Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DFFB	1677	broad.mit.edu	37	1	3775314	3775314	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3775314C>T	uc001alc.2	+	2	470	c.147C>T	c.(145-147)TAC>TAT	p.Y49Y	DFFB_uc001ale.2_RNA|DFFB_uc009vlp.2_RNA|DFFB_uc001alb.2_RNA|DFFB_uc010nzn.1_Silent_p.Y49Y|DFFB_uc009vlq.2_RNA|DFFB_uc009vlr.2_Translation_Start_Site|DFFB_uc001ald.2_Translation_Start_Site|KIAA0562_uc001aky.2_5'Flank|KIAA0562_uc010nzm.1_5'Flank|KIAA0562_uc001akz.2_5'Flank|DFFB_uc009vln.1_Silent_p.Y49Y|DFFB_uc001ala.1_Silent_p.Y49Y|DFFB_uc009vlo.1_Silent_p.Y49Y	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta	49	CIDE-N.				apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TGTGCCTGTACGAGGATGGCA	0.632													9	66	---	---	---	---	PASS
EIF2C1	26523	broad.mit.edu	37	1	36372633	36372633	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36372633G>A	uc001bzl.2	+	12	1708	c.1495G>A	c.(1495-1497)GTG>ATG	p.V499M	EIF2C1_uc001bzk.2_Missense_Mutation_p.V424M|EIF2C1_uc009vuy.2_RNA	NM_012199	NP_036331	Q9UL18	AGO1_HUMAN	eukaryotic translation initiation factor 2C, 1	499					negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|polysome	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGCAGACAGCGTGGAGCCTAT	0.532													37	72	---	---	---	---	PASS
MUTYH	4595	broad.mit.edu	37	1	45797852	45797852	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45797852G>A	uc001cnm.2	-	10	1126	c.910C>T	c.(910-912)CGG>TGG	p.R304W	MUTYH_uc009vxn.2_Missense_Mutation_p.R129W|MUTYH_uc001cnf.2_Missense_Mutation_p.R279W|MUTYH_uc009vxo.2_Missense_Mutation_p.R279W|MUTYH_uc001cng.2_Missense_Mutation_p.R290W|MUTYH_uc001cnj.2_Missense_Mutation_p.R187W|MUTYH_uc001cni.2_Missense_Mutation_p.R279W|MUTYH_uc001cnh.2_Missense_Mutation_p.R280W|MUTYH_uc001cno.2_Missense_Mutation_p.R187W|MUTYH_uc001cnk.2_Missense_Mutation_p.R164W|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Missense_Mutation_p.R293W|MUTYH_uc009vxp.2_Missense_Mutation_p.R307W|MUTYH_uc001cnn.2_Missense_Mutation_p.R294W	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	304					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					TGGCGTGCCCGGCACAGGCTC	0.617			Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				7	80	---	---	---	---	PASS
SLC5A9	200010	broad.mit.edu	37	1	48703474	48703474	+	Silent	SNP	C	T	T	rs141985089		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48703474C>T	uc001cro.2	+	11	1468	c.1416C>T	c.(1414-1416)ACC>ACT	p.T472T	SLC5A9_uc010oms.1_RNA|SLC5A9_uc001crn.2_Silent_p.T497T|SLC5A9_uc010omt.1_Silent_p.T486T|SLC5A9_uc001crp.2_Silent_p.T139T|SLC5A9_uc010omu.1_Silent_p.T139T|SLC5A9_uc009vyt.1_5'Flank	NM_001011547	NP_001011547	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/glucose	472	Helical; (Potential).					integral to membrane|plasma membrane	low-affinity glucose:sodium symporter activity			ovary(3)	3						CACCCATCACCGCTCTCTTCC	0.512													4	43	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93167736	93167736	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93167736G>C	uc001dox.2	-	5	743	c.733C>G	c.(733-735)CAA>GAA	p.Q245E	EVI5_uc010otf.1_Missense_Mutation_p.Q245E	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	245	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GCACTTCCTTGACAGTAACCA	0.308													3	62	---	---	---	---	PASS
NGF	4803	broad.mit.edu	37	1	115829246	115829246	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115829246C>T	uc001efu.1	-	3	340	c.171G>A	c.(169-171)GCG>GCA	p.A57A		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	57					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CAGCTATCGCCGCTGCCGGGG	0.617													11	28	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783718	149783718	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783718C>T	uc001esr.2	-	1	211	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST2H2BF_uc010pbj.1_Missense_Mutation_p.G54D|HIST2H2BF_uc010pbk.1_Missense_Mutation_p.G54D	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	54					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					GGACGAGATGCCGGTGTCGGG	0.597													5	234	---	---	---	---	PASS
MRPS21	54460	broad.mit.edu	37	1	150280628	150280628	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150280628G>A	uc001euk.2	+	3	312	c.230G>A	c.(229-231)CGA>CAA	p.R77Q	MRPS21_uc001eul.2_Missense_Mutation_p.R77Q	NM_031901	NP_114107	P82921	RT21_HUMAN	mitochondrial ribosomal protein S21	77					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	Lung NSC(24;5.57e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTTGATGCGAAAGAATCGG	0.527													5	43	---	---	---	---	PASS
SCNM1	79005	broad.mit.edu	37	1	151140660	151140660	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151140660C>T	uc001ewz.2	+	6	551	c.439C>T	c.(439-441)CCA>TCA	p.P147S	LYSMD1_uc001ewy.2_5'Flank|LYSMD1_uc010pcr.1_5'Flank|SCNM1_uc009wmn.2_RNA	NM_024041	NP_076946	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	147					mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTCCCCTATGCCACCCTCAGA	0.552													6	455	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156617459	156617459	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156617459C>T	uc001fpp.2	+	4	962	c.626C>T	c.(625-627)TCG>TTG	p.S209L	BCAN_uc001fpo.2_Missense_Mutation_p.S209L	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	209	Link 1.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGGCTGTCGGATCAGACC	0.647													45	63	---	---	---	---	PASS
STX6	10228	broad.mit.edu	37	1	180974431	180974431	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180974431G>C	uc010pnq.1	-	2	441	c.204C>G	c.(202-204)ATC>ATG	p.I68M	STX6_uc001goo.2_Missense_Mutation_p.I68M|STX6_uc010pnr.1_Intron	NM_005819	NP_005810	O43752	STX6_HUMAN	syntaxin 6	68	Potential.|Cytoplasmic (Potential).				Golgi vesicle transport|intracellular protein transport|vesicle fusion	clathrin-coated vesicle|early endosome|integral to membrane|perinuclear region of cytoplasm|plasma membrane|trans-Golgi network membrane	SNAP receptor activity			ovary(1)	1						AAAGGATATTGATGGTTTCAT	0.423													28	201	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181745324	181745324	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181745324G>A	uc001gow.2	+	38	5392	c.5227G>A	c.(5227-5229)GAG>AAG	p.E1743K	CACNA1E_uc009wxs.2_Missense_Mutation_p.E1631K|CACNA1E_uc001gox.1_Missense_Mutation_p.E969K|CACNA1E_uc009wxt.2_Missense_Mutation_p.E969K	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1743	EF-hand.|Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						CCACTTGGACGAGTTTGTCCG	0.607													23	162	---	---	---	---	PASS
SUSD4	55061	broad.mit.edu	37	1	223396682	223396682	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223396682C>T	uc001hnx.2	-	7	1987	c.1353G>A	c.(1351-1353)GAG>GAA	p.E451E	SUSD4_uc001hny.3_Silent_p.E451E|SUSD4_uc010puw.1_Silent_p.E291E	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a	451	Cytoplasmic (Potential).					integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)		GGTGGGTGCTCTCTTGGCACC	0.582													11	69	---	---	---	---	PASS
CHML	1122	broad.mit.edu	37	1	241798676	241798676	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241798676G>A	uc001hzd.2	-	1	557	c.393C>T	c.(391-393)TTC>TTT	p.F131F	OPN3_uc001hza.2_Intron|OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_001821	NP_001812	P26374	RAE2_HUMAN	choroideremia-like Rab escort protein 2	131					intracellular protein transport|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(4)|skin(2)	6	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GAACTTCAGTGAAGGTATTAG	0.423													9	315	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21251367	21251367	+	Missense_Mutation	SNP	G	A	A	rs12714214	byFrequency	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21251367G>A	uc002red.2	-	13	1789	c.1661C>T	c.(1660-1662)CCG>CTG	p.P554L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	554	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTTATCTCCCGGAGAAGCATC	0.453													7	124	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74043169	74043169	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74043169C>T	uc002sjr.1	+	3	1940	c.1819C>T	c.(1819-1821)CGG>TGG	p.R607W		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	607	Lys-rich.									ovary(2)	2						CAATATGAAACGGAAGAAAAA	0.443													4	44	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529638	80529638	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529638A>G	uc002sok.1	-	2	1577	c.1307T>C	c.(1306-1308)ATC>ACC	p.I436T	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	436	Helical; (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GAAGGAGAAGATGAGGGCCAT	0.627										HNSCC(69;0.2)			15	35	---	---	---	---	PASS
TGOLN2	10618	broad.mit.edu	37	2	85554084	85554084	+	Silent	SNP	A	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85554084A>C	uc010fgd.1	-	2	1060	c.771T>G	c.(769-771)CCT>CCG	p.P257P	TGOLN2_uc002soz.2_Silent_p.P257P|TGOLN2_uc002spa.2_Intron|TGOLN2_uc002spb.2_Intron|TGOLN2_uc002spc.1_Silent_p.P257P	NM_006464	NP_006455	O43493	TGON2_HUMAN	trans-golgi network protein 2	257	Extracellular (Potential).					integral to membrane|nucleus|plasma membrane|trans-Golgi network|transport vesicle	protein binding				0						CTTTCCGGGAAGGCTGCTCTG	0.572													39	68	---	---	---	---	PASS
CHST10	9486	broad.mit.edu	37	2	101010080	101010080	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101010080C>T	uc002tam.2	-	7	1057	c.698G>A	c.(697-699)CGG>CAG	p.R233Q		NM_004854	NP_004845	O43529	CHSTA_HUMAN	HNK-1 sulfotransferase	233	Lumenal (Potential).				carbohydrate biosynthetic process|cell adhesion	Golgi membrane|integral to membrane|membrane fraction				ovary(1)	1						CTGGATCCCCCGGGTCTCTGT	0.507													6	198	---	---	---	---	PASS
IL1A	3552	broad.mit.edu	37	2	113539283	113539283	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113539283C>T	uc002tig.2	-	4	1177	c.217G>A	c.(217-219)GTA>ATA	p.V73I		NM_000575	NP_000566	P01583	IL1A_HUMAN	interleukin 1, alpha proprotein	73					anti-apoptosis|apoptosis|cell proliferation|cellular response to heat|cytokine-mediated signaling pathway|fever generation|immune response|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation vascular endothelial growth factor production|response to copper ion	cytosol|extracellular space	copper ion binding|cytokine activity|interleukin-1 receptor binding			lung(1)	1						GTTGCTACTACCACCATGCTC	0.483													45	127	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128324316	128324316	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128324316C>T	uc002top.2	+	5	437	c.384C>T	c.(382-384)GGC>GGT	p.G128G		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	128	Myosin head-like.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCCATATGGGCGAGCTGCCCC	0.587													7	17	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	169999312	169999312	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169999312C>T	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CACTGGAAAGCGGGTGAGAAC	0.537													4	89	---	---	---	---	PASS
FKBP7	51661	broad.mit.edu	37	2	179343117	179343117	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179343117A>G	uc002umk.2	-	1	239	c.110T>C	c.(109-111)ATA>ACA	p.I37T	FKBP7_uc002umm.2_Missense_Mutation_p.I37T|FKBP7_uc002uml.2_RNA|FKBP7_uc010zff.1_Missense_Mutation_p.I33T|PLEKHA3_uc002umn.2_5'Flank	NM_181342	NP_851939	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7 isoform a precursor	37					protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CAAAACTTCTATTTTCACTTC	0.418													56	101	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179483051	179483051	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179483051C>T	uc010zfg.1	-	201	39654	c.39430G>A	c.(39430-39432)GAG>AAG	p.E13144K	TTN_uc010zfh.1_Missense_Mutation_p.E6839K|TTN_uc010zfi.1_Missense_Mutation_p.E6772K|TTN_uc010zfj.1_Missense_Mutation_p.E6647K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14071							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACAACTCTCTGCACGGTCT	0.463													16	120	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187540540	187540540	+	Intron	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187540540C>A	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		TTGTTATTTCCAAACAGAAAG	0.328													3	45	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210557806	210557806	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557806G>A	uc002vde.1	+	7	1160	c.912G>A	c.(910-912)TGG>TGA	p.W304*	MAP2_uc002vdc.1_Nonsense_Mutation_p.W304*|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Nonsense_Mutation_p.W300*	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	304					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	TCCCAAAATGGGAAGGGAAAC	0.438													6	75	---	---	---	---	PASS
ZCWPW2	152098	broad.mit.edu	37	3	28476663	28476663	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28476663G>A	uc003ceh.2	+	4	563	c.395G>A	c.(394-396)GGA>GAA	p.G132E	ZCWPW2_uc003cei.2_Missense_Mutation_p.G132E|ZCWPW2_uc010hfo.2_5'UTR	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	132	PWWP.						zinc ion binding			ovary(2)	2						GACCCGGATGGAAATGTTGAA	0.358													34	62	---	---	---	---	PASS
CTDSPL	10217	broad.mit.edu	37	3	38022265	38022265	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38022265G>A	uc003chg.2	+	8	760	c.738G>A	c.(736-738)ACG>ACA	p.T246T	CTDSPL_uc003chh.2_Silent_p.T235T|CTDSPL_uc003chi.2_RNA	NM_001008392	NP_001008393	O15194	CTDSL_HUMAN	small CTD phosphatase 3 isoform 1	246	FCP1 homology.					nucleus	metal ion binding|phosphoprotein phosphatase activity				0		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		ATGACATGACGGACACGGAGC	0.602													24	30	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49758728	49758728	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49758728C>A	uc003cxh.2	+	39	4021	c.3935C>A	c.(3934-3936)TCA>TAA	p.S1312*	RNF123_uc003cxi.2_RNA|AMIGO3_uc003cxj.2_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	1312						cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		ACTACCTCCTCAGCTGCCTAG	0.547													26	186	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62556598	62556598	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62556598G>A	uc003dll.2	-	9	1953	c.1593C>T	c.(1591-1593)ATC>ATT	p.I531I	CADPS_uc003dlk.1_Silent_p.I35I|CADPS_uc003dlm.2_Silent_p.I531I|CADPS_uc003dln.2_Silent_p.I531I	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	531	PH.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CATTCTTACCGATGGCCCATA	0.393													24	158	---	---	---	---	PASS
OR5K3	403277	broad.mit.edu	37	3	98109725	98109725	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98109725C>T	uc011bgw.1	+	1	216	c.216C>T	c.(214-216)TGC>TGT	p.C72C		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGGATTCCTGCTGTTCCTCTG	0.393													20	373	---	---	---	---	PASS
CLDND1	56650	broad.mit.edu	37	3	98235731	98235731	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98235731G>A	uc003dsp.2	-						CLDND1_uc003dso.2_Intron|CLDND1_uc003dsq.2_Intron|CLDND1_uc003dss.2_Intron|CLDND1_uc003dsr.2_Intron|CLDND1_uc003dst.2_Intron|CLDND1_uc003dsu.2_Intron|CLDND1_uc003dsv.2_Intron	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a							integral to membrane				ovary(1)	1						GACCTTGGGGGAAAATTTAGA	0.408													5	35	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100373824	100373824	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100373824G>C	uc003duc.2	+	12	1793	c.1525G>C	c.(1525-1527)GAC>CAC	p.D509H	GPR128_uc011bhc.1_Missense_Mutation_p.D210H|GPR128_uc003dud.2_Missense_Mutation_p.D32H	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	509	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						TATTGACTTTGACAATAATGA	0.388													8	200	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357354	112357354	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357354G>A	uc003dzf.2	-	2	1617	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	CCDC80_uc011bhv.1_Missense_Mutation_p.R467C|CCDC80_uc003dzg.2_Missense_Mutation_p.R467C|CCDC80_uc003dzh.1_Missense_Mutation_p.R467C	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	467										ovary(2)	2						CTGTCCATGCGGTTGTCCCGG	0.602													11	130	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113379802	113379802	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113379802C>T	uc003eam.2	-	7	1138	c.727G>A	c.(727-729)GAA>AAA	p.E243K	KIAA2018_uc003eal.2_Missense_Mutation_p.E187K	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	243					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						GATTCGCTTTCAGAGGTGGGA	0.478													15	54	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	120876455	120876455	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120876455C>G	uc003eec.3	+	9	998	c.858C>G	c.(856-858)TTC>TTG	p.F286L	STXBP5L_uc011bji.1_Missense_Mutation_p.F286L	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	286					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		GTCGCCCTTTCCAGACCACAA	0.413													11	168	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130720086	130720086	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130720086C>T	uc003enl.2	+	28	2874	c.2652C>T	c.(2650-2652)CTC>CTT	p.L884L	ATP2C1_uc011blg.1_Silent_p.L918L|ATP2C1_uc011blh.1_Silent_p.L879L|ATP2C1_uc011bli.1_Silent_p.L918L|ATP2C1_uc003enk.2_Silent_p.L868L|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Silent_p.L868L|ATP2C1_uc003eno.2_Silent_p.L884L|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Silent_p.L884L|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Silent_p.L884L|ATP2C1_uc003ent.2_Silent_p.L884L|ATP2C1_uc003enu.2_Silent_p.L562L	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	884	Helical; Name=10; (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TTTTGGGTCTCACCTCATCAG	0.343									Hailey-Hailey_disease				11	145	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			5	131	---	---	---	---	PASS
FXR1	8087	broad.mit.edu	37	3	180666162	180666162	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180666162G>C	uc003fkq.2	+	5	320	c.298G>C	c.(298-300)GAC>CAC	p.D100H	FXR1_uc003fkp.2_Missense_Mutation_p.D15H|FXR1_uc003fkr.2_Missense_Mutation_p.D100H|FXR1_uc011bqj.1_Missense_Mutation_p.D14H|FXR1_uc003fks.2_Missense_Mutation_p.D14H|FXR1_uc011bqk.1_Missense_Mutation_p.D51H|FXR1_uc011bql.1_Missense_Mutation_p.D87H	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1	100					apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TGCTGCTTGTGACGCTACTTA	0.299													18	94	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52883762	52883762	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52883762G>A	uc003gzi.2	-	1	31	c.18C>T	c.(16-18)TTC>TTT	p.F6F		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	6	Helical; (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						TAATGACTCTGAAATAGAGGT	0.274													5	47	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87671800	87671800	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87671800A>C	uc003hpz.2	+	18	3308	c.2828A>C	c.(2827-2829)TAC>TCC	p.Y943S	PTPN13_uc003hpy.2_Missense_Mutation_p.Y943S|PTPN13_uc003hqa.2_Missense_Mutation_p.Y943S|PTPN13_uc003hqb.2_Intron	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	943						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTGTCGCTTTACCAGCCATTG	0.468													12	32	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95155109	95155109	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95155109G>A	uc003htc.3	+	4	628	c.373G>A	c.(373-375)GAG>AAG	p.E125K	SMARCAD1_uc003htb.3_Missense_Mutation_p.E125K|SMARCAD1_uc003htd.3_Missense_Mutation_p.E125K|SMARCAD1_uc010ila.2_5'UTR	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	125					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TTTTAGTTCTGAGCCATCTGA	0.303													8	66	---	---	---	---	PASS
NAA15	80155	broad.mit.edu	37	4	140281653	140281653	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140281653G>A	uc003ihu.1	+	13	1667	c.1411_splice	c.e13-1	p.E471_splice		NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1						angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						TTTCTGTATAGGAAGGAACAT	0.338													9	104	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13786454	13786454	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13786454G>A	uc003jfd.2	-	52	8696	c.8654C>T	c.(8653-8655)ACA>ATA	p.T2885I		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2885					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTCTTCAGATGTTTCACCTTT	0.353									Kartagener_syndrome				10	78	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42718863	42718863	+	Silent	SNP	A	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42718863A>G	uc003jmt.2	+	10	1297	c.1254A>G	c.(1252-1254)AAA>AAG	p.K418K	GHR_uc011cpq.1_Silent_p.K231K	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	418	Cytoplasmic (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AGAGGTTAAAAGGGGAAGCAG	0.468													3	121	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156721789	156721789	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156721789C>T	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_5'Flank|CYFIP2_uc011ddp.1_5'Flank|CYFIP2_uc003lwp.2_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTTACCATTTCAGAATGAGAT	0.463													5	35	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167645602	167645602	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167645602C>T	uc010jjd.2	+	23	4679	c.4679C>T	c.(4678-4680)GCG>GTG	p.A1560V	ODZ2_uc003lzr.3_Missense_Mutation_p.A1330V|ODZ2_uc003lzt.3_Missense_Mutation_p.A933V|ODZ2_uc010jje.2_Missense_Mutation_p.A824V	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CGGATCAGGGCGGTCAGCAAG	0.493													33	211	---	---	---	---	PASS
HMP19	51617	broad.mit.edu	37	5	173491307	173491307	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173491307G>A	uc003mcx.2	+	3	347	c.202G>A	c.(202-204)GCT>ACT	p.A68T		NM_015980	NP_057064	Q9Y328	NSG2_HUMAN	HMP19 protein	68	Cytoplasmic (Potential).				dopamine receptor signaling pathway	cytoplasmic vesicle membrane|Golgi cisterna membrane|integral to membrane|multivesicular body membrane	dopamine receptor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00925)|all_lung(126;0.0148)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCCGAAAATCGCTGAATTTAC	0.478													13	37	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170594675	170594675	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170594675C>G	uc003qxm.2	-	6	1314	c.844G>C	c.(844-846)GGC>CGC	p.G282R		NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	282	Extracellular (Potential).|EGF-like 2.				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CAGAAAAGGCCCCCCCAGCCT	0.602													17	24	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14758207	14758207	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14758207C>T	uc003ssz.2	-	5	613	c.426G>A	c.(424-426)CTG>CTA	p.L142L	DGKB_uc011jxt.1_Silent_p.L135L|DGKB_uc003sta.2_Silent_p.L142L|DGKB_uc011jxu.1_Silent_p.L142L|DGKB_uc011jxv.1_Silent_p.L142L	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	142					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CAAGCAGAGACAGGTAACAGA	0.448													7	35	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675495	100675495	+	Silent	SNP	A	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675495A>G	uc003uxp.1	+	3	851	c.798A>G	c.(796-798)TCA>TCG	p.S266S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	266	Extracellular (Potential).|59 X approximate tandem repeats.|2.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAGCCTGTCAAACTCAGCTC	0.498													75	107	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142569581	142569581	+	Missense_Mutation	SNP	C	T	T	rs150837047		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142569581C>T	uc003wbx.1	-	15	2273	c.2057G>A	c.(2056-2058)CGA>CAA	p.R686Q	TRPV6_uc003wbw.1_Missense_Mutation_p.R472Q|TRPV6_uc010lou.1_Missense_Mutation_p.R557Q	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	686	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					GGAGGTACTTCGAGACACTGA	0.587													13	46	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962241	151962241	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962241G>A	uc003wla.2	-	8	1285	c.1066C>T	c.(1066-1068)CAG>TAG	p.Q356*		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	356	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CAAAAGAACTGATCTAAGAGG	0.413			N		medulloblastoma								13	281	---	---	---	---	PASS
TTPA	7274	broad.mit.edu	37	8	63976819	63976819	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63976819G>A	uc003xux.1	-	4	641	c.609C>T	c.(607-609)TTC>TTT	p.F203F		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	203	CRAL-TRIO.				lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	AGACAGCATGGAAAATTACTG	0.308													19	39	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134108511	134108511	+	Missense_Mutation	SNP	G	A	A	rs143135039	byFrequency	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134108511G>A	uc003ytw.2	+	43	7507	c.7466G>A	c.(7465-7467)CGT>CAT	p.R2489H	TG_uc010mdw.2_Missense_Mutation_p.R1248H|TG_uc011ljb.1_Missense_Mutation_p.R858H|TG_uc011ljc.1_Missense_Mutation_p.R622H|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2489					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CACTTCCTCCGTGAGCCTCCA	0.537													78	224	---	---	---	---	PASS
RUSC2	9853	broad.mit.edu	37	9	35560823	35560823	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35560823C>T	uc003zww.2	+	10	4441	c.4186C>T	c.(4186-4188)CAG>TAG	p.Q1396*	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Nonsense_Mutation_p.Q1396*	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1396						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCGAAAAGCCCAGCGGGAGGC	0.642													11	11	---	---	---	---	PASS
C9orf128	392307	broad.mit.edu	37	9	35821610	35821610	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35821610G>A	uc010mlc.2	-						C9orf128_uc003zyj.2_RNA|C9orf128_uc011lpg.1_Intron	NM_001012446	NP_001012448	A6H8Z2	CI128_HUMAN	hypothetical protein LOC392307												0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			TCCACTAGAGGAGTTCCGAAT	0.562													4	48	---	---	---	---	PASS
KIAA1958	158405	broad.mit.edu	37	9	115336810	115336810	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115336810G>T	uc004bgf.1	+	2	625	c.450G>T	c.(448-450)GAG>GAT	p.E150D	KIAA1958_uc011lwx.1_Missense_Mutation_p.E150D	NM_133465	NP_597722	Q8N8K9	K1958_HUMAN	hypothetical protein LOC158405	150										skin(1)	1						TGGTTTGTGAGTCTTCTGTTA	0.458													59	92	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7745454	7745454	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7745454C>T	uc001ijs.2	+	1	219	c.57C>T	c.(55-57)TTC>TTT	p.F19F		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	19					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						TATCAGGCTTCGAAATCCCCA	0.418													10	118	---	---	---	---	PASS
RASGEF1A	221002	broad.mit.edu	37	10	43692548	43692548	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43692548C>T	uc001jap.1	-	11	1306	c.1225_splice	c.e11-1	p.K409_splice	RASGEF1A_uc001jao.1_Splice_Site_p.K417_splice	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CCCAGAATTTCTGAAGGGAGC	0.498													47	66	---	---	---	---	PASS
KIAA1279	26128	broad.mit.edu	37	10	70748636	70748636	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70748636G>A	uc001joy.2	+	1	144	c.48G>A	c.(46-48)GCG>GCA	p.A16A		NM_015634	NP_056449	Q96EK5	KBP_HUMAN	KIF1 binding protein	16					cell differentiation|mitochondrial transport|nervous system development	mitochondrion	kinesin binding			ovary(1)	1						TCCAGGCGGCGCTCGCTCTGT	0.592											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	70	---	---	---	---	PASS
SH3PXD2A	9644	broad.mit.edu	37	10	105372776	105372776	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105372776G>A	uc001kxj.1	-	11	1148	c.1008C>T	c.(1006-1008)GCC>GCT	p.A336A	SH3PXD2A_uc010qqr.1_Silent_p.A226A|SH3PXD2A_uc010qqs.1_Silent_p.A171A|SH3PXD2A_uc010qqt.1_Silent_p.A213A|SH3PXD2A_uc009xxn.1_Silent_p.A171A|SH3PXD2A_uc010qqu.1_Silent_p.A279A	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	364					cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CCTCGCCTTCGGCTGGTGGAG	0.587													45	33	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	132965127	132965127	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132965127C>G	uc001lkp.2	-	5	964	c.878G>C	c.(877-879)CGA>CCA	p.R293P	TCERG1L_uc009yax.1_RNA	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	293										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		GCGGGCCACTCGGCCCCGCTC	0.512													3	30	---	---	---	---	PASS
PWWP2B	170394	broad.mit.edu	37	10	134219456	134219456	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134219456C>T	uc001lll.3	+	2	1481	c.1452C>T	c.(1450-1452)GAC>GAT	p.D484D	PWWP2B_uc009ybe.2_Silent_p.D484D	NM_138499	NP_612508	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2 isoform 1	484											0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		TCACGGAGGACGGCAGGACTG	0.647													4	71	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6651131	6651131	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6651131C>T	uc001mem.1	-	11	5217	c.4807G>A	c.(4807-4809)GTG>ATG	p.V1603M		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1603	Cadherin 15.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCGCACCACGGACAGCGCT	0.652													10	27	---	---	---	---	PASS
MARK2	2011	broad.mit.edu	37	11	63670179	63670179	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63670179C>T	uc001nxw.2	+	13	1920	c.1341C>T	c.(1339-1341)GCC>GCT	p.A447A	MARK2_uc001nxx.2_Silent_p.A447A|MARK2_uc001nxy.2_Silent_p.A446A|MARK2_uc001nxv.3_Silent_p.A446A|MARK2_uc001nxz.3_Silent_p.A413A|MARK2_uc009yoy.2_Silent_p.A413A	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2	447					cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						GGCGGAAAGCCAGCAGCACAG	0.612													4	22	---	---	---	---	PASS
PDGFD	80310	broad.mit.edu	37	11	104034556	104034556	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104034556G>A	uc001phq.2	-	1	472	c.100C>T	c.(100-102)CGC>TGC	p.R34C	PDGFD_uc001php.2_Missense_Mutation_p.R34C	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1	34					positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTGGCGTTGCGCAAAGCTTTG	0.423											OREG0021315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	28	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26592082	26592082	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26592082C>A	uc001rhg.2	-	47	7038	c.6621G>T	c.(6619-6621)ATG>ATT	p.M2207I	ITPR2_uc009zjg.1_Missense_Mutation_p.M358I	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2207	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TCTGCCACTTCATTTCATTGT	0.383													11	187	---	---	---	---	PASS
FAM186B	84070	broad.mit.edu	37	12	49994424	49994424	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49994424C>T	uc001ruo.2	-	4	1172	c.999G>A	c.(997-999)GAG>GAA	p.E333E	FAM186B_uc010smk.1_Silent_p.E243E	NM_032130	NP_115506	Q8IYM0	F186B_HUMAN	hypothetical protein LOC84070	333						protein complex				ovary(1)	1						CAACAGAAACCTCAGCCAGGT	0.537													75	114	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56575341	56575341	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56575341C>A	uc001skb.2	-	10	987	c.881G>T	c.(880-882)GGA>GTA	p.G294V	SMARCC2_uc001skd.2_Missense_Mutation_p.G294V|SMARCC2_uc001ska.2_Missense_Mutation_p.G294V|SMARCC2_uc001skc.2_Missense_Mutation_p.G294V|SMARCC2_uc010sqf.1_Missense_Mutation_p.G183V	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	294					chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTTATAGTTTCCCCCCTTCTT	0.512													13	104	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67692752	67692752	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67692752C>T	uc001stn.2	+	7	1314	c.877C>T	c.(877-879)CAT>TAT	p.H293Y	CAND1_uc001sto.2_5'UTR	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	293	HEAT 8.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AGTATATCCTCATGTTTCTAC	0.249													7	67	---	---	---	---	PASS
OSBPL8	114882	broad.mit.edu	37	12	76778126	76778126	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76778126G>A	uc001sye.1	-	15	2018	c.1538C>T	c.(1537-1539)TCC>TTC	p.S513F	OSBPL8_uc001syf.1_Missense_Mutation_p.S471F|OSBPL8_uc001syg.1_Missense_Mutation_p.S471F|OSBPL8_uc001syh.1_Missense_Mutation_p.S488F	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform	513					lipid transport		lipid binding			ovary(1)	1						TGGATGATGGGACACCTATTA	0.279													6	47	---	---	---	---	PASS
ALX1	8092	broad.mit.edu	37	12	85695254	85695254	+	3'UTR	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85695254C>T	uc001tae.3	+	4						NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1						brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)		GGCCATGTAACATACAGTACT	0.363													4	66	---	---	---	---	PASS
GSX1	219409	broad.mit.edu	37	13	28367727	28367727	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28367727G>A	uc001urr.1	+	2	485	c.437G>A	c.(436-438)AGC>AAC	p.S146N		NM_145657	NP_663632	Q9H4S2	GSX1_HUMAN	GS homeobox 1	146					positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CAGCTGCCCAGCAGCAAGAGG	0.597													15	45	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36396959	36396959	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36396959G>A	uc001uvf.2	-	11	1694	c.1461C>T	c.(1459-1461)GAC>GAT	p.D487D	DCLK1_uc001uve.3_Silent_p.D180D|DCLK1_uc010teh.1_Silent_p.D180D|DCLK1_uc010abk.2_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	487	Protein kinase.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCCCACTGGCGTCTCTCTCGG	0.507													52	71	---	---	---	---	PASS
CHMP4A	29082	broad.mit.edu	37	14	24685006	24685006	+	5'Flank	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24685006G>A	uc001wni.2	-						TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_Intron|MDP1_uc001wnk.1_Intron|CHMP4A_uc001wnm.1_Intron|MDP1_uc001wnl.1_Intron	NM_014169	NP_054888	Q9BY43	CHM4A_HUMAN	chromatin modifying protein 4A						cellular membrane organization|endosome transport|protein transport	cytoplasmic vesicle membrane|cytosol|late endosome membrane	lipid binding|protein binding			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0181)		AGTGTAATCTGCGAGAGGAAG	0.567											OREG0022620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	159	---	---	---	---	PASS
SFRS5	6430	broad.mit.edu	37	14	70237703	70237703	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70237703C>T	uc001xll.2	+						SFRS5_uc001xlm.2_Intron|SFRS5_uc001xlo.2_Intron|SFRS5_uc001xlp.2_Intron|SFRS5_uc001xlq.2_Intron	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		TGGCTGTTTTCCATTTTAGGG	0.343													5	21	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55930779	55930779	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55930779C>T	uc002adg.2	-	14	2468	c.2420G>A	c.(2419-2421)AGC>AAC	p.S807N		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	807	Fibronectin type-III 4.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GACTACAGGGCTCCAAGGACT	0.353													27	38	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74315539	74315539	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74315539C>T	uc002awv.2	+	3	1113	c.973C>T	c.(973-975)CGC>TGC	p.R325C	PML_uc002awm.2_Missense_Mutation_p.R325C|PML_uc002awl.2_Missense_Mutation_p.R325C|PML_uc002awj.1_Missense_Mutation_p.R325C|PML_uc002awk.2_Missense_Mutation_p.R325C|PML_uc002awn.2_Missense_Mutation_p.R325C|PML_uc002awo.2_Missense_Mutation_p.R325C|PML_uc002awp.2_Missense_Mutation_p.R325C|PML_uc002awq.2_Missense_Mutation_p.R325C|PML_uc002awr.2_Missense_Mutation_p.R325C|PML_uc002aws.2_Missense_Mutation_p.R325C|PML_uc002awt.2_Missense_Mutation_p.R325C|PML_uc002awu.2_Missense_Mutation_p.R325C|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.R240C|PML_uc002awx.2_Missense_Mutation_p.R83C|PML_uc002awy.2_5'Flank	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	325					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						TGTGCTGCAGCGCATCCGCAC	0.692			T	RARA|PAX5	APL|ALL								7	16	---	---	---	---	PASS
C15orf42	90381	broad.mit.edu	37	15	90162963	90162963	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90162963G>A	uc002boe.2	+	18	3044	c.3044G>A	c.(3043-3045)CGA>CAA	p.R1015Q		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	1015					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CGAAGTCCTCGAATCAAGCAG	0.433													18	136	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24358139	24358139	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24358139G>A	uc002dmf.2	+	2	1495	c.295_splice	c.e2+1	p.R99_splice		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		TATCTCCTGCGTAAGTTCCCC	0.552													21	29	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27472893	27472893	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27472893C>T	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CCTGGAGACACCAGACACACA	0.488													30	39	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30748554	30748554	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30748554G>A	uc002dze.1	+	34	7578	c.7193G>A	c.(7192-7194)CGT>CAT	p.R2398H	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.R2193H	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2398					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GTCAGTGAGCGTCTTCGTGGA	0.632													20	26	---	---	---	---	PASS
TEKT1	83659	broad.mit.edu	37	17	6716198	6716198	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6716198C>T	uc002gdt.2	-	6	914	c.804G>A	c.(802-804)CTG>CTA	p.L268L	TEKT1_uc010vth.1_Silent_p.L122L	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN	tektin 1	268	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|skin(1)	2		Myeloproliferative disorder(207;0.0255)				TTGTATCCTTCAGCCCATTCT	0.542													9	79	---	---	---	---	PASS
MAPT	4137	broad.mit.edu	37	17	44095972	44095972	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44095972G>A	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				TCTTGTGTGTGTTGTGTTCTA	0.493													49	163	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66887638	66887638	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66887638C>A	uc002jhp.2	-	22	3195	c.3016G>T	c.(3016-3018)GAT>TAT	p.D1006Y	ABCA8_uc002jhq.2_Missense_Mutation_p.D1046Y|ABCA8_uc010wqq.1_Missense_Mutation_p.D1046Y|ABCA8_uc010wqr.1_Missense_Mutation_p.D985Y	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	1006						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					ACCTTATAATCATCGATGCTG	0.353													9	42	---	---	---	---	PASS
VAPA	9218	broad.mit.edu	37	18	9950484	9950484	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9950484C>T	uc002kok.2	+	5	809	c.510C>T	c.(508-510)ACC>ACT	p.T170T	VAPA_uc002koj.2_Silent_p.T215T	NM_194434	NP_919415	Q9P0L0	VAPA_HUMAN	vesicle-associated membrane protein-associated	170	Cytoplasmic (Potential).|Potential.				cell death|cellular membrane fusion|neuron projection development|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein localization in endoplasmic reticulum|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane|vesicle	protein heterodimerization activity|signal transducer activity|structural molecule activity				0						TTAATGATACCGAAACAAGGA	0.398													3	86	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1004821	1004821	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1004821G>A	uc002lqo.1	+	3	1321	c.1321G>A	c.(1321-1323)GCG>ACG	p.A441T		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	441	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	GCAGTGCCCAGCGGGGCAGCT	0.672													4	89	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4298016	4298016	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4298016C>T	uc002lzx.1	-	2	419	c.373G>A	c.(373-375)GAG>AAG	p.E125K	TMIGD2_uc010dtv.1_Missense_Mutation_p.E125K	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	125	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTTGCCCTCAGCCTCCTCC	0.602													5	200	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4511413	4511413	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4511413C>T	uc002mar.1	-	3	2517	c.2517G>A	c.(2515-2517)ACG>ACA	p.T839T	PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	839	27 X 33 AA approximate tandem repeat.|23.			GLKTTQNIA -> SVDTTKTVL (in Ref. 2; BAB67774).		lipid particle|plasma membrane					0						TATTTTGGGTCGTTTTCAGCC	0.607													45	73	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9076980	9076980	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9076980G>A	uc002mkp.2	-	3	10670	c.10466C>T	c.(10465-10467)ACA>ATA	p.T3489I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3490	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAAGGAGATGTGACAGATGA	0.502													18	47	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701805	56701805	+	Silent	SNP	C	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701805C>G	uc010ygh.1	-	4	879	c.879G>C	c.(877-879)CTG>CTC	p.L293L		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	293					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TGGGACTGCTCAGATTCAGAG	0.527													81	124	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56703294	56703294	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56703294C>G	uc010ygh.1	-	2	513	c.513G>C	c.(511-513)CAG>CAC	p.Q171H		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	171					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CCGGATGCATCTGGTTCACAG	0.612													6	12	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16485186	16485186	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16485186G>A	uc002wpg.1	-	10	1165	c.1007C>T	c.(1006-1008)TCA>TTA	p.S336L	KIF16B_uc010gch.1_Missense_Mutation_p.S336L|KIF16B_uc010gci.1_Missense_Mutation_p.S336L|KIF16B_uc010gcj.1_Missense_Mutation_p.S336L	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	336	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						ATCAGCAGGTGAAATGGCTGT	0.363													21	223	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17596583	17596583	+	Silent	SNP	G	A	A	rs146359410	byFrequency	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17596583G>A	uc002wpv.1	-	23	2994	c.2640C>T	c.(2638-2640)GCC>GCT	p.A880A	RRBP1_uc010zrp.1_Silent_p.A53A|RRBP1_uc002wpt.1_Silent_p.A250A|RRBP1_uc002wpu.2_Silent_p.A654A|RRBP1_uc002wpw.1_Silent_p.A880A|RRBP1_uc010gcl.1_Silent_p.A654A	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1313	Cytoplasmic (Potential).				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						CCTCAAACTCGGCCGTGAGCT	0.637													8	42	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34263075	34263075	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34263075G>A	uc002xdw.1	-	8	904	c.840C>T	c.(838-840)GCC>GCT	p.A280A	CPNE1_uc002xdn.1_5'Flank|CPNE1_uc002xdo.1_5'Flank|CPNE1_uc002xdp.1_5'Flank|NFS1_uc002xdt.1_Silent_p.A220A|NFS1_uc002xdu.1_Silent_p.A220A|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Silent_p.A78A|NFS1_uc010zvl.1_Silent_p.A229A	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor	280					cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	CACTCTGCAGGGCCTCCACAC	0.582													12	23	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46365435	46365435	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46365435G>A	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010ghv.1_Intron	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						ACCTGCCCCCGTCCCTGCTCA	0.458													5	14	---	---	---	---	PASS
CBS	875	broad.mit.edu	37	21	44488638	44488638	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44488638G>A	uc002zcu.2	-	4	542	c.297C>T	c.(295-297)TTC>TTT	p.F99F	CBS_uc002zcs.1_5'Flank|CBS_uc002zct.2_Silent_p.F99F|CBS_uc002zcw.3_Silent_p.F99F|CBS_uc002zcv.2_Silent_p.F99F	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase	99					cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	ACTTCAGGCCGAACTTCTTCC	0.443													42	70	---	---	---	---	PASS
GSTT1	2952	broad.mit.edu	37	22	24381691	24381691	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24381691C>T	uc002zze.3	-						GSTT1_uc002zzf.3_Intron|GSTT1_uc010gug.2_Intron|GSTT1_uc011ajl.1_Intron|GSTT1_uc010guh.2_Intron	NM_000853	NP_000844	P30711	GSTT1_HUMAN	glutathione S-transferase theta 1						glutathione metabolic process	cytosol|soluble fraction	glutathione peroxidase activity|glutathione transferase activity			ovary(1)	1					Glutathione(DB00143)	GTCCTAGGGTCCCAGTTACCT	0.378									Myelodysplasia_and_Acute_Myeloid_Leukemia_(AML)_Familial				4	78	---	---	---	---	PASS
RNF215	200312	broad.mit.edu	37	22	30776081	30776081	+	Silent	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30776081C>T	uc003ahp.2	-	7	978	c.978G>A	c.(976-978)GCG>GCA	p.A326A	RNF215_uc011akw.1_Silent_p.A231A	NM_001017981	NP_001017981	Q9Y6U7	RN215_HUMAN	ring finger protein 215	326	Cytoplasmic (Potential).|RING-type; atypical.					integral to membrane	zinc ion binding			central_nervous_system(1)	1						CCAGGCACACCGCACAGGTCT	0.647													41	65	---	---	---	---	PASS
SULT4A1	25830	broad.mit.edu	37	22	44234843	44234843	+	Silent	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44234843G>A	uc003bee.1	-	4	528	c.412C>T	c.(412-414)CTG>TTG	p.L138L	SULT4A1_uc003bed.1_Silent_p.L59L|SULT4A1_uc003bef.1_RNA|SULT4A1_uc011aqb.1_Intron	NM_014351	NP_055166	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	138					3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	sulfotransferase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		GACACCACCAGATCCTTGGGG	0.557													16	39	---	---	---	---	PASS
MLC1	23209	broad.mit.edu	37	22	50502481	50502481	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50502481C>A	uc003bjg.1	-	11	1314	c.1041G>T	c.(1039-1041)CAG>CAT	p.Q347H	MLC1_uc011arl.1_Missense_Mutation_p.Q295H|MLC1_uc003bjh.1_Missense_Mutation_p.Q347H|MLC1_uc011arm.1_Missense_Mutation_p.Q317H|MLC1_uc011arn.1_Missense_Mutation_p.Q268H|MLC1_uc011aro.1_Missense_Mutation_p.Q313H	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with	347						basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CCAGGCGCTCCTGCGGGCCGT	0.692													3	21	---	---	---	---	PASS
LMF2	91289	broad.mit.edu	37	22	50943822	50943822	+	Intron	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50943822C>T	uc003blp.2	-						LMF2_uc010hba.2_Intron|LMF2_uc003blo.2_Intron|NCAPH2_uc003blq.3_5'Flank|NCAPH2_uc003blv.2_5'Flank|NCAPH2_uc003blr.3_5'Flank|NCAPH2_uc010hbb.2_5'Flank|NCAPH2_uc003blu.3_5'Flank|NCAPH2_uc003bls.3_5'Flank|NCAPH2_uc003blt.3_5'Flank|NCAPH2_uc003blw.3_5'Flank|NCAPH2_uc003blx.3_5'Flank|NCAPH2_uc003bly.3_5'Flank	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2							endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCCCAGGTCGGCACTCACT	0.617													4	66	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22291584	22291584	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22291584C>T	uc004dai.1	+	1	525	c.476C>T	c.(475-477)CCG>CTG	p.P159L		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	159						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						CATATTGCTCCGCCACAAACT	0.463													6	148	---	---	---	---	PASS
IL13RA1	3597	broad.mit.edu	37	X	117883611	117883611	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117883611G>A	uc004eqs.2	+						IL13RA1_uc004eqr.1_Intron|IL13RA1_uc004eqt.1_Intron	NM_001560	NP_001551	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1 precursor							interleukin-13 receptor complex	cytokine receptor activity				0						TCTTGGCCTGGATATTCTAGG	0.458													7	268	---	---	---	---	PASS
ATP1B4	23439	broad.mit.edu	37	X	119509335	119509335	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119509335G>A	uc004esr.2	+	5	755	c.671G>A	c.(670-672)CGC>CAC	p.R224H	ATP1B4_uc004esq.2_Missense_Mutation_p.R220H|ATP1B4_uc011mtx.1_Missense_Mutation_p.R189H|ATP1B4_uc011mty.1_Missense_Mutation_p.R181H	NM_001142447	NP_001135919	Q9UN42	AT1B4_HUMAN	ATPase, (Na+)/K+ transporting, beta 4	224	Perinuclear space (Potential).				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity			ovary(1)|skin(1)	2						CAATTTAAGCGCTCCTTCCTA	0.483													37	130	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127186109	127186109	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127186109G>C	uc004eum.2	-	1	274	c.77C>G	c.(76-78)TCT>TGT	p.S26C		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	26						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						AATCTCTCCAGACAGGCCTGC	0.443													6	110	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649872	136649872	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649872G>A	uc004fak.2	+	1	1527	c.1022G>A	c.(1021-1023)CGT>CAT	p.R341H		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	341	C2H2-type 3.|Nuclear localization signal.			R->A: Increases its cytoplasmic localization. Does not interact with KPNA1 and KPNA6 and increases strongly its cytoplasmic localization; when associated with A-320; A-337; A-346; A- 349 and A-350.	cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					ATCTTTGCCCGTTCTGAGAAC	0.582													35	106	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138668657	138668657	+	Intron	SNP	G	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138668657G>A	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CTGAAATAGTGATGTATAAAA	0.373													4	84	---	---	---	---	PASS
ARHGAP4	393	broad.mit.edu	37	X	153184293	153184293	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153184293C>T	uc004fjk.1	-	7	1067	c.1025G>A	c.(1024-1026)GGG>GAG	p.G342E	ARHGAP4_uc011mzf.1_Missense_Mutation_p.G319E|ARHGAP4_uc004fjl.1_Missense_Mutation_p.G382E|ARHGAP4_uc010nup.1_RNA	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2	342					apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCTCATCCCCATCATGGGG	0.597													7	120	---	---	---	---	PASS
CATSPER4	378807	broad.mit.edu	37	1	26528180	26528181	+	Intron	DEL	CC	-	-	rs34161386		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26528180_26528181delCC	uc010oez.1	+						CATSPER4_uc009vsf.2_Intron	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		ttctttctttcctttttttttt	0.188													4	2	---	---	---	---	
LEPRE1	64175	broad.mit.edu	37	1	43223463	43223464	+	Frame_Shift_Ins	INS	-	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43223463_43223464insC	uc001chv.2	-	5	1183_1184	c.1070_1071insG	c.(1069-1071)GGCfs	p.G357fs	LEPRE1_uc001chw.2_Frame_Shift_Ins_p.G357fs|LEPRE1_uc001chx.3_Frame_Shift_Ins_p.G357fs	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	357					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCTCACGGGGGCCGATGGATCT	0.535											OREG0013423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	121	69	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	50985107	50985107	+	Intron	DEL	G	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50985107delG	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron|FAF1_uc010onc.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	p.0?(1)		ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		aaggaaggaaggaaggaggag	0.080													4	2	---	---	---	---	
TRIM45	80263	broad.mit.edu	37	1	117659023	117659023	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117659023delT	uc001egz.2	-						TRIM45_uc009whe.2_Intron|TRIM45_uc001eha.2_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		tcccggctaattttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58479808	58479808	+	IGR	DEL	A	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479808delA								FANCL (11293 upstream) : None (None downstream)																							TTTGtaaattaaaaaaaaaaa	0.234													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90048090	90048091	+	Intron	DEL	CA	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90048090_90048091delCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		cacacacactcacacacacaca	0.238													4	2	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	132109442	132109446	+	Intron	DEL	TTTTG	-	-	rs70994755		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132109442_132109446delTTTTG	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		attttcttTCTTTTGTTTTGTTTTA	0.234													5	3	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195690462	195690463	+	Intron	INS	-	G	G			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195690462_195690463insG	uc003fvy.2	-						SDHAP1_uc003fvx.3_Intron					Homo sapiens full length insert cDNA clone ZC24D06.												0						catgcgcaacaggggactgtaa	0.045													4	3	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													9	4	---	---	---	---	
CDH9	1007	broad.mit.edu	37	5	26906755	26906756	+	Intron	INS	-	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26906755_26906756insA	uc003jgs.1	-						CDH9_uc010iug.2_Intron	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						taaaatattttaaaaatctcta	0.248													11	8	---	---	---	---	
NDUFS4	4724	broad.mit.edu	37	5	52942409	52942410	+	Intron	DEL	AA	-	-	rs10571887		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52942409_52942410delAA	uc003jpe.2	+							NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4						brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	ATATTCAGATAAGTGTGGCTTA	0.327													4	3	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115783191	115783192	+	Frame_Shift_Ins	INS	-	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115783191_115783192insT	uc010jck.2	-	19	2919_2920	c.2210_2211insA	c.(2209-2211)AACfs	p.N737fs	SEMA6A_uc003krx.3_Frame_Shift_Ins_p.N754fs|SEMA6A_uc011cwe.1_Frame_Shift_Ins_p.N116fs|SEMA6A_uc003krv.3_Frame_Shift_Ins_p.N164fs|SEMA6A_uc003krw.3_Frame_Shift_Ins_p.N214fs|SEMA6A_uc010jcj.2_Frame_Shift_Ins_p.N281fs	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and	737	Cytoplasmic (Potential).				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TCTTGGCCGTGTTGCCGGGAGT	0.614													200	97	---	---	---	---	
RUFY1	80230	broad.mit.edu	37	5	179036199	179036200	+	Intron	DEL	CT	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179036199_179036200delCT	uc003mka.1	+						RUFY1_uc003mkb.1_Intron|RUFY1_uc003mkc.1_Intron|RUFY1_uc003mkd.1_Intron	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a						endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ctgagcaagactctatctcaaa	0.193										HNSCC(44;0.11)			3	3	---	---	---	---	
C6orf218	221718	broad.mit.edu	37	6	10430699	10430701	+	Intron	DEL	TTT	-	-	rs139837855		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430699_10430701delTTT	uc003myz.2	-							NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				CTCTGACTAGttttttttttttt	0.202													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	97917072	97917073	+	Intron	INS	-	CTTC	CTTC	rs6908138		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97917072_97917073insCTTC	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																		tgcctccctttcttccttcctt	0.213													5	3	---	---	---	---	
LAMA2	3908	broad.mit.edu	37	6	129468410	129468410	+	Intron	DEL	T	-	-	rs66939550		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129468410delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TAGTTTTTCCTTTTTTTTTTT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1396145	1396146	+	IGR	DEL	TT	-	-	rs149226520		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1396145_1396146delTT								UNCX (119533 upstream) : MICALL2 (77850 downstream)																							ccttccttcctttttttttttt	0.010													5	3	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100367079	100367079	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100367079delT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ttgtcttgtctttttttttct	0.144													4	2	---	---	---	---	
ARFGEF1	10565	broad.mit.edu	37	8	68123581	68123581	+	Intron	DEL	A	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68123581delA	uc003xxo.1	-						ARFGEF1_uc003xxl.1_Intron|ARFGEF1_uc003xxn.1_Intron	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine						exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			actccgtctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													3	5	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6645354	6645355	+	Frame_Shift_Ins	INS	-	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6645354_6645355insC	uc003zkc.2	-	1	338_339	c.145_146insG	c.(145-147)GCCfs	p.A49fs		NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	49					glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	GAGGCGCGAGGCCCCAGCCGCG	0.649													4	2	---	---	---	---	
TEK	7010	broad.mit.edu	37	9	27204705	27204706	+	Intron	INS	-	A	A	rs28376331	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27204705_27204706insA	uc003zqi.3	+						TEK_uc011lno.1_Intron|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Intron	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor						angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		tttttttttttaatcttattac	0.079													8	4	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736882	37736883	+	Intron	DEL	GC	-	-	rs151329428		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736882_37736883delGC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgtatgtgtgCGCACACACAC	0.376													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68413605	68413606	+	RNA	DEL	CT	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413605_68413606delCT	uc004aex.2	+	1		c.160_161delCT								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		TTTGCTGAAACTCTGGGGTTGA	0.609													7	4	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101816825	101816826	+	Intron	INS	-	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101816825_101816826insT	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GTGATTTTCCATTTTTTTTTAA	0.426													17	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122114155	122114155	+	IGR	DEL	C	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122114155delC								SEC23IP (412910 upstream) : PPAPDC1A (102311 downstream)																							AAAGTTCATTCTTTTTTTTTT	0.308													4	2	---	---	---	---	
CUZD1	50624	broad.mit.edu	37	10	124596659	124596659	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124596659delT	uc001lgq.2	-						CUZD1_uc001lgp.2_Intron|CUZD1_uc009yad.2_Intron|CUZD1_uc009yaf.2_Intron|CUZD1_uc001lgr.2_Intron|CUZD1_uc010qty.1_Intron|CUZD1_uc009yae.2_Intron|CUZD1_uc001lgs.2_Intron|CUZD1_uc010qtz.1_Intron	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor						cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TGATTATGGATTTTTTTTTTC	0.368													4	2	---	---	---	---	
KNDC1	85442	broad.mit.edu	37	10	135032032	135032032	+	Intron	DEL	G	-	-	rs66904615		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135032032delG	uc001llz.1	+							NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GAAGCTGCCTGGGGAGGTGCA	0.557													1	5	---	---	---	---	
CTTN	2017	broad.mit.edu	37	11	70281357	70281359	+	3'UTR	DEL	CTG	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70281357_70281359delCTG	uc001opv.3	+	18					CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_3'UTR|CTTN_uc010rqm.1_Intron|CTTN_uc001opx.2_3'UTR	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TGGGttttttctgtttttttttt	0.429													6	3	---	---	---	---	
ANKRD13A	88455	broad.mit.edu	37	12	110473900	110473902	+	Intron	DEL	TGT	-	-	rs113289184		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110473900_110473902delTGT	uc001tpx.2	+						ANKRD13A_uc010sxw.1_Intron|ANKRD13A_uc001tpy.2_Intron|ANKRD13A_uc001tpz.2_Intron|ANKRD13A_uc001tqa.2_Intron	NM_033121	NP_149112	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13												0						CCCACTTAGGTGTTGTTTTTGAG	0.429													6	3	---	---	---	---	
LCP1	3936	broad.mit.edu	37	13	46704724	46704724	+	Intron	DEL	T	-	-	rs35095925		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46704724delT	uc001vaz.3	-						LCP1_uc010ack.2_Intron|LCP1_uc001vay.3_Intron|LCP1_uc001vba.3_Intron	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin						regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TATTGGGTTGTTTTTTTTTTT	0.338			T	BCL6	NHL 								4	3	---	---	---	---	
LOC220429	220429	broad.mit.edu	37	13	50464697	50464698	+	5'UTR	INS	-	G	G	rs140429392	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50464697_50464698insG	uc001vdk.2	+	1						NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						CCTGGGTTACTGCGGCCACCGC	0.639													5	6	---	---	---	---	
NYNRIN	57523	broad.mit.edu	37	14	24883721	24883733	+	Intron	DEL	GGGTTTCCACAGA	-	-	rs67039398		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24883721_24883733delGGGTTTCCACAGA	uc001wpf.3	+							NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523						DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						CTTTGGAATGGGGTTTCCACAGAGGTGCTTTCC	0.526													6	6	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64921265	64921265	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64921265delT	uc001xhb.2	+						MTHFD1_uc010aqf.2_Intron|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CCAACAGTTCTTTTTTTTTTT	0.303													3	3	---	---	---	---	
USP8	9101	broad.mit.edu	37	15	50731131	50731132	+	Intron	INS	-	T	T	rs35912128		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50731131_50731132insT	uc001zym.3	+						USP8_uc001zyk.1_Intron|USP8_uc001zyl.3_Intron|USP8_uc001zyn.3_Intron|USP8_uc010ufh.1_Intron|USP8_uc010bev.1_5'Flank	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TGGTTTAGGAATTTTTTTTTTT	0.262													4	4	---	---	---	---	
C16orf62	57020	broad.mit.edu	37	16	19627846	19627847	+	Intron	INS	-	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19627846_19627847insT	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron|C16orf62_uc002dgm.1_Intron	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020							integral to membrane				ovary(1)	1						AACTTTCTGTGTTTTTTTTTGG	0.426													4	2	---	---	---	---	
EXOC7	23265	broad.mit.edu	37	17	74094225	74094225	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74094225delT	uc002jqs.2	-						EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron|EXOC7_uc002jqu.2_Intron	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			CCCTGATAtcttttttttttt	0.284													4	2	---	---	---	---	
JMJD6	23210	broad.mit.edu	37	17	74714798	74714800	+	3'UTR	DEL	CAG	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74714798_74714800delCAG	uc002jso.2	-	6					JMJD6_uc002jsn.1_Intron|JMJD6_uc010dgz.2_In_Frame_Del_p.L363del	NM_015167	NP_055982	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6 isoform 2						mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding			skin(2)|ovary(1)	3						ATACAGACAACAGCCTTGCTGGG	0.621													45	23	---	---	---	---	
DSC2	1824	broad.mit.edu	37	18	28654582	28654582	+	Intron	DEL	A	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28654582delA	uc002kwl.3	-						DSC2_uc002kwk.3_Intron	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein						homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TATTTCATACAAAAAAAAAAA	0.348													6	3	---	---	---	---	
CCL25	6370	broad.mit.edu	37	19	8126930	8126931	+	Intron	INS	-	AA	AA			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8126930_8126931insAA	uc002mjd.2	+						CCL25_uc002mjc.3_Intron	NM_005624	NP_005615	O15444	CCL25_HUMAN	small inducible cytokine A25 precursor						chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response	extracellular space|soluble fraction	CCR10 chemokine receptor binding|chemokine activity|hormone activity				0						gagactgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10544889	10544890	+	Intron	INS	-	T	T			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10544889_10544890insT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	ctctttcttccttttttttttt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14991072	14991072	+	IGR	DEL	A	-	-	rs34163436		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991072delA								OR7A10 (38383 upstream) : OR7A17 (168 downstream)																							AAAGCTTTATAAAGGAATACA	0.313													5	5	---	---	---	---	
LSR	51599	broad.mit.edu	37	19	35741699	35741699	+	Intron	DEL	T	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35741699delT	uc002nyl.2	+						LSR_uc002nym.2_Intron|LSR_uc002nyn.2_Intron|LSR_uc002nyo.2_Intron|LSR_uc010xsr.1_Intron|LSR_uc002nyp.2_Intron	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor						embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGAGCAAttcttttttttttt	0.289													3	3	---	---	---	---	
LGALS4	3960	broad.mit.edu	37	19	39294622	39294624	+	Intron	DEL	CCA	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39294622_39294624delCCA	uc002ojg.2	-						LGALS4_uc010xuj.1_Intron	NM_006149	NP_006140	P56470	LEG4_HUMAN	galectin-4						cell adhesion	cytosol|plasma membrane	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CTGGGGTGGCCCACCACCACCAC	0.586													4	2	---	---	---	---	
RPL18	6141	broad.mit.edu	37	19	49120252	49120253	+	Intron	INS	-	A	A	rs11382518		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49120252_49120253insA	uc002pjq.1	-						RPL18_uc002pjp.1_Intron|RPL18_uc010xzs.1_Intron|SPHK2_uc002pjr.2_5'Flank|SPHK2_uc010xzt.1_5'Flank|SPHK2_uc002pjs.2_5'Flank	NM_000979	NP_000970	Q07020	RL18_HUMAN	ribosomal protein L18						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		AAGCTCCAGATAAAAAAAAAAA	0.540													4	4	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243445	20243446	+	Intron	DEL	TG	-	-	rs79559760	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243445_20243446delTG	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CACCTGTTTTTGTGTTTTTTTT	0.223													6	4	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21312038	21312039	+	Intron	DEL	CA	-	-	rs142695510		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21312038_21312039delCA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						TGGTGTTTTTcacacacacaca	0.267													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32823673	32823680	+	IGR	DEL	AAGGAAGG	-	-	rs71337945		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32823673_32823680delAAGGAAGG								EIF2S2 (123588 upstream) : ASIP (24491 downstream)																							gaaggaaggaaaggaaggaaggaaggaa	0.000													4	3	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													6	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													4	2	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30073959	30073960	+	Intron	INS	-	TGAGGGA	TGAGGGA	rs150466339	by1000genomes	TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30073959_30073960insTGAGGGA	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron|NF2_uc011akq.1_Intron	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GGTTAGAGATTTGAGGGATGAT	0.361			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				5	3	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1404522	1404528	+	Intron	DEL	AGCTTGC	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1404522_1404528delAGCTTGC	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	cgggtggtggagcttgcagcttgcagt	0.000													3	4	---	---	---	---	
SRPX	8406	broad.mit.edu	37	X	38079976	38079978	+	In_Frame_Del	DEL	GCA	-	-	rs72249350		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38079976_38079978delGCA	uc004ddy.1	-	1	154_156	c.68_70delTGC	c.(67-72)CTGCGC>CGC	p.L23del	SRPX_uc004ddz.1_In_Frame_Del_p.L23del|SRPX_uc011mkh.1_In_Frame_Del_p.L23del|SRPX_uc011mki.1_In_Frame_Del_p.L23del	NM_006307	NP_006298	P78539	SRPX_HUMAN	sushi-repeat-containing protein, X-linked	23			Missing.		cell adhesion	cell surface|membrane					0						GGCGGGACGCgcagcagcagcag	0.576											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	4	---	---	---	---	
MED14	9282	broad.mit.edu	37	X	40552264	40552264	+	Intron	DEL	A	-	-			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40552264delA	uc004dex.3	-							NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						TAGATGTCTTAAAAAAAAAAA	0.279													4	2	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57458212	57458213	+	Intron	INS	-	TT	TT	rs57025798		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57458212_57458213insTT	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						ttgtttttttgtttttttgttt	0.050										HNSCC(52;0.14)			4	2	---	---	---	---	
OCRL	4952	broad.mit.edu	37	X	128674639	128674640	+	Intron	INS	-	C	C			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128674639_128674640insC	uc004euq.2	+						OCRL_uc004eur.2_Intron	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						ggtgggggggggGTGGAAGACC	0.545													6	3	---	---	---	---	
ZDHHC9	51114	broad.mit.edu	37	X	128976076	128976077	+	Intron	INS	-	A	A			TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128976076_128976077insA	uc004euv.2	-						ZDHHC9_uc004euw.2_Intron|ZDHHC9_uc004eux.1_Intron|ZDHHC9_uc004euy.1_Intron	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						AGCAGAAAAAGAAAAAAAAATG	0.446													6	3	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138687316	138687316	+	Intron	DEL	T	-	-	rs35352084		TCGA-C5-A1M5-01	TCGA-C5-A1M5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138687316delT	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TATCCATGACTTTTTTTTTTT	0.323													5	3	---	---	---	---	
