481C>G	c.(1480-1482)TCA>TGA	p.S494*	LIPC_uc002afa.1_Nonsense_Mutation_p.S494*|LIPC_uc010ugy.1_Nonsense_Mutation_p.S433*	NM_000236	NP_000227	P11150	LIPC_HUMAN	lipase C precursor	494					cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TCTAAAACATCAAAGCGAAAG	0.348													8	28	---	---	---	---	PASS
FAM63B	54629	broad.mit.edu	37	15	59146724	59146724	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59146724C>G	uc002afj.2	+	9	1983	c.1781C>G	c.(1780-1782)TCT>TGT	p.S594C	FAM63B_uc002afi.2_Missense_Mutation_p.S593C|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	594										central_nervous_system(1)	1						GGAAGACAATCTGGGAATAGT	0.378													22	59	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65491367	65491367	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65491367C>G	uc002aon.2	-	9	1438	c.1257G>C	c.(1255-1257)CAG>CAC	p.Q419H		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	419					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						TGGTGGCATTCTGAAAGCAAT	0.507													27	95	---	---	---	---	PASS
TLE3	7090	broad.mit.edu	37	15	70346924	70346924	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70346924G>A	uc002asm.2	-	16	2807	c.1688C>T	c.(1687-1689)TCG>TTG	p.S563L	TLE3_uc002ask.2_Missense_Mutation_p.S490L|TLE3_uc002asl.2_Missense_Mutation_p.S563L|TLE3_uc010ukd.1_Missense_Mutation_p.S553L|TLE3_uc010bik.1_Missense_Mutation_p.S144L|TLE3_uc010bil.1_Missense_Mutation_p.S560L|TLE3_uc002asn.2_Missense_Mutation_p.S551L|TLE3_uc002asp.2_Missense_Mutation_p.S555L|TLE3_uc002aso.2_Missense_Mutation_p.S558L	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	563	WD 2.				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						GGGCGTGGGCGAGGCCAGGTC	0.652													13	30	---	---	---	---	PASS
CPEB1	64506	broad.mit.edu	37	15	83296112	83296112	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83296112C>G	uc002bit.2	-	2	339	c.202G>C	c.(202-204)GAA>CAA	p.E68Q	CPEB1_uc002biu.2_Missense_Mutation_p.E35Q|CPEB1_uc010uof.1_5'UTR|CPEB1_uc002biv.2_Missense_Mutation_p.E8Q	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding	8					mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			CTTCCTGCTTCTTCTTCCTAG	0.398													10	41	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	601635	601635	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601635C>T	uc002chi.2	+	9	2679	c.2316C>T	c.(2314-2316)GTC>GTT	p.V772V	SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	772	Calpain catalytic.				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				GTGAGGGTGTCTTCTGGATGG	0.672													30	55	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2155925	2155925	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2155925G>A	uc002cos.1	-	20	8013	c.7804C>T	c.(7804-7806)CAG>TAG	p.Q2602*	PKD1_uc002cot.1_Nonsense_Mutation_p.Q2602*|PKD1_uc010bse.1_5'Flank	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2602	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GGATCGGCCTGCCGCAGCAGC	0.657													20	51	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2813979	2813979	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2813979G>A	uc002crk.2	+	11	3999	c.3450G>A	c.(3448-3450)TCG>TCA	p.S1150S	SRRM2_uc002crj.1_Silent_p.S1054S|SRRM2_uc002crl.1_Silent_p.S1150S|SRRM2_uc010bsu.1_Silent_p.S1054S	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1150	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CAGTGGACTCGAATTCTCTCT	0.478													35	129	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3781375	3781375	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3781375G>A	uc002cvv.2	-	30	5194	c.4990C>T	c.(4990-4992)CGC>TGC	p.R1664C	CREBBP_uc002cvw.2_Missense_Mutation_p.R1626C	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1664	Interaction with TRERF1.		R -> H (in RSTS1; abolishes acetyltransferase activity).		cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AAGGCGTCGCGCCCATCCATG	0.642			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				6	10	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14294324	14294324	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14294324G>A	uc010uza.1	+						MKL2_uc002dcg.2_Intron|MKL2_uc002dch.2_Intron|MKL2_uc010uzb.1_5'UTR	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						CAGTAGCATCGTTTTTCCACT	0.388													78	256	---	---	---	---	PASS
COX6A2	1339	broad.mit.edu	37	16	31439079	31439079	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31439079G>A	uc002ebx.1	-	3						NM_005205	NP_005196	Q02221	CX6A2_HUMAN	cytochrome c oxidase subunit VIa polypeptide 2						generation of precursor metabolites and energy	mitochondrial respiratory chain complex IV	cytochrome-c oxidase activity				0						TATTGTGTCCGGGGGCGTCCG	0.697													5	7	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57755605	57755605	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57755605C>A	uc002emi.2	+	9	1322	c.1233C>A	c.(1231-1233)TTC>TTA	p.F411L	CCDC135_uc002emj.2_Missense_Mutation_p.F411L|CCDC135_uc002emk.2_Missense_Mutation_p.F346L	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	411						cytoplasm				central_nervous_system(1)	1						ATAAGAGCTTCGACATGCCCC	0.532													22	63	---	---	---	---	PASS
CDH3	1001	broad.mit.edu	37	16	68718667	68718667	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68718667C>T	uc002ewf.2	+	10	2496	c.1364C>T	c.(1363-1365)ACT>ATT	p.T455I	CDH3_uc010vli.1_Missense_Mutation_p.T400I	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein	455	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		GGCATCCCCACTGGGGAGCCT	0.552													61	214	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85689517	85689517	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85689517C>T	uc002fix.2	+	6	1057	c.983C>T	c.(982-984)GCG>GTG	p.A328V	KIAA0182_uc002fiw.2_Missense_Mutation_p.A224V|KIAA0182_uc002fiy.2_Missense_Mutation_p.A255V	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	328	Potential.						protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GGCCTCAGCGCGGAGAGGTAA	0.657													8	26	---	---	---	---	PASS
KLHDC4	54758	broad.mit.edu	37	16	87743101	87743101	+	Missense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87743101C>A	uc002fki.2	-	10	1263	c.1217G>T	c.(1216-1218)GGC>GTC	p.G406V	KLHDC4_uc002fkh.1_RNA|KLHDC4_uc010cht.1_Intron|KLHDC4_uc002fkj.2_Missense_Mutation_p.G375V|KLHDC4_uc002fkk.2_Missense_Mutation_p.G225V|KLHDC4_uc002fkl.2_Missense_Mutation_p.G349V|KLHDC4_uc010chu.1_Missense_Mutation_p.G225V	NM_017566	NP_060036	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	406										pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CCCCGCCGAGCCTGGCGCGGT	0.697													13	37	---	---	---	---	PASS
TCF25	22980	broad.mit.edu	37	16	89977011	89977011	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89977011C>G	uc002fpb.2	+	17	1894	c.1812C>G	c.(1810-1812)ATC>ATG	p.I604M	TCF25_uc002fpc.2_Missense_Mutation_p.Q409E|uc010ciy.1_5'Flank	NM_014972	NP_055787	Q9BQ70	TCF25_HUMAN	NULP1	604					heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		TAAGTCCTATCAGCCATGGAA	0.557											OREG0024057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	90	---	---	---	---	PASS
SGSM2	9905	broad.mit.edu	37	17	2265472	2265472	+	Silent	SNP	C	T	T	rs113450178		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2265472C>T	uc002fun.3	+	4	541	c.366C>T	c.(364-366)CTC>CTT	p.L122L	SGSM2_uc002fum.3_Silent_p.L122L|SGSM2_uc010vqw.1_Silent_p.L122L	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2	122	RUN.					intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CCCCGGCCCTCAGCCCTCAGG	0.642													109	125	---	---	---	---	PASS
C17orf107	100130311	broad.mit.edu	37	17	4804616	4804616	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4804616G>A	uc002fzl.3	+	3					CHRNE_uc002fzk.1_Intron	NM_001145536	NP_001139008	Q6ZR85	CQ107_HUMAN	hypothetical protein LOC100130311												0						ATTACGGACAGAAAAGGGCAT	0.577													4	12	---	---	---	---	PASS
EIF5A	1984	broad.mit.edu	37	17	7214697	7214697	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7214697C>A	uc010vtv.1	+	4	536	c.299C>A	c.(298-300)TCA>TAA	p.S100*	EIF5A_uc002gfr.2_Nonsense_Mutation_p.S130*|EIF5A_uc002gft.2_Nonsense_Mutation_p.S100*|EIF5A_uc002gfu.2_Nonsense_Mutation_p.S100*	NM_001970	NP_001961	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A	100					induction of apoptosis|mRNA export from nucleus|peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein export from nucleus|translational frameshifting|transmembrane transport	annulate lamellae|cytosol|endoplasmic reticulum membrane|nuclear pore	protein N-terminus binding|ribosome binding|translation elongation factor activity|U6 snRNA binding				0						GGGTACCTATCACTGCTCCAG	0.562													26	136	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7702000	7702000	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7702000G>A	uc002giu.1	+	54	8537	c.8523G>A	c.(8521-8523)GAG>GAA	p.E2841E		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2841	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCTCAGGCGAGGTGCCCAATC	0.512													82	74	---	---	---	---	PASS
RPL26	6154	broad.mit.edu	37	17	8285553	8285553	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8285553G>C	uc002glh.1	-	2	172	c.76C>G	c.(76-78)CGA>GGA	p.R26G		NM_000987	NP_000978	P61254	RL26_HUMAN	ribosomal protein L26	26					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						ATCTTCCTTCGAATGTGGGAA	0.418													16	89	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10419637	10419637	+	Missense_Mutation	SNP	T	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10419637T>G	uc002gmo.2	-	4	321	c.227A>C	c.(226-228)CAA>CCA	p.Q76P	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	76	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GGGGAAGACTTGGTCATCTTT	0.463													56	232	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10442618	10442618	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10442618C>T	uc010coi.2	-	14	1448	c.1320G>A	c.(1318-1320)CTG>CTA	p.L440L	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.L440L|MYH2_uc010coj.2_Silent_p.L440L	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	440	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CAACCATCCACAGGAACATCT	0.473													47	247	---	---	---	---	PASS
ZNF207	7756	broad.mit.edu	37	17	30685544	30685544	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30685544C>G	uc002hhh.3	+	3	339	c.191C>G	c.(190-192)GCC>GGC	p.A64G	ZNF207_uc002hhj.3_Missense_Mutation_p.A64G|ZNF207_uc002hhi.3_Missense_Mutation_p.A64G|ZNF207_uc010csz.2_Missense_Mutation_p.A67G|ZNF207_uc002hhk.1_Missense_Mutation_p.A64G|ZNF207_uc002hhl.1_5'Flank	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	64						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			ACAATAGATGCCGTACCAAAT	0.318													24	90	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35936555	35936555	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35936555G>A	uc002hoa.2	-						SYNRG_uc010wde.1_Intron|SYNRG_uc010wdf.1_Intron|SYNRG_uc002hoc.2_Intron|SYNRG_uc002hoe.2_Intron|SYNRG_uc002hod.2_Intron|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Intron|SYNRG_uc002hof.2_5'UTR|SYNRG_uc010cvd.1_Intron|SYNRG_uc002hog.1_Intron|SYNRG_uc010wdh.1_Intron	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1						endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						AGTGGTCCATGGAGAAGATGG	0.413													9	34	---	---	---	---	PASS
KRTAP4-9	100132386	broad.mit.edu	37	17	39261650	39261650	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39261650T>C	uc010wfp.1	+	1	10	c.10T>C	c.(10-12)TCC>CCC	p.S4P		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	4						keratin filament					0						CATGGTCAGCTCCTGTTGTGG	0.592													9	28	---	---	---	---	PASS
EZH1	2145	broad.mit.edu	37	17	40870014	40870014	+	Missense_Mutation	SNP	T	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40870014T>C	uc002iaz.2	-	10	1148	c.1003A>G	c.(1003-1005)ACA>GCA	p.T335A	EZH1_uc002iba.2_Missense_Mutation_p.T326A|EZH1_uc010wgt.1_Missense_Mutation_p.T265A|EZH1_uc010wgu.1_Missense_Mutation_p.T341A|EZH1_uc010wgv.1_Missense_Mutation_p.T295A|EZH1_uc010wgw.1_Missense_Mutation_p.T196A|EZH1_uc010cyp.2_Missense_Mutation_p.T236A|EZH1_uc010cyq.2_Missense_Mutation_p.T252A|EZH1_uc010cys.2_Missense_Mutation_p.T286A|EZH1_uc010cyo.1_Intron|EZH1_uc010cyr.1_5'UTR	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	335					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		AAGCAGTCTGTGCCACATGGT	0.408													12	57	---	---	---	---	PASS
PLCD3	113026	broad.mit.edu	37	17	43195396	43195396	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43195396C>T	uc002iib.2	-	7	1339	c.1225G>A	c.(1225-1227)GAC>AAC	p.D409N		NM_133373	NP_588614	Q8N3E9	PLCD3_HUMAN	phospholipase C delta 3	409	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)	TGGACCACGTCCCGGAAGAGA	0.657													8	31	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587708	43587708	+	Intron	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587708A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						AACAACCACCATCTCCAAATC	0.348													3	44	---	---	---	---	PASS
PDK2	5164	broad.mit.edu	37	17	48174834	48174834	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48174834G>C	uc002iqc.2	+	2	270	c.166G>C	c.(166-168)GAG>CAG	p.E56Q	PDK2_uc002iqb.2_5'UTR	NM_002611	NP_002602	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase 2 precursor	56					glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|nucleus	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			central_nervous_system(3)	3						CCTCAGGCAGGAGCTGCCTGT	0.488									Autosomal_Dominant_Polycystic_Kidney_Disease				35	63	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901324	51901324	+	Silent	SNP	G	A	A	rs139246128		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901324G>A	uc002iua.2	+	1	1086	c.930G>A	c.(928-930)ACG>ACA	p.T310T	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	310	ATP (By similarity).|Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						GTGGGAAGACGTACACCATGG	0.547													64	70	---	---	---	---	PASS
OR4D1	26689	broad.mit.edu	37	17	56233157	56233157	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56233157C>T	uc010wno.1	+	1	643	c.643C>T	c.(643-645)CTG>TTG	p.L215L	MSX2P1_uc002ivn.2_5'Flank	NM_012374	NP_036506	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCTCCTCCTTCTGATCTCTTA	0.537													56	56	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57148206	57148206	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57148206G>A	uc002iwy.3	-	9	1231	c.787C>T	c.(787-789)CCT>TCT	p.P263S	TRIM37_uc002iwz.3_Missense_Mutation_p.P263S|TRIM37_uc002ixa.3_Missense_Mutation_p.P141S|TRIM37_uc010woc.1_Missense_Mutation_p.P229S	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	263						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GGTGGAACAGGAGTGGTAACA	0.363									Mulibrey_Nanism				25	94	---	---	---	---	PASS
LOC651250	651250	broad.mit.edu	37	17	66122822	66122822	+	RNA	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66122822C>T	uc002jgq.2	+	6		c.1945C>T			LOC651250_uc002kit.2_RNA|LOC651250_uc002jgo.1_Intron	NR_027418				Homo sapiens cDNA FLJ33831 fis, clone CTONG2003937.												0						AGTCCGTCTTCAAGGTCCAGA	0.507													62	64	---	---	---	---	PASS
COG1	9382	broad.mit.edu	37	17	71204383	71204383	+	Intron	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71204383C>T	uc002jjg.2	+						COG1_uc002jjh.2_Intron|COG1_uc002jjf.1_3'UTR|FAM104A_uc002jjj.3_3'UTR|FAM104A_uc002jji.3_3'UTR	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			CGAGTGGCGTCGCGCGGAGGG	0.607													36	34	---	---	---	---	PASS
SYNGR2	9144	broad.mit.edu	37	17	76167700	76167700	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76167700C>T	uc002juu.1	+	3	474	c.447C>T	c.(445-447)ATC>ATT	p.I149I	SYNGR2_uc002jut.2_Silent_p.I149I|SYNGR2_uc002juv.1_Intron|SYNGR2_uc010dhi.1_RNA	NM_004710	NP_004701	O43760	SNG2_HUMAN	synaptogyrin 2	149	MARVEL.|Helical; (Potential).					integral to plasma membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)			GGGCAGCCATCACCTTCAGCT	0.612													23	51	---	---	---	---	PASS
BIRC5	332	broad.mit.edu	37	17	76219552	76219552	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76219552G>A	uc002jvg.2	+	4	467	c.346G>A	c.(346-348)GAA>AAA	p.E116K	BIRC5_uc002jvf.2_Missense_Mutation_p.E139K|BIRC5_uc002jvh.2_Silent_p.R76R|BIRC5_uc002jvi.2_RNA|EPR1_uc002jvj.1_RNA	NM_001168	NP_001159	O15392	BIRC5_HUMAN	baculoviral IAP repeat-containing protein 5	116					anti-apoptosis|apoptosis|cell division|chromosome segregation|cytokinesis|establishment of chromosome localization|G2/M transition of mitotic cell cycle|mitosis|mitotic prometaphase|positive regulation of exit from mitosis|positive regulation of mitotic cell cycle|protein complex localization|spindle checkpoint	centriole|chromosome passenger complex|chromosome, centromeric region|cytoplasm|cytoplasmic microtubule|cytosol|interphase microtubule organizing center|midbody|midbody|nuclear chromosome|spindle|spindle microtubule	caspase inhibitor activity|chaperone binding|cobalt ion binding|cofactor binding|cysteine-type endopeptidase inhibitor activity|metal ion binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|Ran GTPase binding|zinc ion binding			kidney(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)			CCAGGCAAAGGAAACCAACAA	0.468													25	43	---	---	---	---	PASS
C18orf45	85019	broad.mit.edu	37	18	20877820	20877820	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20877820G>A	uc002kuf.2	-	15					C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA|C18orf45_uc002kue.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					TCACTTGGGTGAGGGTGATGG	0.587													4	11	---	---	---	---	PASS
C18orf45	85019	broad.mit.edu	37	18	20877826	20877826	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20877826G>A	uc002kuf.2	-	15					C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA|C18orf45_uc002kue.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					GGGTGAGGGTGATGGCACTGC	0.587													4	11	---	---	---	---	PASS
C18orf45	85019	broad.mit.edu	37	18	20877894	20877894	+	3'UTR	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20877894G>A	uc002kuf.2	-	15					C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA|C18orf45_uc002kue.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					AGGGAGCTATGAGACCAGGGG	0.552													10	28	---	---	---	---	PASS
C18orf10	25941	broad.mit.edu	37	18	34387820	34387820	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34387820C>T	uc002kzw.1	-	3	671	c.243G>A	c.(241-243)GTG>GTA	p.V81V	C18orf10_uc002kzv.1_Silent_p.V81V|C18orf10_uc010xci.1_Silent_p.V81V|C18orf10_uc002kzx.1_Silent_p.V81V|C18orf10_uc002kzy.3_Silent_p.V81V	NM_015476	NP_056291	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	81						cytoplasm|microtubule				skin(1)	1						catccagcttcACACTCCATG	0.204													33	66	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34839222	34839222	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34839222C>G	uc002lae.2	-	11	1651	c.1255G>C	c.(1255-1257)GAG>CAG	p.E419Q	CELF4_uc010dnd.1_Missense_Mutation_p.E417Q|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Missense_Mutation_p.E413Q|CELF4_uc002lai.2_Missense_Mutation_p.E403Q	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	419	RRM 3.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TTACAGCCCTCGGGCCCTGCG	0.323													9	29	---	---	---	---	PASS
BTBD2	55643	broad.mit.edu	37	19	1986426	1986426	+	3'UTR	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1986426G>C	uc002lup.1	-	9					BTBD2_uc002luo.1_3'UTR	NM_017797	NP_060267	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2							cytoplasmic mRNA processing body	protein binding			ovary(1)|skin(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGCAGCAGATGATGGCCT	0.687													13	42	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4168351	4168351	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4168351G>A	uc002lzl.2	+	6	834	c.718G>A	c.(718-720)GAG>AAG	p.E240K	CREB3L3_uc002lzm.2_Missense_Mutation_p.E230K|CREB3L3_uc010xib.1_Missense_Mutation_p.E229K|CREB3L3_uc010xic.1_Intron	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	240	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGGCAGTACGAGGAGCGAGT	0.408													13	43	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4168358	4168358	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4168358G>A	uc002lzl.2	+	6	841	c.725G>A	c.(724-726)CGA>CAA	p.R242Q	CREB3L3_uc002lzm.2_Missense_Mutation_p.R232Q|CREB3L3_uc010xib.1_Missense_Mutation_p.R231Q|CREB3L3_uc010xic.1_Intron	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	242	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TACGAGGAGCGAGTGCTGAAA	0.413													12	46	---	---	---	---	PASS
SEMA6B	10501	broad.mit.edu	37	19	4550273	4550273	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4550273C>G	uc010duc.1	-	11	1171	c.1133G>C	c.(1132-1134)TGC>TCC	p.C378S	SEMA6B_uc010dud.2_Missense_Mutation_p.C378S|SEMA6B_uc010xih.1_Missense_Mutation_p.C378S	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN	semaphorin 6B precursor	378	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGGCTGCGCAGCACCCGGG	0.602													27	76	---	---	---	---	PASS
SH2D3A	10045	broad.mit.edu	37	19	6760801	6760801	+	Silent	SNP	C	T	T	rs143102735		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6760801C>T	uc002mft.2	-	3	461	c.267G>A	c.(265-267)CCG>CCA	p.P89P	SH2D3A_uc010xjg.1_Intron	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	89	SH2.				JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						GAACCAGAGCCGGTATGCTGG	0.632													32	78	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9057196	9057196	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057196G>A	uc002mkp.2	-	3	30454	c.30250C>T	c.(30250-30252)CTG>TTG	p.L10084L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10086	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGGCAGCCAGTATTTCAACT	0.473													10	41	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36221009	36221009	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36221009G>A	uc010eei.2	+	24	5059	c.5059G>A	c.(5059-5061)GAT>AAT	p.D1687N		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1687					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAACACACTGATCTCCTGGA	0.587													8	21	---	---	---	---	PASS
ZNF790	388536	broad.mit.edu	37	19	37310567	37310567	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37310567C>G	uc002oew.2	-	5	798	c.679G>C	c.(679-681)GAA>CAA	p.E227Q	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	227	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCTTTACATTCATATGTTTTC	0.348													27	53	---	---	---	---	PASS
AP2S1	1175	broad.mit.edu	37	19	47349397	47349397	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47349397G>A	uc002pft.1	-	2	186	c.6C>T	c.(4-6)ATC>ATT	p.I2I	AP2S1_uc002pfu.1_Silent_p.I2I	NM_004069	NP_004060	P53680	AP2S1_HUMAN	adaptor-related protein complex 2, sigma 1	2					axon guidance|clathrin coat assembly|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|regulation of endocytosis|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	protein transporter activity				0		all_cancers(25;1.24e-06)|all_epithelial(76;1.09e-05)|all_lung(116;0.00019)|Lung NSC(112;0.000601)|Ovarian(192;0.0221)|all_neural(266;0.0459)|Breast(70;0.128)		OV - Ovarian serous cystadenocarcinoma(262;3.86e-05)|all cancers(93;0.000107)|Epithelial(262;0.00325)|GBM - Glioblastoma multiforme(486;0.0336)		GGATAAAGCGGATCTGGGGGC	0.597													18	50	---	---	---	---	PASS
CRX	1406	broad.mit.edu	37	19	48343102	48343102	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48343102G>A	uc002phq.3	+	4	982	c.778G>A	c.(778-780)GCC>ACC	p.A260T		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	260					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GAGCTATGGCGCCTACAGCCC	0.632													99	236	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51022595	51022595	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51022595G>A	uc002pss.2	-	3	512	c.375C>T	c.(373-375)ATC>ATT	p.I125I		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	125	Extracellular (Potential).|LRR 2.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CGCCCACCTCGATCTTGCGCA	0.622													16	50	---	---	---	---	PASS
LILRA6	79168	broad.mit.edu	37	19	54745730	54745730	+	Missense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54745730G>A	uc002qeu.1	-	4	504	c.380C>T	c.(379-381)TCA>TTA	p.S127L	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Missense_Mutation_p.S127L|LILRA6_uc002qek.1_Missense_Mutation_p.S127L|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.S127L|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S127L|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.S127L|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S127L|LILRA6_uc010yep.1_Missense_Mutation_p.S127L|LILRA6_uc010yeq.1_Missense_Mutation_p.S127L|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_5'UTR	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	127	Extracellular (Potential).					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGCAGGGCTGAGAGGGTGGG	0.562													38	91	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754820	54754820	+	Intron	SNP	T	G	G	rs429425	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754820T>G	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.L605F|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGTGAGAGGTAAGGAACGTG	0.607													6	74	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754843	54754843	+	Intron	SNP	A	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754843A>G	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.S598P|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGGTGGGGAGGCCTGGGGG	0.607													6	54	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733572	56733572	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733572C>T	uc002qmq.2	-	5	1029	c.863G>A	c.(862-864)AGA>AAA	p.R288K	ZSCAN5A_uc010ygi.1_Missense_Mutation_p.R171K|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.R288K|ZSCAN5A_uc002qms.1_Missense_Mutation_p.R287K	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	288					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						AGCGTCTCCTCTGTTCCCGCT	0.537													67	138	---	---	---	---	PASS
RIN2	54453	broad.mit.edu	37	20	19955572	19955572	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19955572G>T	uc002wro.1	+	7	939	c.903G>T	c.(901-903)ACG>ACT	p.T301T	RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Silent_p.T95T	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	301					endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						CGAATGGCACGGAGCGGACTC	0.607													9	31	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31699226	31699226	+	Silent	SNP	T	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31699226T>C	uc010zue.1	+	16	1843	c.1828T>C	c.(1828-1830)TTG>CTG	p.L610L		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	610						cytoplasm|extracellular region	lipid binding				0						CAAGGACCTTTTGGTGCTGAG	0.587													22	47	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34242690	34242690	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34242690G>T	uc002xdq.2	-	3	787	c.555C>A	c.(553-555)GTC>GTA	p.V185V	CPNE1_uc010zvj.1_5'Flank|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Silent_p.V185V|RBM12_uc002xds.2_Silent_p.V185V	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	185	Pro-rich.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GTGGCGGCGGGACTGTGTTCA	0.547													14	41	---	---	---	---	PASS
ADA	100	broad.mit.edu	37	20	43255222	43255222	+	Silent	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43255222G>A	uc002xmj.2	-	4	365	c.237C>T	c.(235-237)ATC>ATT	p.I79I	ADA_uc010ggt.2_RNA	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase	79					adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	CGATCCTTTTGATAGCCTCCC	0.567									Adenosine_Deaminase_Deficiency				29	79	---	---	---	---	PASS
SPINLW1	57119	broad.mit.edu	37	20	44174068	44174068	+	Intron	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44174068G>A	uc002xou.2	-						SPINLW1_uc010zxc.1_Intron|SPINLW1_uc002xot.2_Intron|SPINLW1_uc002xov.1_3'UTR	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				CTGggaaactgagtctcagac	0.174													3	1	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44589147	44589147	+	Missense_Mutation	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44589147C>G	uc002xqw.2	-	13	1923	c.1800G>C	c.(1798-1800)AAG>AAC	p.K600N	ZNF335_uc010zxk.1_Missense_Mutation_p.K445N	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	600	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				TGTAGCGCTTCTTAAAGGACT	0.622													47	113	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43413917	43413917	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43413917C>T	uc002zab.3	-	3	502	c.288G>A	c.(286-288)AAG>AAA	p.K96K	ZNF295_uc002yzz.3_Silent_p.K96K|ZNF295_uc002yzy.3_Silent_p.K96K|ZNF295_uc002zaa.3_Silent_p.K96K|ZNF295_uc010gov.1_Silent_p.K96K|ZNF295_uc002zac.2_Silent_p.K96K	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	96	Mediates homodimerization.|BTB.				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CAAGGCTGCTCTTCTCAACAA	0.398													16	38	---	---	---	---	PASS
KRTAP10-11	386678	broad.mit.edu	37	21	46066356	46066356	+	5'UTR	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46066356C>G	uc002zfr.3	+	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198692	NP_941965	P60412	KR10B_HUMAN	keratin associated protein 10-11							keratin filament				ovary(1)	1						TCCCCCAGCTCACCTCCTCCC	0.498													20	48	---	---	---	---	PASS
RIMBP3	85376	broad.mit.edu	37	22	20457929	20457929	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20457929C>T	uc002zsd.3	-	1	3858	c.3373G>A	c.(3373-3375)GGT>AGT	p.G1125S		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			ACAGCATAACCGGTGACCTGG	0.592													4	28	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20939289	20939289	+	Missense_Mutation	SNP	G	A	A	rs147995933		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20939289G>A	uc002zsp.2	+	15	2031	c.1951G>A	c.(1951-1953)GGC>AGC	p.G651S	MED15_uc002zsq.2_Missense_Mutation_p.G611S|MED15_uc010gso.2_Missense_Mutation_p.G594S|MED15_uc002zsr.2_Missense_Mutation_p.G585S|MED15_uc011ahs.1_Missense_Mutation_p.G585S|MED15_uc002zss.2_Missense_Mutation_p.G530S|MED15_uc011ahu.1_Missense_Mutation_p.G361S|MED15_uc002zst.2_Missense_Mutation_p.G267S|MED15_uc002zsu.2_Missense_Mutation_p.G256S	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	651					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CGCCATTCACGGCCCACCCAT	0.657													20	106	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22730631	22730631	+	RNA	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22730631C>G	uc011aim.1	+	44		c.4798C>G								Parts of antibodies, mostly variable regions.												0						TCACCTGCACCTTGCGCAGTG	0.537													23	96	---	---	---	---	PASS
CRYBB1	1414	broad.mit.edu	37	22	27008146	27008146	+	Silent	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27008146G>T	uc003acy.1	-	3	259	c.189C>A	c.(187-189)GTC>GTA	p.V63V		NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1	63	Beta/gamma crystallin 'Greek key' 1.				visual perception		structural constituent of eye lens			ovary(1)	1						CCAGTTCGAAGACCACCAGCT	0.532													23	93	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38327931	38327931	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38327931C>T	uc003aui.2	+	10	2091	c.2007C>T	c.(2005-2007)ATC>ATT	p.I669I		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	669						cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					TTCCACTCATCAAACGCAAGG	0.642													31	65	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38328839	38328839	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38328839C>T	uc003aui.2	+	12	2262	c.2178C>T	c.(2176-2178)TTC>TTT	p.F726F		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	726						cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					TGGACTGGTTCAAGCTCATCC	0.617													11	59	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46722532	46722532	+	Missense_Mutation	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46722532C>T	uc011aqy.1	+	9	1917	c.1705C>T	c.(1705-1707)CGC>TGC	p.R569C	GTSE1_uc011aqz.1_Missense_Mutation_p.R416C|GTSE1_uc003bhl.1_Missense_Mutation_p.R194C|GTSE1_uc003bhm.1_Missense_Mutation_p.R194C|GTSE1_uc003bhn.2_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	550					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CTCTGAGCCCCGCAAGAACTC	0.562													11	62	---	---	---	---	PASS
RBM10	8241	broad.mit.edu	37	X	47041369	47041369	+	Silent	SNP	C	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47041369C>G	uc004dhf.2	+	16	2092	c.1713C>G	c.(1711-1713)ACC>ACG	p.T571T	RBM10_uc004dhg.2_Silent_p.T493T|RBM10_uc004dhh.2_Silent_p.T570T|RBM10_uc010nhq.2_Silent_p.T494T|RBM10_uc004dhi.2_Silent_p.T636T	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	571	Tyr-rich.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						ACGTCTCTACCTACCAGTACG	0.582													30	21	---	---	---	---	PASS
RBM10	8241	broad.mit.edu	37	X	47045533	47045533	+	Nonsense_Mutation	SNP	A	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47045533A>T	uc004dhf.2	+	22	2879	c.2500A>T	c.(2500-2502)AAG>TAG	p.K834*	RBM10_uc004dhg.2_Nonsense_Mutation_p.K756*|RBM10_uc004dhh.2_Nonsense_Mutation_p.K833*|RBM10_uc010nhq.2_Nonsense_Mutation_p.K757*|RBM10_uc004dhi.2_Nonsense_Mutation_p.K899*	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	834					mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						GCCAGAGCCCAAGAGGAGGAA	0.607													22	18	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48681849	48681849	+	Missense_Mutation	SNP	G	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48681849G>T	uc011mmi.1	+	25	3135	c.3040G>T	c.(3040-3042)GGG>TGG	p.G1014W	HDAC6_uc004dks.1_Missense_Mutation_p.G1014W|HDAC6_uc010nig.1_Missense_Mutation_p.G862W|HDAC6_uc004dkt.1_Missense_Mutation_p.G1014W|HDAC6_uc011mmk.1_Missense_Mutation_p.G995W|HDAC6_uc004dkv.1_Missense_Mutation_p.G662W|HDAC6_uc004dkw.1_Missense_Mutation_p.G662W|HDAC6_uc004dkx.1_Missense_Mutation_p.G377W	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1014					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	GGAGGCTCCAGGGGGCACCGA	0.622													12	8	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63413139	63413139	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63413139G>A	uc004dvo.2	-	2	301	c.28C>T	c.(28-30)CAG>TAG	p.Q10*		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	10					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						CCCTTGGCCTGAGCAGCTTCA	0.527													42	36	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70470410	70470410	+	Silent	SNP	C	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70470410C>T	uc004dzh.1	-	5	1032	c.945G>A	c.(943-945)CGG>CGA	p.R315R	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Silent_p.R315R|ZMYM3_uc004dzj.1_Silent_p.R315R|ZMYM3_uc011mpu.1_Silent_p.R46R|ZMYM3_uc004dzk.3_Silent_p.R315R|ZMYM3_uc004dzl.3_Silent_p.R315R|ZMYM3_uc004dzm.3_Silent_p.R315R	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	315					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					GCAGTGGTGTCCGGCAATGTG	0.622													14	8	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75650837	75650837	+	Missense_Mutation	SNP	G	C	C			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75650837G>C	uc004ecm.1	+	1	2721	c.2514G>C	c.(2512-2514)TTG>TTC	p.L838F		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	838	Interaction with DTNA (By similarity).|MAGE 2.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						ACAACTTTTTGATGCAGGTCC	0.502													11	14	---	---	---	---	PASS
IL12RB2	3595	broad.mit.edu	37	1	67787765	67787766	+	Intron	DEL	TC	-	-	rs71945445		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787765_67787766delTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						ATTTGGCAAGtctctctctctc	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161348471	161348472	+	IGR	INS	-	A	A			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161348471_161348472insA								C1orf192 (10807 upstream) : FCGR2A (126733 downstream)																							aagtccgtctcaaaaaaaaaaa	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223352884	223352885	+	IGR	INS	-	CTTT	CTTT	rs61837572	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223352884_223352885insCTTT								TLR5 (36260 upstream) : SUSD4 (41278 downstream)																							ttccttccttcctttctttctt	0.045													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293343	12293351	+	Intron	DEL	TTCCTTCCC	-	-	rs112549370		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293343_12293351delTTCCTTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		cttcattcctttccttcccttccttccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133034808	133034808	+	IGR	DEL	G	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133034808delG								NCRNA00164 (19266 upstream) : GPR39 (139339 downstream)																							aaggaaggaaggaaggaagga	0.209													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204927676	204927677	+	IGR	INS	-	C	C	rs138783945	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204927676_204927677insC								ICOS (101380 upstream) : PARD3B (482839 downstream)																							cttccttccttcttccttcctt	0.000													3	3	---	---	---	---	
PRKCD	5580	broad.mit.edu	37	3	53218691	53218692	+	Intron	INS	-	A	A	rs11424887		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53218691_53218692insA	uc003dgl.2	+						PRKCD_uc003dgm.2_Intron|PRKCD_uc010hmt.1_Intron	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta						activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		aactccatctcaaaaaaaaaaa	0.153													4	2	---	---	---	---	
MIR567	693152	broad.mit.edu	37	3	111831724	111831724	+	RNA	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111831724delA	hsa-mir-567|MI0003573	+			c.77delA			C3orf52_uc003dyq.3_Intron|C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron																	0						ATGCAAAACTAAAAAAAAAAA	0.323													13	6	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130364072	130364074	+	Intron	DEL	AAA	-	-	rs10551514		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130364072_130364074delAAA	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						ttttattaataaaaaatcattaa	0.296													4	2	---	---	---	---	
GABRB1	2560	broad.mit.edu	37	4	47427501	47427501	+	Intron	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47427501delA	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TGATGATgatagatagataga	0.259													4	2	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													8	6	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10424069	10424069	+	Intron	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10424069delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ATATATAACCTTTTTTTTTTT	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131368633	131368636	+	IGR	DEL	GGAG	-	-	rs59143826		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131368633_131368636delGGAG								ACSL6 (20763 upstream) : IL3 (27711 downstream)																							agagagagaaggagggagggaggg	0.000													5	4	---	---	---	---	
HK3	3101	broad.mit.edu	37	5	176314898	176314899	+	Intron	INS	-	T	T	rs113393288		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176314898_176314899insT	uc003mfa.2	-						HK3_uc003mez.2_Intron	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3						glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCCCATCACTtttttttttt	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33918368	33918369	+	IGR	INS	-	TT	TT	rs147700351		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33918368_33918369insTT								MLN (146575 upstream) : MIR1275 (49380 downstream)																							ctgtgtgtgagtgtgtgtgtgt	0.307													4	2	---	---	---	---	
OOEP	441161	broad.mit.edu	37	6	74082632	74082632	+	Intron	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74082632delT	uc003pgv.3	-							NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ttttctttccttttttttttt	0.378													4	3	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	33066270	33066270	+	Intron	DEL	T	-	-	rs34317509		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33066270delT	uc011kai.1	+						NT5C3_uc003tdi.2_Intron|NT5C3_uc003tdj.2_Intron|NT5C3_uc003tdk.2_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						tgcccggccAttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64498714	64498715	+	5'Flank	INS	-	A	A	rs139476739	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64498714_64498715insA	uc003ttt.1	+						uc010kzt.1_5'Flank					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		gagggaggcggtggaggcggag	0.351													4	2	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82580534	82580534	+	Frame_Shift_Del	DEL	C	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82580534delC	uc003uhx.2	-	6	9659	c.9370delG	c.(9370-9372)GCTfs	p.A3124fs	PCLO_uc003uhv.2_Frame_Shift_Del_p.A3124fs|PCLO_uc010lec.2_Frame_Shift_Del_p.A89fs	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3055					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						ACTGCATCAGCCGTATGAATA	0.453													21	12	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48508351	48508352	+	Intron	INS	-	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48508351_48508352insG	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				AAGAAACTGTTGCATGTCTTTC	0.416													69	18	---	---	---	---	
TAF2	6873	broad.mit.edu	37	8	120793175	120793175	+	Intron	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120793175delA	uc003you.2	-							NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2						G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			actctgtctcaaaaaaaaaaa	0.114													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145073117	145073117	+	IGR	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145073117delA								GRINA (5534 upstream) : SPATC1 (13465 downstream)																							gaccctgtttaaaaaaaaaaa	0.035													4	2	---	---	---	---	
SLC2A8	29988	broad.mit.edu	37	9	130162446	130162446	+	Intron	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130162446delT	uc004bqu.2	+						SLC2A8_uc010mxj.2_Intron	NM_014580	NP_055395	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose							cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						TAGGTGAGTCttttttttttt	0.149													5	3	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134953129	134953129	+	Intron	DEL	A	-	-	rs76460072		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134953129delA	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron|MED27_uc004cbg.3_Intron	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TGGGACACTTAAAAAAAAAAA	0.368													5	3	---	---	---	---	
ANKRD1	27063	broad.mit.edu	37	10	92678871	92678871	+	Intron	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92678871delA	uc001khe.1	-							NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				ACTGGAAACCAAAAAAAAAGC	0.383													107	7	---	---	---	---	
C11orf36	283303	broad.mit.edu	37	11	3238075	3238076	+	5'Flank	INS	-	TCTCT	TCTCT	rs139319777		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3238075_3238076insTCTCT	uc001lxo.2	+						C11orf36_uc001lxn.2_5'Flank	NR_027138				RecName: Full=Uncharacterized protein C11orf36;												0						ccctccCCttctctcttctctt	0.084													4	2	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9493101	9493101	+	Intron	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9493101delT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		TGTTTTGGTGttttttttttt	0.134													4	2	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89106446	89106447	+	Intron	DEL	AA	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89106446_89106447delAA	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CTGTACAAGCaaaaaaaaaaaa	0.252													4	3	---	---	---	---	
ATP2B1	490	broad.mit.edu	37	12	90021524	90021524	+	Intron	DEL	C	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90021524delC	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc001tbf.2_5'Flank	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						TTAAAGCTTTCCAAAAGAAAT	0.348													82	17	---	---	---	---	
ANAPC5	51433	broad.mit.edu	37	12	121758412	121758413	+	Intron	INS	-	T	T			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121758412_121758413insT	uc001uag.2	-						ANAPC5_uc010szu.1_Intron|ANAPC5_uc001uae.2_Intron|ANAPC5_uc010szv.1_Intron|ANAPC5_uc001uaf.2_Intron|ANAPC5_uc001uah.2_Intron|ANAPC5_uc001uai.1_Intron	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					tcttttctttcttttttttttt	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132152375	132152376	+	IGR	INS	-	AAA	AAA	rs34559456		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132152375_132152376insAAA								LOC116437 (454900 upstream) : SFRS8 (43259 downstream)																							TGGTTATTGttaaaaaaaaaaa	0.460													7	5	---	---	---	---	
TRPC4	7223	broad.mit.edu	37	13	38357626	38357627	+	Intron	INS	-	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357626_38357627insG	uc001uws.2	-						TRPC4_uc010abv.2_5'Flank|TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTAAGAGTTAAGGTTTTTTTTT	0.228													3	3	---	---	---	---	
AKAP11	11215	broad.mit.edu	37	13	42860296	42860297	+	Intron	INS	-	G	G			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42860296_42860297insG	uc001uys.1	+							NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11						intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GCAAGTAAATTGGGGGGGGTGC	0.233													4	2	---	---	---	---	
DHRS12	79758	broad.mit.edu	37	13	52343500	52343500	+	Intron	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52343500delA	uc001vfq.2	-						DHRS12_uc001vfr.1_Intron			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;								binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		CCCttaatttaaaaaaaaaaa	0.458													4	2	---	---	---	---	
NARG2	79664	broad.mit.edu	37	15	60720541	60720542	+	Intron	INS	-	AAC	AAC			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60720541_60720542insAAC	uc002agp.2	-						NARG2_uc002ago.2_Intron	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						ATGACAATGAGAACATCAGGGT	0.351													43	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76039782	76039782	+	IGR	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76039782delA								DNM1P35 (7280 upstream) : UBE2Q2 (95840 downstream)																							CTAAATAACCaaaaaaaaaaa	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92199592	92199592	+	IGR	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92199592delT								SV2B (360944 upstream) : SLCO3A1 (197346 downstream)																							cattccttcctttcctccctc	0.015													4	2	---	---	---	---	
UQCRC2	7385	broad.mit.edu	37	16	21994284	21994285	+	Intron	INS	-	A	A	rs74501697		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21994284_21994285insA	uc002djx.2	+						UQCRC2_uc002djy.2_Intron|UQCRC2_uc010bxa.2_Intron	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II						aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		gactccacctcaaaaaaaaaaa	0.094													6	3	---	---	---	---	
MTSS1L	92154	broad.mit.edu	37	16	70708094	70708111	+	Intron	DEL	AGTCTCAACAGCTATAGT	-	-	rs67662127		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70708094_70708111delAGTCTCAACAGCTATAGT	uc002ezj.2	-							NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like						filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1						CCTTCAGGCCAGTCTCAACAGCTATAGTAGTCTCAACA	0.367													3	5	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2921210	2921211	+	Intron	INS	-	GT	GT	rs142119866	by1000genomes	TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2921210_2921211insGT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						CCTCTGTGACCgtgtgtgtgtg	0.475													5	3	---	---	---	---	
LGALS9B	284194	broad.mit.edu	37	17	20370782	20370783	+	Frame_Shift_Ins	INS	-	TC	TC	rs147679570		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20370782_20370783insTC	uc002gxa.1	-	1	66_67	c.1_2insGA	c.(1-3)ATGfs	p.M1fs	LGALS9B_uc002gwz.1_Frame_Shift_Ins_p.M1fs|LGALS9B_uc010vzh.1_Translation_Start_Site	NM_001042685	NP_001036150	Q3B8N2	LEG9B_HUMAN	galectin-9 like	1							sugar binding			skin(1)	1						GCTGAAGGCCATCTCCACCGCC	0.584													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20978234	20978237	+	IGR	DEL	CCTC	-	-	rs75278704		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20978234_20978237delCCTC								USP22 (31161 upstream) : DHRS7B (52021 downstream)																							ttccttctttcctccctccctccc	0.015													3	4	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45691260	45691268	+	Intron	DEL	TATCAGTAT	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45691260_45691268delTATCAGTAT	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010wkv.1_Intron|NPEPPS_uc002ils.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						ATATATGTTATATCAGTATTATCAGTATG	0.263													4	3	---	---	---	---	
PRTN3	5657	broad.mit.edu	37	19	843857	843857	+	Intron	DEL	C	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:843857delC	uc002lqa.1	+							NM_002777	NP_002768	P24158	PRTN3_HUMAN	myeloblastin						collagen catabolic process|positive regulation of cell proliferation|proteolysis		protein binding|serine-type endopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCGAGTGTCCAGGGCGCCG	0.761													4	2	---	---	---	---	
GNA11	2767	broad.mit.edu	37	19	3121300	3121300	+	3'UTR	DEL	T	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3121300delT	uc002lxd.2	+	7					uc010xhe.1_5'Flank	NM_002067	NP_002058	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein),						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			eye(70)|skin(16)	86		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CGGGAGGAGATTTTTTTTTTT	0.557			Mis		uveal melanoma								4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13445408	13445411	+	Intron	DEL	TGTG	-	-	rs138143360		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445408_13445411delTGTG	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	tgtgtgtgtttgtgtgtgtgtgtg	0.309													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17160380	17160383	+	IGR	DEL	AAGT	-	-	rs113736472		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17160380_17160383delAAGT								CPAMD8 (22755 upstream) : HAUS8 (190 downstream)																							AAAGTAAAtaaagtatgtccactc	0.221													1	5	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45890816	45890816	+	Intron	DEL	A	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45890816delA	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			actccatctcaaaaaaaaaaa	0.154													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49068651	49068651	+	IGR	DEL	A	-	-	rs71190560		TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068651delA								CEBPB (259439 upstream) : PTPN1 (58240 downstream)																							ggaaggaaggaaaggaaggaa	0.060													1	5	---	---	---	---	
CECR7	100130418	broad.mit.edu	37	22	17528433	17528434	+	Intron	INS	-	TT	TT			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17528433_17528434insTT	uc002zlx.1	+							NR_015352				Homo sapiens cDNA FLJ40726 fis, clone TKIDN1000164.												0						ACAGTAGTGGCTTTTTTTTCTG	0.446													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	284417	284427	+	IGR	DEL	GTGTGTGTGTG	-	-			TCGA-C4-A0F1-01	TCGA-C4-A0F1-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:284417_284427delGTGTGTGTGTG								NCRNA00107 (2365 upstream) : PPP2R3B (10545 downstream)																							CAGGGACGTtgtgtgtgtgtgtgtgtgtgtg	0.450													6	3	---	---	---	---	
