Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1650895	1650895	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1650895C>T	uc001agv.1	-	6	339	c.228_splice	c.e6-1	p.R76_splice	CDK11B_uc001ags.1_5'Flank|CDK11B_uc001agt.1_5'Flank|CDK11B_uc001aha.1_Splice_Site_p.R42_splice|CDK11B_uc001agw.1_Splice_Site_p.R42_splice|CDK11B_uc001agy.1_Splice_Site_p.R76_splice|CDK11B_uc001agx.1_Splice_Site_p.R76_splice|CDK11B_uc001agz.1_Splice_Site|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Splice_Site_p.R76_splice|CDK11A_uc009vks.2_Splice_Site_p.R76_splice|CDK11A_uc010nys.1_Splice_Site_p.R76_splice|CDK11A_uc010nyt.1_Splice_Site_p.R76_splice|CDK11A_uc010nyu.1_Splice_Site|CDK11A_uc009vkt.1_Splice_Site_p.R76_splice|CDK11A_uc009vku.1_Splice_Site_p.R76_splice|CDK11A_uc009vkv.1_Splice_Site_p.R76_splice|CDK11A_uc001aht.1_Splice_Site_p.R76_splice|CDK11B_uc001ahu.1_Splice_Site_p.R76_splice|CDK11B_uc001ahv.1_Splice_Site_p.R76_splice|CDK11B_uc001ahw.1_Splice_Site_p.R76_splice	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						TTCTTCTCCTCTGAAATAAAA	0.383													27	502	---	---	---	---	PASS
GABRD	2563	broad.mit.edu	37	1	1959590	1959590	+	Intron	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1959590C>G	uc001aip.2	+							NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta							cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		TGCTTTTCCTCCAGACGGTTA	0.657													9	15	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10720517	10720517	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10720517C>T	uc001aro.2	-	6	902	c.582G>A	c.(580-582)CAG>CAA	p.Q194Q	CASZ1_uc001arp.1_Silent_p.Q194Q|CASZ1_uc009vmx.2_Silent_p.Q218Q|CASZ1_uc001arq.1_Silent_p.Q53Q	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	194					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CCCGCGTGTTCTGGTCATCAT	0.652													4	29	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152849	18152849	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152849C>T	uc001bat.2	+	3	1152	c.936C>T	c.(934-936)TTC>TTT	p.F312F		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	312						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		AGCGCCTGTTCAGGGAGCTGA	0.622											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	75	---	---	---	---	PASS
DNAJC8	22826	broad.mit.edu	37	1	28555487	28555487	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28555487C>G	uc001bpn.2	-	2	159	c.126G>C	c.(124-126)CAG>CAC	p.Q42H	DNAJC8_uc001bpo.2_RNA	NM_014280	NP_055095	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	42					nuclear mRNA splicing, via spliceosome|protein folding	nucleoplasm	heat shock protein binding|unfolded protein binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		GTCTTTCAATCTGATTTTTCG	0.378													45	119	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34076831	34076831	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34076831C>T	uc001bxn.1	-	41	6062	c.6033G>A	c.(6031-6033)CTG>CTA	p.L2011L	CSMD2_uc001bxm.1_Silent_p.L2051L|CSMD2_uc001bxo.1_Silent_p.L924L	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2011	CUB 12.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGAGAAGTTCAGGAACTGGA	0.547													8	26	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43782898	43782898	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43782898C>A	uc001ciu.2	+	15	2517	c.2438C>A	c.(2437-2439)TCA>TAA	p.S813*	TIE1_uc010oke.1_Nonsense_Mutation_p.S768*|TIE1_uc009vwq.2_Nonsense_Mutation_p.S769*|TIE1_uc010okg.1_Nonsense_Mutation_p.S458*	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	813	Cytoplasmic (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGTTCAGCTCAGGGACCTTG	0.607													5	65	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43783303	43783303	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43783303C>A	uc001ciu.2	+	16	2768	c.2689C>A	c.(2689-2691)CAC>AAC	p.H897N	TIE1_uc010oke.1_Missense_Mutation_p.H852N|TIE1_uc009vwq.2_Missense_Mutation_p.H853N|TIE1_uc010okg.1_Missense_Mutation_p.H542N	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	897	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATTGGGGCATCACCCCAACAT	0.507													48	188	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45294175	45294175	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45294175C>T	uc010olf.1	-						PTCH2_uc010olg.1_Intron	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2						protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					TGAGAGGCCTCACCTGTAGGG	0.637									Basal_Cell_Nevus_syndrome				8	16	---	---	---	---	PASS
CYP4Z1	199974	broad.mit.edu	37	1	47548000	47548000	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47548000C>T	uc001cqu.1	+							NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1							endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1						CCTCTCATTTCATAAGGTCGA	0.443													9	47	---	---	---	---	PASS
TMEM59	9528	broad.mit.edu	37	1	54497885	54497885	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54497885C>T	uc001cwp.2	-	8	1160	c.910G>A	c.(910-912)GAA>AAA	p.E304K	TMEM59_uc001cwn.2_Missense_Mutation_p.E168K|TMEM59_uc001cwo.2_Missense_Mutation_p.E167K|TMEM59_uc001cwq.2_Missense_Mutation_p.E305K|TMEM59_uc001cwr.2_Missense_Mutation_p.E237K	NM_004872	NP_004863	Q9BXS4	TMM59_HUMAN	thymic dendritic cell-derived factor 1	304	Cytoplasmic (Potential).					Golgi membrane|integral to membrane					0						TCATGATCTTCAGTTTTAGAT	0.348													16	64	---	---	---	---	PASS
MYSM1	114803	broad.mit.edu	37	1	59147737	59147737	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59147737C>G	uc009wab.1	-	8	1002	c.979G>C	c.(979-981)GAT>CAT	p.D327H	MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	327					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					CCCCTTCCATCATGCTTGTTG	0.338													48	199	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93159886	93159886	+	Silent	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93159886C>G	uc001dox.2	-	8	1111	c.1101G>C	c.(1099-1101)CTG>CTC	p.L367L	EVI5_uc010otf.1_Silent_p.L367L|EVI5_uc001doy.1_RNA	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	367	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CAAGTTGCATCAGTTCTGCCT	0.249													19	74	---	---	---	---	PASS
RNF115	27246	broad.mit.edu	37	1	145650536	145650536	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145650536C>T	uc001eoj.2	+	3	419	c.215C>T	c.(214-216)GCA>GTA	p.A72V	NBPF10_uc001emp.3_Intron|RNF115_uc001eok.2_Missense_Mutation_p.A39V|RNF115_uc009wiy.2_5'UTR	NM_014455	NP_055270	Q9Y4L5	RN115_HUMAN	Rabring 7	72					protein autoubiquitination	cytosol	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						ACACATTTTGCAGAGGTAAGT	0.403													13	83	---	---	---	---	PASS
APH1A	51107	broad.mit.edu	37	1	150241157	150241157	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150241157G>A	uc001ety.1	-	1	376	c.54C>T	c.(52-54)TTC>TTT	p.F18F	APH1A_uc010pbx.1_Silent_p.F18F|APH1A_uc001etz.1_Silent_p.F18F|APH1A_uc001eua.1_Silent_p.F18F|APH1A_uc010pby.1_Silent_p.F18F|APH1A_uc001eub.1_5'UTR|APH1A_uc010pbz.1_5'UTR	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform	18	Helical; Name=1; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding			ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGAAAAGCGCGAAGGCCGGGC	0.652													7	12	---	---	---	---	PASS
ZNF687	57592	broad.mit.edu	37	1	151259572	151259572	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151259572C>T	uc001exq.2	+	2	903	c.805C>T	c.(805-807)CAC>TAC	p.H269Y	ZNF687_uc001exp.1_Missense_Mutation_p.H278Y|ZNF687_uc009wmo.2_Missense_Mutation_p.H269Y|ZNF687_uc009wmp.2_Missense_Mutation_p.H269Y	NM_020832	NP_065883	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	269	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding			central_nervous_system(3)|ovary(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTCTCCAGGGCACCAGAGCCC	0.617													27	100	---	---	---	---	PASS
UBE2Q1	55585	broad.mit.edu	37	1	154527964	154527964	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154527964G>A	uc001fff.1	-	3	568	c.477C>T	c.(475-477)CTC>CTT	p.L159L		NM_017582	NP_060052	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q	159							ATP binding|protein binding|ubiquitin-protein ligase activity				0	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGAGGTTATAGAGTTTACACA	0.532													31	155	---	---	---	---	PASS
ISG20L2	81875	broad.mit.edu	37	1	156693241	156693241	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156693241C>T	uc001fps.1	-	3	1223	c.962G>A	c.(961-963)GGA>GAA	p.G321E	ISG20L2_uc001fpt.1_Missense_Mutation_p.G321E	NM_030980	NP_112242	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene	321	Exonuclease.				ribosome biogenesis	nucleolus	exonuclease activity|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGAGGAATGTCCGCTCTTCCC	0.517													5	239	---	---	---	---	PASS
NAV1	89796	broad.mit.edu	37	1	201757712	201757712	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201757712G>A	uc001gwu.2	+	10	3459	c.3112G>A	c.(3112-3114)GAG>AAG	p.E1038K	NAV1_uc001gwv.1_Missense_Mutation_p.E546K|NAV1_uc001gww.1_Missense_Mutation_p.E647K|NAV1_uc001gwx.2_Missense_Mutation_p.E647K|NAV1_uc001gwy.1_Missense_Mutation_p.E419K	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1038					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						GTCCCTGGCCGAGAGACCCAA	0.617													31	147	---	---	---	---	PASS
LPGAT1	9926	broad.mit.edu	37	1	211952327	211952327	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211952327C>T	uc001hiu.2	-	6	1600	c.787G>A	c.(787-789)GAA>AAA	p.E263K	LPGAT1_uc001hiv.2_Missense_Mutation_p.E263K	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	263					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		TCTATAGGTTCAGCTTTGGGA	0.338													52	279	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228487084	228487084	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228487084C>T	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsq.1_Silent_p.L1272L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TTGAGGCTCTCAGAGATGGGG	0.562													19	58	---	---	---	---	PASS
RHOU	58480	broad.mit.edu	37	1	228871718	228871718	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228871718G>A	uc001htf.2	+	1	850	c.229G>A	c.(229-231)GAG>AAG	p.E77K		NM_021205	NP_067028	Q7L0Q8	RHOU_HUMAN	ras homolog gene family, member U	77					regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding				0	Breast(184;0.162)	Prostate(94;0.183)				CTACCCCACCGAGTACATCCC	0.458													8	23	---	---	---	---	PASS
EXOC8	149371	broad.mit.edu	37	1	231472604	231472604	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231472604C>T	uc001huq.2	-	1	975	c.888G>A	c.(886-888)GCG>GCA	p.A296A		NM_175876	NP_787072	Q8IYI6	EXOC8_HUMAN	exocyst complex 84-kDa subunit	296					exocytosis|protein transport	growth cone|nucleus	protein binding			skin(1)	1	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CTCGAGGGGCCGCTGCCTCCT	0.557													25	117	---	---	---	---	PASS
RBM34	23029	broad.mit.edu	37	1	235324478	235324478	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235324478G>A	uc001hwn.2	-						RBM34_uc001hwo.2_Intron|ARID4B_uc001hwp.2_Intron|RBM34_uc010pxp.1_Intron	NM_015014	NP_055829	P42696	RBM34_HUMAN	RNA binding motif protein 34 isoform 1							nucleolus	nucleotide binding|RNA binding			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CTCGTGCCGCGCGCCACTCAC	0.587													27	106	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1680739	1680739	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1680739C>T	uc002qxa.2	-	8	872	c.808G>A	c.(808-810)GAA>AAA	p.E270K	PXDN_uc002qxb.1_Missense_Mutation_p.E270K|PXDN_uc002qxc.1_Missense_Mutation_p.E87K	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	270	Ig-like C2-type 1.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGGTTGCCTTCGGCTCTGCAG	0.572													7	24	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27802554	27802554	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27802554G>A	uc002rkz.3	+	1	3166	c.3115G>A	c.(3115-3117)GAT>AAT	p.D1039N		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1039										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CATATTTTACGATAGAGAAGA	0.453													31	151	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28521339	28521339	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28521339G>C	uc002rlr.2	+	12	1387	c.1069G>C	c.(1069-1071)GAA>CAA	p.E357Q	BRE_uc002rlp.1_Missense_Mutation_p.E357Q|BRE_uc002rlq.2_Missense_Mutation_p.E357Q|BRE_uc002rls.2_Missense_Mutation_p.E357Q|BRE_uc002rlt.2_Missense_Mutation_p.E357Q|BRE_uc002rlu.2_Missense_Mutation_p.E357Q|BRE_uc002rlv.2_Missense_Mutation_p.E219Q|BRE_uc002rlx.2_RNA	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A	357	UEV-like 2.				apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GGATGGAAATGAAATGGCCAA	0.353													41	140	---	---	---	---	PASS
DHX57	90957	broad.mit.edu	37	2	39088417	39088417	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39088417C>T	uc002rrf.2	-	5	1234	c.1135G>A	c.(1135-1137)GAG>AAG	p.E379K	DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Missense_Mutation_p.E379K	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	379							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				GGTAGGTTCTCATTGGTGGAA	0.378													19	78	---	---	---	---	PASS
DHX57	90957	broad.mit.edu	37	2	39088645	39088645	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39088645C>T	uc002rrf.2	-	5	1006	c.907G>A	c.(907-909)GAA>AAA	p.E303K	DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Missense_Mutation_p.E303K	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	303	C3H1-type.						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				TTACAGATTTCAAGTGAATTC	0.358													22	99	---	---	---	---	PASS
PCBP1	5093	broad.mit.edu	37	2	70315104	70315104	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70315104G>A	uc002sgf.2	+	1	520	c.229G>A	c.(229-231)GAC>AAC	p.D77N	ASPRV1_uc002sga.2_5'Flank|uc002sgb.1_5'Flank|uc002sgd.2_5'Flank|uc002sge.1_5'Flank	NM_006196	NP_006187	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	77					nuclear mRNA splicing, via spliceosome	cytoplasm|nucleoplasm|ribonucleoprotein complex	protein binding|RNA binding|single-stranded DNA binding				0						TATGATCATCGACAAGCTGGA	0.597													4	135	---	---	---	---	PASS
IL1R1	3554	broad.mit.edu	37	2	102793102	102793102	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102793102G>A	uc002tbq.2	+	12	1911	c.1593G>A	c.(1591-1593)TGG>TGA	p.W531*	IL1R1_uc010fix.2_Nonsense_Mutation_p.W500*|IL1R1_uc002tbr.2_Nonsense_Mutation_p.W531*	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	531	TIR.|Cytoplasmic (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	CAAGGTTCTGGAAGAATGTCA	0.483													9	41	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173341251	173341251	+	Intron	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173341251C>G	uc002uhp.1	+						ITGA6_uc010zdy.1_Intron|ITGA6_uc002uho.1_Intron|ITGA6_uc010fqm.1_Intron	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GGTCTGTTATCTATGATTTTA	0.343													28	90	---	---	---	---	PASS
ZAK	51776	broad.mit.edu	37	2	174123523	174123523	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174123523G>A	uc002uhz.2	+	17	1656	c.1456G>A	c.(1456-1458)GAG>AAG	p.E486K	uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1	486					activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			ACCTGATGCGGAGATTTTAAA	0.368													15	61	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203421006	203421006	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203421006G>A	uc002uzf.3	+	12	3766	c.2618G>A	c.(2617-2619)CGA>CAA	p.R873Q	BMPR2_uc010ftr.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	873	Cytoplasmic (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						TTACTGAGACGAGAGCAACAA	0.478													43	119	---	---	---	---	PASS
EPHA4	2043	broad.mit.edu	37	2	222307723	222307723	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222307723C>T	uc002vmq.2	-	11	1942	c.1900G>A	c.(1900-1902)GAG>AAG	p.E634K	EPHA4_uc002vmr.2_Missense_Mutation_p.E634K|EPHA4_uc010zlm.1_Missense_Mutation_p.E575K|EPHA4_uc010zln.1_Missense_Mutation_p.E634K	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	634	Protein kinase.|ATP (By similarity).|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CTGCATACCTCACCAAATTCA	0.363													24	58	---	---	---	---	PASS
UGT1A3	54659	broad.mit.edu	37	2	234638600	234638600	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234638600T>G	uc002vuy.2	+	1	828	c.828T>G	c.(826-828)ATT>ATG	p.I276M	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Missense_Mutation_p.I276M	NM_019093	NP_061966	P35503	UD13_HUMAN	UDP glycosyltransferase 1 family, polypeptide A3	276					flavonoid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TGGTCTTCATTGGGGGCATCA	0.463													7	118	---	---	---	---	PASS
TIMP4	7079	broad.mit.edu	37	3	12198411	12198411	+	Silent	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12198411G>C	uc003bwo.2	-	3	568	c.261C>G	c.(259-261)GTC>GTG	p.V87V	SYN2_uc003bwl.1_Intron|SYN2_uc003bwm.2_Intron|SYN2_uc003bwn.2_Intron	NM_003256	NP_003247	Q99727	TIMP4_HUMAN	tissue inhibitor of metalloproteinase 4	87	NTR.						metal ion binding|metalloendopeptidase inhibitor activity				0						GAACATCCTTGACTTTCTCAA	0.393													25	84	---	---	---	---	PASS
RARB	5915	broad.mit.edu	37	3	25637933	25637933	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25637933G>C	uc011awl.1	+	8	1260	c.1194G>C	c.(1192-1194)TTG>TTC	p.L398F	RARB_uc003cdi.1_Missense_Mutation_p.L279F|RARB_uc003cdh.2_Missense_Mutation_p.L391F	NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2	398	Ligand-binding.				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	p.S398L(1)		ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TAATTACCTTGAAAATGGAAA	0.398													32	114	---	---	---	---	PASS
CMTM8	152189	broad.mit.edu	37	3	32409359	32409359	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32409359C>T	uc003cex.2	+						CMTM8_uc010hfu.2_Intron	NM_178868	NP_849199	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0						CCTGTGTCCCCCCAGGGCCTG	0.582													29	89	---	---	---	---	PASS
CX3CR1	1524	broad.mit.edu	37	3	39307048	39307048	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39307048C>T	uc003cjl.2	-	2	1045	c.953G>A	c.(952-954)CGC>CAC	p.R318H		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	318	Cytoplasmic (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		GTGGACTGAGCGCCCACACAG	0.478													6	187	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49160436	49160436	+	Missense_Mutation	SNP	C	G	G	rs141317511		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49160436C>G	uc003cwe.2	-	27	4573	c.4274G>C	c.(4273-4275)GGT>GCT	p.G1425A	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1425	Domain alpha.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACAGCCGGCACCCCCACAAGG	0.662													8	16	---	---	---	---	PASS
ZMYND10	51364	broad.mit.edu	37	3	50382915	50382915	+	Intron	SNP	T	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50382915T>C	uc003dag.1	-						ZMYND10_uc010hll.1_Intron|ZMYND10_uc003dah.1_Intron|ZMYND10_uc010hlm.1_Intron	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10							cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCCGGGTGCCTCACCCTTCGG	0.672										TSP Lung(30;0.18)			2	6	---	---	---	---	PASS
SLMAP	7871	broad.mit.edu	37	3	57898215	57898215	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57898215C>G	uc003dje.1	+	18	1961	c.1756C>G	c.(1756-1758)CTC>GTC	p.L586V	SLMAP_uc003djd.1_Missense_Mutation_p.L569V|SLMAP_uc003djf.1_Missense_Mutation_p.L548V|SLMAP_uc003djg.1_Missense_Mutation_p.L180V|SLMAP_uc011bez.1_Missense_Mutation_p.L54V|SLMAP_uc011bfa.1_Missense_Mutation_p.L120V|SLMAP_uc003djh.2_Missense_Mutation_p.L79V|SLMAP_uc003dji.1_Missense_Mutation_p.L120V|SLMAP_uc011bfb.1_Missense_Mutation_p.L120V|SLMAP_uc011bfc.1_Missense_Mutation_p.L79V	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	586	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TGAAATTTTGCTCCTTCATCA	0.473													3	102	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65456104	65456104	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65456104C>T	uc003dmn.2	-	5	1339	c.813G>A	c.(811-813)GTG>GTA	p.V271V	MAGI1_uc003dmm.2_Silent_p.V271V|MAGI1_uc003dmo.2_Silent_p.V271V|MAGI1_uc003dmp.2_Silent_p.V271V|MAGI1_uc010hny.2_Silent_p.V156V|MAGI1_uc003dmr.2_Silent_p.V272V	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	271	Guanylate kinase-like.				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TGCTACTATTCACAGGTGGTA	0.458													4	105	---	---	---	---	PASS
CRYBG3	131544	broad.mit.edu	37	3	97655689	97655689	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97655689G>A	uc003drx.2	+	16	2662	c.2598G>A	c.(2596-2598)GAG>GAA	p.E866E	CRYBG3_uc010hoz.1_RNA	NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						GGCCTAATGAGATCCCAAACT	0.398													19	62	---	---	---	---	PASS
PVRL3	25945	broad.mit.edu	37	3	110837547	110837547	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110837547G>A	uc003dxt.1	+	3	547	c.547G>A	c.(547-549)GAT>AAT	p.D183N	PVRL3_uc003dxu.1_Missense_Mutation_p.D160N	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	183	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						TTCTTTAATTGATGGAGGAAA	0.373													3	38	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112324383	112324383	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112324383G>A	uc003dzf.2	-	8	2952	c.2734C>T	c.(2734-2736)CGC>TGC	p.R912C	CCDC80_uc011bhv.1_Missense_Mutation_p.R885C|CCDC80_uc003dzg.2_Missense_Mutation_p.R912C	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	912										ovary(2)	2						TCTGGGCAGCGCATCCCCAGT	0.473													4	144	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122259323	122259323	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122259323C>T	uc010hri.2	-	8	2011	c.1866G>A	c.(1864-1866)TCG>TCA	p.S622S	PARP9_uc003eff.3_Silent_p.S587S|PARP9_uc011bjs.1_Silent_p.S587S|PARP9_uc003efg.2_Silent_p.S167S|PARP9_uc003efi.2_Silent_p.S587S|PARP9_uc003efh.2_Silent_p.S622S|PARP9_uc003efj.2_Silent_p.S587S	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	622					cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		ACTCACCTAACGAGCGCCAAA	0.433													14	86	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122399840	122399840	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122399840C>T	uc003efq.3	+	1	169	c.110C>T	c.(109-111)TCG>TTG	p.S37L		NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	37					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		CCGAAGAGGTCGGGAGGCGGC	0.672													7	33	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122399904	122399904	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122399904C>G	uc003efq.3	+	1	233	c.174C>G	c.(172-174)TTC>TTG	p.F58L		NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	58					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		TGGTGTTCTTCTACCCGGAGG	0.677													4	35	---	---	---	---	PASS
DIRC2	84925	broad.mit.edu	37	3	122598136	122598136	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122598136C>T	uc003efw.3	+	9	1487	c.1348C>T	c.(1348-1350)CCC>TCC	p.P450S	DIRC2_uc010hrl.2_RNA|DIRC2_uc010hrm.2_Missense_Mutation_p.P288S|uc003efx.1_RNA	NM_032839	NP_116228	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	450	Helical; (Potential).				transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)		CTGGTGCCTTCCCGGGTCGTG	0.458													86	423	---	---	---	---	PASS
CAMK2N2	94032	broad.mit.edu	37	3	183978917	183978917	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183978917G>A	uc003fnj.1	-	1	335	c.157C>T	c.(157-159)CGA>TGA	p.R53*	ECE2_uc003fni.3_Intron	NM_033259	NP_150284	Q96S95	CK2N2_HUMAN	CaM-KII inhibitory protein	53	Inhibitory domain (By similarity).					cytosol|nucleus	protein kinase inhibitor activity				0	all_cancers(143;1.09e-10)|Ovarian(172;0.0339)		Epithelial(37;2.51e-33)|OV - Ovarian serous cystadenocarcinoma(80;5.69e-22)			CGCTTGGCTCGGCCGATCTGG	0.736													5	16	---	---	---	---	PASS
WDR1	9948	broad.mit.edu	37	4	10083053	10083053	+	Silent	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10083053C>A	uc003gmf.2	-	11	1495	c.1212G>T	c.(1210-1212)GTG>GTT	p.V404V	WDR1_uc003gmg.2_Silent_p.V264V|WDR1_uc010idm.2_RNA|hsa-mir-3138|MI0014161_5'Flank	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	404					platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CGTCCAGTTTCACAACTCCTT	0.522													9	32	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73205317	73205317	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73205317C>G	uc003hgk.1	-	5	792	c.755G>C	c.(754-756)GGA>GCA	p.G252A		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	252					collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATCGTTTTCTCCCGCGTGTCT	0.493													48	215	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95444929	95444929	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95444929C>G	uc003hti.2	+	3	302	c.151C>G	c.(151-153)CTC>GTC	p.L51V	PDLIM5_uc003htf.2_Missense_Mutation_p.L51V|PDLIM5_uc003htg.2_Missense_Mutation_p.L51V|PDLIM5_uc011cdx.1_Missense_Mutation_p.L51V|PDLIM5_uc003hth.2_Missense_Mutation_p.L51V|PDLIM5_uc003htj.2_5'UTR|PDLIM5_uc003htk.2_Missense_Mutation_p.L51V|PDLIM5_uc011cdy.1_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	51	PDZ.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		CGATGTGGTTCTCAGCATTGA	0.393													19	67	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113510819	113510819	+	Intron	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113510819C>G	uc003iau.2	-						C4orf21_uc003iav.2_5'Flank|C4orf21_uc003iaw.2_Nonstop_Mutation_p.*1063S	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AATAATCTCTCAAATAAAAAA	0.323													4	48	---	---	---	---	PASS
USP53	54532	broad.mit.edu	37	4	120169975	120169975	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120169975G>A	uc003ics.3	+	6	1376	c.310G>A	c.(310-312)GAA>AAA	p.E104K	USP53_uc003icr.3_Missense_Mutation_p.E104K|USP53_uc003icu.3_5'UTR	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	104					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						TGCTCTTGCAGAAAGTTTCAA	0.413													30	140	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141555331	141555331	+	Silent	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141555331G>C	uc010ioj.2	-	16	2789	c.2517C>G	c.(2515-2517)CTC>CTG	p.L839L		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	839						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				AGCAGCTGGTGAGATGTTCTG	0.537													13	43	---	---	---	---	PASS
TIGD4	201798	broad.mit.edu	37	4	153690664	153690664	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153690664G>A	uc003imy.2	-	2	2275	c.1493C>T	c.(1492-1494)TCT>TTT	p.S498F		NM_145720	NP_663772	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	498					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding			ovary(1)	1	all_hematologic(180;0.093)					GTCTGCTAAAGAATTTTGAAG	0.299													15	76	---	---	---	---	PASS
KLHL2	11275	broad.mit.edu	37	4	166235222	166235222	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166235222G>C	uc003irb.2	+	13	1772	c.1513G>C	c.(1513-1515)GAT>CAT	p.D505H	KLHL2_uc011cjm.1_Missense_Mutation_p.D509H|KLHL2_uc003irc.2_Missense_Mutation_p.D417H|KLHL2_uc010ira.2_Missense_Mutation_p.D158H	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1	505	Kelch 5.				intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		AGGAGGTCATGATGGCCCTTT	0.388													63	207	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13900383	13900383	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13900383C>T	uc003jfd.2	-	15	2233	c.2191G>A	c.(2191-2193)GTC>ATC	p.V731I		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	731	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGTGGAGAGACTTCCAGACCC	0.423									Kartagener_syndrome				21	109	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35700753	35700753	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35700753C>T	uc003jjo.2	+	16	2408	c.2297C>T	c.(2296-2298)GCG>GTG	p.A766V	SPEF2_uc003jjq.3_Missense_Mutation_p.A761V|SPEF2_uc003jjp.1_Missense_Mutation_p.A252V	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	766					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATTGATCCTGCGACTTCCAAA	0.383													8	50	---	---	---	---	PASS
OXCT1	5019	broad.mit.edu	37	5	41762234	41762234	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41762234G>A	uc003jmn.2	-	14	1648	c.1317C>T	c.(1315-1317)GTC>GTT	p.V439V	OXCT1_uc011cpo.1_Silent_p.V42V|OXCT1_uc011cpp.1_Silent_p.V42V	NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor	439					cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	GCTCCATGGTGACCACCACTT	0.433													5	183	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96498868	96498868	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96498868C>T	uc003kmz.2	-	10	1666	c.1556G>A	c.(1555-1557)CGT>CAT	p.R519H		NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	519	Protein kinase.						ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		CTGCAATCGACGTCTGACAGC	0.378													5	53	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128887582	128887582	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128887582G>A	uc003kvb.1	+	7	1336	c.1336G>A	c.(1336-1338)GAA>AAA	p.E446K		NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	446	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GCACAAAGATGAACCATGTGA	0.299													6	27	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140236854	140236854	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236854G>A	uc003lhx.2	+	1	1221	c.1221G>A	c.(1219-1221)GTG>GTA	p.V407V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Silent_p.V407V|PCDHA10_uc011dad.1_Silent_p.V407V	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	407	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCATTGGTGCTGGACAGCG	0.627													26	155	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140475758	140475758	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475758G>A	uc003lil.2	+	1	1522	c.1384G>A	c.(1384-1386)GTC>ATC	p.V462I	PCDHB2_uc003lim.1_Missense_Mutation_p.V123I	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	462	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCCTGTTCGTCCGCGAGAA	0.637													18	98	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140605248	140605248	+	Missense_Mutation	SNP	G	A	A	rs142658705		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140605248G>A	uc003ljb.2	+	1	2171	c.2171G>A	c.(2170-2172)CGC>CAC	p.R724H	PCDHB14_uc011dal.1_Missense_Mutation_p.R571H	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	724	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGGTGGGTCGCTGCTCGGTG	0.662													22	112	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149453030	149453030	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149453030C>G	uc003lrl.2	-	6	1111	c.916G>C	c.(916-918)GAG>CAG	p.E306Q	CSF1R_uc011dcd.1_Missense_Mutation_p.E158Q|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.E306Q|CSF1R_uc011dce.1_Intron	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	306	Extracellular (Potential).|Ig-like C2-type 4.				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	AGGTTCTGCTCAGAGCTCAAG	0.507													37	137	---	---	---	---	PASS
TCOF1	6949	broad.mit.edu	37	5	149755767	149755767	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149755767G>A	uc003lry.2	+	13	2124	c.2016G>A	c.(2014-2016)GCG>GCA	p.A672A	TCOF1_uc003lrw.2_Silent_p.A672A|TCOF1_uc011dch.1_Silent_p.A672A|TCOF1_uc003lrz.2_Silent_p.A672A|TCOF1_uc003lrx.2_Silent_p.A595A|TCOF1_uc003lsa.2_Silent_p.A595A|TCOF1_uc011dci.1_Silent_p.A161A	NM_001135243	NP_001128715	Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	672					skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGGAACTGCGACTTCTCCAG	0.582													69	176	---	---	---	---	PASS
GEMIN5	25929	broad.mit.edu	37	5	154272068	154272068	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154272068C>T	uc003lvx.3	-	25	3722	c.3639G>A	c.(3637-3639)CTG>CTA	p.L1213L	GEMIN5_uc011ddk.1_Silent_p.L1212L	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	1213					ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTGTTGGCTCAGCACTGCCA	0.587													12	25	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154393426	154393426	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154393426G>A	uc010jih.1	+	1	167	c.7G>A	c.(7-9)GAA>AAA	p.E3K		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	3	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GATCATGAAGGAAGAGGTGAA	0.577													10	75	---	---	---	---	PASS
HK3	3101	broad.mit.edu	37	5	176314515	176314515	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176314515G>A	uc003mfa.2	-	11	1629	c.1537C>T	c.(1537-1539)CGA>TGA	p.R513*	HK3_uc003mez.2_Nonsense_Mutation_p.R69*	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	513	Catalytic.			LR -> SE (in Ref. 4; AAC50422).	glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCTCCCCTCGGAGCCCCTTG	0.662													7	32	---	---	---	---	PASS
C6orf146	222826	broad.mit.edu	37	6	4069809	4069809	+	Silent	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4069809G>C	uc003mvx.2	-	7	988	c.648C>G	c.(646-648)CTC>CTG	p.L216L	C6orf146_uc010jnq.1_Intron|C6orf146_uc003mvy.2_Silent_p.L153L	NM_173563	NP_775834	Q8IXS0	CF146_HUMAN	hypothetical protein LOC222826	216										ovary(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				TAAAATAGCTGAGTAAAGTAT	0.353													6	219	---	---	---	---	PASS
PFDN6	10471	broad.mit.edu	37	6	33258518	33258518	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33258518G>A	uc003odt.1	+	5	401	c.286G>A	c.(286-288)GAT>AAT	p.D96N	WDR46_uc003ods.2_5'Flank|WDR46_uc011dra.1_5'Flank|WDR46_uc010juo.1_5'Flank|PFDN6_uc010jup.1_Missense_Mutation_p.D96N	NM_014260	NP_055075	O15212	PFD6_HUMAN	HLA class II region expressed gene KE2	96					'de novo' posttranslational protein folding|chaperone-mediated protein complex assembly	prefoldin complex	chaperone binding|unfolded protein binding				0						CCAGCTTCGGGATCTTGAGCG	0.557													7	23	---	---	---	---	PASS
C6orf130	221443	broad.mit.edu	37	6	41036673	41036673	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41036673G>A	uc003opm.2	-	5	435	c.263C>T	c.(262-264)TCG>TTG	p.S88L	UNC5CL_uc010jxe.1_Intron|C6orf130_uc010jxg.2_Missense_Mutation_p.S88L|C6orf130_uc003opn.2_Intron	NM_145063	NP_659500	Q9Y530	CF130_HUMAN	hypothetical protein LOC221443	88	Macro.										0	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGGCTTGTGCGAAGCCCTTTT	0.413													9	53	---	---	---	---	PASS
TREML2	79865	broad.mit.edu	37	6	41160155	41160155	+	3'UTR	SNP	T	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41160155T>G	uc010jxm.1	-	5						NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid						T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					CACCCCATGCTTAAGTGGCCT	0.552													7	17	---	---	---	---	PASS
YIPF3	25844	broad.mit.edu	37	6	43483678	43483678	+	Missense_Mutation	SNP	G	C	C	rs150101467		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43483678G>C	uc003ovl.1	-	2	394	c.237C>G	c.(235-237)TTC>TTG	p.F79L	YIPF3_uc011dvk.1_Missense_Mutation_p.F44L|YIPF3_uc010jyr.1_Missense_Mutation_p.F85L|YIPF3_uc010jys.1_5'UTR|YIPF3_uc003ovm.1_5'UTR|YIPF3_uc010jyt.1_Missense_Mutation_p.F79L|POLR1C_uc003ovn.2_5'Flank|POLR1C_uc003ovo.1_5'Flank	NM_015388	NP_056203	Q9GZM5	YIPF3_HUMAN	natural killer cell-specific antigen KLIP1	79					cell differentiation	integral to membrane|plasma membrane|transport vesicle					0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TCATGCCCAGGAACTCTCCAT	0.542													28	110	---	---	---	---	PASS
HSP90AB1	3326	broad.mit.edu	37	6	44218333	44218333	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44218333C>T	uc003oxa.1	+	6	1038	c.954C>T	c.(952-954)GTC>GTT	p.V318V	HSP90AB1_uc011dvr.1_Silent_p.V308V|HSP90AB1_uc003oxb.1_Silent_p.V318V|HSP90AB1_uc011dvs.1_Silent_p.V138V|HSP90AB1_uc003oxc.1_5'UTR	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	318					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACTTGGCAGTCAAGGTGTGAG	0.473													15	66	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46828610	46828610	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46828610G>C	uc003oyo.3	-	16	2510	c.2221C>G	c.(2221-2223)CAG>GAG	p.Q741E	GPR116_uc011dwj.1_Missense_Mutation_p.Q296E|GPR116_uc011dwk.1_Missense_Mutation_p.Q170E|GPR116_uc003oyp.3_Missense_Mutation_p.Q599E|GPR116_uc003oyq.3_Missense_Mutation_p.Q741E|GPR116_uc010jzi.1_Missense_Mutation_p.Q413E	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	741	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			ATCTCATCCTGAGAGGGGCTC	0.423													20	79	---	---	---	---	PASS
ELOVL5	60481	broad.mit.edu	37	6	53156762	53156762	+	Splice_Site	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53156762C>G	uc003pbq.1	-	3	507	c.59_splice	c.e3-1	p.D20_splice	ELOVL5_uc003pbr.1_Splice_Site_p.D20_splice|ELOVL5_uc011dwx.1_Splice_Site_p.D20_splice|ELOVL5_uc003pbs.1_Splice_Site_p.D20_splice	NM_021814	NP_068586	Q9NYP7	ELOV5_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Lung NSC(77;0.116)					ACTCTAGTATCTGaaaaatta	0.274													25	71	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73904187	73904187	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73904187G>A	uc003pgk.2	+	14	2196	c.1849G>A	c.(1849-1851)GAA>AAA	p.E617K	KCNQ5_uc011dyh.1_Missense_Mutation_p.E636K|KCNQ5_uc011dyi.1_Missense_Mutation_p.E627K|KCNQ5_uc010kat.2_Missense_Mutation_p.E608K|KCNQ5_uc011dyj.1_Missense_Mutation_p.E507K|KCNQ5_uc011dyk.1_Missense_Mutation_p.E367K	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	617					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		ACAGTCCATAGAATCCAAGCT	0.408													15	57	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100368918	100368918	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100368918G>A	uc003pqh.1	-	6	1236	c.921C>T	c.(919-921)ATC>ATT	p.I307I	MCHR2_uc003pqi.1_Silent_p.I307I	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	307	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CACTCAGCAGGATGTAGAGAA	0.443													30	181	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671518	112671518	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671518G>A	uc003pvx.1	+	3	920	c.608G>A	c.(607-609)CGC>CAC	p.R203H		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	203	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		GCAAGCCCTCGCCTTCGCCGT	0.453													4	83	---	---	---	---	PASS
SLC2A12	154091	broad.mit.edu	37	6	134328025	134328025	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134328025G>C	uc003qem.1	-	3	1663	c.1492C>G	c.(1492-1494)CGA>GGA	p.R498G		NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose	498	Cytoplasmic (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		GCCATGGCTCGTCCTCTGATC	0.478													8	36	---	---	---	---	PASS
ANKMY2	57037	broad.mit.edu	37	7	16649393	16649393	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16649393G>A	uc003sti.2	-						ANKMY2_uc010ktz.2_Intron	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2							cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTAACAAGCTGAAAGATATTT	0.348													32	78	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72398976	72398976	+	Missense_Mutation	SNP	A	G	G	rs147859349		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72398976A>G	uc003twk.2	+	4	1076	c.1076A>G	c.(1075-1077)AAT>AGT	p.N359S	POM121_uc003twj.2_Missense_Mutation_p.N94S|POM121_uc010lam.1_Missense_Mutation_p.N94S	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	359	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				CTGGTGGCCAATGGAGTCCCC	0.468													6	307	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73814818	73814818	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73814818C>T	uc003uam.2	+	15	3326	c.2999C>T	c.(2998-3000)GCG>GTG	p.A1000V	CLIP2_uc003uan.2_Missense_Mutation_p.A965V	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	1000	Potential.					microtubule associated complex				skin(3)	3						CTGCGGGATGCGCTGGACCAG	0.682													3	20	---	---	---	---	PASS
SEMA3D	223117	broad.mit.edu	37	7	84651843	84651843	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84651843C>T	uc003uic.2	-	11	1318	c.1278G>A	c.(1276-1278)GTG>GTA	p.V426V	SEMA3D_uc010led.2_Silent_p.V426V|SEMA3D_uc003uib.2_Silent_p.V65V	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	426	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						ACTTATACATCACAGAGTGCC	0.428													29	112	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675170	100675170	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675170C>T	uc003uxp.1	+	3	526	c.473C>T	c.(472-474)TCA>TTA	p.S158L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	158	Extracellular (Potential).|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAAGCATTTCATCAACAATG	0.458													65	215	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675897	100675897	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675897C>T	uc003uxp.1	+	3	1253	c.1200C>T	c.(1198-1200)GTC>GTT	p.V400V	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	400	Extracellular (Potential).|59 X approximate tandem repeats.|4.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ATATGCCTGTCAGCACCATAT	0.463													63	248	---	---	---	---	PASS
SLC26A5	375611	broad.mit.edu	37	7	103030907	103030907	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103030907G>C	uc003vbz.2	-	12	1516	c.1280C>G	c.(1279-1281)GCA>GGA	p.A427G	SLC26A5_uc003vbt.1_Missense_Mutation_p.A427G|SLC26A5_uc003vbu.1_Missense_Mutation_p.A427G|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.A427G|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	427	Helical; Name=10; (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						GAATCCAGTTGCTAATATGAC	0.398													26	99	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104753145	104753145	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104753145C>T	uc003vcm.2	+	27	5476	c.4942C>T	c.(4942-4944)CAG>TAG	p.Q1648*	MLL5_uc010ljc.2_Nonsense_Mutation_p.Q1648*|MLL5_uc010ljf.1_Intron|MLL5_uc010ljg.2_Nonsense_Mutation_p.Q382*	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	1648	Pro-rich.				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						GAATTCCCATCAGCAACACTC	0.572													22	60	---	---	---	---	PASS
SLC35B4	84912	broad.mit.edu	37	7	133986776	133986776	+	Intron	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133986776C>G	uc003vrn.2	-						SLC35B4_uc010lmk.2_Intron|SLC35B4_uc010lml.1_Intron|SLC35B4_uc003vro.3_Intron	NM_032826	NP_116215	Q969S0	S35B4_HUMAN	solute carrier family 35, member B4							Golgi membrane|integral to membrane	UDP-N-acetylglucosamine transmembrane transporter activity|UDP-xylose transmembrane transporter activity			skin(1)	1						TTGTGAGCTTCTTACCACCTG	0.338													15	75	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137294339	137294339	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137294339G>C	uc003vtt.2	-	9	1011	c.1010C>G	c.(1009-1011)TCA>TGA	p.S337*	DGKI_uc003vtu.2_Nonsense_Mutation_p.S37*	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	337					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						CTTCCGATTTGAAGCCTTCAG	0.448													7	49	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140273623	140273623	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140273623C>T	uc010lnj.2	-	4	1576	c.1431G>A	c.(1429-1431)AAG>AAA	p.K477K	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Silent_p.K477K|DENND2A_uc003vvw.2_Silent_p.K477K|DENND2A_uc003vvx.2_Silent_p.K477K	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	477										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GTATCTTTCTCTTCTTCCTGC	0.512													52	223	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	156976679	156976679	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156976679G>A	uc010lqs.2	+	9	1411	c.1099G>A	c.(1099-1101)GAC>AAC	p.D367N	UBE3C_uc003wnf.2_Missense_Mutation_p.D324N|UBE3C_uc003wng.2_Missense_Mutation_p.D367N	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	367					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CTCAGCCAGTGACTCTGAGGA	0.622													20	84	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41906386	41906386	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41906386G>T	uc010lxb.2	-	3	654	c.110C>A	c.(109-111)TCT>TAT	p.S37Y	MYST3_uc010lxc.2_Missense_Mutation_p.S37Y|MYST3_uc003xon.3_Missense_Mutation_p.S37Y|MYST3_uc010lxd.2_Missense_Mutation_p.S37Y	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	37	Required for activation of RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			ATGGGATGAAGACACAGCATT	0.388													68	352	---	---	---	---	PASS
GGH	8836	broad.mit.edu	37	8	63948246	63948246	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63948246C>G	uc003xuw.2	-	2	476	c.193G>C	c.(193-195)GAG>CAG	p.E65Q		NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor	65	Gamma-glutamyl hydrolase.				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	CCTGCAGACTCCAAGTACTTT	0.294													26	125	---	---	---	---	PASS
ARMC1	55156	broad.mit.edu	37	8	66525572	66525572	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66525572C>T	uc003xvl.2	-	4	607	c.372G>A	c.(370-372)ATG>ATA	p.M124I	ARMC1_uc011leo.1_Intron	NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein	124					metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			GACGTGAATTCATCTCATTAA	0.398													44	132	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763459	77763459	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763459C>T	uc003yav.2	+	10	4554	c.4167C>T	c.(4165-4167)TTC>TTT	p.F1389F	ZFHX4_uc003yau.1_Silent_p.F1434F|ZFHX4_uc003yaw.1_Silent_p.F1389F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1389	C2H2-type 11.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCGCAGTTTCCGTACATTCC	0.468										HNSCC(33;0.089)			8	17	---	---	---	---	PASS
C8orf59	401466	broad.mit.edu	37	8	86127142	86127142	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86127142C>T	uc010mac.1	-						C8orf59_uc003ydd.2_Intron|C8orf59_uc010mad.1_Intron|C8orf59_uc003yde.2_Intron|uc003ydc.1_RNA|C8orf59_uc011lfu.1_Intron	NM_001099670	NP_001093140	Q8N0T1	CH059_HUMAN	hypothetical protein LOC401466												0						CAAATGATTTCTGCTTACCAG	0.328													9	25	---	---	---	---	PASS
OSGIN2	734	broad.mit.edu	37	8	90937101	90937101	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90937101G>C	uc003yeg.2	+	6	1205	c.859G>C	c.(859-861)GAA>CAA	p.E287Q	OSGIN2_uc003yeh.2_Missense_Mutation_p.E331Q	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	287					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTCAATGCCTGAATTTGGAGC	0.468													41	125	---	---	---	---	PASS
RNF19A	25897	broad.mit.edu	37	8	101273866	101273866	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101273866C>T	uc003yjj.1	-	9	1903	c.1586G>A	c.(1585-1587)CGA>CAA	p.R529Q	RNF19A_uc003yjk.1_Missense_Mutation_p.R529Q	NM_015435	NP_056250	Q9NV58	RN19A_HUMAN	ring finger protein 19	529					microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CAGGTTGTCTCGGATGGCTCC	0.527													27	58	---	---	---	---	PASS
OGN	4969	broad.mit.edu	37	9	95155461	95155461	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95155461C>T	uc004asa.2	-	4	569	c.334G>A	c.(334-336)GAT>AAT	p.D112N	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_Missense_Mutation_p.D112N|OGN_uc011ltx.1_Missense_Mutation_p.D130N	NM_014057	NP_054776	P20774	MIME_HUMAN	osteoglycin preproprotein	112	LRR 1.					extracellular space|proteinaceous extracellular matrix	growth factor activity				0						GGTACAGCATCAATGTCAACT	0.368													12	51	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101787286	101787286	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101787286G>A	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CCCCCGGTGAGCAACTGAAGT	0.562													10	46	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112200443	112200443	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112200443G>C	uc004bed.2	-	8	650	c.538C>G	c.(538-540)CAA>GAA	p.Q180E	PTPN3_uc004beb.2_Missense_Mutation_p.Q49E|PTPN3_uc004bec.2_Missense_Mutation_p.Q49E|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Missense_Mutation_p.Q180E|PTPN3_uc011lwh.1_Missense_Mutation_p.Q71E	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	180	FERM.				negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TCCTCATTTTGATCGGGTATA	0.438													31	84	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123920337	123920337	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123920337G>C	uc004bkx.1	+	28	4745	c.4714G>C	c.(4714-4716)GAG>CAG	p.E1572Q	CEP110_uc010mvo.1_Missense_Mutation_p.E241Q|CEP110_uc004blb.1_Missense_Mutation_p.E241Q|CEP110_uc010mvp.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1572	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TAAAGAATCTGAGGTGCTTCT	0.448													6	104	---	---	---	---	PASS
RAB14	51552	broad.mit.edu	37	9	123952910	123952910	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123952910C>G	uc004blc.2	-	4	662	c.206G>C	c.(205-207)GGA>GCA	p.G69A		NM_016322	NP_057406	P61106	RAB14_HUMAN	GTPase Rab14	69	GTP.				embryo development|fibroblast growth factor receptor signaling pathway|Golgi to endosome transport|neurotransmitter secretion|protein transport|small GTPase mediated signal transduction	cytosol|early endosome membrane|Golgi membrane|Golgi stack|late endosome|lysosome|membrane fraction|nuclear outer membrane-endoplasmic reticulum membrane network|perinuclear region of cytoplasm|rough endoplasmic reticulum|trans-Golgi network transport vesicle	GDP binding|GTP binding|GTPase activity				0						TCGCTCCTGTCCTGCCGTATC	0.423													17	65	---	---	---	---	PASS
STXBP1	6812	broad.mit.edu	37	9	130428485	130428485	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130428485G>A	uc004brl.2	+	9	901	c.704G>A	c.(703-705)CGA>CAA	p.R235Q	STXBP1_uc004brk.2_Missense_Mutation_p.R235Q	NM_001032221	NP_001027392	P61764	STXB1_HUMAN	syntaxin binding protein 1 isoform b	235					axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1						ATCCTGGATCGAGGCTTTGAC	0.522													18	83	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136637069	136637069	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136637069G>A	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GCCGGAGCCAGAAGTCACCTA	0.572													18	61	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15255945	15255945	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15255945G>A	uc001iob.2	-	8	1649	c.1642C>T	c.(1642-1644)CTC>TTC	p.L548F		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	548	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						GGTCTCTCGAGGTGATCTACT	0.537													56	155	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16957870	16957870	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16957870G>A	uc001ioo.2	-	46	7212	c.7160C>T	c.(7159-7161)TCT>TTT	p.S2387F		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2387	CUB 17.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAGCCAGAAGAATTCTGAAG	0.408													20	113	---	---	---	---	PASS
PLXDC2	84898	broad.mit.edu	37	10	20466004	20466004	+	Silent	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20466004G>T	uc001iqg.1	+	8	1597	c.960G>T	c.(958-960)GTG>GTT	p.V320V	PLXDC2_uc001iqh.1_Silent_p.V271V|PLXDC2_uc009xkc.1_RNA	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	320	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						TTTCGGCTGTGGAGATGACCC	0.328													13	89	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24886940	24886940	+	Splice_Site	SNP	T	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24886940T>C	uc001isb.2	-	15	3620	c.3133_splice	c.e15-1	p.D1045_splice	ARHGAP21_uc010qdb.1_Splice_Site|ARHGAP21_uc009xkl.1_Splice_Site_p.D1045_splice|ARHGAP21_uc010qdc.1_Splice_Site_p.D880_splice	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21						signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TCCAGTGTCCTACAGAATAAA	0.328													3	127	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61932648	61932648	+	Intron	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61932648G>T	uc001jky.2	-						ANK3_uc001jkx.2_5'Flank|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron|ANK3_uc001jlc.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AGCTGGCCCTGAGCGCTTACC	0.478													9	32	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62632020	62632020	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62632020C>T	uc001jli.2	-	11	2282	c.1844G>A	c.(1843-1845)TGG>TAG	p.W615*	RHOBTB1_uc001jlh.2_Nonsense_Mutation_p.W615*|RHOBTB1_uc001jlj.2_Nonsense_Mutation_p.W615*|RHOBTB1_uc001jlk.2_Nonsense_Mutation_p.W615*|RHOBTB1_uc009xpe.1_Nonsense_Mutation_p.W553*|RHOBTB1_uc009xpd.2_Intron|RHOBTB1_uc001jll.2_Nonsense_Mutation_p.W365*	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	615					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					GTGCAAACACCAGGCGGCCAA	0.473													27	86	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70446467	70446467	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70446467G>A	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						AACCTTAGGTGAGCCCTATGG	0.418													11	44	---	---	---	---	PASS
CYP26C1	340665	broad.mit.edu	37	10	94825701	94825701	+	Intron	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94825701G>T	uc010qns.1	+						CYP26C1_uc009xud.2_Intron	NM_183374	NP_899230	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C,						anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)				GCAGCCCGGGGCTGTCTTGCA	0.647													3	13	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95113616	95113616	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95113616C>T	uc001kin.2	-	32	3556	c.3433G>A	c.(3433-3435)GTC>ATC	p.V1145I	MYOF_uc001kio.2_Missense_Mutation_p.V1132I|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1145	Cytoplasmic (Potential).|C2 4.				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GCTTGATAGACATAGCAGCGC	0.348													24	105	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98129927	98129927	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98129927C>T	uc001kml.1	-	20	3034	c.2808G>A	c.(2806-2808)CGG>CGA	p.R936R		NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	936	CUB 5.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCTCAAAGGTCCGGAATGTCA	0.632													8	34	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115986992	115986992	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115986992G>C	uc001lbg.1	+	23	3490	c.3337G>C	c.(3337-3339)GAT>CAT	p.D1113H	TDRD1_uc001lbf.2_Missense_Mutation_p.D990H|TDRD1_uc001lbh.1_Missense_Mutation_p.D1100H|TDRD1_uc001lbi.1_Missense_Mutation_p.D1104H|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Missense_Mutation_p.D822H	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1113					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CGATGTAGCTGATAAGCTAGT	0.363													35	139	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124348625	124348625	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124348625C>A	uc001lgk.1	+	17	2055	c.1949C>A	c.(1948-1950)TCA>TAA	p.S650*	DMBT1_uc001lgl.1_Nonsense_Mutation_p.S640*|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Nonsense_Mutation_p.S650*|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Intron	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	650	SRCR 5.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGGCCACGTCAGCCCCAGGA	0.607													56	250	---	---	---	---	PASS
PKP3	11187	broad.mit.edu	37	11	399985	399985	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:399985C>T	uc001lpc.2	+	6	1368	c.1292C>T	c.(1291-1293)TCA>TTA	p.S431L		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	431	ARM 3.				cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAACCTTTCATCCAGCGAC	0.667													3	9	---	---	---	---	PASS
TMEM80	283232	broad.mit.edu	37	11	703087	703087	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:703087C>T	uc001lqr.2	+	5	581	c.444C>T	c.(442-444)CTC>CTT	p.L148L	TMEM80_uc001lqs.2_Silent_p.L140L|TMEM80_uc010qwi.1_Silent_p.L148L	NM_001042463	NP_001035928	Q96HE8	TMM80_HUMAN	transmembrane protein 80 isoform 2	148	Helical; (Potential).					integral to membrane					0		all_cancers(49;5.11e-06)|all_epithelial(84;0.00143)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.44e-27)|Epithelial(43;2.29e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.19e-20)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGCCACGCTCCTGGCCCTTC	0.697													8	19	---	---	---	---	PASS
APBB1	322	broad.mit.edu	37	11	6417049	6417049	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6417049G>A	uc001mdb.1	-	13	2032	c.1932C>T	c.(1930-1932)GCC>GCT	p.A644A	APBB1_uc001mcz.1_Silent_p.A263A|APBB1_uc001mdd.3_Silent_p.A422A|APBB1_uc001mda.2_Silent_p.A169A|APBB1_uc001mdc.1_Silent_p.A642A|APBB1_uc010rab.1_Silent_p.A169A|APBB1_uc001mcy.1_Missense_Mutation_p.P82L	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	644	PID 2.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CTGAGAGGCTGGCAGCATTGG	0.622													13	27	---	---	---	---	PASS
SERPING1	710	broad.mit.edu	37	11	57369616	57369616	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57369616C>T	uc001nkp.1	+	4	850	c.659C>T	c.(658-660)TCA>TTA	p.S220L	SERPING1_uc001nkq.1_Missense_Mutation_p.S220L|SERPING1_uc010rju.1_Missense_Mutation_p.S168L|SERPING1_uc010rjv.1_Missense_Mutation_p.S225L|SERPING1_uc001nkr.1_Missense_Mutation_p.S220L|SERPING1_uc009ymi.1_Missense_Mutation_p.S220L|SERPING1_uc009ymj.1_Missense_Mutation_p.S220L|SERPING1_uc001nks.1_5'UTR	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	220					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						GGTGTCACCTCAGTCTCTCAG	0.582									Hereditary_Angioedema				15	74	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66328096	66328096	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66328096G>A	uc001oio.1	+	15	1746	c.1728_splice	c.e15+2	p.D576_splice	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3						focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						GAGGCTGACTGAGAGCGAGGT	0.607													15	49	---	---	---	---	PASS
RCE1	9986	broad.mit.edu	37	11	66612502	66612502	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66612502G>C	uc001ojk.1	+	5	658	c.614G>C	c.(613-615)GGA>GCA	p.G205A	RCE1_uc001ojl.1_Missense_Mutation_p.G101A	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN	prenyl protein peptidase RCE1 isoform 1	205	Helical; (Potential).				proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity			ovary(1)|breast(1)	2						CTCTTTTTTGGAGTTGGTGAG	0.597													19	57	---	---	---	---	PASS
ADRBK1	156	broad.mit.edu	37	11	67047341	67047341	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67047341G>A	uc009yrn.1	+	6	739	c.473G>A	c.(472-474)CGA>CAA	p.R158Q	ADRBK1_uc009yrm.1_Missense_Mutation_p.R158Q	NM_001619	NP_001610	P25098	ARBK1_HUMAN	beta-adrenergic receptor kinase 1	158	RGS.|N-terminal.				activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CAAAACCTCCGAGGGGACGTG	0.592													4	63	---	---	---	---	PASS
GAL	51083	broad.mit.edu	37	11	68455487	68455487	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68455487G>T	uc001oob.2	+	4	360	c.142G>T	c.(142-144)GTT>TTT	p.V48F		NM_015973	NP_057057	P22466	GALA_HUMAN	galanin preproprotein	48					growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		AACAGATGCCGTTGGCAACCA	0.572													13	32	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69062821	69062821	+	5'UTR	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69062821C>T	uc001oov.2	+	2					MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_5'UTR|MYEOV_uc001oow.2_Intron	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed												0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		tccctcggctcatggccctca	0.000													8	19	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69062904	69062904	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69062904C>T	uc001oov.2	+	2	533	c.83C>T	c.(82-84)TCT>TTT	p.S28F	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.S28F|MYEOV_uc001oow.2_5'UTR	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	28											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		ctggaacagtctccctcctgg	0.244													16	56	---	---	---	---	PASS
AMICA1	120425	broad.mit.edu	37	11	118076709	118076709	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118076709G>A	uc001psk.2	-						AMICA1_uc001psg.2_5'Flank|AMICA1_uc001psh.2_Intron|AMICA1_uc009yzw.1_Intron|AMICA1_uc001psi.2_Intron|AMICA1_uc001psj.2_Intron|AMICA1_uc010rxw.1_Intron|AMICA1_uc010rxx.1_Intron|AMICA1_uc001psl.1_Intron	NM_001098526	NP_001091996	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen						blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane				ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CATGAGCTCTGAGGATAAAAC	0.398													23	62	---	---	---	---	PASS
KLHDC5	57542	broad.mit.edu	37	12	27944650	27944650	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27944650C>G	uc001rij.2	+	2	959	c.882C>G	c.(880-882)TTC>TTG	p.F294L	KLHDC5_uc009zjj.2_RNA	NM_020782	NP_065833	Q9P2K6	KLDC5_HUMAN	kelch domain containing 5	294	Kelch 3.									ovary(1)|central_nervous_system(1)	2	Lung SC(9;0.0873)					GGTCTAACTTCAAACTTGTGG	0.443													65	175	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44149050	44149050	+	5'UTR	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44149050C>A	uc001rnq.3	-	2					PUS7L_uc001rnr.3_5'UTR|PUS7L_uc001rns.3_5'UTR|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TTCTTCCATTCTTCTATAACA	0.343													6	39	---	---	---	---	PASS
RAPGEF3	10411	broad.mit.edu	37	12	48140693	48140693	+	Intron	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48140693G>C	uc009zkp.2	-						RAPGEF3_uc001rpx.2_5'Flank|RAPGEF3_uc010sln.1_Intron|RAPGEF3_uc001rpy.2_Intron|RAPGEF3_uc009zkq.2_Intron|RAPGEF3_uc001rpz.3_Intron|RAPGEF3_uc001rqa.2_Intron	NM_001098532	NP_001092002	A8K2G5	A8K2G5_HUMAN	Rap guanine nucleotide exchange factor 3 isoform						regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex	cAMP-dependent protein kinase regulator activity|guanyl-nucleotide exchange factor activity			lung(2)|skin(1)|pancreas(1)	4	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		CTGCAGACAAGAGAGAAGGGA	0.602													2	10	---	---	---	---	PASS
TFCP2	7024	broad.mit.edu	37	12	51492613	51492613	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51492613G>C	uc001rxw.2	-	13	1824	c.1365C>G	c.(1363-1365)ATC>ATG	p.I455M	TFCP2_uc001rxv.1_Missense_Mutation_p.I455M|TFCP2_uc009zlx.1_Missense_Mutation_p.I404M|TFCP2_uc001rxx.2_Missense_Mutation_p.I377M|TFCP2_uc009zly.1_Missense_Mutation_p.I357M	NM_005653	NP_005644	Q12800	TFCP2_HUMAN	transcription factor CP2	455					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						AAATCTGGCTGATCTGGCAAG	0.393													20	59	---	---	---	---	PASS
GLIPR1	11010	broad.mit.edu	37	12	75884309	75884309	+	Intron	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884309G>C	uc001sxs.2	+						GLIPR1_uc009zsb.1_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						GTAAGTGCCTGAATCAACCGG	0.403													4	15	---	---	---	---	PASS
BBS10	79738	broad.mit.edu	37	12	76740222	76740222	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76740222C>T	uc001syd.1	-	2	1627	c.1543G>A	c.(1543-1545)GAT>AAT	p.D515N		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	515					cellular protein metabolic process|nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	cilium	ATP binding			ovary(1)|skin(1)	2						TGGAATGTATCTGTTGGTGTC	0.333									Bardet-Biedl_syndrome				8	247	---	---	---	---	PASS
SYT1	6857	broad.mit.edu	37	12	79747354	79747354	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79747354C>A	uc001sys.2	+	10	1554	c.883C>A	c.(883-885)CTG>ATG	p.L295M	SYT1_uc001syt.2_Missense_Mutation_p.L295M|SYT1_uc001syu.2_Missense_Mutation_p.L292M|SYT1_uc001syv.2_Missense_Mutation_p.L295M	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I	295	Cytoplasmic (Potential).|Phospholipid binding (Probable).|C2 2.				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						TGTTGTCATTCTGGAGGCAAA	0.428													67	220	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100452656	100452656	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100452656G>A	uc001tgq.2	-	14	2628	c.2399C>T	c.(2398-2400)TCG>TTG	p.S800L	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.S450L	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	800										ovary(2)	2						TGCCTCTGACGAGGAAGGGGA	0.398													25	105	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100904813	100904813	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100904813C>T	uc001tht.1	+	2	395	c.367C>T	c.(367-369)CGC>TGC	p.R123C	NR1H4_uc001thp.1_Missense_Mutation_p.R113C|NR1H4_uc001thq.1_Missense_Mutation_p.R113C|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.R113C|NR1H4_uc010svk.1_Missense_Mutation_p.R113C|NR1H4_uc001ths.1_Missense_Mutation_p.R123C	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	123					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						AAAGAAGCCCCGCATGGGCGC	0.527													37	108	---	---	---	---	PASS
BTBD11	121551	broad.mit.edu	37	12	108012145	108012145	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108012145C>G	uc001tmk.1	+	10	2963	c.2442C>G	c.(2440-2442)ATC>ATG	p.I814M	BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Missense_Mutation_p.I814M|BTBD11_uc001tml.1_Missense_Mutation_p.I351M	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	814						integral to membrane	DNA binding			skin(2)|ovary(1)	3						CAATTGATATCAGGAGCATAG	0.488													8	12	---	---	---	---	PASS
UNG	7374	broad.mit.edu	37	12	109539758	109539758	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109539758C>T	uc001tnz.1	+	4	557	c.487C>T	c.(487-489)CAC>TAC	p.H163Y	UNG_uc001toa.1_Missense_Mutation_p.H154Y	NM_080911	NP_550433	P13051	UNG_HUMAN	uracil-DNA glycosylase isoform UNG2	163					base-excision repair|interspecies interaction between organisms	mitochondrion|nucleus	protein binding|uracil DNA N-glycosylase activity			lung(1)|central_nervous_system(1)	2						TAATCAAGCTCACGGGCTCTG	0.488								BER_DNA_glycosylases	Immune_Deficiency_with_Hyper-IgM				24	64	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116452926	116452926	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116452926C>T	uc001tvw.2	-	8	1218	c.1163G>A	c.(1162-1164)AGA>AAA	p.R388K		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	388					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GGACTGGGTTCTGTTGAGGAT	0.423													4	95	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117658014	117658014	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117658014C>A	uc001twm.1	-	27	4722	c.4036G>T	c.(4036-4038)GAG>TAG	p.E1346*		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1346					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CCCCCTTGCTCCTTCAGGGCT	0.607													24	171	---	---	---	---	PASS
PITPNM2	57605	broad.mit.edu	37	12	123494554	123494554	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123494554G>A	uc001uej.1	-	5	625	c.486C>T	c.(484-486)TTC>TTT	p.F162F	PITPNM2_uc001uek.1_Silent_p.F162F|PITPNM2_uc009zxu.1_Silent_p.F162F	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	162					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGGTTGACTGGAACAGCTTGG	0.542													29	156	---	---	---	---	PASS
RNF6	6049	broad.mit.edu	37	13	26788558	26788558	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26788558G>A	uc001uqo.2	-	5	1752	c.1461C>T	c.(1459-1461)ATC>ATT	p.I487I	RNF6_uc001uqn.1_Intron|RNF6_uc010aak.2_Silent_p.I487I|RNF6_uc001uqp.2_Silent_p.I487I|RNF6_uc001uqq.2_Silent_p.I487I|RNF6_uc010tdk.1_Silent_p.I131I	NM_183044	NP_898865	Q9Y252	RNF6_HUMAN	ring finger protein 6	487					negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		ACCCAGTCATGATCTGCCTTA	0.438													28	98	---	---	---	---	PASS
N4BP2L2	10443	broad.mit.edu	37	13	33096410	33096410	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33096410G>A	uc001uuk.3	-						N4BP2L2_uc001uuj.2_Intron|N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron	NM_014887	NP_055702	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5												0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TTGTTTTGCTGaaataaaata	0.269													27	105	---	---	---	---	PASS
TRIM13	10206	broad.mit.edu	37	13	50587012	50587012	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50587012G>T	uc001vdq.1	+	3	1249	c.936G>T	c.(934-936)TGG>TGT	p.W312C	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_5'Flank|KCNRG_uc001vdu.2_5'Flank|TRIM13_uc001vdp.1_Missense_Mutation_p.W315C|TRIM13_uc001vdr.1_Missense_Mutation_p.W312C|TRIM13_uc001vds.1_Missense_Mutation_p.W312C	NM_052811	NP_434698	O60858	TRI13_HUMAN	ret finger protein 2 isoform 1	312					anatomical structure morphogenesis|ER-associated protein catabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination	cytoplasm|endoplasmic reticulum membrane|integral to membrane	protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		AGATTCCCTGGAGCTTTTATA	0.398													82	334	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52951826	52951826	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52951826C>G	uc001vgo.2	-	5	2824	c.2279G>C	c.(2278-2280)CGT>CCT	p.R760P	THSD1_uc001vgp.2_Missense_Mutation_p.R707P|THSD1_uc010tgz.1_Missense_Mutation_p.R381P|THSD1_uc010aea.2_Missense_Mutation_p.R221P	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	760	Cytoplasmic (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CGGTCCCCGACGAGCTCTGTG	0.547													5	230	---	---	---	---	PASS
SUGT1	10910	broad.mit.edu	37	13	53239860	53239860	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53239860G>C	uc001vhc.2	+	10	832	c.607G>C	c.(607-609)GAA>CAA	p.E203Q	SUGT1_uc001vha.2_RNA|SUGT1_uc001vhb.2_Missense_Mutation_p.E171Q|SUGT1_uc010thb.1_Missense_Mutation_p.E115Q|SUGT1_uc001vhd.2_Missense_Mutation_p.E60Q	NM_001130912	NP_001124384	Q9Y2Z0	SUGT1_HUMAN	suppressor of G2 allele of SKP1 isoform a	203	CS.				mitosis	kinetochore|ubiquitin ligase complex	binding				0		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		GGAATTTTCAGAAAAAGAGGT	0.279													14	40	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60240728	60240728	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60240728C>T	uc001vht.2	-	28	3791	c.3572G>A	c.(3571-3573)CGA>CAA	p.R1191Q	DIAPH3_uc001vhs.2_RNA	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	1191					actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TTATAAAGCTCGTAATCTTGC	0.323													3	80	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	102029363	102029363	+	Silent	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102029363G>T	uc001vox.1	-	5	609	c.420C>A	c.(418-420)GGC>GGA	p.G140G	NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Silent_p.G140G|NALCN_uc001vpa.2_Silent_p.G140G	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	140	Helical; Voltage-sensor; Name=S4 of repeat I; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCGCAACATGCCCCAAGGTG	0.393													10	46	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861152	108861152	+	Missense_Mutation	SNP	G	A	A	rs141441003		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861152G>A	uc001vqn.2	-	2	2738	c.2465C>T	c.(2464-2466)TCG>TTG	p.S822L	LIG4_uc001vqo.2_Missense_Mutation_p.S822L|LIG4_uc010agg.1_Missense_Mutation_p.S755L|LIG4_uc010agf.2_Missense_Mutation_p.S822L|LIG4_uc001vqp.2_Missense_Mutation_p.S822L	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	822	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					AACAGCATACGAGTCCAAATA	0.423								NHEJ					11	72	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20873630	20873630	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20873630C>G	uc001vxe.2	-	4	890	c.850G>C	c.(850-852)GAG>CAG	p.E284Q	TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.E284Q	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	284	TROVE.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AACTCAGGCTCCAGGAGGGCA	0.517													10	60	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21788328	21788328	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21788328C>T	uc001wag.2	+	11	1459	c.1459C>T	c.(1459-1461)CAG>TAG	p.Q487*	RPGRIP1_uc001wah.2_Nonsense_Mutation_p.Q129*|RPGRIP1_uc001wai.2_Nonsense_Mutation_p.Q129*|RPGRIP1_uc001waj.1_5'Flank|RPGRIP1_uc001wak.2_5'Flank|RPGRIP1_uc010aim.2_5'Flank|RPGRIP1_uc001wal.2_5'Flank	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	487	Potential.				response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGAGAACACTCAGATCGAGGT	0.448													3	23	---	---	---	---	PASS
C14orf166	51637	broad.mit.edu	37	14	52466482	52466482	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52466482C>T	uc010aod.2	+	5	560	c.430C>T	c.(430-432)CAG>TAG	p.Q144*	C14orf166_uc001wzm.3_Nonsense_Mutation_p.Q10*|C14orf166_uc001wzn.3_Nonsense_Mutation_p.Q10*	NM_016039	NP_057123	Q9Y224	CN166_HUMAN	homeobox prox 1	144						microtubule organizing center|nucleus|perinuclear region of cytoplasm|tRNA-splicing ligase complex	identical protein binding				0	Breast(41;0.0639)|all_epithelial(31;0.101)					GCTTCAGATTCAGCGTCATGA	0.343													25	71	---	---	---	---	PASS
SAMD4A	23034	broad.mit.edu	37	14	55203957	55203957	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55203957C>G	uc001xbb.2	+	3	929	c.928C>G	c.(928-930)CAG>GAG	p.Q310E	SAMD4A_uc001xbc.2_Intron	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform	311					positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						CTTAGAAGATCAGACCACTGC	0.512													45	129	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58830881	58830881	+	Intron	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58830881C>G	uc001xdp.2	+						ARID4A_uc001xdo.2_Intron|ARID4A_uc001xdq.2_Intron|ARID4A_uc010apg.1_Intron	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						AATATTTCCTCTTACAGACTC	0.229													9	30	---	---	---	---	PASS
C14orf39	317761	broad.mit.edu	37	14	60945022	60945022	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60945022C>G	uc001xez.3	-	5	429	c.319G>C	c.(319-321)GAC>CAC	p.D107H	C14orf39_uc010apo.2_Intron	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	107										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		CTATACTTGTCTTTTTCAACA	0.294													10	57	---	---	---	---	PASS
TGFB3	7043	broad.mit.edu	37	14	76447123	76447123	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76447123C>G	uc001xsc.2	-	1	970	c.114G>C	c.(112-114)AAG>AAC	p.K38N	TGFB3_uc001xsd.2_Missense_Mutation_p.K36N	NM_003239	NP_003230	P10600	TGFB3_HUMAN	transforming growth factor, beta 3 precursor	38					cell growth|cell-cell junction organization|detection of hypoxia|face morphogenesis|in utero embryonic development|induction of apoptosis|lung alveolus development|mammary gland development|menstrual cycle phase|negative regulation of cell proliferation|negative regulation of DNA replication|negative regulation of macrophage cytokine production|negative regulation of neuron apoptosis|odontogenesis|ossification involved in bone remodeling|palate development|platelet activation|platelet degranulation|positive regulation of bone mineralization|positive regulation of cell division|positive regulation of collagen biosynthetic process|positive regulation of DNA replication|positive regulation of epithelial to mesenchymal transition|positive regulation of filopodium assembly|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein secretion|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|response to progesterone stimulus|salivary gland morphogenesis|transforming growth factor beta receptor signaling pathway	extracellular matrix|platelet alpha granule lumen	growth factor activity|identical protein binding|transforming growth factor beta binding|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0169)		CTTCCACCCTCTTCTTCTTGA	0.597													17	123	---	---	---	---	PASS
SPATA7	55812	broad.mit.edu	37	14	88904624	88904624	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88904624C>G	uc001xwq.2	+	12	1809	c.1658C>G	c.(1657-1659)TCA>TGA	p.S553*	SPATA7_uc001xwr.2_Nonsense_Mutation_p.S521*|SPATA7_uc001xws.2_Nonsense_Mutation_p.S489*|SPATA7_uc001xwt.2_Nonsense_Mutation_p.S447*|SPATA7_uc001xwu.2_Intron	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN	spermatogenesis-associated protein 7 isoform a	553					response to stimulus|visual perception					ovary(1)	1						GTTGAGATTTCAAATGGATTA	0.383													8	117	---	---	---	---	PASS
CALM1	801	broad.mit.edu	37	14	90870837	90870837	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90870837G>A	uc001xyl.1	+	5	602	c.400G>A	c.(400-402)GAC>AAC	p.D134N	CALM1_uc010atq.1_Missense_Mutation_p.D135N|CALM1_uc010atr.1_RNA|CALM1_uc001xym.1_Missense_Mutation_p.D98N	NM_006888	NP_008819	P62158	CALM_HUMAN	calmodulin 1 isoform 1	134	4.|EF-hand 4.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			central_nervous_system(1)	1		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	TATTGATGGAGACGGACAAGT	0.388													20	78	---	---	---	---	PASS
YY1	7528	broad.mit.edu	37	14	100728666	100728666	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100728666G>C	uc001ygy.1	+	2	1185	c.705G>C	c.(703-705)GAG>GAC	p.E235D		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	235					cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				TTGACCATGAGACAGTGGTTG	0.353													22	103	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28413663	28413663	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28413663C>T	uc001zbj.2	-	67	10409	c.10303G>A	c.(10303-10305)GCC>ACC	p.A3435T		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3435					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCGGAAGGGGCCGCCGAGGAG	0.592													3	52	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31327888	31327888	+	Intron	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31327888G>C	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTGAAAGAAAGACAAGCTGTT	0.453													14	67	---	---	---	---	PASS
PLA2G4D	283748	broad.mit.edu	37	15	42371887	42371887	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42371887G>A	uc001zox.2	-	13	1260	c.1165C>T	c.(1165-1167)CGG>TGG	p.R389W		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	389	PLA2c.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		AGGTGCTCCCGGGCGTATCTG	0.652													3	62	---	---	---	---	PASS
USP3	9960	broad.mit.edu	37	15	63882965	63882965	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63882965G>A	uc002amf.2	+	15	1632	c.1503G>A	c.(1501-1503)GCG>GCA	p.A501A	USP3_uc002amg.2_Silent_p.A416A|USP3_uc002amh.2_Silent_p.A479A|USP3_uc010uij.1_Silent_p.A457A|USP3_uc010uik.1_Silent_p.A252A|USP3_uc010bgs.2_Silent_p.A484A|USP3_uc002ami.2_Silent_p.A332A|uc002amj.2_Intron|uc002amk.2_Intron|uc002aml.2_Intron	NM_006537	NP_006528	Q9Y6I4	UBP3_HUMAN	ubiquitin thiolesterase 3	501					DNA repair|histone deubiquitination|mitotic cell cycle|regulation of protein stability|ubiquitin-dependent protein catabolic process	nuclear chromatin	histone binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(80;0.0187)		TGGTGAAGGCGAAGGCCTACA	0.478													43	167	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65621255	65621255	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65621255C>T	uc002aos.2	-	14	2689	c.2437G>A	c.(2437-2439)GAA>AAA	p.E813K	IGDCC3_uc002aor.1_Missense_Mutation_p.E99K	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	813	Cytoplasmic (Potential).									ovary(3)	3						GGCTACTGTTCCGAGTGAGCT	0.632													8	31	---	---	---	---	PASS
EDC3	80153	broad.mit.edu	37	15	74963937	74963937	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74963937G>C	uc002ayn.2	-	6	831	c.343C>G	c.(343-345)CAG>GAG	p.Q115E	EDC3_uc002ayo.2_Missense_Mutation_p.Q115E|EDC3_uc002aym.2_Missense_Mutation_p.Q115E	NM_001142443	NP_001135915	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	115					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1						GGGATATTCTGAGGGGCACTG	0.532													45	130	---	---	---	---	PASS
EDC3	80153	broad.mit.edu	37	15	74964118	74964118	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74964118G>A	uc002ayn.2	-						EDC3_uc002ayo.2_Intron|EDC3_uc002aym.2_Intron	NM_001142443	NP_001135915	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1						CACCTGCCCTGAAATACACAA	0.403													31	132	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2158464	2158464	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2158464G>A	uc002cos.1	-	15	6913	c.6704C>T	c.(6703-6705)TCA>TTA	p.S2235L	PKD1_uc002cot.1_Missense_Mutation_p.S2235L	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2235	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GTCCCCAAATGACACGACAAA	0.672													8	38	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4836063	4836063	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4836063G>C	uc002cxq.2	-	3	351	c.210C>G	c.(208-210)TTC>TTG	p.F70L	SEPT12_uc002cxr.2_Missense_Mutation_p.F70L|SEPT12_uc010bty.2_RNA|uc002cxt.2_5'Flank	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	70					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CTTTGGACTTGAACAGCGTGT	0.597													14	34	---	---	---	---	PASS
ERCC4	2072	broad.mit.edu	37	16	14016073	14016073	+	Intron	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14016073G>C	uc002dce.2	+						ERCC4_uc010bva.2_Intron	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent						double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						TTACTGGTAAGAATTTGAAAT	0.289			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				6	26	---	---	---	---	PASS
NOMO2	283820	broad.mit.edu	37	16	18542930	18542930	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18542930C>T	uc002dfe.2	-	13	1468	c.1396_splice	c.e13-1	p.V466_splice	NOMO2_uc002dff.2_Splice_Site_p.V466_splice|NOMO2_uc010bvx.2_Splice_Site_p.V299_splice	NM_001004060	NP_001004060	Q5JPE7	NOMO2_HUMAN	nodal modulator 2 isoform 1							endoplasmic reticulum membrane|integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			skin(1)	1						GAACCATCACCTGCGGAAACG	0.542													23	158	---	---	---	---	PASS
LOC81691	81691	broad.mit.edu	37	16	20857632	20857632	+	Silent	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20857632C>G	uc002dhv.2	+	19	2477	c.2214C>G	c.(2212-2214)CTC>CTG	p.L738L	ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Silent_p.L707L|LOC81691_uc002dhw.2_Silent_p.L481L|LOC81691_uc002dhy.3_Silent_p.L738L	NM_030941	NP_112203	Q96IC2	REXON_HUMAN	exonuclease NEF-sp isoform 1	738						nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2						CGGGCACTCTCTGCCTCATCC	0.532													36	91	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24902257	24902257	+	Silent	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24902257G>C	uc002dmu.2	+	9	964	c.732G>C	c.(730-732)CGG>CGC	p.R244R	SLC5A11_uc002dms.2_Silent_p.R180R|SLC5A11_uc010vcd.1_Silent_p.R209R|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Silent_p.R174R|SLC5A11_uc010bxt.2_Silent_p.R180R	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	244	Extracellular (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		CTAGCAACCGGAGTGAGAACA	0.557													32	152	---	---	---	---	PASS
PHKG2	5261	broad.mit.edu	37	16	30764777	30764777	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30764777G>A	uc002dzk.1	+	6	548	c.455G>A	c.(454-456)CGA>CAA	p.R152Q	PHKG2_uc002dzi.1_Missense_Mutation_p.R152Q|PHKG2_uc002dzj.1_Missense_Mutation_p.R50Q	NM_000294	NP_000285	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	152	Protein kinase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			ovary(1)	1			Colorectal(24;0.198)			ATTGTGCATCGAGATCTGAAG	0.542													21	61	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31141434	31141434	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31141434G>C	uc002eay.2	+	7	886	c.868G>C	c.(868-870)GAG>CAG	p.E290Q	MYST1_uc002eax.2_Missense_Mutation_p.E290Q|MYST1_uc002eaz.2_Missense_Mutation_p.E132Q|MYST1_uc002eba.2_Missense_Mutation_p.E74Q|MYST1_uc002ebb.2_RNA	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	290					histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						CATCCTGACTGAGGTGGACCG	0.562													57	264	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46746648	46746648	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46746648G>A	uc002eei.3	-	10	2142	c.2026C>T	c.(2026-2028)CCT>TCT	p.P676S	MYLK3_uc010vge.1_Missense_Mutation_p.P335S	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	676	Protein kinase.				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGGAACTCAGGAGTGCCGAAG	0.542													23	53	---	---	---	---	PASS
NKD1	85407	broad.mit.edu	37	16	50667159	50667159	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50667159C>T	uc002egg.1	+	10	1104	c.880C>T	c.(880-882)CGA>TGA	p.R294*		NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1	294					Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CAATCCCACTCGATCTCGCTC	0.522													11	64	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58752559	58752559	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58752559G>C	uc002eof.1	-	5	583	c.469C>G	c.(469-471)CTG>GTG	p.L157V	GOT2_uc010vim.1_Missense_Mutation_p.L114V	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	157					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GGTTTGGGCAGAAAGACATCT	0.428													18	80	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81929544	81929544	+	Intron	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81929544G>C	uc002fgt.2	+						PLCG2_uc010chg.1_Intron	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCAGTTGGCTGATTTCTGGGT	0.532													21	92	---	---	---	---	PASS
VPS53	55275	broad.mit.edu	37	17	465783	465783	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:465783G>A	uc002frn.2	-	14	1663	c.1516C>T	c.(1516-1518)CGA>TGA	p.R506*	VPS53_uc002frk.2_Nonsense_Mutation_p.R25*|VPS53_uc010cjo.1_Nonsense_Mutation_p.R506*|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Nonsense_Mutation_p.R477*|VPS53_uc002fro.2_Nonsense_Mutation_p.R308*|VPS53_uc010cjp.1_Nonsense_Mutation_p.R229*	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	506					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GCGTATTCTCGGAGGTACTTC	0.488													16	69	---	---	---	---	PASS
ALOX15B	247	broad.mit.edu	37	17	7948588	7948588	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7948588C>G	uc002gju.2	+	7	998	c.882C>G	c.(880-882)ATC>ATG	p.I294M	ALOX15B_uc002gjv.2_Missense_Mutation_p.I294M|ALOX15B_uc002gjw.2_Missense_Mutation_p.I294M|ALOX15B_uc010vun.1_Missense_Mutation_p.I294M|ALOX15B_uc010cnp.2_Missense_Mutation_p.I100M	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	294	Lipoxygenase.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						ATCACGGCATCCTCTCTGGCA	0.567													37	126	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8076761	8076761	+	3'UTR	SNP	C	T	T	rs116395281	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8076761C>T	uc002gkg.3	-	5					TMEM107_uc002gkh.3_3'UTR|TMEM107_uc002gki.3_3'UTR|TMEM107_uc002gkj.3_RNA	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						TGTAAGTGATCGTCAGAAAGa	0.209													25	117	---	---	---	---	PASS
MYH10	4628	broad.mit.edu	37	17	8395749	8395749	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8395749C>G	uc002gll.2	-	32	4540	c.4444G>C	c.(4444-4446)GAA>CAA	p.E1482Q	MYH10_uc002glm.2_Missense_Mutation_p.E1513Q|MYH10_uc010cnx.2_Missense_Mutation_p.E1491Q	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	1482	Potential.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						GCTTTGGTTTCTTTCTCTCTG	0.602													28	89	---	---	---	---	PASS
KSR1	8844	broad.mit.edu	37	17	25932695	25932695	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25932695G>A	uc010crg.2	+	15	1950	c.1505G>A	c.(1504-1506)CGC>CAC	p.R502H	KSR1_uc002gzj.1_RNA|KSR1_uc002gzm.2_Missense_Mutation_p.R281H	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	637	Protein kinase.				Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GTGGCCATTCGCCTGCTGGAG	0.652													4	6	---	---	---	---	PASS
CCDC55	84081	broad.mit.edu	37	17	28512006	28512006	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28512006C>A	uc002heu.2	+	7	1019	c.991C>A	c.(991-993)CAT>AAT	p.H331N	CCDC55_uc002hev.2_Missense_Mutation_p.H277N|CCDC55_uc010wbl.1_Missense_Mutation_p.H277N|CCDC55_uc010wbm.1_Missense_Mutation_p.H277N|CCDC55_uc002hex.2_Missense_Mutation_p.H277N	NM_032141	NP_115517	Q9H0G5	NSRP1_HUMAN	coiled-coil domain containing 55 isoform 1	331	His-rich.				developmental process|nucleocytoplasmic transport|regulation of alternative nuclear mRNA splicing, via spliceosome	nuclear speck|ribonucleoprotein complex	mRNA binding|protein binding				0						CCAAGAGAACCATTACACTGA	0.488													3	54	---	---	---	---	PASS
TNS4	84951	broad.mit.edu	37	17	38645133	38645133	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38645133G>A	uc010cxb.2	-	3	692	c.528C>T	c.(526-528)TTC>TTT	p.F176F		NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor	176	Ser-rich.				apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GAAGGGAGCCGAAGGGCGGGG	0.622													19	70	---	---	---	---	PASS
KRTAP9-8	83901	broad.mit.edu	37	17	39394399	39394399	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39394399C>G	uc002hwh.3	+	1	130	c.96C>G	c.(94-96)TGC>TGG	p.C32W	KRTAP9-9_uc010wfq.1_Intron	NM_031963	NP_114169	Q9BYQ0	KRA98_HUMAN	keratin associated protein 9.8	32	3.|15 X 5 AA repeats of C-C-[RQVSGE]- [SPSNQ]-[TASPI].					keratin filament				ovary(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCACACCCTGCTGCCAGCCCT	0.617													10	67	---	---	---	---	PASS
WNK4	65266	broad.mit.edu	37	17	40947491	40947491	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40947491C>G	uc002ibj.2	+	15	2995	c.2974C>G	c.(2974-2976)CCT>GCT	p.P992A	WNK4_uc010wgx.1_Missense_Mutation_p.P656A|CCDC56_uc010wgz.1_3'UTR	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	992			P -> S (in a metastatic melanoma sample; somatic mutation).		intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity	p.P992S(1)		ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CTCACCACCTCCTGCTCGGCC	0.582													30	132	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42475272	42475272	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42475272G>A	uc002igw.1	-	8	4237	c.4173C>T	c.(4171-4173)ATC>ATT	p.I1391I	GPATCH8_uc002igv.1_Silent_p.I1313I|GPATCH8_uc010wiz.1_Silent_p.I1313I	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1391						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GGTGAATGCCGATGGCGGCAG	0.572													4	14	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42882272	42882272	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42882272G>C	uc002ihj.2	-	2	1425	c.914C>G	c.(913-915)TCC>TGC	p.S305C	GJC1_uc002ihk.2_Missense_Mutation_p.S305C|GJC1_uc002ihl.2_Missense_Mutation_p.S305C|GJC1_uc010czx.2_Missense_Mutation_p.S305C|GJC1_uc010czy.1_Missense_Mutation_p.S166C	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	305	Cytoplasmic (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				CTTAGCATTGGACAGTTCGGT	0.502													5	217	---	---	---	---	PASS
ACBD4	79777	broad.mit.edu	37	17	43213602	43213602	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43213602G>A	uc002iid.2	+						ACBD4_uc010wjj.1_Intron|ACBD4_uc002iie.2_Intron|ACBD4_uc002iif.2_Intron|ACBD4_uc002iic.2_Intron|ACBD4_uc010dae.2_5'UTR	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4								fatty-acyl-CoA binding			ovary(1)|kidney(1)	2						CAAGAACGGTGAGGCTGCGGG	0.572													6	15	---	---	---	---	PASS
ACBD4	79777	broad.mit.edu	37	17	43214086	43214086	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43214086G>A	uc002iid.2	+	4	581	c.237G>A	c.(235-237)ATG>ATA	p.M79I	ACBD4_uc010wjj.1_Missense_Mutation_p.M79I|ACBD4_uc002iie.2_Missense_Mutation_p.M79I|ACBD4_uc002iif.2_Missense_Mutation_p.M79I|ACBD4_uc002iic.2_Missense_Mutation_p.M79I|ACBD4_uc010dae.2_Missense_Mutation_p.M1I	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4	79	ACB.						fatty-acyl-CoA binding			ovary(1)|kidney(1)	2						TGGGCAAGATGAGCAGGGAGG	0.612													19	43	---	---	---	---	PASS
SNF8	11267	broad.mit.edu	37	17	47010637	47010637	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47010637C>T	uc002ioj.2	-	6	552	c.494G>A	c.(493-495)GGC>GAC	p.G165D	SNF8_uc002iok.2_Missense_Mutation_p.G165D	NM_007241	NP_009172	Q96H20	SNF8_HUMAN	EAP30 subunit of ELL complex	165					cellular membrane organization|endosome transport|protein transport|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytosol|late endosome membrane|transcription factor complex	transcription factor binding				0						GAGGTAAGTGCCGCCCACAGG	0.527													4	89	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65134104	65134104	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65134104C>G	uc010wqk.1	-	22	3086	c.2899G>C	c.(2899-2901)GAA>CAA	p.E967Q	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.E966Q	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TTTCGAAGTTCAGCACGTATT	0.383													43	185	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76497914	76497914	+	RNA	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76497914G>A	uc002jvt.1	+	2		c.3373G>A								Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		CAGCGTTGAGGTTCCCCATGA	0.592													18	89	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76501416	76501416	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76501416C>T	uc010wtu.1	-	5	967	c.790G>A	c.(790-792)GAG>AAG	p.E264K						full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACCATGTACTCGTCCTCCTTG	0.562													6	39	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77077040	77077040	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77077040C>T	uc002jwv.2	+	6	765	c.757C>T	c.(757-759)CGG>TGG	p.R253W	ENGASE_uc002jwu.1_Missense_Mutation_p.R253W|ENGASE_uc010wtz.1_Missense_Mutation_p.R67W|ENGASE_uc002jww.2_5'UTR	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	253						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						TCCTTTCCTGCGGTACCTCAC	0.567													19	66	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2577797	2577797	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2577797G>C	uc002kli.2	+	4	414	c.232G>C	c.(232-234)GAG>CAG	p.E78Q		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	78	Interaction with the N-terminus of CDCA1.|Nuclear localization.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						TTCCAGTTCTGAGAAAATCAA	0.368													35	94	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2579017	2579017	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2579017G>C	uc002kli.2	+	6	750	c.568G>C	c.(568-570)GAC>CAC	p.D190H		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	190	Interaction with the N-terminus of CDCA1.|Nuclear localization.|Interaction with RB1.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						TTGGCTAATAGACTGCATCAA	0.388													15	68	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67993286	67993286	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67993286C>A	uc002lkr.1	+	2	1698	c.1382C>A	c.(1381-1383)TCA>TAA	p.S461*	SOCS6_uc010dqq.2_Nonsense_Mutation_p.S461*	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	461	SH2.				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ATTGAGCATTCAATCAGGGAC	0.453													26	74	---	---	---	---	PASS
RNF126	55658	broad.mit.edu	37	19	648229	648229	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:648229C>A	uc010drs.2	-	9	941	c.835G>T	c.(835-837)GCC>TCC	p.A279S	RNF126_uc002lpi.2_Missense_Mutation_p.A103S	NM_194460	NP_919442	Q9BV68	RN126_HUMAN	ring finger protein 126	279							protein binding|zinc ion binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTTCGTGGCCGTGTTCTGT	0.478													3	9	---	---	---	---	PASS
MUM1	84939	broad.mit.edu	37	19	1360225	1360225	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1360225C>T	uc010xgm.1	+	4	374	c.305C>T	c.(304-306)TCG>TTG	p.S102L	MUM1_uc010dsi.2_Missense_Mutation_p.S34L|MUM1_uc002lrz.2_Missense_Mutation_p.S103L|MUM1_uc002lsb.2_Missense_Mutation_p.S34L|MUM1_uc002lsc.1_Missense_Mutation_p.S34L			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;	102					chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCGAGGGCTCGATTTGGAGT	0.597											OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	129	---	---	---	---	PASS
MUM1	84939	broad.mit.edu	37	19	1360624	1360624	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1360624C>T	uc010xgm.1	+	4	773	c.704C>T	c.(703-705)TCA>TTA	p.S235L	MUM1_uc010dsi.2_Missense_Mutation_p.S167L|MUM1_uc002lrz.2_Missense_Mutation_p.S236L|MUM1_uc002lsb.2_Missense_Mutation_p.S167L|MUM1_uc002lsc.1_Missense_Mutation_p.S167L			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;	235					chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTCCCTTTCAGAGGACGAC	0.577													20	100	---	---	---	---	PASS
SH3GL1	6455	broad.mit.edu	37	19	4361723	4361723	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4361723G>A	uc002maj.2	-	10	1087	c.981C>T	c.(979-981)TTC>TTT	p.F327F	SH3GL1_uc002mak.2_Silent_p.F263F|SH3GL1_uc010xig.1_Silent_p.F279F	NM_003025	NP_003016	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	327	SH3.				central nervous system development|endocytosis|signal transduction	early endosome membrane	lipid binding|protein binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CGCCCTCATGGAAGCCCAGCT	0.672			T	MLL	AL								15	38	---	---	---	---	PASS
SH2D3A	10045	broad.mit.edu	37	19	6755149	6755149	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6755149G>C	uc002mft.2	-	5	868	c.674C>G	c.(673-675)TCT>TGT	p.S225C	SH2D3A_uc010xjg.1_Missense_Mutation_p.S103C	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	225					JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						GGGACGTTCAGAGGCATCAGG	0.652													62	315	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10467307	10467307	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10467307C>T	uc002moc.3	-	18	2932	c.2554G>A	c.(2554-2556)GAG>AAG	p.E852K	TYK2_uc010dxe.2_Missense_Mutation_p.E667K	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	852	Protein kinase 1.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TGGGTTGGCTCATAGGTCAGA	0.632													5	38	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10572231	10572231	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10572231G>A	uc002moj.2	+	12	1603	c.1495G>A	c.(1495-1497)GAG>AAG	p.E499K	PDE4A_uc002mok.2_Missense_Mutation_p.E473K|PDE4A_uc002mol.2_Missense_Mutation_p.E438K|PDE4A_uc002mom.2_Missense_Mutation_p.E260K|PDE4A_uc002mon.2_5'UTR|PDE4A_uc002moo.2_Missense_Mutation_p.E165K	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	499	Catalytic.				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	GTACAACGATGAGTCGGTGCT	0.647													34	54	---	---	---	---	PASS
PRKCSH	5589	broad.mit.edu	37	19	11557090	11557090	+	Silent	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11557090C>A	uc002mrt.2	+	9	1023	c.687C>A	c.(685-687)GTC>GTA	p.V229V	PRKCSH_uc002mru.2_Silent_p.V229V|PRKCSH_uc010xlz.1_Silent_p.V229V|PRKCSH_uc010dya.2_Intron|PRKCSH_uc002mrv.1_Silent_p.V229V|PRKCSH_uc010dyb.2_Silent_p.V229V	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	229	1 (Potential).|EF-hand 1.				innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						CCCGCAGGGTCTCGGTGACTG	0.667													6	34	---	---	---	---	PASS
WDR83	84292	broad.mit.edu	37	19	12781580	12781580	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12781580G>A	uc002mue.3	+	7	786	c.451G>A	c.(451-453)GAG>AAG	p.E151K	WDR83_uc002muc.2_RNA|C19orf56_uc002mud.2_5'Flank|WDR83_uc010dyw.2_Missense_Mutation_p.E151K	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1	151	WD 4.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						GACGCTGGATGAGGCCAGAGA	0.602													18	35	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35836524	35836524	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35836524C>G	uc010edt.2	+	12	2305	c.2228C>G	c.(2227-2229)TCT>TGT	p.S743C	CD22_uc010xst.1_Missense_Mutation_p.S571C|CD22_uc010edu.2_Missense_Mutation_p.S655C|CD22_uc010edv.2_Intron|CD22_uc002nzb.3_Missense_Mutation_p.S566C|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	743	Cytoplasmic (Potential).				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	GCCCCCCTCTCTGAAGGCCCC	0.587													14	61	---	---	---	---	PASS
TYROBP	7305	broad.mit.edu	37	19	36395531	36395531	+	Silent	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36395531G>C	uc002ocm.2	-	5	338	c.282C>G	c.(280-282)CTC>CTG	p.L94L	TYROBP_uc002ocn.2_Silent_p.L93L	NM_003332	NP_003323	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	94	Cytoplasmic (Potential).				axon guidance|cell junction assembly|cellular defense response|intracellular signal transduction|regulation of immune response	integral to plasma membrane|intracellular	identical protein binding|receptor signaling protein activity				0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCTGACCCTGGAGCTCCTAAA	0.542													4	19	---	---	---	---	PASS
ZFP82	284406	broad.mit.edu	37	19	36884445	36884445	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36884445C>T	uc002ody.1	-	5	1032	c.797G>A	c.(796-798)CGA>CAA	p.R266Q		NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog	266	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						AAGTTGTCCTCGTACCCTAAA	0.433													43	217	---	---	---	---	PASS
IL28B	282617	broad.mit.edu	37	19	39735130	39735130	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39735130T>A	uc010xut.1	-	2	189	c.185A>T	c.(184-186)GAG>GTG	p.E62V	IL28B_uc010xuu.1_Missense_Mutation_p.E62V	NM_172139	NP_742151	Q8IZI9	IL28B_HUMAN	interleukin 28B	62					response to virus	extracellular space	cytokine activity				0	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CAGAAGCGACTCTTCCTAGAC	0.617													3	13	---	---	---	---	PASS
DYRK1B	9149	broad.mit.edu	37	19	40316906	40316906	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40316906T>G	uc002omj.2	-	10	1712	c.1432A>C	c.(1432-1434)AGT>CGT	p.S478R	DYRK1B_uc002omi.2_Missense_Mutation_p.S450R|DYRK1B_uc002omk.2_Missense_Mutation_p.S438R	NM_004714	NP_004705	Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	478					positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity			ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			CGGTTGTCACTGGAGGAGCCA	0.597													6	16	---	---	---	---	PASS
HIPK4	147746	broad.mit.edu	37	19	40890035	40890035	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40890035G>A	uc002onp.2	-	2	762	c.477C>T	c.(475-477)TTC>TTT	p.F159F		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	159	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			TGGCGGATCCGAAGTCAATCA	0.632													14	51	---	---	---	---	PASS
CYP2B6	1555	broad.mit.edu	37	19	41522627	41522627	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41522627C>T	uc002opr.1	+	9	1378	c.1371C>T	c.(1369-1371)TTC>TTT	p.F457F	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Silent_p.F257F	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	457					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	TCCAGAACTTCTCCATGGCCA	0.572													18	39	---	---	---	---	PASS
AXL	558	broad.mit.edu	37	19	41743843	41743843	+	Intron	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41743843C>T	uc010ehj.2	+						CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Intron|AXL_uc010ehk.2_Intron	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1							integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						CCTTGCCTCTCCTCAGGCTGT	0.602													8	27	---	---	---	---	PASS
CEACAM21	90273	broad.mit.edu	37	19	42082621	42082621	+	5'UTR	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42082621G>C	uc002ore.3	+	1					CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_RNA|CEACAM21_uc002org.3_5'UTR	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						GCAGGCAGCAGAGACCATGGG	0.617													5	19	---	---	---	---	PASS
LYPD5	284348	broad.mit.edu	37	19	44302644	44302644	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44302644C>G	uc002oxm.3	-	4	561	c.480G>C	c.(478-480)CAG>CAC	p.Q160H	LYPD5_uc002oxn.3_Missense_Mutation_p.Q117H	NM_001031749	NP_001026919	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5 isoform A	160	UPAR/Ly6.					anchored to membrane|plasma membrane					0		Prostate(69;0.0352)				AGCAGGCGGTCTGGTCCTGGT	0.647													14	71	---	---	---	---	PASS
LMTK3	114783	broad.mit.edu	37	19	49004787	49004787	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49004787G>C	uc002pjk.2	-	9	914	c.914C>G	c.(913-915)TCT>TGT	p.S305C		NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GGTCAGGTCAGAGGTCAGCAG	0.687													2	10	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50204795	50204795	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50204795C>T	uc002ppj.2	+	6	802	c.597C>T	c.(595-597)TTC>TTT	p.F199F	CPT1C_uc002ppl.3_Silent_p.F165F|CPT1C_uc002ppi.2_Silent_p.F116F|CPT1C_uc002ppk.2_Silent_p.F199F|CPT1C_uc010eng.2_Silent_p.F199F|CPT1C_uc010enh.2_Silent_p.F199F|CPT1C_uc010ybc.1_Silent_p.F37F	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	199	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		ACGAGGACTTCGACTGGACCG	0.547													5	19	---	---	---	---	PASS
VN1R4	317703	broad.mit.edu	37	19	53770125	53770125	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53770125A>G	uc010ydu.1	-	1	794	c.794T>C	c.(793-795)TTA>TCA	p.L265S		NM_173857	NP_776256	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	265	Helical; Name=7; (Potential).				response to pheromone	actin cytoskeleton|cytoplasm|integral to membrane|plasma membrane	pheromone receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.00294)		GTTCACCAGTAAACTATTGGG	0.453										HNSCC(26;0.072)			4	63	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55672018	55672018	+	Silent	SNP	T	C	C			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55672018T>C	uc002qji.1	-	9	1072	c.1038A>G	c.(1036-1038)CCA>CCG	p.P346P	TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Silent_p.P161P|C19orf51_uc002qjj.1_Silent_p.P393P|C19orf51_uc002qjk.1_Silent_p.P292P|C19orf51_uc002qjl.1_Silent_p.P414P			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	346											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CTGGAGTCCCTGGCTCCGGGC	0.657											OREG0025678	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	254	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57293432	57293432	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57293432C>T	uc002qnr.2	-	9	917	c.535G>A	c.(535-537)GAG>AAG	p.E179K	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnq.2_Missense_Mutation_p.E179K|ZIM2_uc010etp.2_Missense_Mutation_p.E179K|ZIM2_uc010ygs.1_Missense_Mutation_p.E179K	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	179	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		AGCACATCCTCGAAGGTCACC	0.498													33	136	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57641688	57641688	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641688C>T	uc002qny.2	+	4	2001	c.1645C>T	c.(1645-1647)CTT>TTT	p.L549F		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	549					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAAACCACCTCTTCCCTTGAG	0.413													72	254	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5294782	5294782	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5294782G>A	uc010zqw.1	-	1	234	c.234C>T	c.(232-234)CTC>CTT	p.L78L	PROKR2_uc010zqx.1_Silent_p.L78L|PROKR2_uc010zqy.1_Silent_p.L78L|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	78	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TATAGCGGGTGAGGGCAGCGA	0.557										HNSCC(71;0.22)			12	54	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46265142	46265142	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46265142C>G	uc002xtk.2	+	12	2217	c.2012C>G	c.(2011-2013)TCC>TGC	p.S671C	NCOA3_uc010ght.1_Missense_Mutation_p.S681C|NCOA3_uc002xtl.2_Missense_Mutation_p.S671C|NCOA3_uc002xtm.2_Missense_Mutation_p.S671C|NCOA3_uc002xtn.2_Missense_Mutation_p.S671C|NCOA3_uc010zyc.1_Missense_Mutation_p.S466C	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	671	Ser-rich.				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						TCCTCTACATCCAATATGCAT	0.473													25	127	---	---	---	---	PASS
KCNB1	3745	broad.mit.edu	37	20	47989992	47989992	+	Missense_Mutation	SNP	G	A	A	rs144379782		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47989992G>A	uc002xur.1	-	2	2269	c.2105C>T	c.(2104-2106)GCG>GTG	p.A702V	KCNB1_uc002xus.1_Missense_Mutation_p.A702V	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	702	Poly-Ala.|Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GACAGCAGCCGCAGCACTCCC	0.592													6	36	---	---	---	---	PASS
EEF1A2	1917	broad.mit.edu	37	20	62120282	62120282	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62120282T>G	uc002yfd.1	-	6	1354	c.1253A>C	c.(1252-1254)TAC>TCC	p.Y418S	EEF1A2_uc002yfe.1_Missense_Mutation_p.Y418S|EEF1A2_uc010gkg.1_Intron	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	418						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GAGAGGCGGGTACTGGGAGAA	0.667													6	11	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37741397	37741397	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37741397C>T	uc002yvi.2	+	15	1807	c.1731C>T	c.(1729-1731)GTC>GTT	p.V577V		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	577					cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						ATGAAGATGTCATCATCTTAG	0.383													34	111	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37741838	37741838	+	Silent	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37741838C>T	uc002yvi.2	+	15	2248	c.2172C>T	c.(2170-2172)ATC>ATT	p.I724I		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	724	Potential.				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						CTGATCAAATCAAAGTGTTAC	0.358													23	121	---	---	---	---	PASS
PCBP3	54039	broad.mit.edu	37	21	47337528	47337528	+	Silent	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47337528C>A	uc002zhq.1	+	9	827	c.702C>A	c.(700-702)GCC>GCA	p.A234A	PCBP3_uc010gqb.2_Silent_p.A234A|PCBP3_uc002zhp.1_Silent_p.A234A|PCBP3_uc010gqc.1_Missense_Mutation_p.H301N|PCBP3_uc002zhs.1_Silent_p.A209A|PCBP3_uc002zhr.1_Silent_p.A234A|PCBP3_uc002zht.1_Silent_p.A225A	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	234					mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		GACAGTATGCCATCCCTCACC	0.542													8	63	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23237713	23237713	+	RNA	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23237713G>A	uc011aim.1	+	363		c.15116G>A			uc011aiw.1_Missense_Mutation_p.E162K|uc010gtu.1_RNA|uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						GGCGGGAGTGGAGACCACCAA	0.592													6	20	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23237841	23237841	+	RNA	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23237841G>A	uc011aim.1	+	363		c.15244G>A			uc011aiw.1_Silent_p.V204V|uc010gtu.1_RNA|uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						GGAGCACCGTGGAGAAGACAG	0.607													4	35	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23237842	23237842	+	RNA	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23237842G>A	uc011aim.1	+	363		c.15245G>A			uc011aiw.1_Missense_Mutation_p.E205K|uc010gtu.1_RNA|uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						GAGCACCGTGGAGAAGACAGT	0.612													4	35	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23237847	23237847	+	RNA	SNP	G	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23237847G>T	uc011aim.1	+	363		c.15250G>T			uc011aiw.1_Missense_Mutation_p.K206N|uc010gtu.1_RNA|uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						CCGTGGAGAAGACAGTGGCCC	0.617													5	32	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25150111	25150111	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25150111C>T	uc003abd.1	-	8	1264	c.847G>A	c.(847-849)GAT>AAT	p.D283N	PIWIL3_uc011ajx.1_Missense_Mutation_p.D174N|PIWIL3_uc011ajy.1_Missense_Mutation_p.D174N|PIWIL3_uc010gut.1_Missense_Mutation_p.D283N	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	283					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						TGGCTCACATCGGCACAGAGG	0.408													12	145	---	---	---	---	PASS
NEFH	4744	broad.mit.edu	37	22	29886525	29886525	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29886525G>A	uc003afo.2	+	4	2967	c.2896G>A	c.(2896-2898)GAG>AAG	p.E966K	NEFH_uc003afp.2_Silent_p.L31L	NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa	972	Tail.				cell death|nervous system development	neurofilament					0						CAAGAAGCCTGAGGAGAAACC	0.517													7	78	---	---	---	---	PASS
ATF4	468	broad.mit.edu	37	22	39917809	39917809	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39917809G>A	uc003axz.2	+	3	538	c.258G>A	c.(256-258)TTG>TTA	p.L86L	ATF4_uc011aol.1_5'UTR|ATF4_uc003aya.2_Silent_p.L86L	NM_182810	NP_877962	P18848	ATF4_HUMAN	activating transcription factor 4	86					cellular amino acid metabolic process|gluconeogenesis|positive regulation of transcription from RNA polymerase II promoter|response to endoplasmic reticulum stress|transcription from RNA polymerase II promoter	cytoplasm|plasma membrane	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.04)					ATTGGATGTTGGAGAAAATGG	0.488													51	136	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41676974	41676974	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41676974G>A	uc003azs.2	-	1	1545	c.75C>T	c.(73-75)TTC>TTT	p.F25F	RANGAP1_uc003azt.2_Silent_p.F25F|RANGAP1_uc003azu.2_Silent_p.F25F|RANGAP1_uc011aoz.1_5'Flank	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	25					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TCTTGCCTTTGAAACTCAGCT	0.532													4	88	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50724722	50724722	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50724722G>A	uc003bkv.3	-							NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor						regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GTGGTCTGCAGACAGCAGAGG	0.667													11	40	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3238287	3238287	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3238287C>G	uc004crg.3	-	5	5596	c.5439G>C	c.(5437-5439)CAG>CAC	p.Q1813H		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1813						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AGATAGAACTCTGGGTGGAAG	0.507													19	36	---	---	---	---	PASS
WWC3	55841	broad.mit.edu	37	X	10106899	10106899	+	Missense_Mutation	SNP	C	T	T	rs150439410		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10106899C>T	uc004csx.3	+	21	3205	c.3007C>T	c.(3007-3009)CGT>TGT	p.R1003C	WWC3_uc010nds.2_Missense_Mutation_p.R667C|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	1003	Potential.									ovary(4)	4						CGCCCAGCTCCGTGGCCAGAC	0.706													3	18	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11157630	11157630	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11157630C>T	uc004cup.1	-	13	3151	c.2278G>A	c.(2278-2280)GAA>AAA	p.E760K	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cum.1_Missense_Mutation_p.E557K|ARHGAP6_uc004cun.1_Missense_Mutation_p.E580K	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	760					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						GAGCTGCTTTCAAAAATGTCT	0.532													7	20	---	---	---	---	PASS
FRMPD4	9758	broad.mit.edu	37	X	12725747	12725747	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12725747G>A	uc004cuz.1	+	13	1953	c.1447G>A	c.(1447-1449)GAA>AAA	p.E483K	FRMPD4_uc011mij.1_Missense_Mutation_p.E475K	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	483	FERM.				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						GGTGCGGGTAGAACTCCACGT	0.473													17	184	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20033420	20033420	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20033420C>A	uc004czr.1	-	11	1566	c.1547G>T	c.(1546-1548)CGG>CTG	p.R516L	MAP7D2_uc004czq.1_Missense_Mutation_p.R401L|MAP7D2_uc011mji.1_Missense_Mutation_p.R464L|MAP7D2_uc010nfo.1_Missense_Mutation_p.R557L|MAP7D2_uc011mjj.1_Missense_Mutation_p.R471L	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	516										ovary(2)|breast(1)	3						AGCTACCTCCCGGGCCTTTGT	0.463													32	119	---	---	---	---	PASS
CXorf36	79742	broad.mit.edu	37	X	45013378	45013378	+	Silent	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45013378G>A	uc004dgg.2	-	4	813	c.738C>T	c.(736-738)GTC>GTT	p.V246V		NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN	hypothetical protein LOC79742 isoform 1	246						extracellular region				lung(1)	1						TGCTGGTGCTGACGAGGAATC	0.587													12	52	---	---	---	---	PASS
XAGE5	170627	broad.mit.edu	37	X	52842276	52842276	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52842276G>A	uc004drd.1	+							NM_130775	NP_570131	Q8WWM1	GAGD5_HUMAN	X antigen family, member 5											ovary(1)	1						CAAGGTGCTGGGAAGGGAAAG	0.498													6	43	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54022200	54022200	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54022200C>T	uc004dsu.2	-	12	1430	c.1357G>A	c.(1357-1359)GAG>AAG	p.E453K	PHF8_uc004dst.2_Missense_Mutation_p.E417K|PHF8_uc004dsv.2_Missense_Mutation_p.E283K|PHF8_uc004dsw.2_Missense_Mutation_p.E417K|PHF8_uc004dsx.2_Missense_Mutation_p.E181K|PHF8_uc004dsy.2_Missense_Mutation_p.E417K	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	453					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						ATCTCATCCTCATGGTCTGGC	0.368													7	27	---	---	---	---	PASS
RPS4X	6191	broad.mit.edu	37	X	71495568	71495568	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71495568G>A	uc004ear.2	-	3	184	c.88C>T	c.(88-90)CGT>TGT	p.R30C	RPS4X_uc011mqb.1_Missense_Mutation_p.R30C	NM_001007	NP_000998	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked X isoform	30					endocrine pancreas development|positive regulation of cell proliferation|positive regulation of translation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0	Renal(35;0.156)					GTGGATGGACGAGGAGCCTGT	0.463													6	16	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	86069847	86069847	+	Intron	SNP	G	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86069847G>A	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Intron|DACH2_uc010nmr.2_Intron|DACH2_uc004eey.2_Intron|DACH2_uc004eez.2_Intron	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						GGTAATGTCTGATTTGGATTT	0.323													8	59	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105178272	105178272	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105178272C>G	uc004emd.2	+	20	3638	c.3335C>G	c.(3334-3336)GCC>GGC	p.A1112G	NRK_uc010npc.1_Missense_Mutation_p.A780G	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1112							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGAAATGAGGCCTCAAATGCC	0.428										HNSCC(51;0.14)			4	157	---	---	---	---	PASS
IL13RA2	3598	broad.mit.edu	37	X	114245323	114245323	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114245323C>T	uc004epx.2	-	6	715	c.590G>A	c.(589-591)TGC>TAC	p.C197Y	IL13RA2_uc010nqd.1_Missense_Mutation_p.C197Y	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	197	Extracellular (Potential).|Fibronectin type-III 2.					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						GGGAAATCTGCATCCTATATT	0.358													21	182	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994898	140994898	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994898C>T	uc004fbt.2	+	4	1994	c.1708C>T	c.(1708-1710)CAG>TAG	p.Q570*	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	570							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCCTCAGGGGGAGGA	0.597										HNSCC(15;0.026)			301	541	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153282519	153282519	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153282519C>T	uc004fjs.1	-	8	989	c.910_splice	c.e8-1	p.T304_splice	IRAK1_uc004fjr.1_Splice_Site_p.T304_splice|IRAK1_uc004fjt.1_Splice_Site_p.T304_splice|IRAK1_uc010nur.2_Intron|IRAK1_uc004fju.2_Splice_Site_p.T330_splice	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGCCTGGGTCTGGGGTGGCA	0.443													46	94	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153580315	153580315	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153580315C>T	uc004fkk.2	-	42	7093	c.6844G>A	c.(6844-6846)GAG>AAG	p.E2282K	FLNA_uc004fki.2_Missense_Mutation_p.E325K|FLNA_uc011mzn.1_Missense_Mutation_p.E415K|FLNA_uc010nuu.1_Missense_Mutation_p.E2274K	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2282	Filamin 21.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAAGAGATCTCAGCCTTGCTG	0.612													12	77	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216363840	216363841	+	Intron	INS	-	T	T			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216363840_216363841insT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAGGAAAAGGGTTTTTTTTTTT	0.337										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92319926	92319926	+	IGR	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92319926delT								FKSG73 (189432 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	9311575	9311575	+	IGR	DEL	G	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9311575delG								SRGAP3 (20264 upstream) : LOC440944 (79799 downstream)																							gagggacagagggaggaaggg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40418599	40418600	+	IGR	INS	-	G	G			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40418599_40418600insG								EIF1B (64686 upstream) : ENTPD3 (10073 downstream)																							aggggaggggagggagggagga	0.000													3	3	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57493939	57493940	+	Intron	INS	-	C	C	rs68187229		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493939_57493940insC	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						aaaaaaaaaaaaaCCAAAAAAA	0.129													4	4	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115342811	115342811	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115342811delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		CTAGAAATAATTTTTTTTTTT	0.423													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128315979	128315994	+	IGR	DEL	GAAGGAAGGAAGGAAA	-	-	rs71720183		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128315979_128315994delGAAGGAAGGAAGGAAA								C3orf27 (21050 upstream) : RPN1 (22819 downstream)																							aggagagaaggaaggaaggaaggaaagaaggaagga	0.102													4	2	---	---	---	---	
ADIPOQ	9370	broad.mit.edu	37	3	186566039	186566042	+	Intron	DEL	GAAG	-	-	rs63385760		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186566039_186566042delGAAG	uc003fra.2	+						ADIPOQ_uc010hyy.2_Intron	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor						brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		aggaaggaaagaaggaaggaagga	0.069													4	2	---	---	---	---	
YIPF7	285525	broad.mit.edu	37	4	44651969	44651969	+	Intron	DEL	A	-	-	rs35447406		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44651969delA	uc010ifx.1	-						YIPF7_uc010ify.1_Intron	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7							endoplasmic reticulum membrane|integral to membrane					0						agactctgtcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
C4orf14	84273	broad.mit.edu	37	4	57839652	57839652	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57839652delT	uc003hck.2	-							NM_032313	NP_115689	Q8NC60	CD014_HUMAN	hypothetical protein LOC84273								GTP binding			ovary(1)|breast(1)	2	Glioma(25;0.08)|all_neural(26;0.181)					ATACTTTTGCTTTTTTTTTTT	0.393													9	6	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						TTAATTCTTATTAATTAATTCT	0.282													7	5	---	---	---	---	
FAM160A1	729830	broad.mit.edu	37	4	152333718	152333730	+	Intron	DEL	CTTTCTTTCTTTC	-	-	rs146973116	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152333718_152333730delCTTTCTTTCTTTC	uc003imj.2	+							NM_001109977	NP_001103447	Q05DH4	F16A1_HUMAN	hypothetical protein LOC729830												0						ttctttctttctttctttctttcctttctttcc	0.108													4	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5235001	5235002	+	Intron	INS	-	G	G	rs145857413	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5235001_5235002insG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						aaaaaaaaaaagaaTCCACTTT	0.134													4	4	---	---	---	---	
SRFBP1	153443	broad.mit.edu	37	5	121354815	121354819	+	Intron	DEL	TATCT	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121354815_121354819delTATCT	uc003kst.1	+							NM_152546	NP_689759	Q8NEF9	SRFB1_HUMAN	serum response factor binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		ATTATACAGATATCTTATCTAAGGA	0.244													2	6	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134140863	134140864	+	Intron	INS	-	T	T	rs113554220		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134140863_134140864insT	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAAGAACTGTAttttttttttt	0.203													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167644115	167644116	+	Intron	DEL	GA	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167644115_167644116delGA	uc010jjd.2	+						ODZ2_uc003lzr.3_Intron|ODZ2_uc003lzt.3_Intron|ODZ2_uc010jje.2_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGATAGGTATgagagagagaga	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170261080	170261082	+	IGR	DEL	CAT	-	-	rs111380690		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261080_170261082delCAT								GABRP (20032 upstream) : RANBP17 (27940 downstream)																							ccaccatcaccatcaccaccacc	0.118													6	3	---	---	---	---	
MAPK9	5601	broad.mit.edu	37	5	179665609	179665609	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179665609delT	uc003mls.3	-						MAPK9_uc003mlt.3_Intron|MAPK9_uc010jlc.2_Intron|MAPK9_uc003mlv.3_Intron	NM_002752	NP_002743	P45984	MK09_HUMAN	mitogen-activated protein kinase 9 isoform JNK2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			Cttcttcttcttttttttttt	0.109													4	2	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74115935	74115936	+	Intron	INS	-	GG	GG	rs143908408	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74115935_74115936insGG	uc003pgw.2	+						DDX43_uc011dyn.1_Intron	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						ttagtagagacggtttctctat	0.000													6	9	---	---	---	---	
KIAA0776	23376	broad.mit.edu	37	6	96972043	96972044	+	Intron	INS	-	A	A			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96972043_96972044insA	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TGATGttatttaaaaaaaaaaa	0.337													4	2	---	---	---	---	
PDSS2	57107	broad.mit.edu	37	6	107566623	107566626	+	Intron	DEL	AAAA	-	-	rs71900103		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107566623_107566626delAAAA	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		AACACTAATCaaaaaaaaaaaaaa	0.319													4	3	---	---	---	---	
ULBP2	80328	broad.mit.edu	37	6	150267343	150267343	+	Intron	DEL	A	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150267343delA	uc003qno.2	+						ULBP2_uc011eeh.1_Intron|ULBP2_uc010kij.2_Intron	NM_025217	NP_079493	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2 precursor						antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|cell surface|extracellular space|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		accctttctcaaaaaaaaaaa	0.189													6	3	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1510298	1510298	+	Frame_Shift_Del	DEL	A	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1510298delA	uc003skn.2	-	48	6589	c.6488delT	c.(6487-6489)TTCfs	p.F2163fs	INTS1_uc003skm.1_Frame_Shift_Del_p.F300fs	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	2163					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GCCCACCAGGAAGGCCCGGTG	0.672													4	2	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	97946299	97946300	+	Intron	INS	-	T	T	rs143087564	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97946299_97946300insT	uc003upj.2	-							NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			cctcagcctccgagtagctgtg	0.000													5	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3432693	3432693	+	Intron	DEL	A	-	-	rs71850597		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3432693delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAATCACAGTAAAAAAAAAAA	0.383													4	6	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9091314	9091314	+	Intron	DEL	A	-	-	rs324467	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9091314delA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATTGTACTTTAAAAAAAAAAT	0.358										TSP Lung(15;0.13)			10	9	---	---	---	---	
LRSAM1	90678	broad.mit.edu	37	9	130253286	130253287	+	Intron	INS	-	A	A	rs72544370	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130253286_130253287insA	uc004brb.1	+						LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron|LRSAM1_uc004bre.1_Intron	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0						gcacgtccatgccccaggaacg	0.252													5	4	---	---	---	---	
AKR1C1	1645	broad.mit.edu	37	10	5008988	5008991	+	Intron	DEL	AAGA	-	-	rs10562538		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5008988_5008991delAAGA	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc009xhx.2_Intron|AKR1C1_uc001ihq.2_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	GCATCACAAGAAGAGAGAGAATAA	0.299													5	8	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106274	8106275	+	Intron	INS	-	T	T	rs72784616	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106274_8106275insT	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						tcttcttcttcttttttttttt	0.312			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33347321	33347321	+	IGR	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33347321delT								ITGB1 (100028 upstream) : NRP1 (119099 downstream)																							CCCCTTGGCCTTCTTTCCTTT	0.368													4	2	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70371619	70371620	+	Intron	DEL	GA	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70371619_70371620delGA	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						gggagagagggagagagagaga	0.084													4	2	---	---	---	---	
ANKRD1	27063	broad.mit.edu	37	10	92676188	92676189	+	Intron	DEL	TG	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92676188_92676189delTG	uc001khe.1	-							NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				CTAAATTACAtgtgtgtgtgtg	0.248													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97159104	97159104	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97159104delT	uc001kkp.2	-						SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		CATGGGCTGAttttactggaa	0.259													4	2	---	---	---	---	
ZNF195	7748	broad.mit.edu	37	11	3392662	3392662	+	Intron	DEL	A	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3392662delA	uc001lxt.2	-						ZNF195_uc001lxv.2_Intron|ZNF195_uc001lxs.2_Intron|ZNF195_uc010qxr.1_Intron|ZNF195_uc009ydz.2_Intron|ZNF195_uc001lxu.2_Intron	NM_001130520	NP_001123992	O14628	ZN195_HUMAN	zinc finger protein 195 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		TTTTTTTTTTACATCAACTAT	0.348													4	2	---	---	---	---	
DNAJC14	85406	broad.mit.edu	37	12	56188742	56188742	+	Intron	DEL	A	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56188742delA	uc001shu.1	-						SARNP_uc009zoa.2_Intron|SARNP_uc001shs.3_Intron|SARNP_uc001sht.2_Intron|SARNP_uc001shv.3_Intron	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein						protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						AGGTATCTTTaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31652513	31652520	+	IGR	DEL	AAGAAAGA	-	-	rs7986217		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652513_31652520delAAGAAAGA								C13orf26 (103362 upstream) : HSPH1 (58245 downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.192													6	3	---	---	---	---	
KCNH5	27133	broad.mit.edu	37	14	63246270	63246270	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63246270delT	uc001xfx.2	-						KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Intron	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGAAATAGGGTTTTTTTCCTT	0.279													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76420616	76420619	+	Intron	DEL	AAAG	-	-	rs145807913		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76420616_76420619delAAAG	uc001xrx.2	+						TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		aaaaaaaaaaaaagagctttccac	0.029													4	2	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81565263	81565264	+	Intron	INS	-	TGT	TGT	rs67106640		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81565263_81565264insTGT	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						gttgttgttggtgttgttgttg	0.450													2	5	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15132211	15132212	+	Intron	INS	-	AAAGTTG	AAAGTTG	rs147448533	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15132211_15132212insAAAGTTG	uc002ddc.2	+						NTAN1_uc002ddd.2_Intron|NTAN1_uc010uzo.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTAGTAAGAAAAAAGTTGATTG	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33852385	33852388	+	IGR	DEL	AAAC	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33852385_33852388delAAAC								SLC6A10P (955922 upstream) : MIR1826 (113120 downstream)																							AACATACAAAAAACAAATCAGAAC	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46417207	46417216	+	IGR	DEL	TTCGAATGGA	-	-	rs60768439		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46417207_46417216delTTCGAATGGA								None (None upstream) : ANKRD26P1 (86033 downstream)																							tggAATCATCTtcgaatggaattgaatgga	0.052													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14608987	14608988	+	IGR	INS	-	T	T	rs73273330	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14608987_14608988insT								HS3ST3B1 (359495 upstream) : PMP22 (524109 downstream)																							GTGCTTTGGGGTTTTTTTTTTT	0.351													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													4	3	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49247504	49247505	+	Intron	DEL	TT	-	-	rs112707943		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49247504_49247505delTT	uc002itk.2	+						NME1-NME2_uc002itj.2_Intron|NME2_uc002itl.2_Intron|NME2_uc002itm.2_Intron|NME2_uc002itn.2_Intron|NME2_uc002ito.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ATCTGTGCCCtttttttttttt	0.243													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63778799	63778800	+	IGR	INS	-	GAA	GAA	rs148360663	by1000genomes	TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778799_63778800insGAA								CDH7 (230625 upstream) : CDH19 (392521 downstream)																							aaggaaggaaggaaggaaggag	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9802060	9802060	+	Intron	DEL	T	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9802060delT	uc010xkx.1	-											RecName: Full=Zinc finger protein 562;																		TAATGTTTAATTTTTTTTTCA	0.284													4	8	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NWD1	284434	broad.mit.edu	37	19	16872616	16872616	+	Intron	DEL	A	-	-			TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16872616delA	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7						TGATGTAAGGAAAAAAAAAAC	0.269													4	4	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8665965	8665966	+	Intron	DEL	CA	-	-	rs75405686		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8665965_8665966delCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AAAATGCAACCACGGCTGACAT	0.441													6	3	---	---	---	---	
PYGB	5834	broad.mit.edu	37	20	25262537	25262539	+	Intron	DEL	CTC	-	-	rs146665561		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25262537_25262539delCTC	uc002wup.2	+							NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase						glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	TCACTCTGTTCTCCTTAGAAAAC	0.576													4	9	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37619142	37619151	+	Intron	DEL	TTATGTTATG	-	-	rs67162183		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37619142_37619151delTTATGTTATG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron|DOPEY2_uc002yvh.2_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TTCTGATCCAttatgttatgttatgttatg	0.210													4	2	---	---	---	---	
BRWD3	254065	broad.mit.edu	37	X	79952019	79952028	+	Intron	DEL	ACACACACAC	-	-	rs72072858		TCGA-C5-A1BK-01	TCGA-C5-A1BK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79952019_79952028delACACACACAC	uc004edt.2	-						BRWD3_uc010nmi.1_Intron|BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3											ovary(4)	4						TAACATAAATacacacacacacacacacac	0.124													4	2	---	---	---	---	
