Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	979098	979098	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:979098C>T	uc001ack.1	+	9	1834	c.1784C>T	c.(1783-1785)TCA>TTA	p.S595L		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	595	Kazal-like 6.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CACGTGGCCTCAGCTGGACCC	0.701													5	58	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10364264	10364264	+	Intron	SNP	A	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10364264A>G	uc001aqx.3	+						KIF1B_uc001aqv.3_Silent_p.K1007K|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GCCAAGAAAAAGGGGGTAAAG	0.418													3	210	---	---	---	---	PASS
RNF186	54546	broad.mit.edu	37	1	20141324	20141324	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20141324C>T	uc001bcr.2	-	1	448	c.271G>A	c.(271-273)GTC>ATC	p.V91I		NM_019062	NP_061935	Q9NXI6	RN186_HUMAN	ring finger protein 186	91						integral to membrane	zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;7.77e-05)|Kidney(64;0.000162)|GBM - Glioblastoma multiforme(114;0.00036)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCCGGGGACGGCGGTGACC	0.672													18	40	---	---	---	---	PASS
IL28RA	163702	broad.mit.edu	37	1	24483816	24483816	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24483816G>A	uc001bis.2	-	7	1380	c.1367C>T	c.(1366-1368)CCG>CTG	p.P456L	IL28RA_uc001bir.2_Missense_Mutation_p.P427L|IL28RA_uc001bit.2_3'UTR|IL28RA_uc001biu.2_Missense_Mutation_p.P372L	NM_170743	NP_734464	Q8IU57	I28RA_HUMAN	interleukin 28 receptor, alpha isoform 1	456	Cytoplasmic (Potential).				cytokine-mediated signaling pathway|negative regulation of cell proliferation|regulation of defense response to virus by host	interleukin-28 receptor complex	protein binding|receptor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00117)|all_lung(284;0.00151)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.21e-24)|Colorectal(126;6.61e-08)|COAD - Colon adenocarcinoma(152;3.56e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00918)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.185)		ATTCGGCTCCGGTGGTAAGGT	0.587													30	89	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102290786	102290786	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102290786T>A	uc001duf.2	-	4	519	c.448A>T	c.(448-450)ATG>TTG	p.M150L	OLFM3_uc001dug.2_Missense_Mutation_p.M130L|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Missense_Mutation_p.M55L|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	150	Potential.					extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		AGCTCGTCCATTTTCTCTTTC	0.403													4	27	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156534463	156534463	+	Silent	SNP	C	T	T	rs138994698		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156534463C>T	uc001fpf.2	-	5	456	c.381G>A	c.(379-381)ACG>ACA	p.T127T	IQGAP3_uc009wsb.1_Silent_p.T84T	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	127	CH.				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CATAGATGTCCGTGGTCTCTG	0.507													24	133	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157772382	157772382	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157772382A>C	uc001frg.2	-	4	505	c.392T>G	c.(391-393)GTC>GGC	p.V131G	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.V131G|FCRL1_uc001fri.2_Missense_Mutation_p.V131G|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	131	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCAGATGAGGACCAGCCTGTC	0.542													9	33	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179363044	179363044	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179363044G>C	uc001gmo.2	+	10	997	c.870G>C	c.(868-870)AGG>AGC	p.R290S	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Missense_Mutation_p.R78S|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.R290S	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	290											0						GCAGAGAGAGGTATGTGCAAA	0.259													59	177	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277493	186277493	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277493C>T	uc001gru.3	+	7	2693	c.2642C>T	c.(2641-2643)TCT>TTT	p.S881F	PRG4_uc001grt.3_Missense_Mutation_p.S840F|PRG4_uc009wyl.2_Missense_Mutation_p.S788F|PRG4_uc009wym.2_Missense_Mutation_p.S747F|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	881					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCTGAGCTTTCTGCAGAACCC	0.483													32	240	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277798	186277798	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277798C>T	uc001gru.3	+	7	2998	c.2947C>T	c.(2947-2949)CCC>TCC	p.P983S	PRG4_uc001grt.3_Missense_Mutation_p.P942S|PRG4_uc009wyl.2_Missense_Mutation_p.P890S|PRG4_uc009wym.2_Missense_Mutation_p.P849S|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	983					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						TACTCTTGCACCCAAAGTAAC	0.353													35	283	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229779306	229779306	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229779306C>A	uc001hts.1	+	5	3797	c.3661C>A	c.(3661-3663)CAG>AAG	p.Q1221K	URB2_uc009xfd.1_Missense_Mutation_p.Q1221K	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1221						nucleolus				central_nervous_system(2)|ovary(1)	3						TCAGGTCACTCAGGATATTGA	0.448													4	158	---	---	---	---	PASS
PGBD5	79605	broad.mit.edu	37	1	230486821	230486821	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230486821C>T	uc010pwb.1	-	3	570	c.570G>A	c.(568-570)CTG>CTA	p.L190L	PGBD5_uc001htv.2_Silent_p.L289L	NM_024554	NP_078830	Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	190						integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CCTCATCGATCAGGGGTTCAT	0.388													15	76	---	---	---	---	PASS
SLC35F3	148641	broad.mit.edu	37	1	234367397	234367397	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234367397C>T	uc001hwa.1	+	2	539	c.311C>T	c.(310-312)GCC>GTC	p.A104V	SLC35F3_uc001hvy.1_Missense_Mutation_p.A173V	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	104	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			ACGTGGTTTGCCACCAACTGG	0.592													5	278	---	---	---	---	PASS
SLC30A6	55676	broad.mit.edu	37	2	32432000	32432000	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32432000G>C	uc002roe.1	+	12	851	c.814G>C	c.(814-816)GAG>CAG	p.E272Q	SLC30A6_uc002rof.1_Missense_Mutation_p.E312Q|SLC30A6_uc010ymw.1_Missense_Mutation_p.E243Q|SLC30A6_uc010ezr.1_Missense_Mutation_p.E272Q|SLC30A6_uc002rog.1_Missense_Mutation_p.E75Q|SLC30A6_uc010ezs.1_Missense_Mutation_p.E198Q|SLC30A6_uc002roh.1_Missense_Mutation_p.E75Q	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),	272	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ACTCATCAGAGAGGTAAGATG	0.313													31	123	---	---	---	---	PASS
MIR558	693143	broad.mit.edu	37	2	32757248	32757248	+	RNA	SNP	G	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32757248G>T	hsa-mir-558|MI0003564	+			c.29G>T			BIRC6_uc010ezu.2_Intron																	0						gGTTATTTTGGTATAGTAGCT	0.134													20	49	---	---	---	---	PASS
CDKL4	344387	broad.mit.edu	37	2	39417530	39417530	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39417530C>A	uc002rrm.2	-	5	568	c.568G>T	c.(568-570)GTT>TTT	p.V190F	CDKL4_uc010fal.1_Missense_Mutation_p.V190F	NM_001009565	NP_001009565	Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	190	Protein kinase.					cytoplasm	ATP binding|cyclin-dependent protein kinase activity			ovary(1)	1		all_hematologic(82;0.248)				TCTGCAAAAACACAACCAATA	0.443													7	143	---	---	---	---	PASS
C2orf49	79074	broad.mit.edu	37	2	105954074	105954074	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105954074C>T	uc002tcs.1	+	1	62	c.30C>T	c.(28-30)TGC>TGT	p.C10C	C2orf49_uc010fjd.1_Silent_p.C10C	NM_024093	NP_076998	Q9BVC5	ASHWN_HUMAN	ashwin	10						tRNA-splicing ligase complex					0						GTCGCAGCTGCACGGACTCGG	0.677													12	20	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109347309	109347309	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109347309G>A	uc002tem.3	+	3	346	c.220G>A	c.(220-222)GAA>AAA	p.E74K		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	74	TPR.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TGAATTGGAAGAAAACACAGA	0.348													122	235	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152586147	152586147	+	Silent	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152586147G>A	uc010fnx.2	-	4	251	c.60C>T	c.(58-60)TAC>TAT	p.Y20Y		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	20					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCACCTCTTCGTAAACCACTT	0.493													54	111	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179612941	179612941	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179612941T>C	uc002unb.2	-	46	14410	c.14186A>G	c.(14185-14187)TAT>TGT	p.Y4729C	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATTCACTATAGATTTCTTC	0.348													54	64	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225637916	225637916	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225637916C>G	uc010fwz.1	-	53	6401	c.6162G>C	c.(6160-6162)ATG>ATC	p.M2054I	DOCK10_uc002vob.2_Missense_Mutation_p.M2048I|DOCK10_uc002voa.2_Missense_Mutation_p.M710I	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2054	DHR-2.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCAGTCTGATCATGTCCACTT	0.458													11	22	---	---	---	---	PASS
OSBPL10	114884	broad.mit.edu	37	3	31725292	31725292	+	Silent	SNP	A	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31725292A>G	uc003cev.2	-	9	1941	c.1560T>C	c.(1558-1560)CCT>CCC	p.P520P	OSBPL10_uc003ceu.1_Silent_p.P277P|OSBPL10_uc011axf.1_Silent_p.P456P	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	520					lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		AGCTTTTGGAAGGGTCATCGG	0.547													3	107	---	---	---	---	PASS
TGM4	7047	broad.mit.edu	37	3	44951664	44951664	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44951664G>C	uc003coc.3	+	11	1483	c.1410G>C	c.(1408-1410)GAG>GAC	p.E470D		NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	470					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	CTGTAAAAGAGAACTTTCTTC	0.478													55	35	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49160390	49160390	+	Silent	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49160390G>C	uc003cwe.2	-	27	4619	c.4320C>G	c.(4318-4320)CTC>CTG	p.L1440L	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1440	Domain alpha.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CATTGCAGCTGAGGCCCCCAC	0.682													9	8	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49161416	49161416	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49161416G>A	uc003cwe.2	-	24	3841	c.3542C>T	c.(3541-3543)TCA>TTA	p.S1181L		NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1181	Laminin EGF-like 13.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AAAGATTCCTGAGAAGCCACG	0.617													13	9	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119428733	119428733	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119428733C>T	uc010hqx.1	+	5	568	c.491C>T	c.(490-492)GCC>GTC	p.A164V	C3orf15_uc003edc.2_Missense_Mutation_p.A164V|C3orf15_uc010hqy.1_Missense_Mutation_p.A164V|C3orf15_uc003ede.3_Missense_Mutation_p.A164V|C3orf15_uc010hqz.2_Missense_Mutation_p.A102V|C3orf15_uc011bjd.1_Missense_Mutation_p.A38V|C3orf15_uc011bje.1_Missense_Mutation_p.A144V|C3orf15_uc010hra.1_5'UTR			Q7Z4T9	AAT1_HUMAN	RecName: Full=AMY-1-associating protein expressed in testis 1;          Short=AAT-1;	164						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		GTTGTTTATGCCGTATCCAAG	0.254													4	149	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140407216	140407216	+	Silent	SNP	C	T	T	rs149309664		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140407216C>T	uc003eto.1	+	3	1883	c.1692C>T	c.(1690-1692)CCC>CCT	p.P564P		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	564						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						CAGCCACCCCCGCCAAACCCA	0.567													6	61	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197665535	197665535	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197665535G>C	uc003fyo.2	-	4	545	c.399C>G	c.(397-399)ATC>ATG	p.I133M	IQCG_uc003fyn.2_Missense_Mutation_p.I35M|IQCG_uc003fyp.2_Missense_Mutation_p.I133M|IQCG_uc003fyq.3_Missense_Mutation_p.I133M	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	133											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CTCTGTGTCTGATTTCTGGCA	0.438													26	543	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56831889	56831889	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56831889C>G	uc003hbi.2	+	8	1142	c.908C>G	c.(907-909)TCT>TGT	p.S303C	CEP135_uc003hbj.2_Missense_Mutation_p.S9C|CEP135_uc010igz.1_Missense_Mutation_p.S133C	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	303	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					ACAGTGACATCTGAAGTCGTT	0.353													20	52	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66189876	66189876	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66189876G>A	uc003hcy.2	-	18	3263	c.3070C>T	c.(3070-3072)CAA>TAA	p.Q1024*	EPHA5_uc003hcx.2_Nonsense_Mutation_p.Q956*|EPHA5_uc003hcz.2_Nonsense_Mutation_p.Q1002*|EPHA5_uc011cah.1_Nonsense_Mutation_p.Q1025*|EPHA5_uc011cai.1_Nonsense_Mutation_p.Q1003*	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	1024	Cytoplasmic (Potential).|SAM.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TTCATTTCTTGAAGGCTGTTC	0.423										TSP Lung(17;0.13)			9	91	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146059410	146059410	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146059410C>T	uc003ika.3	-	21	2460	c.2322G>A	c.(2320-2322)CAG>CAA	p.Q774Q	OTUD4_uc003ijz.3_Silent_p.Q773Q	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	838							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					CAAAAGATGGCTGGGGGAACA	0.458													24	73	---	---	---	---	PASS
GALNTL6	442117	broad.mit.edu	37	4	172735776	172735776	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172735776C>G	uc003isv.2	+	2	781	c.45C>G	c.(43-45)TTC>TTG	p.F15L		NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6	15	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						CTTTGTTGTTCACGGTGGCTT	0.473													23	64	---	---	---	---	PASS
GLRA3	8001	broad.mit.edu	37	4	175564951	175564951	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175564951G>C	uc003ity.1	-	10	1884	c.1381C>G	c.(1381-1383)CAG>GAG	p.Q461E	GLRA3_uc003itz.1_Missense_Mutation_p.Q446E	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	461					synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	TCTTGCTGCTGATGAATATCC	0.398													42	194	---	---	---	---	PASS
IRF2	3660	broad.mit.edu	37	4	185310135	185310135	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185310135C>T	uc003iwf.3	-	9	1027	c.827G>A	c.(826-828)GGC>GAC	p.G276D		NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2	276					blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		GGACGCCATGCCGGGCAGCAG	0.552													4	228	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187629360	187629360	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187629360G>C	uc003izf.2	-	2	1810	c.1622C>G	c.(1621-1623)TCA>TGA	p.S541*	FAT1_uc010iso.1_Nonsense_Mutation_p.S541*	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	541	Extracellular (Potential).|Cadherin 4.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GCCCCAGTCTGATGCACGAAT	0.468										HNSCC(5;0.00058)			36	64	---	---	---	---	PASS
MARCH11	441061	broad.mit.edu	37	5	16067780	16067780	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16067780C>G	uc003jfo.2	-	4	1222	c.1009G>C	c.(1009-1011)GAG>CAG	p.E337Q	MARCH11_uc010itw.1_Missense_Mutation_p.E93Q	NM_001102562	NP_001096032	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	337						cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0						GTGGAAGACTCTCCCCGGCTG	0.483													15	55	---	---	---	---	PASS
COL4A3BP	10087	broad.mit.edu	37	5	74677813	74677813	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74677813C>T	uc011csu.1	-	15	2000	c.1578G>A	c.(1576-1578)TGG>TGA	p.W526*	COL4A3BP_uc003kds.2_Nonsense_Mutation_p.W500*|COL4A3BP_uc003kdt.2_Nonsense_Mutation_p.W654*|COL4A3BP_uc003kdu.2_Nonsense_Mutation_p.W526*	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform	526	START.				ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TACAAACTATCCAAGTTTCAG	0.383													9	49	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79030326	79030326	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79030326C>A	uc003kgc.2	+	2	5810	c.5738C>A	c.(5737-5739)TCT>TAT	p.S1913Y		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1913						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATAGCAGGATCTGTGCAGCTG	0.463													3	59	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90074397	90074397	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90074397G>C	uc003kju.2	+	63	12916	c.12820G>C	c.(12820-12822)GAG>CAG	p.E4274Q	GPR98_uc003kjt.2_Missense_Mutation_p.E1980Q|GPR98_uc003kjw.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4274	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTTTTCACATGAGCAACTTCG	0.418													15	29	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118866973	118866973	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118866973C>T	uc003ksj.2	+	22	1990	c.1867C>T	c.(1867-1869)CAG>TAG	p.Q623*	HSD17B4_uc011cwg.1_Nonsense_Mutation_p.Q599*|HSD17B4_uc011cwh.1_Nonsense_Mutation_p.Q605*|HSD17B4_uc011cwi.1_Nonsense_Mutation_p.Q648*|HSD17B4_uc003ksk.3_Nonsense_Mutation_p.Q476*|HSD17B4_uc011cwj.1_Nonsense_Mutation_p.Q476*|HSD17B4_uc010jcn.1_Nonsense_Mutation_p.Q361*|HSD17B4_uc010jco.1_Intron	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	623					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	CGGGAAGCTTCAGAGTACCTT	0.363													33	80	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140228212	140228212	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140228212C>T	uc003lhu.2	+	1	856	c.132C>T	c.(130-132)TTC>TTT	p.F44F	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.F44F	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	44	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGCACCTTCGTGGGCCGCA	0.657													36	86	---	---	---	---	PASS
SERPINB6	5269	broad.mit.edu	37	6	2955781	2955781	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2955781C>T	uc003muk.2	-	2	2284	c.289G>A	c.(289-291)GAA>AAA	p.E97K	SERPINB6_uc003mui.2_5'UTR|SERPINB6_uc003muj.2_RNA|SERPINB6_uc003mul.2_Missense_Mutation_p.E97K|SERPINB6_uc003mum.2_Missense_Mutation_p.E97K|SERPINB6_uc003mun.2_Missense_Mutation_p.E97K|SERPINB6_uc003muo.2_Missense_Mutation_p.E97K	NM_004568	NP_004559	P35237	SPB6_HUMAN	serine (or cysteine) proteinase inhibitor, clade	97					regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	CAAGACTTTTCCCCAAAGAGC	0.517													30	124	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682355	47682355	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682355C>G	uc003oza.1	+	6	1632	c.1374C>G	c.(1372-1374)ATC>ATG	p.I458M	GPR115_uc003oyz.1_Missense_Mutation_p.I515M|GPR115_uc003ozb.1_Missense_Mutation_p.I456M	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	458	Helical; Name=2; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						TGTGGTTTATCATAGGCTCTC	0.463													8	462	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56458919	56458919	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56458919C>G	uc003pdf.2	-	42	5939	c.5911G>C	c.(5911-5913)GAG>CAG	p.E1971Q	DST_uc003pcz.3_Missense_Mutation_p.E1793Q|DST_uc011dxj.1_Missense_Mutation_p.E1822Q|DST_uc011dxk.1_Missense_Mutation_p.E1833Q|DST_uc003pcy.3_Missense_Mutation_p.E1467Q|DST_uc010kaa.1_RNA	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	3879					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCTGTTTCTCAAGCAACACT	0.423													41	181	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87795485	87795485	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87795485G>C	uc003plj.1	-	4	441	c.340C>G	c.(340-342)CAC>GAC	p.H114D		NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	114					hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		TAAGATTTGTGATAATAACAA	0.368													6	51	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109770936	109770936	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109770936C>T	uc003ptj.2	-	9	1612	c.1358G>A	c.(1357-1359)CGC>CAC	p.R453H	MICAL1_uc003ptk.2_Missense_Mutation_p.R453H|MICAL1_uc010kdr.2_Missense_Mutation_p.R367H|MICAL1_uc011eaq.1_Missense_Mutation_p.R472H	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	453				R -> C (in Ref. 6; AAH52983).	cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GGCCACATTGCGATGCATGTT	0.617													4	112	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42004984	42004984	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42004984C>G	uc011kbh.1	-	15	3778	c.3687G>C	c.(3685-3687)TTG>TTC	p.L1229F	GLI3_uc011kbg.1_Missense_Mutation_p.L1170F	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1229					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						TGTGGAGCATCAAGTGCTCTG	0.627									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				18	60	---	---	---	---	PASS
DNAJC30	84277	broad.mit.edu	37	7	73097115	73097115	+	Silent	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73097115G>A	uc003tys.1	-	1	667	c.639C>T	c.(637-639)TTC>TTT	p.F213F	WBSCR22_uc010lbi.1_5'Flank|WBSCR22_uc003tyt.2_5'Flank|WBSCR22_uc003tyu.2_5'Flank|WBSCR22_uc003tyv.2_5'Flank|WBSCR22_uc003tyw.1_5'Flank	NM_032317	NP_115693	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog subfamily C member 30	213					protein folding		heat shock protein binding|unfolded protein binding				0						AAAAGATGAGGAAAATGGCAG	0.562													4	93	---	---	---	---	PASS
CBLL1	79872	broad.mit.edu	37	7	107393876	107393876	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107393876G>C	uc003veq.2	+	3	532	c.202G>C	c.(202-204)GAA>CAA	p.E68Q	CBLL1_uc011kme.1_5'UTR|CBLL1_uc011kmf.1_Missense_Mutation_p.E67Q	NM_024814	NP_079090	Q75N03	HAKAI_HUMAN	Cas-Br-M (murine) ecotropic retroviral	68					cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|skin(2)|lung(1)	5						TTATAATGAAGAAGAACGGTA	0.328													20	63	---	---	---	---	PASS
LEP	3952	broad.mit.edu	37	7	127892098	127892098	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127892098C>A	uc003vml.2	+	2	84	c.27C>A	c.(25-27)TTC>TTA	p.F9L	LEP_uc003vmm.2_Missense_Mutation_p.F9L	NM_000230	NP_000221	P41159	LEP_HUMAN	leptin precursor	9					adult feeding behavior|energy reserve metabolic process|negative regulation of appetite|placenta development|positive regulation of developmental growth	extracellular space					0						TGTGCGGATTCTTGTGGCTTT	0.493													5	209	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143039071	143039071	+	Silent	SNP	G	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143039071G>T	uc003wcr.1	+	15	1719	c.1632G>T	c.(1630-1632)GTG>GTT	p.V544V	CLCN1_uc011ktc.1_Silent_p.V156V	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	544					muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CCACAGCTGTGATTTGCTTCG	0.537													28	55	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9563734	9563734	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9563734C>T	uc003wss.2	+	7	1245	c.1240C>T	c.(1240-1242)CAT>TAT	p.H414Y	TNKS_uc011kwv.1_Missense_Mutation_p.H414Y|TNKS_uc011kww.1_Missense_Mutation_p.H177Y	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	414	ANK 5.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TTCATATGGACATTATGAAGT	0.303													54	78	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72936146	72936146	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72936146G>A	uc003xza.2	-	26	3227	c.3052C>T	c.(3052-3054)CAT>TAT	p.H1018Y	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	1018	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	CAGAATATATGCTGTCGGATA	0.284													34	75	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107550317	107550317	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107550317G>A	uc004bcl.2	-	46	6401	c.6088C>T	c.(6088-6090)CGG>TGG	p.R2030W	NIPSNAP3B_uc004bcj.1_RNA	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	2030	ABC transporter 2.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCCAGTTTCCGAATCGCCCAC	0.468													49	98	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134353258	134353258	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134353258G>A	uc004can.3	+	16	4589	c.4534G>A	c.(4534-4536)GAG>AAG	p.E1512K	BAT2L1_uc004cao.3_Missense_Mutation_p.E870K	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1512							protein binding				0						TAAAAAGGCAGAGAAGGAGGC	0.562													25	30	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30318699	30318699	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30318699C>G	uc001iux.2	-	2	437	c.378G>C	c.(376-378)CAG>CAC	p.Q126H	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_5'UTR|KIAA1462_uc009xle.1_Missense_Mutation_p.Q126H	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	126										ovary(4)	4						CCCTCGGCTTCTGGCTCCTGG	0.597													4	227	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37508313	37508313	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37508313A>T	uc001iza.1	+	34	3604	c.3505A>T	c.(3505-3507)ATT>TTT	p.I1169F		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1225						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TGCTTTCCACATTGCAGGAGA	0.398													30	57	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55581697	55581697	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55581697G>C	uc001jju.1	-	33	6184	c.5789C>G	c.(5788-5790)TCT>TGT	p.S1930C	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Missense_Mutation_p.S784C|PCDH15_uc010qhv.1_Missense_Mutation_p.S1927C|PCDH15_uc010qhw.1_Missense_Mutation_p.S1890C|PCDH15_uc010qhx.1_Missense_Mutation_p.S1861C|PCDH15_uc010qhy.1_Missense_Mutation_p.S1937C|PCDH15_uc010qhz.1_Missense_Mutation_p.S1932C|PCDH15_uc010qia.1_Missense_Mutation_p.S1910C|PCDH15_uc010qib.1_Missense_Mutation_p.S1907C	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1930	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GTTTTGTTCAGATGTGATTTC	0.338										HNSCC(58;0.16)			7	184	---	---	---	---	PASS
ADK	132	broad.mit.edu	37	10	76430010	76430010	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76430010G>C	uc001jwi.2	+	10	1019	c.947G>C	c.(946-948)GGA>GCA	p.G316A	ADK_uc010qlb.1_Missense_Mutation_p.G259A|ADK_uc001jwj.2_Missense_Mutation_p.G299A|ADK_uc010qlc.1_Missense_Mutation_p.G281A|ADK_uc001jwl.2_Missense_Mutation_p.G86A	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b	316					purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	AATGGAGCTGGAGATGCATTT	0.343													4	86	---	---	---	---	PASS
DUSP13	51207	broad.mit.edu	37	10	76855494	76855494	+	3'UTR	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76855494G>A	uc001jws.2	-	7					DUSP13_uc001jwr.2_Missense_Mutation_p.A78V|DUSP13_uc001jwu.2_Missense_Mutation_p.A171V|DUSP13_uc001jww.2_Missense_Mutation_p.A128V|DUSP13_uc009xrs.2_Missense_Mutation_p.A171V|DUSP13_uc001jwt.2_Missense_Mutation_p.A171V|DUSP13_uc001jwv.2_Missense_Mutation_p.A78V	NM_001007271	NP_001007272	Q6B8I1	MDSP_HUMAN	muscle-restricted dual specificity phosphatase							cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCCTGCAGCGGCATTCACAAC	0.577													4	201	---	---	---	---	PASS
CNNM1	26507	broad.mit.edu	37	10	101090617	101090617	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101090617C>T	uc001kpp.3	+	1	1762	c.1473C>T	c.(1471-1473)GAC>GAT	p.D491D	CNNM1_uc009xwe.2_Silent_p.D491D|CNNM1_uc010qpi.1_Silent_p.D491D|CNNM1_uc009xwf.2_Silent_p.D491D	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1	491	CBS 1.				ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		ACCCCGACGACTGCACCCCGC	0.562													20	47	---	---	---	---	PASS
PAOX	196743	broad.mit.edu	37	10	135195106	135195106	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135195106G>C	uc001lmv.2	+	3	891	c.811G>C	c.(811-813)GAG>CAG	p.E271Q	PAOX_uc001lmw.2_RNA|PAOX_uc001lmx.2_Missense_Mutation_p.E271Q|PAOX_uc001lmy.2_Missense_Mutation_p.E271Q|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	409					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		AGTGTCGGTAGAGTGTGAGGA	0.587													17	40	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17426064	17426064	+	Silent	SNP	C	T	T	rs144207158		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17426064C>T	uc001mnc.2	-	28	3678	c.3552G>A	c.(3550-3552)GCG>GCA	p.A1184A		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	1184	ABC transmembrane type-1 2.|Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	ATCACCTGGACGCCACCCGGA	0.562													6	96	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47840977	47840977	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47840977C>A	uc001ngm.2	-	10	1396	c.1311G>T	c.(1309-1311)ATG>ATT	p.M437I	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	437					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						GCAGAGGCTGCATAAAAACTG	0.378													4	240	---	---	---	---	PASS
OR4A5	81318	broad.mit.edu	37	11	51411565	51411565	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411565G>C	uc001nhi.1	-	1	831	c.831C>G	c.(829-831)CAC>CAG	p.H277Q		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	277	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				GACTCAGCATGTGTGTGATAA	0.313													3	63	---	---	---	---	PASS
SYT7	9066	broad.mit.edu	37	11	61291945	61291945	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61291945G>A	uc001nrv.2	-	6	688	c.682C>T	c.(682-684)CGC>TGC	p.R228C	SYT7_uc009ynr.2_Missense_Mutation_p.R303C	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	228	C2 1.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						CGGCTGAAGCGGTCATAGTCC	0.557													19	43	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65266070	65266070	+	RNA	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65266070C>T	uc010roh.1	+	1		c.838C>T				NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TGCCACTTCTCAACCGTCCCT	0.483													13	73	---	---	---	---	PASS
PPP2R1B	5519	broad.mit.edu	37	11	111635535	111635535	+	Silent	SNP	A	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111635535A>G	uc001plx.1	-	3	384	c.300T>C	c.(298-300)TGT>TGC	p.C100C	PPP2R1B_uc001plw.1_Silent_p.C100C|PPP2R1B_uc010rwi.1_Intron|PPP2R1B_uc010rwj.1_5'UTR|PPP2R1B_uc010rwk.1_Silent_p.C100C|PPP2R1B_uc010rwl.1_Silent_p.C100C	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	100	HEAT 3.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TCACCAGCAGACAGTGGGCAA	0.418													14	9	---	---	---	---	PASS
C11orf52	91894	broad.mit.edu	37	11	111795061	111795061	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111795061C>G	uc001pmh.2	+	3	527	c.44C>G	c.(43-45)TCA>TGA	p.S15*	C11orf52_uc001pmi.2_Nonsense_Mutation_p.S15*	NM_080659	NP_542390	Q96A22	CK052_HUMAN	hypothetical protein LOC91894	15										ovary(1)	1		all_cancers(61;8.8e-15)|all_epithelial(67;6.27e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.63e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.7e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		AGCTGCCCATCAACTTTCCAG	0.468													37	81	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43945017	43945017	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43945017C>T	uc010skx.1	-	2	148	c.148G>A	c.(148-150)GAG>AAG	p.E50K		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	50						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTCCAAACTCATTGACCCGC	0.592													8	42	---	---	---	---	PASS
TUBA1C	84790	broad.mit.edu	37	12	49666957	49666957	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49666957G>C	uc001rtt.1	+	4	1397	c.1297G>C	c.(1297-1299)GAG>CAG	p.E433Q	TUBA1C_uc001rts.2_Missense_Mutation_p.E398Q|TUBA1C_uc010smh.1_Missense_Mutation_p.E503Q|uc010smi.1_5'UTR	NM_032704	NP_116093	Q9BQE3	TBA1C_HUMAN	tubulin alpha 6	433					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0						GAAGGATTATGAGGAGGTTGG	0.507													6	148	---	---	---	---	PASS
AQP2	359	broad.mit.edu	37	12	50347951	50347951	+	Missense_Mutation	SNP	C	T	T	rs104894333		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50347951C>T	uc001rvn.2	+	2	464	c.374C>T	c.(373-375)ACG>ATG	p.T125M	AQP2_uc009zll.1_5'Flank	NM_000486	NP_000477	P41181	AQP2_HUMAN	aquaporin 2	125	Extracellular (Potential).		T -> M (in ANDI).		cellular response to copper ion|cellular response to mercury ion|excretion	apical plasma membrane|integral to membrane|transport vesicle membrane	glycerol transmembrane transporter activity|water channel activity			ovary(2)	2						AGCAACAGCACGACGGCTGGC	0.637													20	80	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51887508	51887508	+	Silent	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51887508C>G	uc001rys.1	+	20	2899	c.2721C>G	c.(2719-2721)CTC>CTG	p.L907L	SLC4A8_uc001rym.2_Silent_p.L854L|SLC4A8_uc001ryn.2_Silent_p.L854L|SLC4A8_uc001ryo.2_Silent_p.L854L|SLC4A8_uc010snj.1_Silent_p.L934L|SLC4A8_uc001ryr.2_Silent_p.L907L	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	907	Helical; (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		TGCCAGTACTCTACGGAGTTT	0.383													5	240	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56637832	56637832	+	Intron	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56637832C>G	uc001skm.3	-							NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						CCCAGGCACTCACATCTGCAG	0.577													19	33	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100649885	100649885	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100649885G>C	uc001thi.2	-	4	823	c.820C>G	c.(820-822)CTT>GTT	p.L274V	DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.L220V|DEPDC4_uc009ztv.1_Missense_Mutation_p.L274V|DEPDC4_uc001thk.1_Missense_Mutation_p.L85V|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	274					intracellular signal transduction						0						GTGATAACAAGATCTTCCTCT	0.323													30	127	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120650348	120650348	+	Silent	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120650348G>A	uc001txt.2	-	12	1676	c.1545C>T	c.(1543-1545)TTC>TTT	p.F515F	uc001txs.1_RNA|PXN_uc001txu.2_Silent_p.F327F|PXN_uc001txv.2_Silent_p.F396F|PXN_uc001txx.2_Silent_p.F348F|PXN_uc001txy.2_Silent_p.F481F|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	515	LIM zinc-binding 3.				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTCGTGCTCGAAGAAGCTGC	0.657													7	44	---	---	---	---	PASS
B3GNT4	79369	broad.mit.edu	37	12	122690993	122690993	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122690993C>T	uc001ubx.2	+	3	413	c.195C>T	c.(193-195)TTC>TTT	p.F65F	B3GNT4_uc001uby.2_Silent_p.F40F	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	65	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		ACCAGCCTTTCTGGGCTCCCC	0.647													10	173	---	---	---	---	PASS
B3GNT4	79369	broad.mit.edu	37	12	122691461	122691461	+	Silent	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122691461C>A	uc001ubx.2	+	3	881	c.663C>A	c.(661-663)GTC>GTA	p.V221V	B3GNT4_uc001uby.2_Silent_p.V196V	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	221	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		ATGACGATGTCTTTGTCCACG	0.602													6	107	---	---	---	---	PASS
DIABLO	56616	broad.mit.edu	37	12	122693005	122693005	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122693005C>T	uc010tab.1	-	7	1448	c.643G>A	c.(643-645)GAG>AAG	p.E215K	DIABLO_uc010taa.1_Missense_Mutation_p.E162K|DIABLO_uc010tac.1_RNA|DIABLO_uc010tad.1_Missense_Mutation_p.E171K|VPS33A_uc001ucc.2_RNA	NM_019887	NP_063940	Q9NR28	DBLOH_HUMAN	diablo isoform 1 precursor	215					activation of caspase activity by cytochrome c|induction of apoptosis via death domain receptors	CD40 receptor complex|cytosol|internal side of plasma membrane|mitochondrial intermembrane space	protein binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		TGACGGAGCTCTTCTATCTGT	0.582													7	108	---	---	---	---	PASS
PHF11	51131	broad.mit.edu	37	13	50098334	50098334	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50098334G>C	uc001vdb.2	+	8	1088	c.751G>C	c.(751-753)GAG>CAG	p.E251Q	PHF11_uc001vdc.2_Missense_Mutation_p.E212Q|PHF11_uc001vdd.2_RNA	NM_001040443	NP_001035533	Q9UIL8	PHF11_HUMAN	PHD finger protein 11 isoform a	251					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		ACTCATGGATGAGACTACTTC	0.323													5	94	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88328010	88328010	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88328010G>A	uc001vln.2	+	2	586	c.367G>A	c.(367-369)GGG>AGG	p.G123R	SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	123	LRR 2.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CATTGAGACCGGGGCTTTCCA	0.453													54	130	---	---	---	---	PASS
ZNF828	283489	broad.mit.edu	37	13	115090342	115090342	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115090342C>G	uc010ahb.2	+	3	1354	c.1025C>G	c.(1024-1026)TCT>TGT	p.S342C	ZNF828_uc001vuv.2_Missense_Mutation_p.S342C|ZNF828_uc010tko.1_Missense_Mutation_p.S342C	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828	342	Mediates interaction with MAD2L2.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		CCTGCTCCATCTGTGTCTCCT	0.517													6	113	---	---	---	---	PASS
OR4K17	390436	broad.mit.edu	37	14	20585888	20585888	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20585888C>T	uc001vwo.1	+	1	323	c.323C>T	c.(322-324)GCC>GTC	p.A108V		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	80	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GCTTCTTTTGCCACCCCTAAG	0.398													5	472	---	---	---	---	PASS
RPL36AL	6166	broad.mit.edu	37	14	50085719	50085719	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50085719G>A	uc001wwq.1	-	2	210	c.104C>T	c.(103-105)GCC>GTC	p.A35V	SDCCAG1_uc010anj.1_Intron|MGAT2_uc001wwr.2_5'Flank	NM_001001	NP_000992	Q969Q0	RL36L_HUMAN	ribosomal protein L36a-like protein	35					translation	ribosome	structural constituent of ribosome				0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CCTTCCCTGGGCATACAAAGA	0.478													4	170	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51224567	51224567	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51224567C>T	uc001wym.2	-	18	3372	c.3181G>A	c.(3181-3183)GAA>AAA	p.E1061K	NIN_uc001wyi.2_Missense_Mutation_p.E1061K|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Missense_Mutation_p.E1067K|NIN_uc001wyo.2_Missense_Mutation_p.E1061K	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1061					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CCATTTTCTTCCAACAGCTGC	0.502			T	PDGFRB	MPD								8	286	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68265155	68265155	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68265155C>T	uc001xka.2	-	11	1963	c.1824G>A	c.(1822-1824)AAG>AAA	p.K608K	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Silent_p.K608K|ZFYVE26_uc010tta.1_Silent_p.K608K	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	608					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CTGAGGGGCTCTTCCCCTCAA	0.527													37	58	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50546436	50546436	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50546436G>C	uc001zxz.2	-	6	717	c.611C>G	c.(610-612)TCC>TGC	p.S204C	HDC_uc001zxy.2_5'Flank|HDC_uc010uff.1_Missense_Mutation_p.S204C|HDC_uc010bet.1_Missense_Mutation_p.S125C|HDC_uc010beu.1_Missense_Mutation_p.S204C	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	204					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CTTCACAAGGGAAATCAAACC	0.517													12	49	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56207553	56207553	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56207553C>G	uc002adj.2	-	1	1777	c.1477G>C	c.(1477-1479)GAA>CAA	p.E493Q	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Missense_Mutation_p.E493Q|NEDD4_uc010ugj.1_Missense_Mutation_p.E493Q|NEDD4_uc010bfm.2_Missense_Mutation_p.E493Q|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	493					development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		ACTTTACCTTCATTTCCAGAT	0.383													3	196	---	---	---	---	PASS
LIPC	3990	broad.mit.edu	37	15	58830668	58830668	+	Silent	SNP	C	T	T	rs146362585	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58830668C>T	uc010bga.1	+	4	833	c.225C>T	c.(223-225)TGC>TGT	p.C75C	LIPC_uc010bfz.1_Silent_p.C75C|LIPC_uc002afa.1_Silent_p.C75C|LIPC_uc010bgb.1_Intron|LIPC_uc010ugy.1_Silent_p.C75C	NM_000236	NP_000227	P11150	LIPC_HUMAN	lipase C precursor	75					cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TACAGGAGTGCGGCTTCAACT	0.473													4	172	---	---	---	---	PASS
IQCH	64799	broad.mit.edu	37	15	67709351	67709351	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67709351C>T	uc002aqo.1	+	15	2227	c.2180C>T	c.(2179-2181)CCG>CTG	p.P727L	IQCH_uc002aqq.1_Missense_Mutation_p.P384L|IQCH_uc002aqp.1_Missense_Mutation_p.P388L|uc002aqr.1_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	727										skin(3)|ovary(1)	4				Colorectal(3;0.0856)		AAACGGTTCCCGACGTGGAGG	0.438													3	81	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4936024	4936024	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4936024C>G	uc002cyd.1	-	22	2722	c.2632G>C	c.(2632-2634)GAG>CAG	p.E878Q		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	878					keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TGCAGGGTCTCATGGGTCACT	0.572													38	83	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20996705	20996705	+	Silent	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996705G>A	uc010vbe.1	-	48	7359	c.7359C>T	c.(7357-7359)TAC>TAT	p.Y2453Y	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2453	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GGTATAGCTCGTATGCGTTCA	0.552													17	31	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22343428	22343428	+	Silent	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22343428C>G	uc002dkk.2	+	20	2148	c.1992C>G	c.(1990-1992)CGC>CGG	p.R664R	POLR3E_uc002dkm.2_Silent_p.R628R|POLR3E_uc010vbr.1_Intron|POLR3E_uc002dkl.2_Intron|POLR3E_uc010vbs.1_Silent_p.R628R|POLR3E_uc010vbt.1_Silent_p.R608R	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	664					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		ACCGGGTACGCCGAAACATGA	0.393													48	85	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28842280	28842280	+	Intron	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28842280C>A	uc002drc.2	+						uc010vct.1_Intron|ATXN2L_uc010byl.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Intron|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_Intron	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A							membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AAAAACCAAACAGGCCCTTCC	0.493													4	27	---	---	---	---	PASS
PHKG2	5261	broad.mit.edu	37	16	30768370	30768370	+	Silent	SNP	A	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30768370A>C	uc002dzk.1	+	10	1266	c.1173A>C	c.(1171-1173)GGA>GGC	p.G391G	PHKG2_uc002dzi.1_Silent_p.G395G|PHKG2_uc002dzj.1_Silent_p.G289G	NM_000294	NP_000285	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	391					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			ovary(1)	1			Colorectal(24;0.198)			AAGAGGAGGGAGACTCTGCTG	0.592													12	146	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31382737	31382737	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31382737C>T	uc002ebu.1	+	16	1991	c.1924C>T	c.(1924-1926)CAG>TAG	p.Q642*	ITGAX_uc002ebt.2_Nonsense_Mutation_p.Q642*	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	642	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTGTCGGGAGCAGGTGGTCTC	0.587													25	41	---	---	---	---	PASS
CDT1	81620	broad.mit.edu	37	16	88873552	88873552	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88873552A>C	uc002flu.2	+	8	1270	c.1216A>C	c.(1216-1218)ACC>CCC	p.T406P		NM_030928	NP_112190	Q9H211	CDT1_HUMAN	chromatin licensing and DNA replication factor	406					DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of DNA-dependent DNA replication initiation|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CCCACCAGCCACCCCGCCTGC	0.697													5	8	---	---	---	---	PASS
RNMTL1	55178	broad.mit.edu	37	17	686413	686413	+	Silent	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:686413C>G	uc002frw.2	+	2	511	c.405C>G	c.(403-405)CTC>CTG	p.L135L	GLOD4_uc002fru.2_5'Flank|GLOD4_uc010vqc.1_5'Flank|GLOD4_uc002frv.2_5'Flank	NM_018146	NP_060616	Q9HC36	RMTL1_HUMAN	RNA methyltransferase like 1	135					RNA processing		protein binding|RNA binding|RNA methyltransferase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		CAGACGCTCTCAAGGCTGGAG	0.468													23	71	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5485360	5485360	+	Silent	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5485360G>A	uc002gci.2	-	3	1026	c.471C>T	c.(469-471)TAC>TAT	p.Y157Y	NLRP1_uc002gcg.1_Silent_p.Y157Y|NLRP1_uc002gck.2_Silent_p.Y157Y|NLRP1_uc002gcj.2_Silent_p.Y157Y|NLRP1_uc002gcl.2_Silent_p.Y157Y|NLRP1_uc002gch.3_Silent_p.Y157Y|NLRP1_uc010clh.2_Silent_p.Y157Y	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	157					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				GAAGAGCTTGGTAGAGGAGTG	0.443													13	24	---	---	---	---	PASS
RFFL	117584	broad.mit.edu	37	17	33348478	33348478	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33348478C>A	uc002hin.1	-	3	676	c.503G>T	c.(502-504)AGC>ATC	p.S168I	RFFL_uc002hiq.2_Intron|RFFL_uc002him.1_Missense_Mutation_p.S168I|RFFL_uc010cti.1_Missense_Mutation_p.S174I|RFFL_uc002hip.1_Missense_Mutation_p.S168I|RFFL_uc002hio.1_Missense_Mutation_p.S168I	NM_001017368	NP_001017368	Q8WZ73	RFFL_HUMAN	rififylin	168					apoptosis	membrane	ligase activity|zinc ion binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TGGAACCATGCTGGAGTGAGG	0.602													15	32	---	---	---	---	PASS
MLLT6	4302	broad.mit.edu	37	17	36872024	36872024	+	Missense_Mutation	SNP	G	A	A	rs146278240	byFrequency	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36872024G>A	uc002hqi.3	+	9	992	c.979G>A	c.(979-981)GCC>ACC	p.A327T	MLLT6_uc010cvm.1_Missense_Mutation_p.A327T|MLLT6_uc002hqj.2_5'UTR|MLLT6_uc002hqk.3_5'Flank	NM_005937	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	327	Poly-Ser.				regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding	p.A327T(1)		breast(3)|prostate(1)|lung(1)|skin(1)	6	Breast(7;4.43e-21)					TTTTAcctccgcctcctcttc	0.453			T	MLL	AL								12	12	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48753463	48753463	+	Intron	SNP	G	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48753463G>T	uc002isl.2	+						ABCC3_uc002isn.2_5'Flank	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	TGAGCTTGTGGGGGTGTCCAG	0.562													3	34	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49057249	49057249	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49057249C>G	uc002itc.2	-	26	3476	c.3267G>C	c.(3265-3267)GAG>GAC	p.E1089D	SPAG9_uc002itb.2_Missense_Mutation_p.E1075D|SPAG9_uc002itd.2_Missense_Mutation_p.E1079D|SPAG9_uc002ita.2_Missense_Mutation_p.E932D	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	1089					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GCACTTGGCTCTCCTTCCTGG	0.443													3	97	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66039465	66039465	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66039465G>C	uc002jgk.2	+	7	1048	c.916G>C	c.(916-918)GAA>CAA	p.E306Q	KPNA2_uc002jgl.2_Missense_Mutation_p.E306Q	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	306	ARM 6.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGGAGCTTCTGAATTGCCAAT	0.388													7	474	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59931383	59931383	+	Intron	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59931383G>A	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TCAATTGTAAGTTACCACCTC	0.378													18	48	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1008188	1008188	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1008188C>T	uc002lqo.1	+	6	2364	c.2364C>T	c.(2362-2364)TCC>TCT	p.S788S	uc002lqp.1_RNA	NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	788	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CCAACCTGTCCGAGTTCATCA	0.647													5	4	---	---	---	---	PASS
SIRT6	51548	broad.mit.edu	37	19	4174895	4174895	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4174895T>G	uc002lzo.2	-	8	847	c.787A>C	c.(787-789)ACC>CCC	p.T263P	SIRT6_uc002lzn.2_Nonstop_Mutation_p.*177C|SIRT6_uc002lzp.2_Nonstop_Mutation_p.*188C|SIRT6_uc010xid.1_Missense_Mutation_p.T191P|SIRT6_uc002lzq.2_Missense_Mutation_p.T236P|SIRT6_uc002lzr.2_Missense_Mutation_p.T164P	NM_016539	NP_057623	Q8N6T7	SIRT6_HUMAN	sirtuin 6	263	Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation	nuclear telomeric heterochromatin|nucleoplasm	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|protein binding|zinc ion binding			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGAGCCGGGTCATGACCTCG	0.716													6	11	---	---	---	---	PASS
HAUS5	23354	broad.mit.edu	37	19	36104926	36104926	+	Intron	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36104926C>T	uc002oam.1	+							NM_015302	NP_056117	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle					0						ACTCTGGCCTCGTTTTCCTAG	0.453													21	101	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44351765	44351765	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44351765G>C	uc002oxr.3	+	7	1280	c.1012G>C	c.(1012-1014)GAG>CAG	p.E338Q	ZNF283_uc002oxp.3_Missense_Mutation_p.E199Q	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	338	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TGCTAAACATGAGATAATTCA	0.398													37	72	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44564891	44564891	+	Intron	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44564891C>G	uc002oyf.1	+						ZNF284_uc010ejd.2_Intron	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				TGTGACTTTTCCTGTTTACAG	0.403													150	288	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50212070	50212070	+	Silent	SNP	C	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50212070C>A	uc002ppj.2	+	13	1745	c.1540C>A	c.(1540-1542)CGG>AGG	p.R514R	CPT1C_uc002ppl.3_Silent_p.R480R|CPT1C_uc002ppi.2_Silent_p.R431R|CPT1C_uc002ppk.2_Silent_p.R503R|CPT1C_uc010eng.2_Silent_p.R514R|CPT1C_uc010enh.2_Silent_p.R514R|CPT1C_uc010ybc.1_Silent_p.R385R|CPT1C_uc010eni.1_Silent_p.R171R	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	514	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		CCAGCCCCAGCGGCTGCAATG	0.507													3	109	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25450668	25450668	+	Silent	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25450668C>T	uc002wux.1	-	18	3386	c.3312G>A	c.(3310-3312)CGG>CGA	p.R1104R	NINL_uc010gdn.1_Silent_p.R755R	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	1104	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CAAGCTCTTGCCGAACCCTTC	0.502													4	195	---	---	---	---	PASS
L3MBTL	26013	broad.mit.edu	37	20	42162661	42162661	+	Silent	SNP	T	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42162661T>C	uc010zwh.1	+	14	1507	c.1461T>C	c.(1459-1461)CCT>CCC	p.P487P	L3MBTL_uc002xkl.2_Silent_p.P419P|L3MBTL_uc002xkm.2_Silent_p.P419P|L3MBTL_uc010ggl.2_Silent_p.P419P|L3MBTL_uc002xkn.1_Silent_p.P178P|L3MBTL_uc002xko.2_Silent_p.P71P	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	419					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ACCCAGACCCTGATAACTTCT	0.577													4	167	---	---	---	---	PASS
ACOT8	10005	broad.mit.edu	37	20	44483793	44483793	+	Intron	SNP	T	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44483793T>G	uc002xqa.1	-						ACOT8_uc010zxe.1_Intron|ACOT8_uc002xqc.1_Intron|ACOT8_uc010zxf.1_Intron|ZSWIM3_uc002xqd.2_5'Flank|ZSWIM3_uc010zxg.1_5'Flank	NM_005469	NP_005460	O14734	ACOT8_HUMAN	peroxisomal acyl-CoA thioesterase 1 isoform a						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|interspecies interaction between organisms|peroxisome organization	peroxisomal matrix	acetyl-CoA hydrolase activity|acyl-CoA thioesterase activity|carboxylesterase activity|choloyl-CoA hydrolase activity|protein binding			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AAGTGGGGGGTTTACCTGCCC	0.607													11	64	---	---	---	---	PASS
JAM2	58494	broad.mit.edu	37	21	27070996	27070996	+	Silent	SNP	A	C	C			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27070996A>C	uc002ylp.1	+	5	947	c.402A>C	c.(400-402)CCA>CCC	p.P134P	JAM2_uc011ace.1_Silent_p.P134P|JAM2_uc002ylq.1_RNA|JAM2_uc011acf.1_Silent_p.P98P|JAM2_uc010glh.1_RNA|JAM2_uc002ylr.1_Silent_p.P134P|JAM2_uc010gli.1_Silent_p.P134P	NM_021219	NP_067042	P57087	JAM2_HUMAN	junctional adhesion molecule 2 precursor	134	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|cell-cell adhesion|leukocyte migration	integral to plasma membrane|tight junction					0						CAGTGGCTCCAGCAGTTCCAT	0.393													7	23	---	---	---	---	PASS
DSCR10	259234	broad.mit.edu	37	21	39580376	39580376	+	RNA	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39580376C>T	uc010gnt.1	+	3		c.498C>T				NR_027695				Homo sapiens DSCR10 mRNA, complete cds.												0						GCACCAGCCTCTGCCTCAGCT	0.602													6	198	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24724888	24724888	+	Splice_Site	SNP	G	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24724888G>T	uc002zzw.2	+	7	2527	c.2220_splice	c.e7+1	p.R740_splice	CYTSA_uc002zzv.3_Splice_Site_p.R740_splice|CYTSA_uc011ajq.1_Splice_Site_p.R740_splice	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						AAGACTTCGGGTAGGATAAAT	0.348													3	21	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31741282	31741282	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31741282C>G	uc003akq.2	-	1	968	c.307G>C	c.(307-309)GAG>CAG	p.E103Q	PATZ1_uc003akp.2_Missense_Mutation_p.E103Q|PATZ1_uc003akr.2_Missense_Mutation_p.E103Q|PATZ1_uc003aks.2_Missense_Mutation_p.E103Q|uc003akt.2_5'Flank	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	103	BTB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						ATCTCCAGCTCCCGGCTGCCC	0.667													8	19	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31859712	31859712	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31859712C>G	uc003akz.1	-	5	704	c.540G>C	c.(538-540)TTG>TTC	p.L180F	EIF4ENIF1_uc003ala.1_Missense_Mutation_p.L180F|EIF4ENIF1_uc003alb.1_Intron	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	180	Arg-rich.					nucleus	protein binding|protein transporter activity			ovary(1)	1						CTCTGTCTCTCAAGTCCCGCA	0.398													39	13	---	---	---	---	PASS
GPR173	54328	broad.mit.edu	37	X	53105861	53105861	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53105861G>A	uc004dru.2	+	2	316	c.58G>A	c.(58-60)GCA>ACA	p.A20T		NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	20	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CCCACCGTCCGCATCAGCTTA	0.617													3	36	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53658567	53658567	+	Splice_Site	SNP	C	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53658567C>G	uc004dsp.2	-	10	1048	c.646_splice	c.e10-1	p.T216_splice		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TACTAGTTGTCTAAAATTAAA	0.393													13	133	---	---	---	---	PASS
DCX	1641	broad.mit.edu	37	X	110644391	110644391	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110644391G>A	uc004epd.2	-	3	947	c.775C>T	c.(775-777)CGC>TGC	p.R259C	DCX_uc011msv.1_Missense_Mutation_p.R259C|DCX_uc004epe.2_Missense_Mutation_p.R178C|DCX_uc004epf.2_Missense_Mutation_p.R178C|DCX_uc004epg.2_Missense_Mutation_p.R178C	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	259			R -> L (in SBHX).|R -> C (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						AGCTTGGGGCGCACAAAGTCC	0.537													4	142	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	152991452	152991452	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152991452C>T	uc004fif.2	+	1	1130	c.731C>T	c.(730-732)TCG>TTG	p.S244L	BCAP31_uc004fid.2_5'Flank|BCAP31_uc011myz.1_5'Flank|BCAP31_uc011mza.1_5'Flank|BCAP31_uc004fie.2_5'Flank	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	244	ABC transmembrane type-1.|Helical; (Potential).				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCTGGCCCTCGGCCATCGCC	0.697													6	31	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12918676	12918681	+	Intron	DEL	CAGCAG	-	-	rs150338541		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12918676_12918681delCAGCAG	uc001aum.1	+							NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCCTGGTACCAGCAGAAGCAGAAGT	0.447													9	5	---	---	---	---	
RIMKLA	284716	broad.mit.edu	37	1	42880841	42880842	+	3'UTR	INS	-	CA	CA	rs140509445	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880841_42880842insCA	uc001chi.2	+	5						NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						ATAAAAACACTCAAGAACAACG	0.426													5	3	---	---	---	---	
GBP1	2633	broad.mit.edu	37	1	89518866	89518866	+	3'UTR	DEL	T	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89518866delT	uc001dmx.2	-	11						NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,						interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		ATTTACAGTCTTTTTTTTTTT	0.318													4	2	---	---	---	---	
ENSA	2029	broad.mit.edu	37	1	150595354	150595355	+	Intron	INS	-	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150595354_150595355insA	uc001eve.2	-						ENSA_uc001evd.2_Intron|ENSA_uc001evb.2_Intron|ENSA_uc001evc.2_Intron	NM_004436	NP_004427	O43768	ENSA_HUMAN	endosulfine alpha isoform 3						cell division|G2/M transition of mitotic cell cycle|mitosis|response to nutrient|transport	cytoplasm	ion channel inhibitor activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity|receptor binding			central_nervous_system(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			GAACACAGAAGAAAAAAAAAAA	0.510													3	5	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155774575	155774575	+	Intron	DEL	A	-	-	rs77957644		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155774575delA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc009wrj.1_Intron|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ctgtctcaggaaaaaaaaaaa	0.104													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179570160	179570160	+	Intron	DEL	T	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179570160delT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTCAAAGATTATATACTTC	0.264													4	2	---	---	---	---	
ZBTB38	253461	broad.mit.edu	37	3	141164925	141164926	+	3'UTR	INS	-	A	A	rs79262793		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141164925_141164926insA	uc003etw.2	+	8					ZBTB38_uc010hun.2_3'UTR|ZBTB38_uc010huo.2_3'UTR|ZBTB38_uc003ety.2_3'UTR|ZBTB38_uc010hup.2_3'UTR	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38						positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GGAGTGAAATTAAAAAAAAAAA	0.262													6	6	---	---	---	---	
PKD2	5311	broad.mit.edu	37	4	88996325	88996326	+	Intron	DEL	AA	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88996325_88996326delAA	uc003hre.2	+						PKD2_uc011cdf.1_Intron|PKD2_uc011cdg.1_Intron|PKD2_uc011cdh.1_Intron	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2							basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		ATAAAACATCAATGTAGTCATA	0.292													2	4	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169370087	169370088	+	Intron	INS	-	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169370087_169370088insA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		tataagtccccaaactaatgct	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	58184883	58184906	+	IGR	DEL	AAGAAAGGAAGGAAGGAAGGAAGG	-	-	rs58863015	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58184883_58184906delAAGAAAGGAAGGAAGGAAGGAAGG								RAB3C (37478 upstream) : PDE4D (79960 downstream)																							gaaagaaagaaagaaaggaaggaaggaaggaaggaaggaaggaa	0.071													2	4	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64766506	64766507	+	Intron	DEL	TA	-	-	rs112458452		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64766506_64766507delTA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		TTAAACTACCtatatatatata	0.248													4	2	---	---	---	---	
TRIM23	373	broad.mit.edu	37	5	64907242	64907243	+	Intron	INS	-	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64907242_64907243insT	uc003jty.2	-						TRIM23_uc003jtw.2_Intron|TRIM23_uc003jtx.2_Intron	NM_001656	NP_001647	P36406	TRI23_HUMAN	ADP-ribosylation factor domain protein 1 isoform						interspecies interaction between organisms|small GTPase mediated signal transduction	Golgi membrane|lysosomal membrane	enzyme activator activity|GDP binding|GTP binding|GTPase activity|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CCTCTTTGAAGTTTTTTTTTTT	0.317													5	3	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237907	112237908	+	Intron	INS	-	T	T	rs150628851	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237907_112237908insT	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		ttgcttgagcATTtttttgttt	0.099													3	4	---	---	---	---	
C5orf15	56951	broad.mit.edu	37	5	133295095	133295096	+	Intron	INS	-	A	A	rs140333707		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133295095_133295096insA	uc003kyo.2	-							NM_020199	NP_064584	Q8NC54	KCT2_HUMAN	keratinocytes associated transmembrane protein 2							integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			cttttttttgcaaaaaaaaaaa	0.119													9	5	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167825035	167825036	+	Intron	DEL	AT	-	-	rs142942307		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167825035_167825036delAT	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		gaaatatctcatgtgtattatc	0.084													1	5	---	---	---	---	
F12	2161	broad.mit.edu	37	5	176831178	176831178	+	Intron	DEL	C	-	-	rs67902409		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176831178delC	uc003mgo.3	-						F12_uc011dfy.1_Intron|F12_uc003mgn.3_5'UTR|F12_uc010jkl.2_Intron	NM_000505	NP_000496	P00748	FA12_HUMAN	coagulation factor XII precursor						Factor XII activation|fibrinolysis|innate immune response|positive regulation of blood coagulation|positive regulation of fibrinolysis|positive regulation of plasminogen activation|protein autoprocessing|response to misfolded protein|zymogen activation	extracellular space|plasma membrane	serine-type endopeptidase activity				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCCTCCTTCCCCCCCCCAC	0.736									Hereditary_Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32441392	32441393	+	IGR	INS	-	T	T	rs71556927		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441392_32441393insT								HLA-DRA (28571 upstream) : HLA-DRB1 (43770 downstream)																							AATTATGGGGAGGAGGTTACTG	0.505													4	2	---	---	---	---	
C6orf223	221416	broad.mit.edu	37	6	43970504	43970509	+	In_Frame_Del	DEL	GCGGCG	-	-	rs72369323		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43970504_43970509delGCGGCG	uc003own.2	+	4	388_393	c.370_375delGCGGCG	c.(370-375)GCGGCGdel	p.AA130del	uc003owm.1_Intron|C6orf223_uc003owo.2_In_Frame_Del_p.AA110del	NM_153246	NP_694978	Q8N319	CF223_HUMAN	hypothetical protein LOC221416	130_131	Ala-rich.										0	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			GGTAGAGCGCgcggcggcggcggcgg	0.636													4	2	---	---	---	---	
ZUFSP	221302	broad.mit.edu	37	6	116982067	116982067	+	Intron	DEL	C	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116982067delC	uc003pxf.1	-						ZUFSP_uc010kef.1_Intron	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		tttttctttgctttttttttt	0.129													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74129039	74129040	+	Intron	INS	-	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74129039_74129040insT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|uc003uaz.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TCTTGTCAGTCttttttttttt	0.297													4	2	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													7	6	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6390140	6390141	+	Intron	INS	-	C	C	rs141106218	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6390140_6390141insC	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TACCTTGCCTTCCTTTTGGAAT	0.312													4	5	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20995373	20995374	+	Intron	INS	-	AC	AC	rs150489586		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20995373_20995374insAC	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		AAAAAAAAAAAAAACAACTTTC	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	39817160	39817160	+	IGR	DEL	T	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39817160delT								LOC653501 (308272 upstream) : FAM74A1 (83040 downstream)																							TTACCGATAATAAAAAAAAAA	0.383													4	2	---	---	---	---	
CDC14B	8555	broad.mit.edu	37	9	99327506	99327506	+	Intron	DEL	T	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99327506delT	uc004awj.2	-						CDC14B_uc004awk.2_Intron|CDC14B_uc004awl.2_Intron|CDC14B_uc004awi.2_Intron	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2						activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TTTAGGGAGGTTTTTTTTTTT	0.294													2	4	---	---	---	---	
NOTCH1	4851	broad.mit.edu	37	9	139393593	139393594	+	Frame_Shift_Ins	INS	-	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139393593_139393594insA	uc004chz.2	-	32	6052_6053	c.6052_6053insT	c.(6052-6054)CACfs	p.H2018fs		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	2018	ANK 3.|Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GACGTCGGCGTGTGAGTTGATG	0.678			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			66	39	---	---	---	---	
GRIN1	2902	broad.mit.edu	37	9	140061896	140061897	+	Frame_Shift_Ins	INS	-	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140061896_140061897insA	uc004clk.2	+	20	3064_3065	c.2734_2735insA	c.(2734-2736)CAAfs	p.Q912fs	GRIN1_uc004cll.2_Frame_Shift_Ins_p.Q875fs|GRIN1_uc004clm.2_Intron|GRIN1_uc004cln.2_Intron|GRIN1_uc004clo.2_Intron	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor	912	Cytoplasmic (Potential).				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	TTTGCAAAACCAAAAAGACACA	0.634													4	2	---	---	---	---	
PNPLA7	375775	broad.mit.edu	37	9	140414285	140414294	+	Intron	DEL	TGACCTGGGG	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140414285_140414294delTGACCTGGGG	uc004cnf.2	-						PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Intron	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7						lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ATGTGCAAGATGACCTGGGGTGACCTGAGG	0.633													16	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	47728039	47728041	+	IGR	DEL	ATC	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47728039_47728041delATC								ANTXRL (26593 upstream) : ANXA8L2 (18879 downstream)																							CAGAAAATGTAtctttttttttt	0.172													4	2	---	---	---	---	
P4HA1	5033	broad.mit.edu	37	10	74804988	74804989	+	Intron	INS	-	TT	TT			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74804988_74804989insTT	uc010qka.1	-						P4HA1_uc001jtg.2_Intron|P4HA1_uc001jth.2_Intron|P4HA1_uc010qkb.1_Intron|P4HA1_uc001jti.2_Intron	NM_001142595	NP_001136067	P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha I subunit isoform 2							endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			ovary(1)	1	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GGTTTTTGGGGTTTTTTTTTTT	0.342													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78844283	78844284	+	Intron	INS	-	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78844283_78844284insT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TGTACAGTGGCTTGTGGGGCAA	0.609													7	7	---	---	---	---	
PPP2R1B	5519	broad.mit.edu	37	11	111626315	111626315	+	Intron	DEL	T	-	-	rs72173499		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111626315delT	uc001plx.1	-						PPP2R1B_uc001plw.1_Intron|PPP2R1B_uc010rwi.1_Intron|PPP2R1B_uc010rwj.1_Intron|PPP2R1B_uc010rwk.1_Intron|PPP2R1B_uc010rwl.1_Intron	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein								protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		CATCtttttcttttttttttt	0.214													4	2	---	---	---	---	
ITGA5	3678	broad.mit.edu	37	12	54792619	54792619	+	Intron	DEL	C	-	-	rs12319365		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54792619delC	uc001sga.2	-							NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor						angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						ctctctctctctttttttttt	0.209													4	2	---	---	---	---	
PPP1R12A	4659	broad.mit.edu	37	12	80201041	80201042	+	Frame_Shift_Ins	INS	-	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80201041_80201042insT	uc001syz.2	-	12	1886_1887	c.1619_1620insA	c.(1618-1620)AATfs	p.N540fs	PPP1R12A_uc010suc.1_Frame_Shift_Ins_p.N453fs|PPP1R12A_uc001sza.2_Frame_Shift_Ins_p.N540fs|PPP1R12A_uc010sud.1_Frame_Shift_Ins_p.N540fs|PPP1R12A_uc001szb.2_Frame_Shift_Ins_p.N540fs|PPP1R12A_uc001szc.2_Frame_Shift_Ins_p.N540fs	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	540	Ser/Thr-rich.					contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						TAACTGAGCTATTTTTTTTAAG	0.302													4	2	---	---	---	---	
MTERFD3	80298	broad.mit.edu	37	12	107371179	107371180	+	3'UTR	DEL	AT	-	-	rs147247471		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107371179_107371180delAT	uc001tme.1	-	2					MTERFD3_uc001tmf.1_3'UTR|MTERFD3_uc001tmg.1_3'UTR	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						aatatGGCACATGAGTCAGAAT	0.262													4	3	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110230049	110230050	+	Intron	DEL	AA	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110230049_110230050delAA	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						actccacctcaaaaaaaaaaaa	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116244731	116244732	+	IGR	INS	-	T	T	rs58302742		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116244731_116244732insT								None (None upstream) : MED13L (151651 downstream)																							tttttcttttcttttttttctt	0.000													4	2	---	---	---	---	
SCARB1	949	broad.mit.edu	37	12	125279967	125279968	+	Intron	INS	-	G	G	rs145223970	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125279967_125279968insG	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc010tbe.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AGCCACAGGCTGGGGGGGGTCA	0.545													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133702169	133702170	+	IGR	INS	-	A	A			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133702169_133702170insA								ZNF140 (17913 upstream) : ZNF10 (5043 downstream)																							TTCACAGCAACAAAAAAAAAGA	0.485													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22111982	22111983	+	IGR	INS	-	T	T			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22111982_22111983insT								OR10G2 (8984 upstream) : OR4E2 (21314 downstream)																							gtcagtcactatttttttttct	0.074													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57150484	57150485	+	IGR	INS	-	AA	AA			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57150484_57150485insAA								C14orf101 (34254 upstream) : OTX2 (116942 downstream)																							TATCGGTAAGGaaaaaaaaaaa	0.238													8	4	---	---	---	---	
HEATR4	399671	broad.mit.edu	37	14	73961712	73961712	+	Intron	DEL	A	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73961712delA	uc010tua.1	-							NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		AAATAGAGATAACTTTTTTTT	0.308													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106816592	106816593	+	Intron	INS	-	AC	AC	rs112484509		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106816592_106816593insAC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CACATCTAAAAATTTAGTCCTA	0.436													3	3	---	---	---	---	
SPTBN5	51332	broad.mit.edu	37	15	42171798	42171799	+	Intron	INS	-	G	G	rs141761744	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42171798_42171799insG	uc001zos.2	-							NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCAGACTGGCTGTCCCTTGCCC	0.644													9	4	---	---	---	---	
FRMD5	84978	broad.mit.edu	37	15	44168003	44168003	+	Intron	DEL	T	-	-	rs34063043		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44168003delT	uc001ztl.2	-						FRMD5_uc001ztj.1_Intron|FRMD5_uc001ztk.1_Intron|FRMD5_uc010uef.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		CTGGGCCTAGttttttttttt	0.219													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60214848	60214855	+	IGR	DEL	TTCCGTCT	-	-	rs71979129		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60214848_60214855delTTCCGTCT								None (None upstream) : None (None downstream)																							ccttccttccttccgtctgtctgtctgt	0.000													5	3	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84034564	84034565	+	Intron	INS	-	GGTGGAG	GGTGGAG	rs144191894	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84034564_84034565insGGTGGAG	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						CAGTAAACCCTGGTGGAGGCAG	0.609													4	2	---	---	---	---	
ABR	29	broad.mit.edu	37	17	982630	982630	+	Frame_Shift_Del	DEL	C	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:982630delC	uc002fsd.2	-	6	750	c.640delG	c.(640-642)GAAfs	p.E214fs	ABR_uc002fse.2_Frame_Shift_Del_p.E168fs|ABR_uc010vqg.1_5'Flank|ABR_uc002fsg.2_Frame_Shift_Del_p.E177fs|ABR_uc002fsh.1_Frame_Shift_Del_p.E98fs	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	214	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		ACTTTGAGTTCCTGCCAAAGG	0.577													18	13	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19753013	19753013	+	Intron	DEL	G	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19753013delG	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					aaaaaaaaaagaaatttgaaa	0.229													4	2	---	---	---	---	
TWSG1	57045	broad.mit.edu	37	18	9396146	9396148	+	Intron	DEL	AAA	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9396146_9396148delAAA	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699	Q9GZX9	TWSG1_HUMAN	twisted gastrulation precursor											ovary(1)|pancreas(1)	2						CTCACCCAGCaaaaaaaaaaaaa	0.197													3	3	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29429382	29429382	+	Intron	DEL	A	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29429382delA	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TTTTTAGGCCAAAAAAAAATA	0.264													4	2	---	---	---	---	
ZFP30	22835	broad.mit.edu	37	19	38133953	38133954	+	Intron	INS	-	A	A	rs72477911		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38133953_38133954insA	uc002ogv.1	-						ZFP30_uc002ogw.1_Intron|ZFP30_uc002ogx.1_Intron|ZFP30_uc010xtt.1_Intron	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gactccgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19804031	19804031	+	IGR	DEL	G	-	-	rs35040175		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19804031delG								SLC24A3 (100491 upstream) : RIN2 (66179 downstream)																							TGCTCTGCCTGCTTTTTTTTT	0.393													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961024	23961025	+	IGR	INS	-	AC	AC	rs146633246	by1000genomes	TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961024_23961025insAC								CST5 (100644 upstream) : GGTLC1 (4666 downstream)																							cactcacacatacacacacaaa	0.000													4	5	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30032737	30032743	+	Splice_Site	DEL	CAGATGA	-	-			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30032737_30032743delCAGATGA	uc003age.3	+	2	558	c.115_splice	c.e2-1	p.M39_splice	NF2_uc003afy.3_Splice_Site_p.M39_splice|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Splice_Site_p.M39_splice|NF2_uc003agb.3_Splice_Site|NF2_uc003agc.3_Splice_Site_p.M1_splice|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Splice_Site_p.M39_splice|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Splice_Site_p.M39_splice|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Splice_Site_p.M39_splice|NF2_uc003agk.3_Translation_Start_Site	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(12)|p.M39_K80del(3)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						TTTGTTATTGCAGATGAAGTGGAAAGG	0.473			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				49	37	---	---	---	---	
TRAPPC2	6399	broad.mit.edu	37	X	13734919	13734920	+	Intron	INS	-	TTTG	TTTG	rs142846606		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13734919_13734920insTTTG	uc010nek.1	-						TRAPPC2_uc010nej.1_5'Flank|TRAPPC2_uc010nel.1_Intron|TRAPPC2_uc010nem.1_Intron	NM_001011658	NP_001011658	Q6IBE5	Q6IBE5_HUMAN	trafficking protein particle complex 2 isoform						ER to Golgi vesicle-mediated transport	intracellular					0						TGCTTTTATACTTTGTTATTGT	0.282													6	4	---	---	---	---	
OTUD5	55593	broad.mit.edu	37	X	48791593	48791593	+	Intron	DEL	T	-	-	rs10715761		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48791593delT	uc004dlu.2	-						OTUD5_uc004dlt.3_Intron|OTUD5_uc004dlv.2_Intron|OTUD5_uc011mmp.1_Intron	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a						negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						TAACTCCCTATTTTTTTTTTT	0.443													9	5	---	---	---	---	
ACSL4	2182	broad.mit.edu	37	X	108887450	108887451	+	Intron	INS	-	G	G			TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108887450_108887451insG	uc004eoi.2	-						ACSL4_uc004eoj.2_Intron|ACSL4_uc004eok.2_Intron	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4						fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	agaaaaggagagggggggaaag	0.233													43	26	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122772579	122772580	+	Intron	DEL	AC	-	-	rs35181346		TCGA-C5-A1BF-01	TCGA-C5-A1BF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772579_122772580delAC	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						acacacacgtacacacacacac	0.139													7	5	---	---	---	---	
