Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PHF13	148479	broad.mit.edu	37	1	6680012	6680012	+	Silent	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6680012C>G	uc001aob.3	+	3	662	c.291C>G	c.(289-291)CTC>CTG	p.L97L		NM_153812	NP_722519	Q86YI8	PHF13_HUMAN	PHD finger protein 13	97					cell division|chromatin modification|mitotic chromosome condensation	nucleoplasm	chromatin binding|methylated histone residue binding|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		AGCCTACTCTCTTGCAGCGAG	0.493													5	60	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7792499	7792499	+	Intron	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7792499C>G	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TCCTCCTGCTCTGCCCTAGAT	0.567													4	50	---	---	---	---	PASS
MYCBP	26292	broad.mit.edu	37	1	39333265	39333265	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39333265C>T	uc001ccs.2	-	3	179	c.106G>A	c.(106-108)GAA>AAA	p.E36K	RRAGC_uc001ccr.2_5'UTR	NM_012333	NP_036465	Q99417	MYCBP_HUMAN	c-myc binding protein	36					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	mitochondrion|nucleus	protein binding|transcription coactivator activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)				TCTGGTTCTTCATATAAGGCT	0.289													19	91	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92184977	92184977	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92184977G>A	uc001doh.2	-	10	1924	c.1458C>T	c.(1456-1458)ACC>ACT	p.T486T	TGFBR3_uc009wde.2_Silent_p.T263T|TGFBR3_uc010osy.1_Silent_p.T444T|TGFBR3_uc001doi.2_Silent_p.T485T|TGFBR3_uc001doj.2_Silent_p.T485T	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	486	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TGGCCTTGCAGGTAGGATCCA	0.542													13	108	---	---	---	---	PASS
DR1	1810	broad.mit.edu	37	1	93812311	93812311	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93812311G>C	uc001dpu.2	+	1	834	c.109G>C	c.(109-111)GAG>CAG	p.E37Q	uc001dps.2_5'Flank|uc001dpt.1_5'Flank|DR1_uc010otj.1_Missense_Mutation_p.E37Q	NM_001938	NP_001929	Q01658	NC2B_HUMAN	down-regulator of transcription 1	37					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex	sequence-specific DNA binding|TBP-class protein binding|transcription corepressor activity				0		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		CGATGCTCGAGAGCTGGTGGT	0.453													12	97	---	---	---	---	PASS
DR1	1810	broad.mit.edu	37	1	93812394	93812394	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93812394G>C	uc001dpu.2	+	1	917	c.192G>C	c.(190-192)AAG>AAC	p.K64N	uc001dps.2_5'Flank|uc001dpt.1_5'Flank|DR1_uc010otj.1_Missense_Mutation_p.K64N	NM_001938	NP_001929	Q01658	NC2B_HUMAN	down-regulator of transcription 1	64					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex	sequence-specific DNA binding|TBP-class protein binding|transcription corepressor activity				0		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		CGGAAAAGAAGACCATCTCAC	0.463													5	52	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107867489	107867489	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107867489G>A	uc001dvh.3	+	3	1550	c.832G>A	c.(832-834)GAG>AAG	p.E278K	NTNG1_uc001dvf.3_Missense_Mutation_p.E278K|NTNG1_uc010out.1_Missense_Mutation_p.E278K|NTNG1_uc001dvc.3_Missense_Mutation_p.E278K|NTNG1_uc001dvd.1_Missense_Mutation_p.E278K	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	278	Laminin N-terminal.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ATTTGTAGATGAGCTACACTT	0.463													8	52	---	---	---	---	PASS
KIAA1324	57535	broad.mit.edu	37	1	109740254	109740254	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109740254C>T	uc001dwq.2	+	17	2416	c.2280C>T	c.(2278-2280)GTC>GTT	p.V760V	KIAA1324_uc009wex.1_Silent_p.V710V|KIAA1324_uc009wey.2_Silent_p.V673V|KIAA1324_uc010ovg.1_Silent_p.V658V|KIAA1324_uc001dwr.2_Silent_p.V410V|KIAA1324_uc001dws.1_RNA|KIAA1324_uc009wez.1_RNA	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor	760	Extracellular (Potential).				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CACAGCCTGTCAGCCTTGCTG	0.453													3	30	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145532812	145532812	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145532812C>T	uc001eoa.2	+	10	1207	c.1131C>T	c.(1129-1131)TTC>TTT	p.F377F	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.F246F|ITGA10_uc009wiw.2_Silent_p.F234F|ITGA10_uc010oyw.1_Silent_p.F322F	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	377	Extracellular (Potential).|FG-GAP 3.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGATTGGTTTCTCCACTCATC	0.468													38	164	---	---	---	---	PASS
TARS2	80222	broad.mit.edu	37	1	150463973	150463973	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150463973C>T	uc001euq.2	+	5	623	c.616C>T	c.(616-618)CGC>TGC	p.R206C	TARS2_uc010pcd.1_RNA|TARS2_uc001eur.2_Missense_Mutation_p.R206C|TARS2_uc009wlt.2_Intron|TARS2_uc009wls.2_Missense_Mutation_p.R206C	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial	206					threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GGATCAGCTTCGCCAGTTGTT	0.532													18	146	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158369020	158369020	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158369020G>A	uc010pih.1	-	1	237	c.237C>T	c.(235-237)ATC>ATT	p.I79I		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	79	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					GCAGCTGAGGGATGATGACAA	0.498													4	48	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166973503	166973503	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166973503C>G	uc001gdy.1	+	6	681	c.610C>G	c.(610-612)CAT>GAT	p.H204D	MAEL_uc001gdz.1_Missense_Mutation_p.H173D|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	204					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						TAGATTTATTCATCCCAACCC	0.353													19	165	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179401391	179401391	+	Intron	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179401391C>T	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TTTTTTTTTTCTTCTTTTCAG	0.289													5	25	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179989083	179989083	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179989083G>A	uc001gnt.2	+	12	2558	c.2175_splice	c.e12-1	p.R725_splice	CEP350_uc009wxl.2_Splice_Site_p.R724_splice|CEP350_uc001gnu.2_Splice_Site_p.R559_splice	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4						TTCATTTCCAGAAAAGACTTG	0.294													28	176	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183111854	183111854	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183111854C>T	uc001gpy.3	+	28	5016	c.4759C>T	c.(4759-4761)CGC>TGC	p.R1587C		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1587	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAAGGACATTCGCAATCTGGA	0.498													19	100	---	---	---	---	PASS
UCHL5	51377	broad.mit.edu	37	1	193029028	193029028	+	5'Flank	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193029028G>A	uc001gsm.2	-						UCHL5_uc001gsn.2_5'Flank|UCHL5_uc001gso.2_5'Flank|UCHL5_uc010pov.1_5'Flank|UCHL5_uc001gsp.2_5'Flank|UCHL5_uc001gsq.2_5'Flank|UCHL5_uc010pow.1_5'UTR|UCHL5_uc010pox.1_5'Flank|UCHL5_uc001gsr.1_Missense_Mutation_p.S34L|TROVE2_uc001gst.1_Intron|TROVE2_uc001gss.2_Intron|TROVE2_uc001gsu.1_Intron|TROVE2_uc001gsv.1_5'UTR|TROVE2_uc001gsw.2_5'UTR|TROVE2_uc009wyp.2_5'UTR|TROVE2_uc009wyq.2_5'UTR	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5						DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3						CAAACGCCGCGAAACTATCGC	0.652													3	14	---	---	---	---	PASS
ARV1	64801	broad.mit.edu	37	1	231125863	231125863	+	Missense_Mutation	SNP	G	A	A	rs35764859	byFrequency	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231125863G>A	uc009xfl.1	+	3	331	c.302G>A	c.(301-303)GGA>GAA	p.G101E	ARV1_uc001huh.2_Missense_Mutation_p.G101E	NM_022786	NP_073623	Q9H2C2	ARV1_HUMAN	ARV1 homolog	101					sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		CAGATCCATGGAAAACTCTGC	0.423													25	208	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237890472	237890472	+	Missense_Mutation	SNP	G	A	A	rs56228594		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237890472G>A	uc001hyl.1	+	76	10931	c.10811G>A	c.(10810-10812)CGG>CAG	p.R3604Q	RYR2_uc010pya.1_5'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3604					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	p.R3602Q(1)		ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCCTGCTTCCGGATGGCCCCC	0.403													14	101	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20478361	20478361	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20478361G>A	uc002rds.1	-	12	1963	c.1940C>T	c.(1939-1941)TCA>TTA	p.S647L	PUM2_uc002rdq.1_Missense_Mutation_p.S24L|PUM2_uc002rdt.1_Missense_Mutation_p.S647L|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Missense_Mutation_p.S647L|PUM2_uc010yjz.1_Missense_Mutation_p.S586L	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	647	Ser-rich.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAACTGGATGAGGATCCATG	0.318													9	54	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39499440	39499440	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39499440C>T	uc002rro.2	-	26	2048	c.1957G>A	c.(1957-1959)GAC>AAC	p.D653N	MAP4K3_uc002rrp.2_Missense_Mutation_p.D632N|MAP4K3_uc010yns.1_Missense_Mutation_p.D206N	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	653	CNH.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				AGTATTCTGTCAGGGAGTTTG	0.363													26	138	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44079964	44079964	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44079964C>T	uc002rtq.2	+	6	1011	c.921C>T	c.(919-921)ATC>ATT	p.I307I	ABCG8_uc010yoa.1_Silent_p.I307I	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	307	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCACAGCCATCGGCTACCCCT	0.592													9	58	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80101289	80101289	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80101289C>G	uc010ysh.1	+	5	678	c.673C>G	c.(673-675)CAA>GAA	p.Q225E	CTNNA2_uc010yse.1_Missense_Mutation_p.Q225E|CTNNA2_uc010ysf.1_Missense_Mutation_p.Q225E|CTNNA2_uc010ysg.1_Missense_Mutation_p.Q225E	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	225					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CACGGCCTCTCAAGCATTTCT	0.567													12	66	---	---	---	---	PASS
ST6GAL2	84620	broad.mit.edu	37	2	107460106	107460106	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107460106C>G	uc002tdq.2	-	2	447	c.328G>C	c.(328-330)GAG>CAG	p.E110Q	ST6GAL2_uc002tdr.2_Missense_Mutation_p.E110Q|ST6GAL2_uc002tds.3_Missense_Mutation_p.E110Q	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	110	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						GAAAAAAACTCTTTATGTTCA	0.567													22	132	---	---	---	---	PASS
ST6GAL2	84620	broad.mit.edu	37	2	107460390	107460390	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107460390C>T	uc002tdq.2	-	2	163	c.44G>A	c.(43-45)GGA>GAA	p.G15E	ST6GAL2_uc002tdr.2_Missense_Mutation_p.G15E|ST6GAL2_uc002tds.3_Missense_Mutation_p.G15E	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	15	Helical; Signal-anchor for type II membrane protein; (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						AGCGAATATTCCGAAAAGCAT	0.517													14	40	---	---	---	---	PASS
TUBA3E	112714	broad.mit.edu	37	2	130953801	130953801	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130953801G>A	uc002tqv.2	-	2	248	c.147C>T	c.(145-147)TTC>TTT	p.F49F		NM_207312	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	49					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1	Colorectal(110;0.1)					AGAACGTGTTGAAGGAGTCGT	0.557													19	66	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136567146	136567146	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136567146G>A	uc002tuu.1	-	8	2782	c.2771C>T	c.(2770-2772)GCC>GTC	p.A924V		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	924	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TTTGCCATCGGCATCCCACGC	0.532													3	68	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152472532	152472532	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152472532C>G	uc010fnx.2	-	72	10735	c.10544G>C	c.(10543-10545)AGA>ACA	p.R3515T		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3515	Nebulin 96.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGCAATATCTCTTGAAGCCTT	0.373													5	12	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152518812	152518812	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152518812C>T	uc010fnx.2	-	46	5998	c.5807G>A	c.(5806-5808)GGA>GAA	p.G1936E		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1936	Nebulin 51.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGGGAGCCATCCAATGCCCTT	0.428													15	113	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179612885	179612885	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179612885G>C	uc002unb.2	-	46	14466	c.14242C>G	c.(14242-14244)CTT>GTT	p.L4748V	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTCAGAAAGATCAGTTTCT	0.368													13	61	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179614188	179614188	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179614188C>T	uc002unb.2	-	46	13163	c.12939G>A	c.(12937-12939)GAG>GAA	p.E4313E	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTCAATAGTCTCAAGGCTTT	0.383													13	72	---	---	---	---	PASS
STAT1	6772	broad.mit.edu	37	2	191855956	191855956	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191855956C>G	uc002usj.2	-	11	1423	c.1035G>C	c.(1033-1035)TTG>TTC	p.L345F	STAT1_uc010fse.1_Missense_Mutation_p.L345F|STAT1_uc002usk.2_Missense_Mutation_p.L345F|STAT1_uc002usl.2_Missense_Mutation_p.L347F|STAT1_uc010fsf.1_Missense_Mutation_p.L157F	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	345					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	CTTGTTACCTCAACTTCACAG	0.478													9	48	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210892058	210892058	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210892058G>C	uc002vds.2	-	12	2621	c.2413C>G	c.(2413-2415)CTT>GTT	p.L805V	C2orf67_uc002vdt.2_Missense_Mutation_p.L763V	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	805										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		AAAGGCTGAAGAACAACCATC	0.318													9	91	---	---	---	---	PASS
UGT1A4	54657	broad.mit.edu	37	2	234628184	234628184	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234628184C>G	uc002vux.2	+	1	747	c.718C>G	c.(718-720)CAG>GAG	p.Q240E	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Missense_Mutation_p.Q240E	NM_007120	NP_009051	P22310	UD14_HUMAN	UDP glycosyltransferase 1 family, polypeptide A4	240					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)	TGAGCTTTTTCAGAGAGAGGT	0.512													34	207	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	432680	432680	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:432680C>T	uc003bou.2	+	21	2852	c.2581C>T	c.(2581-2583)CAT>TAT	p.H861Y	CHL1_uc003bot.2_Missense_Mutation_p.H877Y|CHL1_uc003bow.1_Missense_Mutation_p.H861Y|CHL1_uc011asi.1_Missense_Mutation_p.H877Y	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	861	Fibronectin type-III 3.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TGGAAGAACACATCCCAAAGA	0.358													18	87	---	---	---	---	PASS
ZNF445	353274	broad.mit.edu	37	3	44490124	44490124	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44490124C>T	uc003cnf.2	-	8	1387	c.1039G>A	c.(1039-1041)GAG>AAG	p.E347K	ZNF445_uc011azv.1_Missense_Mutation_p.E335K|ZNF445_uc011azw.1_Missense_Mutation_p.E347K	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	347					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CCAATTCCCTCAGAAACACTT	0.403													21	105	---	---	---	---	PASS
FSTL1	11167	broad.mit.edu	37	3	120122095	120122095	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120122095C>G	uc003eds.2	-	8	863	c.688G>C	c.(688-690)GAG>CAG	p.E230Q	FSTL1_uc011bjh.1_Missense_Mutation_p.E195Q	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	230					BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		ATACTCTTCTCAGGAGGGTTG	0.448													12	68	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			7	99	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184074819	184074819	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184074819C>A	uc003foi.2	-	10	1171	c.1047G>T	c.(1045-1047)ATG>ATT	p.M349I	CLCN2_uc003foh.2_5'UTR|CLCN2_uc010hya.1_Missense_Mutation_p.M349I|CLCN2_uc011brl.1_Missense_Mutation_p.M349I|CLCN2_uc011brm.1_Missense_Mutation_p.M305I|CLCN2_uc011brn.1_Missense_Mutation_p.M349I	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	349	Helical; (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TCTGCTTCCGCATCACCTGGA	0.527													3	49	---	---	---	---	PASS
RUFY3	22902	broad.mit.edu	37	4	71665848	71665848	+	Intron	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71665848C>G	uc003hfr.2	+						RUFY3_uc011cay.1_Intron	NM_001037442	NP_001032519	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 1						negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			GGGCTGTTTTCTTTTGGCAGG	0.328													7	45	---	---	---	---	PASS
RCHY1	25898	broad.mit.edu	37	4	76439453	76439453	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76439453C>T	uc003hik.2	-	1	176	c.44G>A	c.(43-45)CGA>CAA	p.R15Q	RCHY1_uc003hij.2_Missense_Mutation_p.R15Q|RCHY1_uc003hil.2_Missense_Mutation_p.R15Q|RCHY1_uc010iip.2_Missense_Mutation_p.R15Q|RCHY1_uc010iiq.2_RNA|RCHY1_uc010iir.2_Missense_Mutation_p.R15Q|THAP6_uc010iis.1_5'Flank|THAP6_uc003him.2_5'Flank|THAP6_uc003hin.2_5'Flank|THAP6_uc011cbm.1_5'Flank|THAP6_uc010iiu.1_5'Flank|THAP6_uc003hio.1_5'Flank|THAP6_uc010iiv.2_5'Flank	NM_015436	NP_056251	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain	15	CHY-type.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nuclear speck|ubiquitin ligase complex	electron carrier activity|p53 binding|protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CCGCTGACCTCGCTCTTGACC	0.617													13	54	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77272920	77272920	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272920C>G	uc003hkb.3	-	16	2644	c.2491G>C	c.(2491-2493)GAG>CAG	p.E831Q		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	831	Potential.									skin(3)|ovary(2)|pancreas(1)	6						GATTCTTGCTCCTGACGCTGT	0.328													6	75	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90169399	90169399	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90169399C>T	uc003hsm.1	-	2	2382	c.1863G>A	c.(1861-1863)AAG>AAA	p.K621K		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	621										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		ATGGGGTCTTCTTGCCAGAAC	0.577													19	134	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5232548	5232548	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5232548C>T	uc003jdl.2	+	12	1907	c.1769C>T	c.(1768-1770)TCG>TTG	p.S590L	ADAMTS16_uc003jdk.1_Missense_Mutation_p.S590L|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	590	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GGCCACTGGTCGGACTGGTCT	0.532													17	95	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5306632	5306632	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5306632G>A	uc003jdl.2	+	21	3340	c.3202G>A	c.(3202-3204)GAA>AAA	p.E1068K		NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1068	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TGTGACATGTGAAAGAGGAAC	0.368													20	172	---	---	---	---	PASS
C5orf35	133383	broad.mit.edu	37	5	56209780	56209780	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209780C>T	uc003jqx.2	+	4	1043	c.670C>T	c.(670-672)CTG>TTG	p.L224L	C5orf35_uc003jqy.2_RNA	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383	224										ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		TCATAACCCTCTGGCTGTGGG	0.418													7	47	---	---	---	---	PASS
F2R	2149	broad.mit.edu	37	5	76028349	76028349	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76028349G>C	uc003ken.3	+	2	564	c.299G>C	c.(298-300)TGG>TCG	p.W100S		NM_001992	NP_001983	P25116	PAR1_HUMAN	coagulation factor II receptor precursor	100	Extracellular (Potential).				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity			ovary(3)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	ACCAGCTCCTGGCTGACACTC	0.448													34	234	---	---	---	---	PASS
PAM	5066	broad.mit.edu	37	5	102262314	102262314	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102262314G>A	uc003knw.2	+	6	841	c.468G>A	c.(466-468)GAG>GAA	p.E156E	PAM_uc003kns.2_Silent_p.E156E|PAM_uc003knt.2_Silent_p.E156E|PAM_uc003knu.2_Silent_p.E156E|PAM_uc003knv.2_Silent_p.E156E|PAM_uc011cuz.1_Silent_p.E59E	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	156	Peptidylglycine alpha-hydroxylating monooxygenase (By similarity).|Intragranular (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTGGAGGAGAGACTGGAAGTA	0.328													43	197	---	---	---	---	PASS
TGFBI	7045	broad.mit.edu	37	5	135391395	135391395	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135391395C>T	uc003lbf.3	+	11	1598	c.1437C>T	c.(1435-1437)ATC>ATT	p.I479I	TGFBI_uc003lbg.3_Silent_p.I212I|TGFBI_uc003lbh.3_Silent_p.I305I|TGFBI_uc011cyb.1_Silent_p.I305I|TGFBI_uc010jed.2_Silent_p.I212I	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	479	FAS1 3.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACAGCTGCATCGCGGCCCACG	0.572													3	32	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140532130	140532130	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140532130C>T	uc003lir.2	+	1	2292	c.2292C>T	c.(2290-2292)TTC>TTT	p.F764F	PCDHB6_uc011dah.1_Silent_p.F628F	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	764	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGTTCAAGTTCCTGAAGCCGA	0.542													16	136	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173376973	173376973	+	Silent	SNP	C	T	T	rs146932436	byFrequency	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173376973C>T	uc003mcs.3	+	7	2963	c.1557C>T	c.(1555-1557)TTC>TTT	p.F519F	CPEB4_uc010jju.1_Silent_p.F494F|CPEB4_uc010jjv.2_Silent_p.F502F|CPEB4_uc011dfg.1_Silent_p.F494F|CPEB4_uc003mct.3_Silent_p.F129F|CPEB4_uc003mcu.3_Silent_p.F112F	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	519	RRM 1.						nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCTATGCATTCCTGCTGTTTC	0.403													27	204	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179731829	179731829	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179731829C>T	uc003mlw.1	-	17	1883	c.1785G>A	c.(1783-1785)ATG>ATA	p.M595I		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	595	SIS 2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AAGGATCCTTCATAATGACCA	0.577													31	202	---	---	---	---	PASS
HIST1H4K	8362	broad.mit.edu	37	6	27798995	27798995	+	Nonstop_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27798995C>G	uc003njr.2	-	1	311	c.311G>C	c.(310-312)TGA>TCA	p.*104S		NM_003541	NP_003532	P62805	H4_HUMAN	histone cluster 1, H4k	104					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0						AAGGGACGCTCAACCACCGAA	0.552													9	50	---	---	---	---	PASS
ZBTB12	221527	broad.mit.edu	37	6	31868750	31868750	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31868750C>T	uc003nyd.1	-	2	509	c.333G>A	c.(331-333)CAG>CAA	p.Q111Q	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_5'Flank	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	111					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGTGCTCCATCTGCAGGTAGG	0.567													11	55	---	---	---	---	PASS
TMEM30A	55754	broad.mit.edu	37	6	75975015	75975015	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75975015G>A	uc003phw.2	-	3	663	c.385C>T	c.(385-387)CAA>TAA	p.Q129*	TMEM30A_uc003phx.2_Nonsense_Mutation_p.Q93*	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1	129						integral to membrane					0						CGATGGTTTTGATAGAAATTA	0.299													14	60	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84913788	84913788	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84913788C>T	uc010kbp.2	-	7	695	c.598G>A	c.(598-600)GAG>AAG	p.E200K	KIAA1009_uc003pkj.3_Missense_Mutation_p.E124K|KIAA1009_uc003pkk.2_Missense_Mutation_p.E200K	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	200					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CCAACATACTCATCTTCAAAA	0.328													14	92	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123369870	123369870	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123369870G>A	uc003pzi.1	+	4	1537	c.668G>A	c.(667-669)CGG>CAG	p.R223Q		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	223	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GAGAAAACTCGGAAAAGGGTA	0.378													19	96	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146256116	146256116	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146256116G>A	uc003qlf.2	-	13	3316	c.2917C>T	c.(2917-2919)CCA>TCA	p.P973S	SHPRH_uc003qld.2_Missense_Mutation_p.P973S|SHPRH_uc003qle.2_Missense_Mutation_p.P973S|SHPRH_uc003qlg.1_Missense_Mutation_p.P529S|SHPRH_uc003qlj.1_Missense_Mutation_p.P862S|SHPRH_uc003qlh.2_5'Flank	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	973					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CTCAGCAATGGATACAGGATA	0.478													19	51	---	---	---	---	PASS
SNX9	51429	broad.mit.edu	37	6	158323021	158323021	+	Silent	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158323021C>A	uc003qqv.1	+	6	737	c.564C>A	c.(562-564)GGC>GGA	p.G188G		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	188					cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		ATGCAGGCGGCGCTCAGCGAG	0.507													5	62	---	---	---	---	PASS
TAGAP	117289	broad.mit.edu	37	6	159457435	159457435	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159457435C>T	uc003qrz.2	-	10	1952	c.1620G>A	c.(1618-1620)CCG>CCA	p.P540P	TAGAP_uc011eft.1_Silent_p.P477P|TAGAP_uc003qsa.2_Silent_p.P362P	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN	T-cell activation Rho GTPase-activating protein	540					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TGACACCCCTCGGGACGTGGT	0.562													18	84	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21765513	21765513	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21765513G>A	uc003svc.2	+	46	7403	c.7372G>A	c.(7372-7374)GAT>AAT	p.D2458N		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2458					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AACAATCTTTGATTATTATGT	0.428									Kartagener_syndrome				3	22	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23808627	23808627	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23808627C>G	uc003sws.3	+	12	1497	c.1430C>G	c.(1429-1431)TCT>TGT	p.S477C	STK31_uc003swt.3_Missense_Mutation_p.S454C|STK31_uc011jze.1_Missense_Mutation_p.S477C|STK31_uc010kuq.2_Missense_Mutation_p.S454C	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	477							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTGTCAGTCTCTTTAGAAGCA	0.358													14	134	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44152195	44152195	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44152195G>C	uc003tkb.2	+	18	2561	c.2256G>C	c.(2254-2256)GAG>GAC	p.E752D	AEBP1_uc003tkc.3_Missense_Mutation_p.E327D|AEBP1_uc003tkd.2_Missense_Mutation_p.E2D	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	752	Interaction with PTEN (By similarity).				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCTGGATGGAGAAGAACCCCT	0.637													6	34	---	---	---	---	PASS
ZNF92	168374	broad.mit.edu	37	7	64864655	64864655	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64864655A>G	uc003ttz.2	+	4	1771	c.1628A>G	c.(1627-1629)GAC>GGC	p.D543G	ZNF92_uc003tua.2_Missense_Mutation_p.D474G|ZNF92_uc010kzu.2_Missense_Mutation_p.D511G|ZNF92_uc003tub.2_Missense_Mutation_p.D467G	NM_152626	NP_689839	Q03936	ZNF92_HUMAN	zinc finger protein 92 isoform 2	543	C2H2-type 15; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(55;0.159)				GAAGAATGTGACAAAGCCTTT	0.363													13	92	---	---	---	---	PASS
GTPBP10	85865	broad.mit.edu	37	7	90014195	90014195	+	Intron	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90014195C>G	uc003ukm.1	+						GTPBP10_uc003ukn.1_Intron|GTPBP10_uc003uko.1_Intron|CLDN12_uc003ukp.2_Intron|CLDN12_uc003ukq.2_Intron	NM_033107	NP_149098	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 isoform 2						ribosome biogenesis	chromosome|nucleolus	GTP binding|GTPase activity|magnesium ion binding				0						TGTTTGTGCTCTTTCTTTTAG	0.358													10	80	---	---	---	---	PASS
AZGP1	563	broad.mit.edu	37	7	99564616	99564616	+	3'UTR	SNP	C	A	A	rs146780290	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99564616C>A	uc003ush.2	-	4						NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc						antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					TTGCCTCCAACCCTTGCTTCC	0.622													16	123	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677708	100677708	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677708C>G	uc003uxp.1	+	3	3064	c.3011C>G	c.(3010-3012)TCA>TGA	p.S1004*	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1004	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|14.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCACCCTTTCAACAACTCCT	0.522													39	775	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111508135	111508135	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111508135C>T	uc003vfx.2	-	22	2454	c.2185G>A	c.(2185-2187)GAG>AAG	p.E729K	DOCK4_uc003vfw.2_Missense_Mutation_p.E170K|DOCK4_uc003vfy.2_Missense_Mutation_p.E729K|DOCK4_uc003vga.1_Missense_Mutation_p.E334K	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	729					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CGGAACTCCTCTTCGTTTTGC	0.408													5	30	---	---	---	---	PASS
FAM71F1	84691	broad.mit.edu	37	7	128370133	128370133	+	Intron	SNP	T	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128370133T>G	uc003vno.1	+						FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc003vnp.1_Intron	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18											skin(1)	1						GGTACAGCAATGGGAGGAATC	0.627													6	55	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148487457	148487457	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148487457G>A	uc010lpg.2	+	16	2256	c.1730G>A	c.(1729-1731)CGA>CAA	p.R577Q	CUL1_uc003wey.2_Missense_Mutation_p.R577Q|CUL1_uc003wez.2_Missense_Mutation_p.R467Q|CUL1_uc003wfa.2_Missense_Mutation_p.R238Q	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	577					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CACAGTGGCCGAAAATTGACG	0.383													14	73	---	---	---	---	PASS
E2F5	1875	broad.mit.edu	37	8	86124418	86124418	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86124418G>A	uc003ycz.3	+	7	947	c.910G>A	c.(910-912)GAT>AAT	p.D304N	E2F5_uc003yda.3_Missense_Mutation_p.D303N|E2F5_uc010mab.2_Missense_Mutation_p.D143N|E2F5_uc003ydb.3_Missense_Mutation_p.D123N|uc003ydc.1_5'Flank	NM_001951	NP_001942	Q15329	E2F5_HUMAN	E2F transcription factor 5 isoform 1	304	Transactivation (Potential).				G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1						AGATATCATTGATGAGTTAAT	0.289													4	72	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95188869	95188869	+	Silent	SNP	A	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95188869A>C	uc003ygh.2	-	5	449	c.324T>G	c.(322-324)GGT>GGG	p.G108G	CDH17_uc011lgo.1_Silent_p.G108G|CDH17_uc011lgp.1_Silent_p.G108G	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	108	Extracellular (Potential).|Cadherin 1.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TAGGGACTGGACCCTCCACTA	0.478													7	35	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143565330	143565330	+	Intron	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143565330C>G	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TCTTCCTCTTCTTTCCAGAAC	0.557													22	138	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79840896	79840896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79840896G>T	uc004akr.2	+	14	1476	c.1216G>T	c.(1216-1218)GAA>TAA	p.E406*	VPS13A_uc004akp.3_Nonsense_Mutation_p.E406*|VPS13A_uc004akq.3_Nonsense_Mutation_p.E406*|VPS13A_uc004aks.2_Nonsense_Mutation_p.E406*	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	406	TPR 2.				Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ACAGACGGCAGAAGTTGAGGT	0.264													23	202	---	---	---	---	PASS
CTSL2	1515	broad.mit.edu	37	9	99795320	99795320	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99795320C>G	uc004awt.2	-	8	1113	c.916G>C	c.(916-918)GAA>CAA	p.E306Q	CTSL2_uc010msi.2_Missense_Mutation_p.E306Q|CTSL2_uc004awu.2_Missense_Mutation_p.E251Q	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein	306						lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				GAGCCCCATTCTGGACCCCAG	0.398													15	57	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131331147	131331147	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131331147G>A	uc004bvl.3	+	3	447	c.334G>A	c.(334-336)GAA>AAA	p.E112K	SPTAN1_uc011mbg.1_Missense_Mutation_p.E112K|SPTAN1_uc011mbh.1_Missense_Mutation_p.E124K|SPTAN1_uc004bvm.3_Missense_Mutation_p.E112K|SPTAN1_uc004bvn.3_Missense_Mutation_p.E112K	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	112	Spectrin 2.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						GATGATCTCAGAAGGGCATTT	0.468													9	53	---	---	---	---	PASS
TOR1A	1861	broad.mit.edu	37	9	132576379	132576379	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132576379C>G	uc004byl.2	-	5	948	c.871G>C	c.(871-873)GAA>CAA	p.E291Q	TOR1A_uc004bym.2_RNA	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	291					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)				TCATCAATTTCATAGCCTCGG	0.433													46	295	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202135	135202135	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202135G>A	uc004cbk.2	-	10	5033	c.4850C>T	c.(4849-4851)TCT>TTT	p.S1617F	SETX_uc004cbj.2_Missense_Mutation_p.S1236F|SETX_uc010mzt.2_Missense_Mutation_p.S1236F	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1617					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AAGTGCTGAAGAAGTTTCCAA	0.418													28	141	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50819080	50819080	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50819080G>A	uc001jhw.2	+	1	734	c.294G>A	c.(292-294)TCG>TCA	p.S98S	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	98	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						CCAACACCTCGGCGTCCCCGA	0.716													3	44	---	---	---	---	PASS
CH25H	9023	broad.mit.edu	37	10	90966589	90966589	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90966589C>T	uc001kfz.2	-	1	483	c.461G>A	c.(460-462)CGC>CAC	p.R154H		NM_003956	NP_003947	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	154					bile acid biosynthetic process|fatty acid biosynthetic process|sterol biosynthetic process	cytosol|endoplasmic reticulum membrane|integral to membrane	cholesterol 25-hydroxylase activity|iron ion binding				0		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		GTGGAAGGTGCGGTACAGCCA	0.567													4	75	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95848926	95848926	+	Intron	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95848926C>T	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Silent_p.F25F|uc001kjl.1_Intron	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ACGTGAGATTCTGCAAAGGGA	0.522													18	89	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100374769	100374769	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100374769C>T	uc001kpn.1	-	9	1272	c.1212G>A	c.(1210-1212)TTG>TTA	p.L404L	HPSE2_uc009xwc.1_Silent_p.L394L|HPSE2_uc001kpo.1_Silent_p.L336L|HPSE2_uc009xwd.1_Silent_p.L282L	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	404					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CTAAAGTGTTCAACCATCTAA	0.383													13	139	---	---	---	---	PASS
PWWP2B	170394	broad.mit.edu	37	10	134219238	134219238	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134219238G>A	uc001lll.3	+	2	1263	c.1234G>A	c.(1234-1236)GAG>AAG	p.E412K	PWWP2B_uc009ybe.2_Missense_Mutation_p.E412K	NM_138499	NP_612508	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2 isoform 1	412											0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CAGCTGCCCTGAGGGGAGAGC	0.642													4	42	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3716727	3716727	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3716727G>A	uc001lyh.2	-	26	4410	c.4119C>T	c.(4117-4119)TTC>TTT	p.F1373F	NUP98_uc001lyi.2_Silent_p.F1373F|NUP98_uc001lyg.2_Silent_p.F338F	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1390					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CATCCTGGATGAAGGAGTCTG	0.458			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								42	197	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	9803164	9803164	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9803164C>T	uc001mib.2	-	39	5479	c.5341G>A	c.(5341-5343)GAG>AAG	p.E1781K	uc001mhz.1_Intron|SBF2_uc001mid.2_Missense_Mutation_p.E425K|SBF2_uc001mic.2_Missense_Mutation_p.E71K|uc001mie.3_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1781	PH.				myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CTTGTGTCCTCACCTGAGTCA	0.473													14	170	---	---	---	---	PASS
MICALCL	84953	broad.mit.edu	37	11	12316100	12316100	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12316100C>T	uc001mkg.1	+	3	1413	c.1122C>T	c.(1120-1122)CTC>CTT	p.L374L		NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	374					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		CCACACTCCTCGAGAAAGTGA	0.493													30	146	---	---	---	---	PASS
PRG2	5553	broad.mit.edu	37	11	57156480	57156480	+	Intron	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57156480C>T	uc001njz.2	-						PRG2_uc001njw.1_Intron|PRG2_uc001njx.1_Intron|PRG2_uc001njy.1_Intron|PRG2_uc001nka.2_Intron|PRG2_uc001nkb.2_Intron|PRG2_uc001nkd.2_Intron|PRG2_uc001nkc.2_Intron|PRG2_uc001nke.2_Intron	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein						defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	ATAGGCCACTCACCCAAGCTT	0.572													10	74	---	---	---	---	PASS
SYT7	9066	broad.mit.edu	37	11	61300491	61300491	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61300491G>A	uc001nrv.2	-	4	327	c.321C>T	c.(319-321)CTC>CTT	p.L107L	SYT7_uc009ynr.2_Silent_p.L182L	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	107	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						GGGAGTTGACGAGGTCTGAGA	0.647													11	55	---	---	---	---	PASS
NXF1	10482	broad.mit.edu	37	11	62560166	62560166	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62560166G>C	uc001nvf.1	-	20	1904	c.1768C>G	c.(1768-1770)CAG>GAG	p.Q590E	TMEM223_uc001nve.2_5'Flank|NXF1_uc001nvg.1_3'UTR	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	590	TAP-C.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						TTGTTGTCCTGAAGGCACCTG	0.353													5	62	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64521826	64521826	+	Intron	SNP	G	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64521826G>T	uc001oax.3	-						PYGM_uc001oay.3_Intron	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1						glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	ACCTGGGGTAGGGGGAGGGGT	0.612													3	39	---	---	---	---	PASS
CLPB	81570	broad.mit.edu	37	11	72005439	72005439	+	Missense_Mutation	SNP	T	C	C	rs150857620		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72005439T>C	uc001osj.2	-	15	1750	c.1700A>G	c.(1699-1701)TAC>TGC	p.Y567C	CLPB_uc010rqx.1_Missense_Mutation_p.Y522C|CLPB_uc010rqy.1_Missense_Mutation_p.Y508C|CLPB_uc001osk.2_Missense_Mutation_p.Y537C|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_Missense_Mutation_p.Y366C|CLPB_uc001osi.2_Missense_Mutation_p.Y175C	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B	567					cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						GGGGAGGAAGTAGACGATCTC	0.567													7	47	---	---	---	---	PASS
PIWIL4	143689	broad.mit.edu	37	11	94326762	94326762	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94326762G>A	uc001pfa.2	+	9	1316	c.1105G>A	c.(1105-1107)GAG>AAG	p.E369K	PIWIL4_uc010rue.1_RNA|PIWIL4_uc009ywk.1_RNA	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4	369	PAZ.				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGACAACAGTGAGGCTCAGCT	0.428													16	100	---	---	---	---	PASS
SIK2	23235	broad.mit.edu	37	11	111572232	111572232	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111572232G>A	uc001plt.2	+	6	778	c.660G>A	c.(658-660)CCG>CCA	p.P220P		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	220	Protein kinase.				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						TTGATGGACCGACTCTTCCAA	0.418													30	212	---	---	---	---	PASS
BACE1	23621	broad.mit.edu	37	11	117163788	117163788	+	Silent	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117163788C>G	uc001pqz.2	-	5	1283	c.822G>C	c.(820-822)CTG>CTC	p.L274L	BACE1_uc001pqw.2_Silent_p.L249L|BACE1_uc001pqx.2_Silent_p.L205L|BACE1_uc001pqy.2_Silent_p.L230L|BACE1_uc010rxg.1_Silent_p.L149L|BACE1_uc010rxh.1_Silent_p.L174L|BACE1_uc009yzo.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A	274	Extracellular (Potential).				beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		AGTCCATTTTCAGATCCTGTC	0.502													53	432	---	---	---	---	PASS
BACE1	23621	broad.mit.edu	37	11	117163829	117163829	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117163829C>T	uc001pqz.2	-	5	1242	c.781G>A	c.(781-783)GAG>AAG	p.E261K	BACE1_uc001pqw.2_Missense_Mutation_p.E236K|BACE1_uc001pqx.2_Missense_Mutation_p.E192K|BACE1_uc001pqy.2_Missense_Mutation_p.E217K|BACE1_uc010rxg.1_Missense_Mutation_p.E136K|BACE1_uc010rxh.1_Missense_Mutation_p.E161K|BACE1_uc009yzo.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A	261	Extracellular (Potential).				beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		ATGATCACCTCATAATACCAC	0.507													29	290	---	---	---	---	PASS
SIAE	54414	broad.mit.edu	37	11	124519595	124519595	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124519595G>A	uc001qan.2	-	5	755	c.642C>T	c.(640-642)ATC>ATT	p.I214I		NM_170601	NP_733746	Q9HAT2	SIAE_HUMAN	sialate O-acetylesterase precursor	214						extracellular region|lysosome	carboxylesterase activity|sialate O-acetylesterase activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		AGCTGGAGGCGATCAGCCCGA	0.527													5	141	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124743605	124743605	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124743605T>C	uc001qbc.2	+	11	1823	c.1631T>C	c.(1630-1632)GTA>GCA	p.V544A		NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	544	Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GACTGGGGAGTATCACCAGAC	0.522													7	41	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	274981	274981	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:274981G>A	uc001qhw.1	+	8	1993	c.1987G>A	c.(1987-1989)GAG>AAG	p.E663K	IQSEC3_uc001qhu.1_Missense_Mutation_p.E663K	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	966	Potential.|PH.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		GGGCTCGGACGAGATGCAGAA	0.582													7	54	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6710828	6710828	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6710828G>A	uc001qpo.2	-	5	707	c.543C>T	c.(541-543)TTC>TTT	p.F181F	CHD4_uc001qpn.2_Silent_p.F174F|CHD4_uc001qpp.2_Silent_p.F178F	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	181					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						CAAACTGGCTGAAGGCCTTGT	0.453													68	424	---	---	---	---	PASS
NANOG	79923	broad.mit.edu	37	12	7945646	7945646	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7945646C>T	uc009zfy.1	+	2	468	c.252C>T	c.(250-252)GTC>GTT	p.V84V		NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox	84					cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		AGAAGAGTGTCGCAAAAAAGG	0.478													27	117	---	---	---	---	PASS
LASS5	91012	broad.mit.edu	37	12	50528463	50528463	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528463C>T	uc001rwd.3	-	9	912	c.895G>A	c.(895-897)GAG>AAG	p.E299K	LASS5_uc001rwc.2_Missense_Mutation_p.E218K|LASS5_uc001rwe.3_Missense_Mutation_p.E240K|LASS5_uc001rwf.3_RNA|LASS5_uc010smq.1_Missense_Mutation_p.E155K	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5	299	TLC.|Cytoplasmic (Potential).				ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						TCCCAACTCTCAAAGAGGGTC	0.512													21	134	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56087878	56087878	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56087878G>A	uc001shh.2	-	19	2694	c.2474C>T	c.(2473-2475)TCT>TTT	p.S825F	ITGA7_uc001shg.2_Missense_Mutation_p.S821F|ITGA7_uc010sps.1_Missense_Mutation_p.S728F|ITGA7_uc009znw.2_Missense_Mutation_p.S68F|ITGA7_uc009znx.2_Missense_Mutation_p.S702F	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	865	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						CACCACACCAGAGAAGAAGAG	0.602													3	24	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56092524	56092524	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56092524G>C	uc001shh.2	-	6	1200	c.980C>G	c.(979-981)TCA>TGA	p.S327*	ITGA7_uc001shg.2_Nonsense_Mutation_p.S323*|ITGA7_uc010sps.1_Nonsense_Mutation_p.S230*|ITGA7_uc009znw.2_5'Flank|ITGA7_uc009znx.2_Nonsense_Mutation_p.S210*	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	367	FG-GAP 5.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						CACAGCCAGTGAGTAGCCAAA	0.637													3	51	---	---	---	---	PASS
TAOK3	51347	broad.mit.edu	37	12	118615108	118615108	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118615108C>T	uc001twx.2	-	16	1888	c.1593G>A	c.(1591-1593)AAG>AAA	p.K531K	TAOK3_uc001twv.2_Silent_p.K71K|TAOK3_uc001tww.2_Silent_p.K361K|TAOK3_uc001twy.3_Silent_p.K531K	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	531					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTGGAACTTCTTCTCATCTG	0.353													17	124	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32836601	32836601	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32836601G>A	uc001utx.2	+	53	8264	c.7768G>A	c.(7768-7770)GAG>AAG	p.E2590K	FRY_uc010tdw.1_RNA|FRY_uc001uty.2_Missense_Mutation_p.E145K|FRY_uc001utz.2_Missense_Mutation_p.E115K|FRY_uc010tdx.1_5'Flank	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	2590					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCAGATTTCTGAGGGTTCAAA	0.398													26	113	---	---	---	---	PASS
C13orf36	400120	broad.mit.edu	37	13	37269395	37269395	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37269395C>G	uc001uvt.3	+	2	626	c.180C>G	c.(178-180)ATC>ATG	p.I60M		NM_203451	NP_982276	A2A2V5	CM036_HUMAN	hypothetical protein LOC400120	60	Helical; (Potential).					integral to membrane				skin(1)	1						TGCTTTTAATCATTGCCCTCC	0.478													5	179	---	---	---	---	PASS
ITGBL1	9358	broad.mit.edu	37	13	102344970	102344970	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102344970C>T	uc001vpb.2	+	8	1270	c.1051C>T	c.(1051-1053)CCA>TCA	p.P351S	ITGBL1_uc010agb.2_Missense_Mutation_p.P302S|ITGBL1_uc001vpc.3_Missense_Mutation_p.P210S	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat	351	VII.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGCTATCCTCCAGGAGATCG	0.483													21	138	---	---	---	---	PASS
EDDM3A	10876	broad.mit.edu	37	14	21216063	21216063	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21216063G>C	uc001vyb.2	+	2	391	c.324G>C	c.(322-324)GAG>GAC	p.E108D	EDDM3A_uc001vyc.2_Missense_Mutation_p.E108D	NM_006683	NP_006674	Q14507	EP3A_HUMAN	human epididymis-specific 3 alpha precursor	108					sperm displacement	extracellular space					0						GTCACTGGGAGAAGTACAACA	0.448													11	59	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23900167	23900167	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23900167C>T	uc001wjx.2	-	10	944	c.838G>A	c.(838-840)GAG>AAG	p.E280K		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	280	Myosin head-like.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TAATCTCTCTCTGCTTTCAGC	0.448													22	181	---	---	---	---	PASS
TRMT5	57570	broad.mit.edu	37	14	61446334	61446334	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61446334G>A	uc001xff.3	-	2	373	c.282C>T	c.(280-282)GTC>GTT	p.V94V	SLC38A6_uc001xfg.1_5'Flank|SLC38A6_uc001xfh.1_5'Flank|SLC38A6_uc001xfi.2_5'Flank|SLC38A6_uc001xfj.1_5'Flank|SLC38A6_uc001xfk.2_5'Flank|SLC38A6_uc010trz.1_5'Flank	NM_020810	NP_065861	Q32P41	TRMT5_HUMAN	tRNA methyltransferase 5	94						cytoplasm	tRNA (guanine-N1-)-methyltransferase activity			central_nervous_system(2)|large_intestine(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0873)		CTGGAATGTTGACTGTCTTTT	0.418													46	306	---	---	---	---	PASS
MAX	4149	broad.mit.edu	37	14	65560458	65560458	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65560458G>A	uc001xif.1	-	3	309	c.139C>T	c.(139-141)CGG>TGG	p.R47W	MAX_uc001xic.1_Missense_Mutation_p.R47W|MAX_uc001xie.1_Missense_Mutation_p.R47W|MAX_uc010aql.1_Intron|MAX_uc001xig.1_Missense_Mutation_p.R38W|MAX_uc001xih.1_RNA|MAX_uc001xii.1_Missense_Mutation_p.R38W|MAX_uc001xij.1_Missense_Mutation_p.R47W|MAX_uc001xik.2_Missense_Mutation_p.R47W	NM_002382	NP_002373	P61244	MAX_HUMAN	MAX protein isoform a	47	Helix-loop-helix motif.				transcription from RNA polymerase II promoter	cytoplasm|MLL1 complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(1)	1				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		ACTGAGTCCCGCAAACTGTGA	0.483													4	117	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088400	94088400	+	Silent	SNP	G	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088400G>T	uc001ybv.1	+	28	4439	c.4356G>T	c.(4354-4356)CTG>CTT	p.L1452L	KIAA1409_uc001ybs.1_Silent_p.L1430L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1607						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ATTTAGATCTGATAGATCTAT	0.473													13	114	---	---	---	---	PASS
CTDSPL2	51496	broad.mit.edu	37	15	44811464	44811464	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44811464G>C	uc001ztr.2	+	11	1626	c.1210G>C	c.(1210-1212)GAC>CAC	p.D404H	CTDSPL2_uc001zts.2_Missense_Mutation_p.D404H|CTDSPL2_uc001ztt.2_Missense_Mutation_p.D404H|CTDSPL2_uc010bdv.2_Missense_Mutation_p.D332H	NM_016396	NP_057480	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	404	FCP1 homology.						phosphoprotein phosphatase activity				0		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TATAATAATTGACAACTCACC	0.348													21	138	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50782647	50782647	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50782647C>A	uc001zym.3	+	15	2659	c.2159C>A	c.(2158-2160)CCA>CAA	p.P720Q	USP8_uc001zyl.3_Missense_Mutation_p.P720Q|USP8_uc001zyn.3_Missense_Mutation_p.P720Q|USP8_uc010ufh.1_Missense_Mutation_p.P614Q|USP8_uc001zyp.3_5'Flank	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	720					cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TACTCCTCCCCAGATATAACC	0.478													24	160	---	---	---	---	PASS
FEM1B	10116	broad.mit.edu	37	15	68583140	68583140	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68583140C>T	uc002arg.2	+	2	2059	c.1444C>T	c.(1444-1446)CGT>TGT	p.R482C	FEM1B_uc002arh.2_Missense_Mutation_p.R402C	NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	482					apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0						TCCCAGAACTCGTGAAGGTTT	0.438													28	178	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73615839	73615839	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73615839G>A	uc002avp.2	-	8	3589	c.2595C>T	c.(2593-2595)TTC>TTT	p.F865F		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	865	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		CGGGGGCAGAGAATCCAGCCA	0.687													4	17	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85451977	85451977	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85451977C>T	uc002blg.2	+	9	948	c.746C>T	c.(745-747)TCC>TTC	p.S249F	SLC28A1_uc010upd.1_Missense_Mutation_p.S171F|SLC28A1_uc010bnb.2_Missense_Mutation_p.S249F|SLC28A1_uc010upe.1_Missense_Mutation_p.S249F|SLC28A1_uc010upf.1_Missense_Mutation_p.S249F|SLC28A1_uc010upg.1_Missense_Mutation_p.S249F	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	249					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGGCTGGCTCCAGCTTCGTG	0.562													11	44	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86189140	86189140	+	Silent	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86189140C>G	uc002blv.1	+	10	4499	c.4329C>G	c.(4327-4329)CTC>CTG	p.L1443L	AKAP13_uc002blt.1_Silent_p.L1443L|AKAP13_uc002blu.1_Silent_p.L1443L|AKAP13_uc010bnf.1_Silent_p.L83L|AKAP13_uc010bne.1_Silent_p.L96L	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1443					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						ATTCTGACCTCTTTCACTCAC	0.438													39	215	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18859259	18859259	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18859259G>A	uc002dfm.2	-	37	6083	c.5720C>T	c.(5719-5721)TCT>TTT	p.S1907F	SMG1_uc010bwb.2_Missense_Mutation_p.S1767F|SMG1_uc010bwa.2_Missense_Mutation_p.S638F|SMG1_uc002dfo.3_Missense_Mutation_p.S205F	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1907	Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						GCTATCCTGAGATGCAGGAGG	0.398													24	114	---	---	---	---	PASS
ZNF668	79759	broad.mit.edu	37	16	31073360	31073360	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31073360G>A	uc010caf.2	-	3	1246	c.889C>T	c.(889-891)CGC>TGC	p.R297C	ZNF668_uc002eao.2_Missense_Mutation_p.R297C	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	297	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						CGCTGGTGGCGACGGAAGCTC	0.682													4	18	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76513385	76513385	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76513385C>T	uc002feu.1	+	14	2217	c.1832C>T	c.(1831-1833)TCA>TTA	p.S611L	CNTNAP4_uc002fev.1_Missense_Mutation_p.S475L|CNTNAP4_uc010chb.1_Missense_Mutation_p.S538L|CNTNAP4_uc002fex.1_Missense_Mutation_p.S614L|CNTNAP4_uc002few.2_Missense_Mutation_p.S586L	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	611	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TATATAGATTCAGATGGAAGT	0.333													13	233	---	---	---	---	PASS
TUBB3	10381	broad.mit.edu	37	16	89985855	89985855	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89985855C>T	uc002fpf.2	+	1	597	c.189C>T	c.(187-189)ATC>ATT	p.I63I	MC1R_uc002fpe.3_Silent_p.I63I|TUBB3_uc010ciz.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	Error:Variant_position_missing_in_Q13509_after_alignment					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TGGCCACCATCGCCAAGAACC	0.642													8	62	---	---	---	---	PASS
WDR81	124997	broad.mit.edu	37	17	1639342	1639342	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1639342C>T	uc002fti.2	+	9	1915	c.1654C>T	c.(1654-1656)CGA>TGA	p.R552*	WDR81_uc002fth.2_Nonsense_Mutation_p.R728*|WDR81_uc010vqp.1_Nonsense_Mutation_p.R576*|WDR81_uc002ftj.2_Nonsense_Mutation_p.R1779*|WDR81_uc010vqq.1_Nonsense_Mutation_p.R410*	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4	552										skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCACGAGTTCCGACTGGGCGG	0.662													8	53	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195210	3195210	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195210G>A	uc002fvh.1	-	1	667	c.667C>T	c.(667-669)CAC>TAC	p.H223Y		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	223	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						GCTGCCACGTGGATATAGGAG	0.527													5	45	---	---	---	---	PASS
SHBG	6462	broad.mit.edu	37	17	7534569	7534569	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7534569G>C	uc002gie.2	+	4	483	c.445G>C	c.(445-447)GAG>CAG	p.E149Q	SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Missense_Mutation_p.E91Q|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmt.2_Missense_Mutation_p.E91Q|SHBG_uc010cmu.2_Missense_Mutation_p.E91Q|SHBG_uc010cmz.2_Missense_Mutation_p.E91Q|SHBG_uc010cmv.2_Intron|SHBG_uc010cmw.2_Intron|SHBG_uc010cmx.2_Intron|SHBG_uc010cmy.2_Missense_Mutation_p.E91Q|SHBG_uc002gid.3_Missense_Mutation_p.E91Q|SHBG_uc010cnd.2_Intron|SHBG_uc010cna.2_Intron|SHBG_uc010vue.1_Missense_Mutation_p.E149Q|SHBG_uc010vuf.1_Missense_Mutation_p.E149Q|SHBG_uc010cnb.2_Missense_Mutation_p.E149Q|SHBG_uc010cnc.2_Intron	NM_001040	NP_001031	P04278	SHBG_HUMAN	sex hormone-binding globulin isoform 1	149	Laminin G-like 1.				hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.0?(1)|p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)	GGATGGGGAGGAGGTGCTGCG	0.607													3	13	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8168914	8168914	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8168914C>G	uc002gkr.2	+	20	2643	c.2502C>G	c.(2500-2502)ATC>ATG	p.I834M	PFAS_uc010vuv.1_Missense_Mutation_p.I410M|PFAS_uc002gks.2_5'Flank	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	834					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GCCCAGACATCACAGCCACTG	0.532													6	74	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18045516	18045516	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18045516C>G	uc010vxh.1	+	23	6111	c.5773C>G	c.(5773-5775)CTG>GTG	p.L1925V		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1925	Neck or regulatory domain.|IQ 2.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					ATTCCGCTCTCTGCGCCACAA	0.592													6	30	---	---	---	---	PASS
THRA	7067	broad.mit.edu	37	17	38240101	38240101	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38240101G>A	uc002htw.2	+	5	719	c.236G>A	c.(235-237)CGC>CAC	p.R79H	THRA_uc010cwp.1_Missense_Mutation_p.R79H|THRA_uc002htv.2_Missense_Mutation_p.R79H|THRA_uc002htx.2_Missense_Mutation_p.R79H	NM_003250	NP_003241	P10827	THA_HUMAN	thyroid hormone receptor, alpha isoform 2	79	Nuclear receptor.				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)	TTCTTTCGCCGCACAATCCAG	0.547													4	130	---	---	---	---	PASS
JUP	3728	broad.mit.edu	37	17	39913796	39913796	+	Intron	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39913796G>A	uc002hxq.2	-						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Intron|JUP_uc002hxs.2_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TGGCTGAGCAGAGAGGAAAGG	0.637													11	51	---	---	---	---	PASS
STAT3	6774	broad.mit.edu	37	17	40475064	40475064	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40475064C>T	uc002hzl.1	-	20	2086	c.1846G>A	c.(1846-1848)GAA>AAA	p.E616K	STAT3_uc002hzk.1_Missense_Mutation_p.E616K|STAT3_uc002hzm.1_Missense_Mutation_p.E616K|STAT3_uc010wgh.1_Missense_Mutation_p.E518K|STAT3_uc002hzn.1_Missense_Mutation_p.E616K	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	616	SH2.				cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		ACGCCTCCTTCTTTGCTGCTT	0.567									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome		OREG0024421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	164	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41215378	41215378	+	Missense_Mutation	SNP	G	A	A	rs80357104		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41215378G>A	uc002icq.2	-	18	5397	c.5165C>T	c.(5164-5166)TCT>TTT	p.S1722F	BRCA1_uc010whp.1_Missense_Mutation_p.S571F|BRCA1_uc010whl.1_Missense_Mutation_p.S618F|BRCA1_uc010whm.1_Missense_Mutation_p.S32F|BRCA1_uc002icp.3_Missense_Mutation_p.S1651F|BRCA1_uc002icu.2_Missense_Mutation_p.S618F|BRCA1_uc010cyx.2_Missense_Mutation_p.S1675F|BRCA1_uc002ict.2_Missense_Mutation_p.S1743F|BRCA1_uc010whn.1_Missense_Mutation_p.S213F|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Missense_Mutation_p.S451F|BRCA1_uc002idc.1_Missense_Mutation_p.S618F|BRCA1_uc010whr.1_Missense_Mutation_p.S572F	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1722	BRCT 1.				androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTCTTTAATAGACTGGGTCAC	0.363			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			11	57	---	---	---	---	PASS
C17orf71	55181	broad.mit.edu	37	17	57287571	57287571	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57287571C>A	uc002ixi.2	+	1	201	c.159C>A	c.(157-159)TTC>TTA	p.F53L		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	53					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					TGGGAATCTTCGGCAAGACGG	0.607													8	40	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62892842	62892842	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62892842C>G	uc002jey.2	-	3	1065	c.534G>C	c.(532-534)CAG>CAC	p.Q178H	LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	178	Extracellular (Potential).					integral to membrane					0						TCTGCAAAGTCTGTTTCTGAC	0.493													41	271	---	---	---	---	PASS
NAT9	26151	broad.mit.edu	37	17	72767864	72767864	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72767864C>T	uc002jlq.2	-	7	697	c.623G>A	c.(622-624)TGA>TAA	p.*208*	NAT9_uc002jlr.2_Silent_p.*207*	NM_015654	NP_056469	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9	208						protein complex	N-acetyltransferase activity				0						GCCCAGCCATCAGCAGGGCTC	0.602													7	20	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73624482	73624482	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73624482G>A	uc010dgl.2	-	18	2777	c.2621C>T	c.(2620-2622)TCA>TTA	p.S874L	RECQL5_uc010dgk.2_Missense_Mutation_p.S847L|RECQL5_uc002jot.3_Missense_Mutation_p.S70L	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	874					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGGCTTGGCTGAGGGGCGTGG	0.647								Other_identified_genes_with_known_or_suspected_DNA_repair_function					11	64	---	---	---	---	PASS
ZNF271	10778	broad.mit.edu	37	18	32887449	32887449	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32887449C>T	uc002kyq.3	+	3	1853	c.861C>T	c.(859-861)TTC>TTT	p.F287F	ZNF271_uc002kyp.3_Silent_p.F287F|ZNF271_uc002kyr.3_Silent_p.F287F	NR_024565				SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;												0						GGAAGGCTTTCAGTCAGTGCT	0.458													9	75	---	---	---	---	PASS
ZNF271	10778	broad.mit.edu	37	18	32887460	32887460	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32887460C>T	uc002kyq.3	+	3	1864	c.872C>T	c.(871-873)TCA>TTA	p.S291L	ZNF271_uc002kyp.3_Missense_Mutation_p.S291L|ZNF271_uc002kyr.3_Missense_Mutation_p.S291L	NR_024565				SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;												0						AGTCAGTGCTCAGCTCTTACC	0.448													11	69	---	---	---	---	PASS
ZNF271	10778	broad.mit.edu	37	18	32887561	32887561	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32887561C>G	uc002kyq.3	+	3	1965	c.973C>G	c.(973-975)CAA>GAA	p.Q325E	ZNF271_uc002kyp.3_Missense_Mutation_p.Q325E|ZNF271_uc002kyr.3_Missense_Mutation_p.Q325E	NR_024565				SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;												0						CATTAACCATCAAAAAATACA	0.433													13	69	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61324655	61324655	+	Intron	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61324655G>C	uc002ljg.2	-						SERPINB3_uc002lji.2_Intron|SERPINB3_uc010dqa.2_Intron			P48594	SPB4_HUMAN	SubName: Full=Squamous cell carcinoma antigen 2;						immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						TTCTGCAAGGGAAAGAATAAA	0.378													20	128	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6901986	6901986	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6901986C>T	uc002mfw.2	+	6	653	c.615C>T	c.(613-615)TCC>TCT	p.S205S	EMR1_uc010dvc.2_Silent_p.S205S|EMR1_uc010dvb.2_Silent_p.S153S|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	205	Extracellular (Potential).|EGF-like 4; calcium-binding (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					GATTTGAATCCAGCAGTGGCC	0.478													45	280	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7671660	7671660	+	Intron	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7671660C>T	uc002mgv.3	+						KIAA1543_uc002mgu.3_Intron	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2						epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						TCTCTGGCCTCAGTGCCCTAC	0.577													5	16	---	---	---	---	PASS
KIAA1683	80726	broad.mit.edu	37	19	18378221	18378221	+	Silent	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18378221G>C	uc002nin.2	-	3	345	c.129C>G	c.(127-129)CTC>CTG	p.L43L	KIAA1683_uc010ebn.2_Silent_p.L43L|KIAA1683_uc010xqe.1_5'UTR	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN	KIAA1683 isoform b	43						mitochondrion				ovary(2)	2						TTTTGTCCAGGAGACTGGGGT	0.632													14	121	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21991529	21991529	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21991529C>A	uc002nqj.2	-	4	1440	c.1310G>T	c.(1309-1311)TGG>TTG	p.W437L	ZNF43_uc010ecv.2_Missense_Mutation_p.W431L|ZNF43_uc002nql.2_Missense_Mutation_p.W431L|ZNF43_uc002nqm.2_Missense_Mutation_p.W431L|ZNF43_uc002nqk.2_Missense_Mutation_p.W367L	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	437	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		GGTTGAGGGCCAGTTAAAGGC	0.398													4	143	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32954774	32954774	+	Splice_Site	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32954774G>C	uc002ntg.2	+	14	1622	c.1446_splice	c.e14-1	p.R482_splice	DPY19L3_uc002nth.1_Splice_Site_p.G482_splice|DPY19L3_uc002nti.1_Splice_Site	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3							integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					TGTTCTTGCAGAATGAAGTAC	0.433													39	250	---	---	---	---	PASS
RHPN2	85415	broad.mit.edu	37	19	33502623	33502623	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33502623G>A	uc002nuf.2	-	6	621	c.555C>T	c.(553-555)TTC>TTT	p.F185F	RHPN2_uc010xro.1_Silent_p.F34F|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	185	BRO1.				signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					TGGGCGGGAAGAATCGACTCT	0.577													10	43	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36271142	36271142	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36271142C>T	uc002obr.1	+	7	616	c.531C>T	c.(529-531)CTC>CTT	p.L177L	ARHGAP33_uc002obs.1_Silent_p.L177L|ARHGAP33_uc002obt.1_Silent_p.L41L|ARHGAP33_uc010eel.2_5'Flank|ARHGAP33_uc002obv.1_5'Flank	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	177					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						GACTGCTCCTCAGTGAGGAGG	0.577													9	45	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229932	38229932	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229932G>C	uc002ohe.2	-	4	1481	c.1459C>G	c.(1459-1461)CAA>GAA	p.Q487E	ZNF573_uc010efs.2_Missense_Mutation_p.Q400E|ZNF573_uc002ohd.2_Missense_Mutation_p.Q485E|ZNF573_uc002ohf.2_Missense_Mutation_p.Q429E|ZNF573_uc002ohg.2_Missense_Mutation_p.Q399E	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	467	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTCCGATGTTGAATAAGGTTT	0.368													29	145	---	---	---	---	PASS
AXL	558	broad.mit.edu	37	19	41759596	41759596	+	Silent	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41759596G>C	uc010ehj.2	+	17	2209	c.2019G>C	c.(2017-2019)CTG>CTC	p.L673L	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehk.2_Silent_p.L664L	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	673	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						ACCGGGACCTGGCGGCCAGGA	0.582													6	34	---	---	---	---	PASS
MIR516A1	574498	broad.mit.edu	37	19	54259998	54259998	+	RNA	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54259998C>T	hsa-mir-516a-1|MI0003180	+			c.4C>T			MIR1283-2_hsa-mir-1283-2|MI0006430_5'Flank																	0						AGCAAGATCTCAGGCTGTGAC	0.413													41	222	---	---	---	---	PASS
LENG1	79165	broad.mit.edu	37	19	54659533	54659533	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54659533G>A	uc002qdm.2	-	4	734	c.721C>T	c.(721-723)CGG>TGG	p.R241W		NM_024316	NP_077292	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	241										ovary(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TTGTACCGCCGCCGCCGGTCA	0.682													3	11	---	---	---	---	PASS
ZNF671	79891	broad.mit.edu	37	19	58233778	58233778	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58233778G>A	uc002qpz.3	-	3	393	c.294C>T	c.(292-294)GTC>GTT	p.V98V	ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Silent_p.V21V|ZNF671_uc010yhf.1_5'UTR	NM_024833	NP_079109	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	98	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTAGTTTCATGACTGCACGTG	0.522													40	194	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13899729	13899729	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13899729G>A	uc010gcf.2	-	4	406	c.324C>T	c.(322-324)GAC>GAT	p.D108D	SEL1L2_uc002woq.3_5'UTR|SEL1L2_uc010zrl.1_Silent_p.D108D|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	108	Extracellular (Potential).|Sel1-like 1.					integral to membrane	binding			ovary(2)	2						TAAATAGCTGGTCTCCTTCAT	0.313													21	150	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16485148	16485148	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16485148G>C	uc002wpg.1	-	10	1203	c.1045C>G	c.(1045-1047)CTT>GTT	p.L349V	KIF16B_uc010gch.1_Missense_Mutation_p.L349V|KIF16B_uc010gci.1_Missense_Mutation_p.L349V|KIF16B_uc010gcj.1_Missense_Mutation_p.L349V	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	349	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						GCATAGCGAAGAGTACTTAGG	0.398													28	163	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30746296	30746296	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30746296C>T	uc002wxj.2	+	15	1783	c.1548C>T	c.(1546-1548)ATC>ATT	p.I516I	TM9SF4_uc010zts.1_Silent_p.I423I|TM9SF4_uc002wxk.2_Silent_p.I499I|TM9SF4_uc010gdz.2_Silent_p.I395I	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	516	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCATGTTCATCGAGCTCTTCT	0.552													5	73	---	---	---	---	PASS
DDX27	55661	broad.mit.edu	37	20	47859223	47859223	+	Intron	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47859223G>C	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AGCTGGGTAGGATTTTAAGTC	0.294													11	99	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50776785	50776785	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50776785C>T	uc002xwl.2	-	5	989	c.640G>A	c.(640-642)GAC>AAC	p.D214N	ZFP64_uc002xwk.2_Missense_Mutation_p.D214N|ZFP64_uc002xwm.2_Missense_Mutation_p.D212N|ZFP64_uc002xwn.2_Missense_Mutation_p.D160N	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	214	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CTGCTGCTGTCGGCAGCGGCG	0.592													11	79	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027331	55027331	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027331G>C	uc002xxp.2	+	6	1324	c.1099G>C	c.(1099-1101)GAG>CAG	p.E367Q	CASS4_uc002xxq.3_Missense_Mutation_p.E367Q|CASS4_uc002xxr.2_Missense_Mutation_p.E367Q|CASS4_uc010zze.1_Missense_Mutation_p.E313Q|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	367					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						GAAGGAGCTGGAGAAAGCCAA	0.507													9	51	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32638880	32638880	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32638880C>A	uc002yow.1	-	5	881	c.409G>T	c.(409-411)GAT>TAT	p.D137Y	TIAM1_uc011adk.1_Missense_Mutation_p.D137Y|TIAM1_uc011adl.1_Missense_Mutation_p.D137Y|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	137					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GTAGCGTCATCCCCGTAAAGC	0.547													14	71	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40568805	40568805	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40568805C>T	uc002yxk.1	-	41	6329	c.6190G>A	c.(6190-6192)GAG>AAG	p.E2064K	BRWD1_uc010goc.1_Missense_Mutation_p.E707K|BRWD1_uc002yxl.2_Missense_Mutation_p.E2064K	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	2064					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTATCAGTCTCACTCCCTGGA	0.393													38	233	---	---	---	---	PASS
MX1	4599	broad.mit.edu	37	21	42812922	42812922	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42812922G>C	uc002yzh.2	+	11	1647	c.700G>C	c.(700-702)GAG>CAG	p.E234Q	MX1_uc002yzi.2_Missense_Mutation_p.E234Q|MX1_uc010goq.2_Missense_Mutation_p.E234Q	NM_001144925	NP_001138397	P20591	MX1_HUMAN	myxovirus resistance protein 1	234					induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CATGGCCCAGGAGGTGGACCC	0.612													16	76	---	---	---	---	PASS
C22orf29	79680	broad.mit.edu	37	22	19839483	19839483	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19839483C>T	uc002zqg.2	-	2	901	c.302G>A	c.(301-303)GGC>GAC	p.G101D	GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqe.1_Intron|GNB1L_uc002zqf.1_Intron|C22orf29_uc002zqh.2_Missense_Mutation_p.G101D|C22orf29_uc002zqi.2_Missense_Mutation_p.G101D|C22orf29_uc010grt.1_Intron	NM_024627	NP_078903	Q7L3V2	CV029_HUMAN	hypothetical protein LOC79680	101											0	Colorectal(54;0.0993)					TGGGTCTGAGCCTGGTACCCA	0.607													12	70	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21119489	21119489	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21119489C>G	uc002zsz.3	-	21	2530	c.2299G>C	c.(2299-2301)GAA>CAA	p.E767Q		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	767					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GTGGCTATTTCACAGACCCCC	0.517													19	146	---	---	---	---	PASS
MAPK1	5594	broad.mit.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22127164C>T	uc002zvn.2	-	7	1204	c.964G>A	c.(964-966)GAG>AAG	p.E322K	MAPK1_uc002zvo.2_Missense_Mutation_p.E322K|MAPK1_uc010gtk.1_Missense_Mutation_p.E278K	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	GCTCTTACCTCGTCACTCGGG	0.478													14	68	---	---	---	---	PASS
NDUFA6	4700	broad.mit.edu	37	22	42483075	42483075	+	Silent	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42483075G>A	uc003bcb.2	-	2	384	c.322C>T	c.(322-324)CTG>TTG	p.L108L		NM_002490	NP_002481	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	108					mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	TTAATGACCAGAAGATCAACC	0.433													38	271	---	---	---	---	PASS
PHF21B	112885	broad.mit.edu	37	22	45278961	45278961	+	3'UTR	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45278961C>T	uc003bfn.2	-	13					PHF21B_uc003bfm.2_3'UTR|PHF21B_uc011aqk.1_3'UTR|PHF21B_uc011aql.1_3'UTR	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		ACTGGTCCCTCGGGGTCAGTT	0.592													29	132	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5811015	5811015	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5811015C>T	uc010ndh.2	-	6	2795	c.2294G>A	c.(2293-2295)CGC>CAC	p.R765H	NLGN4X_uc004crp.2_Missense_Mutation_p.R785H|NLGN4X_uc004crq.2_Missense_Mutation_p.R765H|NLGN4X_uc010ndi.2_Missense_Mutation_p.R802H|NLGN4X_uc004crr.2_Missense_Mutation_p.R765H|NLGN4X_uc010ndj.2_Missense_Mutation_p.R765H	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	765	Cytoplasmic (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						TGGCGACCGGCGCAGCGTGAG	0.562													18	84	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18748335	18748335	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18748335G>A	uc004cyq.2	+	5	564	c.83G>A	c.(82-84)CGA>CAA	p.R28Q	PPEF1_uc004cyp.2_Missense_Mutation_p.R28Q|PPEF1_uc004cyr.2_Missense_Mutation_p.R28Q|PPEF1_uc004cys.2_Missense_Mutation_p.R28Q|PPEF1_uc011mja.1_Intron|PPEF1_uc011mjb.1_5'UTR	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	28	IQ.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AACTGGTACCGAGGTTACAAA	0.458													19	158	---	---	---	---	PASS
FAM48B2	170067	broad.mit.edu	37	X	24329676	24329676	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24329676T>A	uc011mjw.1	-	1	1757	c.1757A>T	c.(1756-1758)CAG>CTG	p.Q586L		NM_001136233	NP_001129705	P0C7V6	F48B2_HUMAN	family with sequence similarity 48, member B2	586											0						CCCCAAAACCTGGGCTCCCCG	0.637													4	9	---	---	---	---	PASS
PRRG1	5638	broad.mit.edu	37	X	37312800	37312800	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37312800G>A	uc004ddn.2	+	5	836	c.583G>A	c.(583-585)GAG>AAG	p.E195K	PRRG1_uc004ddo.2_Missense_Mutation_p.E195K	NM_000950	NP_000941	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	195	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	calcium ion binding			ovary(1)|breast(1)	2						CCCACCCCCAGAGTATGAGGA	0.498													8	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	47664154	47664154	+	IGR	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47664154C>G								LOC100133957 (144378 upstream) : ZNF81 (32147 downstream)																							GAAGATGACTCCTCTGAATTT	0.493													14	81	---	---	---	---	PASS
PRICKLE3	4007	broad.mit.edu	37	X	49032207	49032207	+	Missense_Mutation	SNP	C	T	T	rs144390456	byFrequency	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49032207C>T	uc004dmy.1	-	9	1689	c.1663G>A	c.(1663-1665)GAA>AAA	p.E555K	PRICKLE3_uc011mmv.1_Missense_Mutation_p.E487K|PRICKLE3_uc011mmw.1_Missense_Mutation_p.E474K|PRICKLE3_uc011mmx.1_Missense_Mutation_p.E517K	NM_006150	NP_006141	O43900	PRIC3_HUMAN	LIM domain only 6	555	Poly-Ser.						protein binding|zinc ion binding			breast(1)	1						TCTGATGATTCGGAACTGGAA	0.567													31	158	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64722635	64722635	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64722635C>T	uc010nko.2	+	5	2033	c.2024C>T	c.(2023-2025)CCT>CTT	p.P675L		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	675							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						AATATCCATCCTGGGGCAACC	0.587													9	35	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67339181	67339181	+	Intron	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67339181G>A	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						GGATCTATTTGAGAAAAGTAA	0.313													9	77	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68383010	68383010	+	Silent	SNP	C	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68383010C>T	uc004dxh.2	-	2	358	c.72G>A	c.(70-72)AGG>AGA	p.R24R	PJA1_uc011mpi.1_Intron|PJA1_uc004dxg.2_Silent_p.R24R|PJA1_uc004dxi.2_Intron	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	24							zinc ion binding				0						TTCTTCCATACCTCCTACCTG	0.512													17	140	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100604945	100604945	+	Intron	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100604945C>G	uc004ehg.2	-						TIMM8A_uc004ehd.2_5'Flank|TIMM8A_uc011mri.1_5'Flank|BTK_uc004ehf.2_Intron|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_Intron|BTK_uc010nnj.2_Intron|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Intron|BTK_uc010nnn.2_Intron|BTK_uc010nno.2_Intron	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						CATCTGCTTTCTAAAACCAAA	0.363									Agammaglobulinemia_X-linked				29	157	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107834847	107834847	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107834847G>A	uc004enz.1	+	21	1598	c.1396G>A	c.(1396-1398)GGA>AGA	p.G466R	COL4A5_uc011mso.1_Missense_Mutation_p.G466R|COL4A5_uc004eob.1_Missense_Mutation_p.G74R	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	466	Triple-helical region.		G -> E (in APSX).		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						AGGTGATAAAGGACTCCAAGG	0.408									Alport_syndrome_with_Diffuse_Leiomyomatosis				25	174	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130410033	130410033	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130410033C>G	uc004ewd.2	-	15	3036	c.2798G>C	c.(2797-2799)GGA>GCA	p.G933A	IGSF1_uc004ewe.3_Missense_Mutation_p.G927A|IGSF1_uc004ewf.2_Missense_Mutation_p.G913A	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	933	Extracellular (Potential).|Ig-like C2-type 9.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GTCCTCTGCTCCAACAGTGTG	0.517													16	103	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	147733590	147733590	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147733590G>A	uc004fcp.2	+	2	597	c.118G>A	c.(118-120)GAA>AAA	p.E40K	AFF2_uc004fco.2_Missense_Mutation_p.E40K|AFF2_uc004fcq.2_Missense_Mutation_p.E40K|AFF2_uc004fcr.2_Missense_Mutation_p.E40K|AFF2_uc011mxb.1_Missense_Mutation_p.E40K|AFF2_uc004fcs.2_Missense_Mutation_p.E40K	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	40					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AGTCCAGCAAGAAGACGATCT	0.383													31	308	---	---	---	---	PASS
LZIC	84328	broad.mit.edu	37	1	9992160	9992163	+	Intron	DEL	GGGG	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9992160_9992163delGGGG	uc001aqm.2	-						LZIC_uc001aqn.2_Intron|LZIC_uc001aqo.2_Intron|LZIC_uc009vmr.2_Intron|LZIC_uc010oah.1_Intron	NM_032368	NP_115744	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing								beta-catenin binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		tgggaggcgtgggggggggggggg	0.103													5	3	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16953130	16953131	+	5'Flank	INS	-	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16953130_16953131insA	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0						GCGTGAGATGGAAAAAAAAATC	0.545													4	2	---	---	---	---	
POMGNT1	55624	broad.mit.edu	37	1	46655768	46655769	+	Intron	DEL	TC	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46655768_46655769delTC	uc001cpe.2	-						POMGNT1_uc010olx.1_Intron|POMGNT1_uc010oly.1_Intron|POMGNT1_uc010olz.1_Intron|POMGNT1_uc001cpg.2_Intron|POMGNT1_uc001cpf.2_Intron	NM_017739	NP_060209	Q8WZA1	PMGT1_HUMAN	O-linked mannose						protein N-linked glycosylation|protein O-linked glycosylation	Golgi membrane|integral to membrane|microsome	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					accttgaagttctttttttttt	0.149													5	3	---	---	---	---	
USP33	23032	broad.mit.edu	37	1	78163754	78163754	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78163754delT	uc001dht.2	-						USP33_uc009wca.1_5'Flank|USP33_uc001dhs.2_Intron|USP33_uc001dhu.2_Intron	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TAGTTAAttcttttttttttt	0.129													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100088798	100088798	+	IGR	DEL	G	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100088798delG								LPPR4 (313662 upstream) : PALMD (22633 downstream)																							aaaaaaaaaagaaaaagaaag	0.100													3	4	---	---	---	---	
C1orf124	83932	broad.mit.edu	37	1	231475793	231475794	+	Intron	INS	-	A	A	rs3071954		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231475793_231475794insA	uc001hur.2	+						EXOC8_uc001huq.2_5'Flank|C1orf124_uc001hus.2_Intron|C1orf124_uc001hut.2_Intron	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a						DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TGCTTCATAGTAAAAAAAAAAA	0.203													4	3	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245446118	245446118	+	Intron	DEL	A	-	-	rs34770861		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245446118delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ccgctcctttaaaAAAAAAGA	0.179													6	10	---	---	---	---	
TTLL4	9654	broad.mit.edu	37	2	219616632	219616633	+	Intron	DEL	TC	-	-	rs59713184		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219616632_219616633delTC	uc002viy.2	+						TTLL4_uc010zkl.1_Intron|TTLL4_uc010fvx.2_Intron|TTLL4_uc010zkm.1_Intron	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4						protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		cttttctttttctttttttttt	0.183													4	3	---	---	---	---	
RHBDD1	84236	broad.mit.edu	37	2	227833659	227833659	+	Intron	DEL	T	-	-	rs11362668		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227833659delT	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		ttggaaacagttaaacattgt	0.169													1	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32676648	32676649	+	IGR	INS	-	T	T	rs35155529		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32676648_32676649insT								DYNC1LI1 (64298 upstream) : CNOT10 (50049 downstream)																							gcatctcaatcttTTTTTTTTT	0.153													4	2	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47129455	47129458	+	Intron	DEL	AAAC	-	-	rs66851205		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47129455_47129458delAAAC	uc003cqs.2	-						SETD2_uc003cqv.2_Intron	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		gaccccatctaaacaaacaaacaa	0.078			N|F|S|Mis		clear cell renal carcinoma								6	3	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185985725	185985726	+	Intron	DEL	GT	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185985725_185985726delGT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	gtgtgtgcacgtgtgtgtgtgt	0.475													4	2	---	---	---	---	
HTN1	3346	broad.mit.edu	37	4	70920344	70920344	+	Intron	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70920344delA	uc003hex.2	+							NM_002159	NP_002150	P15515	HIS1_HUMAN	histatin 1 precursor						biomineral tissue development|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			skin(1)	1						CTTGTGTCCTAAAAGCATTTC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111323431	111323447	+	IGR	DEL	TTCCTTCCTTCCTCCCT	-	-	rs6817024		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111323431_111323447delTTCCTTCCTTCCTCCCT								ELOVL6 (203611 upstream) : ENPEP (73782 downstream)																							ccttccttccttccttccttcctcccttcccttccct	0.097													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	125391768	125391771	+	IGR	DEL	TCTT	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125391768_125391771delTCTT								LOC285419 (540250 upstream) : ANKRD50 (193697 downstream)																							tctccctttctctttctttctttc	0.049													4	3	---	---	---	---	
SPOCK3	50859	broad.mit.edu	37	4	167663376	167663379	+	Intron	DEL	TCTA	-	-	rs141328456		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167663376_167663379delTCTA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CATACATGTGtctatctatcatct	0.211													3	3	---	---	---	---	
KIAA1712	80817	broad.mit.edu	37	4	175238738	175238739	+	3'UTR	INS	-	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175238738_175238739insT	uc003itr.2	+	12					KIAA1712_uc010iro.2_Intron|KIAA1712_uc003its.2_RNA	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN	HBV PreS1-transactivated protein 3 isoform a							centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)		CCTTGTGTCACTTTTTTTTTTT	0.302													4	2	---	---	---	---	
KLKB1	3818	broad.mit.edu	37	4	187149200	187149201	+	Intron	INS	-	A	A	rs138397648	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187149200_187149201insA	uc003iyy.2	+						KLKB1_uc011clc.1_Intron|KLKB1_uc011cld.1_Intron	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor						blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		ACAAATGTACCAAAAAAAAACC	0.327													4	3	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TGATTATCTGCttttttttttt	0.233													3	3	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19747498	19747499	+	Intron	INS	-	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747498_19747499insT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTTTCTGCAGTTTTTTTTTTT	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	104467112	104467115	+	IGR	DEL	CTTC	-	-	rs7733624	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104467112_104467115delCTTC								RAB9BP1 (31314 upstream) : None (None downstream)																							TAAGTGCAAActtccttccttcct	0.196													4	2	---	---	---	---	
SLU7	10569	broad.mit.edu	37	5	159834330	159834331	+	Intron	INS	-	TGTA	TGTA	rs146511469	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159834330_159834331insTGTA	uc003lyg.2	-							NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7						alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tcatacaAAATTACCATCTGAC	0.168													3	3	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810500	35810501	+	Intron	INS	-	T	T	rs71652741		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810500_35810501insT	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						CTTATAGATCATTTAAAAAAAA	0.307													3	3	---	---	---	---	
HACE1	57531	broad.mit.edu	37	6	105300073	105300074	+	Intron	DEL	TC	-	-	rs2499661	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105300073_105300074delTC	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GTCCAAACtgtctgtgtgtgtg	0.119													6	3	---	---	---	---	
PHACTR2	9749	broad.mit.edu	37	6	144128096	144128096	+	Intron	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144128096delA	uc003qjq.3	+						PHACTR2_uc010khh.2_Intron|PHACTR2_uc010khi.2_Intron|PHACTR2_uc003qjr.3_Intron	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3								actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		tctatctcttaaaaaaaaaaa	0.149													8	6	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159146359	159146360	+	Intron	DEL	GT	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159146359_159146360delGT	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		gtgtgtgtgcgtgtgtgtgtgt	0.386													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57929445	57929445	+	IGR	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57929445delA								ZNF716 (396180 upstream) : None (None downstream)																							ACAAGAGACTAGGGGGATAAG	0.403													4	2	---	---	---	---	
CCL26	10344	broad.mit.edu	37	7	75419475	75419476	+	5'Flank	INS	-	CCTT	CCTT			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419475_75419476insCCTT	uc003udt.1	-							NM_006072	NP_006063	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						ctgtctctctcccttccttcct	0.000													1	6	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152445928	152445928	+	IGR	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152445928delA								XRCC2 (72678 upstream) : ACTR3B (10923 downstream)																							gctctgtctcaaaaaaaaaaa	0.229													5	3	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104922219	104922220	+	Intron	DEL	TA	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922219_104922220delTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGCACTCACTATATATATATA	0.282										HNSCC(12;0.0054)			8	5	---	---	---	---	
NDUFB9	4715	broad.mit.edu	37	8	125555195	125555196	+	Intron	INS	-	G	G	rs142132603	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125555195_125555196insG	uc003yrg.3	+						NDUFB9_uc011lim.1_Intron	NM_005005	NP_004996	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|sensory perception of sound|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			ovary(1)|skin(1)	2	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)		NADH(DB00157)	ATGATACGGCTGCTCCATTGGG	0.475													7	4	---	---	---	---	
SCRIB	23513	broad.mit.edu	37	8	144873997	144873997	+	Intron	DEL	A	-	-	rs6982642		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144873997delA	uc003yzp.1	-						SCRIB_uc003yzn.1_Intron|SCRIB_uc003yzo.1_Intron	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b						activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCCAGACCCCACCCCCATGCC	0.677													6	4	---	---	---	---	
RASEF	158158	broad.mit.edu	37	9	85619330	85619331	+	Intron	INS	-	TTTATTCTATTA	TTTATTCTATTA			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85619330_85619331insTTTATTCTATTA	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						TATTCTATTATTTTAATCCACC	0.302													5	4	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													4	3	---	---	---	---	
APBB1IP	54518	broad.mit.edu	37	10	26828336	26828337	+	Intron	INS	-	A	A	rs113271338		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26828336_26828337insA	uc001iss.2	+						APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						atgagatcctgaaaaaaaaaaa	0.025													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30450743	30450744	+	IGR	INS	-	T	T	rs148421389		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30450743_30450744insT								KIAA1462 (46323 upstream) : MTPAP (147987 downstream)																							ATAGTTCCGGGttttttttttt	0.307													6	5	---	---	---	---	
C10orf58	84293	broad.mit.edu	37	10	82186899	82186899	+	Intron	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82186899delA	uc001kcc.3	+						C10orf58_uc001kcd.3_Intron|C10orf58_uc001kce.3_Intron|C10orf58_uc001kcf.3_Intron	NM_032333	NP_115709	Q9BRX8	CJ058_HUMAN	hypothetical protein LOC84293 precursor							extracellular region					0			Colorectal(32;0.229)			actccatctcaaaaaaaaaaa	0.219													5	3	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13722198	13722199	+	Intron	INS	-	TCT	TCT	rs137872059	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13722198_13722199insTCT	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						TAAAAGAATTCTCTTCTTCTTC	0.317													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30932782	30932783	+	Intron	INS	-	T	T	rs72110565		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30932782_30932783insT	uc001mss.1	-						uc009yjk.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		TTCTATGACAGTTTTTTTTTTT	0.272													4	2	---	---	---	---	
NUP160	23279	broad.mit.edu	37	11	47804929	47804929	+	Intron	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47804929delA	uc001ngm.2	-						NUP160_uc009ylw.2_Intron	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						GGGAGTTAGGAAAAAAAAAAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115497786	115497786	+	IGR	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115497786delT								CADM1 (122545 upstream) : None (None downstream)																							ttccccctccttttttttttt	0.000													4	2	---	---	---	---	
PDE3A	5139	broad.mit.edu	37	12	20788182	20788182	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20788182delT	uc001reh.1	+							NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	gtgaaacccctatctgtaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																							gaaagaaaggaaaggaaggaag	0.000													4	2	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56562166	56562166	+	Intron	DEL	T	-	-	rs72399911		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56562166delT	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ttcttttttcttttttttttt	0.104													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68946696	68946696	+	IGR	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68946696delT								MDM1 (220535 upstream) : RAP1B (57956 downstream)																							caaattattcttttttTTTTT	0.179													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101713543	101713543	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101713543delT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TATTAAAGCCTTTTTTTTTTT	0.294													11	6	---	---	---	---	
ZMYM5	9205	broad.mit.edu	37	13	20409966	20409967	+	Intron	INS	-	T	T			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20409966_20409967insT	uc010tcn.1	-						ZMYM5_uc001umm.1_Intron	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3							nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		CAGGGAAAAGAttttttttttt	0.188													7	5	---	---	---	---	
KIAA0391	9692	broad.mit.edu	37	14	35649732	35649733	+	Intron	INS	-	TG	TG	rs140304917	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35649732_35649733insTG	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487	O15091	MRRP3_HUMAN	mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TGTAGAGTATCtgtgtgtgtgt	0.228													4	2	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65264221	65264222	+	Intron	DEL	GG	-	-	rs74056015		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65264221_65264222delGG	uc001xht.2	-						SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron|SPTB_uc001xhu.2_Intron	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		aaaaaaaaaaGGACTCAGGGAT	0.282													4	2	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102504685	102504686	+	Intron	INS	-	G	G	rs140348429	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102504685_102504686insG	uc001yks.2	+							NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACGCAAGTGGCGGGTGGCTTTT	0.277													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104536180	104536181	+	IGR	INS	-	G	G	rs11427970		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104536180_104536181insG								TDRD9 (17178 upstream) : ASPG (15867 downstream)																							attgtgctgttggggggggggg	0.015													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106993634	106993634	+	Intron	DEL	C	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993634delC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TGGAGAAGTTCCCTGGGGAAA	0.458													9	6	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28473275	28473276	+	Intron	INS	-	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28473275_28473276insA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		caaaaAGCTTTAaaaaaaaaaa	0.178													6	3	---	---	---	---	
EIF3J	8669	broad.mit.edu	37	15	44844034	44844034	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44844034delT	uc001ztv.2	+						EIF3J_uc010ueg.1_Intron|EIF3J_uc001ztw.2_Intron	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		ttgttttttgttttttttttt	0.169													4	2	---	---	---	---	
ARID3B	10620	broad.mit.edu	37	15	74865017	74865018	+	Intron	INS	-	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74865017_74865018insA	uc002aye.2	+						ARID3B_uc002ayc.2_Intron|ARID3B_uc002ayd.2_Intron	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						AATCAAAAGCCAAAAAAAAAAA	0.386													4	2	---	---	---	---	
TARSL2	123283	broad.mit.edu	37	15	102255353	102255353	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102255353delT	uc002bxm.2	-						TARSL2_uc010usi.1_Intron	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2						threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			acattcactgttttttttttt	0.075													4	2	---	---	---	---	
GDE1	51573	broad.mit.edu	37	16	19522426	19522426	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19522426delT	uc002dgh.2	-						GDE1_uc002dgi.2_Intron	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						TACTTTAAGAttttttttttt	0.164													5	3	---	---	---	---	
RPA1	6117	broad.mit.edu	37	17	1779217	1779218	+	Intron	DEL	TT	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1779217_1779218delTT	uc002fto.2	+							NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0						GGGTTTACTCTTTTTTTTTTTT	0.356								NER					4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7700253	7700254	+	Intron	INS	-	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7700253_7700254insA	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				attaaaaatacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
FMNL1	752	broad.mit.edu	37	17	43314485	43314486	+	Intron	INS	-	A	A			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43314485_43314486insA	uc002iin.2	+							NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						actccatcttgaaaaaaaaaat	0.064													4	2	---	---	---	---	
CGB	1082	broad.mit.edu	37	19	49528886	49528886	+	5'Flank	DEL	C	-	-	rs36051701		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49528886delC	uc002plv.1	-						CGB_uc010yad.1_Intron|CGB_uc002plu.1_5'Flank	NM_000737	NP_000728	P01233	CGHB_HUMAN	chorionic gonadotropin beta 3 subunit precursor						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	CCGGCGGCAGCCCCCTCCACC	0.657													10	6	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50747737	50747739	+	Intron	DEL	TTT	-	-	rs72142249		TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50747737_50747739delTTT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ATTTCCTGCAttttttttttttt	0.305													4	2	---	---	---	---	
STK4	6789	broad.mit.edu	37	20	43607443	43607443	+	Intron	DEL	T	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43607443delT	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron|STK4_uc010ggw.1_Intron	NM_006282	NP_006273	Q13043	STK4_HUMAN	serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				tcaatttttcttttttttttt	0.109													4	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074688	62074690	+	Intron	DEL	CAC	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074688_62074690delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													3	3	---	---	---	---	
RBM11	54033	broad.mit.edu	37	21	15585612	15585613	+	5'Flank	INS	-	TTCC	TTCC	rs145138104	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15585612_15585613insTTCC	uc002yjo.3	+						RBM11_uc002yjn.3_5'Flank|RBM11_uc002yjp.3_5'Flank	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		GCCAAcctcctttccttccttc	0.144													5	3	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47536840	47536841	+	Intron	INS	-	ACAC	ACAC	rs147352816	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47536840_47536841insACAC	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		Tacacacgcatacacacacaca	0.480													11	6	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43435575	43435576	+	3'UTR	INS	-	A	A	rs143546633	by1000genomes	TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43435575_43435576insA	uc003bdi.2	-	11					TTLL1_uc010gzh.2_3'UTR|TTLL1_uc003bdj.2_3'UTR|TTLL1_uc003bdh.2_3'UTR	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GGTTAAAAATTAAAAAAAAAAG	0.312													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	52613556	52613557	+	IGR	DEL	AC	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52613556_52613557delAC								XAGE1D (369605 upstream) : SSX8 (38428 downstream)																							acacacacagacacacacacac	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128542666	128542666	+	IGR	DEL	A	-	-			TCGA-C5-A1BI-01	TCGA-C5-A1BI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128542666delA								None (None upstream) : SMARCA1 (37814 downstream)																							AATTCTACTTaaaaaaaaaaa	0.353													3	3	---	---	---	---	
