Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NOC2L	26155	broad.mit.edu	37	1	881866	881866	+	Silent	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:881866C>A	uc001abz.3	-	15	1778	c.1719G>T	c.(1717-1719)CTG>CTT	p.L573L	NOC2L_uc001aby.3_Silent_p.L370L|NOC2L_uc009vjq.2_Silent_p.L573L	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog	573						nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CCTTCCCAAGCAGCTGCTGCA	0.637													3	56	---	---	---	---	PASS
TCEB3	6924	broad.mit.edu	37	1	24078184	24078184	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24078184G>C	uc001bho.2	+	4	1227	c.1167G>C	c.(1165-1167)GAG>GAC	p.E389D		NM_003198	NP_003189	Q14241	ELOA1_HUMAN	elongin A	389					positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AGGTAAAAGAGAAGGGTTCTA	0.458											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	23	---	---	---	---	PASS
ZC3H12A	80149	broad.mit.edu	37	1	37948736	37948736	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37948736T>C	uc001cbb.3	+	6	1474	c.1324T>C	c.(1324-1326)TCC>CCC	p.S442P	ZC3H12A_uc001cbc.1_Missense_Mutation_p.S237P	NM_025079	NP_079355	Q5D1E8	ZC12A_HUMAN	zinc finger CCCH-type containing 12A	442					angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGGCATTGGCTCCCTGGAGAG	0.662													22	22	---	---	---	---	PASS
FOXJ3	22887	broad.mit.edu	37	1	42657386	42657386	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42657386C>T	uc001che.2	-	11	1251	c.939G>A	c.(937-939)TTG>TTA	p.L313L	FOXJ3_uc001chf.2_Silent_p.L313L|FOXJ3_uc001chg.2_Silent_p.L313L|FOXJ3_uc001chh.1_Silent_p.L279L	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	313					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGATGTTCATCAAACCTAAAA	0.383													8	87	---	---	---	---	PASS
MED8	112950	broad.mit.edu	37	1	43852678	43852678	+	Intron	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43852678C>T	uc001cjg.3	-						MED8_uc001cje.1_Intron|MED8_uc001cjf.3_Intron|C1orf84_uc001cjh.2_5'Flank|C1orf84_uc001cji.1_5'Flank|KIAA0467_uc009vws.1_5'Flank	NM_201542	NP_963836	Q96G25	MED8_HUMAN	mediator complex subunit 8 isoform 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGCTGTAACACACAGATTTTA	0.468													31	96	---	---	---	---	PASS
ANKRD34A	284615	broad.mit.edu	37	1	145474435	145474435	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145474435G>A	uc001enq.1	+	4	2400	c.1107G>A	c.(1105-1107)TTG>TTA	p.L369L	NBPF10_uc001emp.3_Intron|LIX1L_uc001enr.2_5'Flank	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	369	Pro-rich.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTCCCCGTTGACCCTCCCTC	0.697													8	15	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158368642	158368642	+	Silent	SNP	G	T	T	rs145580938	byFrequency	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158368642G>T	uc010pih.1	-	1	615	c.615C>A	c.(613-615)ATC>ATA	p.I205I		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TAATTACCAGGATGCTGAGGC	0.453													9	23	---	---	---	---	PASS
RGS2	5997	broad.mit.edu	37	1	192779519	192779519	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192779519C>T	uc001gsl.2	+	3	265	c.232C>T	c.(232-234)CAG>TAG	p.Q78*		NM_002923	NP_002914	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	78					cell cycle|negative regulation of cardiac muscle hypertrophy|negative regulation of G-protein coupled receptor protein signaling pathway|negative regulation of MAP kinase activity|negative regulation of phospholipase activity|positive regulation of cardiac muscle contraction|regulation of adrenergic receptor signaling pathway|regulation of translation|relaxation of cardiac muscle	cytosol|internal side of plasma membrane|mitochondrion|nucleolus	calmodulin binding|GTPase activator activity|signal transducer activity				0						TGAGGAAGCACAGCTGTGGTC	0.468													21	84	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197069809	197069809	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197069809G>A	uc001gtu.2	-	18	8829	c.8572C>T	c.(8572-8574)CAG>TAG	p.Q2858*	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Nonsense_Mutation_p.Q706*	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2858					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTTTTCTGCTGAACAAATCTT	0.383													11	25	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568794	229568794	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568794G>A	uc001htm.2	-	2	174	c.69C>T	c.(67-69)TTC>TTT	p.F23F		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	23					muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	CATCCCCGGCGAAGCCGGCTT	0.682													9	69	---	---	---	---	PASS
KCNS3	3790	broad.mit.edu	37	2	18113430	18113430	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18113430C>T	uc002rcv.2	+	3	1606	c.1155C>T	c.(1153-1155)CTC>CTT	p.L385L	KCNS3_uc002rcw.2_Silent_p.L385L	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel	385	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CGGGAAAGCTCATCGCCAGCA	0.552													32	30	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21231002	21231002	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21231002A>C	uc002red.2	-	26	8866	c.8738T>G	c.(8737-8739)CTG>CGG	p.L2913R		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2913					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AGCTTTCAACAGTGTCTTGAT	0.468													27	160	---	---	---	---	PASS
DHX57	90957	broad.mit.edu	37	2	39081288	39081288	+	Silent	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39081288C>A	uc002rrf.2	-	9	2037	c.1938G>T	c.(1936-1938)ACG>ACT	p.T646T	DHX57_uc002rrd.3_Silent_p.T30T|DHX57_uc002rre.2_Silent_p.T79T|DHX57_uc002rrg.2_3'UTR	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	646	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				GCAGCACTCCCGTGGTGCAGT	0.393													4	99	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40342512	40342512	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40342512C>T	uc002rrx.2	-	10	2827	c.2803G>A	c.(2803-2805)GGT>AGT	p.G935S	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.G930S|SLC8A1_uc002rrz.2_Missense_Mutation_p.G922S|SLC8A1_uc002rsa.2_Missense_Mutation_p.G899S|SLC8A1_uc002rsd.3_Missense_Mutation_p.G899S	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	935	Extracellular (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CCCAGCTCACCTCCGATTTCT	0.552													4	54	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101654036	101654036	+	Silent	SNP	G	A	A	rs146126229	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101654036G>A	uc010fiv.2	-	8	1496	c.1365C>T	c.(1363-1365)ACC>ACT	p.T455T	TBC1D8_uc010yvw.1_Silent_p.T470T|TBC1D8_uc002tau.3_Silent_p.T212T	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	455					blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						GCTGGAAGGCGGTGACCAGGG	0.592													7	59	---	---	---	---	PASS
GPR148	344561	broad.mit.edu	37	2	131487317	131487317	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131487317G>A	uc002trv.1	+	1	595	c.593G>A	c.(592-594)GGA>GAA	p.G198E		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	198	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)					GAGGAGCAAGGAGCTTCATAC	0.582													6	52	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158167845	158167845	+	Silent	SNP	A	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158167845A>G	uc002tzg.2	+	10	3063	c.2808A>G	c.(2806-2808)AAA>AAG	p.K936K	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	936	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						AATTTGAAAAATATTATGAAG	0.333													34	38	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166773832	166773832	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166773832C>A	uc002udk.2	-	14	1967	c.1834G>T	c.(1834-1836)GAT>TAT	p.D612Y		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	612						cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TGGCTTGTATCAACTTCAGTT	0.378													16	117	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178705049	178705049	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178705049C>T	uc002ulq.2	-	6	1747	c.1429G>A	c.(1429-1431)GAG>AAG	p.E477K	PDE11A_uc002ulp.2_Missense_Mutation_p.E33K|PDE11A_uc002ulr.2_Missense_Mutation_p.E227K|PDE11A_uc002uls.1_Missense_Mutation_p.E119K|PDE11A_uc002ult.1_Missense_Mutation_p.E227K|PDE11A_uc002ulu.1_Missense_Mutation_p.E119K	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	477	GAF 2.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			GCAACCAGCTCAGCAATGCTG	0.473									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				27	48	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179495034	179495034	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179495034C>G	uc010zfg.1	-	188	36735	c.36511G>C	c.(36511-36513)GAC>CAC	p.D12171H	TTN_uc010zfh.1_Missense_Mutation_p.D5866H|TTN_uc010zfi.1_Missense_Mutation_p.D5799H|TTN_uc010zfj.1_Missense_Mutation_p.D5674H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13098							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCGTCTGGTCCAGGCGACAG	0.388													6	49	---	---	---	---	PASS
TRAF3IP1	26146	broad.mit.edu	37	2	239307437	239307437	+	Silent	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239307437G>T	uc002vye.2	+	17	2072	c.1953G>T	c.(1951-1953)GCG>GCT	p.A651A	TRAF3IP1_uc002vyf.2_Silent_p.A585A	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting	651	Potential.|DISC1-interaction domain.					cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		CTGAGCTCGCGGAGCTGGAGC	0.483													4	139	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38889083	38889083	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38889083G>A	uc011ays.1	-	26	4677	c.4478C>T	c.(4477-4479)TCG>TTG	p.S1493L		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1493	IV.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	AGAAGGAAGCGACATCATCAG	0.473													16	21	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108276131	108276131	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108276131C>A	uc003dxb.3	-	17	2413	c.2144G>T	c.(2143-2145)AGG>ATG	p.R715M		NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	715	Potential.					cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						CTCTAACTTCCTATTATGTTG	0.378													11	77	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109027096	109027096	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109027096C>T	uc003dxo.2	-	6	688	c.441G>A	c.(439-441)TCG>TCA	p.S147S		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	147						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						TGCGTTTCCTCGAACATCGCT	0.433													6	64	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119109638	119109638	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119109638G>A	uc003ecj.3	+	7	1221	c.689G>A	c.(688-690)CGG>CAG	p.R230Q		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	230					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						ACAGAAAACCGGCCCATCATG	0.562													6	23	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128199926	128199926	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128199926T>G	uc003ekm.3	-	7	1814	c.1379A>C	c.(1378-1380)CAC>CCC	p.H460P	GATA2_uc003ekn.3_Missense_Mutation_p.H446P|GATA2_uc003eko.2_Missense_Mutation_p.H460P	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	460					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		GGAGGAGGGGTGGATGGGCGT	0.687			Mis		AML(CML blast transformation)								6	25	---	---	---	---	PASS
A4GNT	51146	broad.mit.edu	37	3	137843671	137843671	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137843671G>A	uc003ers.2	-	3	660	c.458C>T	c.(457-459)TCC>TTC	p.S153F		NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	153	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity			central_nervous_system(1)	1						GGCCAGGCGGGATGCATCCGA	0.577													21	46	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148928011	148928011	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148928011C>T	uc003ewy.3	-	3	803	c.550G>A	c.(550-552)GAT>AAT	p.D184N	CP_uc011bnr.1_RNA|CP_uc003ewx.3_5'Flank|CP_uc003ewz.2_Missense_Mutation_p.D184N|CP_uc010hvf.1_5'Flank	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	184	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TTTGGAGCATCAATGTGGGAA	0.413													34	94	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172766842	172766842	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172766842G>T	uc003fin.3	-	3	813	c.655C>A	c.(655-657)CCT>ACT	p.P219T		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	219					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TCTTCAGCAGGTGCATCAAAT	0.368													7	28	---	---	---	---	PASS
LIPH	200879	broad.mit.edu	37	3	185252845	185252845	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185252845C>A	uc003fpm.2	-	2	235	c.125G>T	c.(124-126)AGG>ATG	p.R42M	LIPH_uc010hyh.2_Missense_Mutation_p.R42M	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor	42					lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GAGCATCAGCCTCACATTTAG	0.448													4	167	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060338	46060338	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060338C>A	uc003gxb.2	-	7	964	c.812G>T	c.(811-813)GGA>GTA	p.G271V		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	271	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		AGTGAAATATCCCATTCTTCT	0.338													17	30	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060339	46060339	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060339C>G	uc003gxb.2	-	7	963	c.811G>C	c.(811-813)GGA>CGA	p.G271R		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	271	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		GTGAAATATCCCATTCTTCTG	0.333													16	31	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119978608	119978608	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119978608C>A	uc010inb.2	+	5	3501	c.3305C>A	c.(3304-3306)TCT>TAT	p.S1102Y	SYNPO2_uc011cgh.1_Missense_Mutation_p.L104I|SYNPO2_uc010inc.2_Missense_Mutation_p.S972Y	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						CCCCCCATTTCTACATCTCCT	0.428													4	78	---	---	---	---	PASS
C4orf49	84709	broad.mit.edu	37	4	140187927	140187927	+	Silent	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140187927G>T	uc003ihr.1	-	4	729	c.549C>A	c.(547-549)GCC>GCA	p.A183A		NM_032623	NP_116012	Q8TDB4	CD049_HUMAN	ovary-specific acidic protein	183						integral to membrane				central_nervous_system(1)|skin(1)	2						CTTCATCCAGGGCAGCATTTG	0.473													4	239	---	---	---	---	PASS
SMAD1	4086	broad.mit.edu	37	4	146435948	146435948	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146435948G>A	uc003ikc.2	+	2	599	c.183G>A	c.(181-183)CCG>CCA	p.P61P	SMAD1_uc003ikd.2_Silent_p.P61P|SMAD1_uc010iov.2_Silent_p.P61P|SMAD1_uc011cic.1_Silent_p.P61P	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1	61	MH1.				BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					CAGGGCAACCGAGTAACTGTG	0.537													9	48	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151729520	151729520	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151729520G>A	uc010ipj.2	-	32	5810	c.5336C>T	c.(5335-5337)TCA>TTA	p.S1779L	LRBA_uc003ilt.3_Missense_Mutation_p.S438L|LRBA_uc003ilu.3_Missense_Mutation_p.S1779L	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1779						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TGTTGGAACTGAGGGCAATTT	0.294													13	51	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66398418	66398418	+	Silent	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66398418C>G	uc003jut.1	+	8	626	c.558C>G	c.(556-558)GTC>GTG	p.V186V	MAST4_uc003jus.2_Silent_p.V186V|MAST4_uc003juu.1_Silent_p.V196V|MAST4_uc011cra.1_Silent_p.V169V|MAST4_uc010ixa.2_RNA|MAST4_uc003juv.2_Silent_p.V181V|MAST4_uc003juw.2_Silent_p.V181V	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	378						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TGAACCATGTCTACAAAGAAA	0.408													18	75	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140249937	140249937	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140249937G>A	uc003lia.2	+	1	2107	c.1249G>A	c.(1249-1251)GTG>ATG	p.V417M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.V417M	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	417	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGAGAACGTGTGGGCCTA	0.622													26	147	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	140481796	140481796	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140481796C>T	uc003lin.2	-	1		c.1_splice	c.e1-1		PCDHB3_uc003lio.2_Silent_p.Y521Y					Homo sapiens cDNA clone IMAGE:4838878.																		CGCTGGACTACGAGGCCCTGC	0.692													12	78	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140754832	140754832	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140754832G>A	uc003ljy.1	+	1	1182	c.1182G>A	c.(1180-1182)TTG>TTA	p.L394L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.L394L	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	394	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTTGAATTGGAAAAATCAG	0.458													4	68	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140768904	140768904	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140768904G>A	uc003lkc.1	+	1	1453	c.1453G>A	c.(1453-1455)GTC>ATC	p.V485I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.V485I	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	485	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACGGCCAAGTCTCTTACTG	0.592													18	74	---	---	---	---	PASS
KCTD16	57528	broad.mit.edu	37	5	143586961	143586961	+	Silent	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143586961C>G	uc003lnm.1	+	3	1313	c.684C>G	c.(682-684)CTC>CTG	p.L228L	KCTD16_uc003lnn.1_Silent_p.L228L	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	228						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GATTTTATCTCAAATTCAAGC	0.438													6	79	---	---	---	---	PASS
SPINK13	153218	broad.mit.edu	37	5	147665577	147665577	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147665577G>A	uc003lpc.2	+	5	313	c.251G>A	c.(250-252)CGT>CAT	p.R84H	uc003lpb.1_Intron|SPINK13_uc010jgt.2_RNA	NM_001040129	NP_001035218	Q1W4C9	ISK13_HUMAN	serine PI Kazal type 5-like 3 precursor	84	Kazal-like.					extracellular region	serine-type endopeptidase inhibitor activity				0						TTTCATTATCGTATAAAATTT	0.269													3	39	---	---	---	---	PASS
ZNF454	285676	broad.mit.edu	37	5	178392175	178392175	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178392175C>T	uc003mjo.1	+	5	1041	c.770C>T	c.(769-771)TCC>TTC	p.S257F	ZNF454_uc010jkz.1_Missense_Mutation_p.S257F	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	257	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		TCAGTGAGCTCCTCACTTACG	0.433													20	78	---	---	---	---	PASS
RUFY1	80230	broad.mit.edu	37	5	179021873	179021873	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179021873G>C	uc003mka.1	+	12	1420	c.1420G>C	c.(1420-1422)GAG>CAG	p.E474Q	RUFY1_uc003mkb.1_Missense_Mutation_p.E366Q|RUFY1_uc003mkc.1_Missense_Mutation_p.E366Q|RUFY1_uc003mkd.1_Missense_Mutation_p.E76Q	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	474	Potential.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTAGAATGCAGAGAGCAGTTT	0.398										HNSCC(44;0.11)			10	28	---	---	---	---	PASS
E2F3	1871	broad.mit.edu	37	6	20402643	20402643	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20402643C>G	uc003nda.2	+	1	507	c.180C>G	c.(178-180)ATC>ATG	p.I60M	E2F3_uc003ncz.2_Missense_Mutation_p.I60M	NM_001949	NP_001940	O00716	E2F3_HUMAN	E2F transcription factor 3	60					G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			ACATCCAGATCCTCACCACGA	0.597													4	31	---	---	---	---	PASS
EHMT2	10919	broad.mit.edu	37	6	31864205	31864205	+	Silent	SNP	T	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31864205T>C	uc003nxz.1	-	4	427	c.417A>G	c.(415-417)AAA>AAG	p.K139K	EHMT2_uc003nxy.1_5'UTR|EHMT2_uc011don.1_Silent_p.K196K|EHMT2_uc003nya.1_Silent_p.K139K|EHMT2_uc003nyb.1_Silent_p.K139K|C2_uc003nyc.2_5'Flank|C2_uc011doo.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	139					DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						ATGGAGGTGATTTTCCCGCCC	0.587													8	82	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34840174	34840174	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34840174C>T	uc003oju.3	+	21	4516	c.4282C>T	c.(4282-4284)CTT>TTT	p.L1428F	UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1428	Potential.									ovary(3)	3						AGAAAAACTTCTTCAGGAGAT	0.433													9	57	---	---	---	---	PASS
KLHDC3	116138	broad.mit.edu	37	6	42985400	42985400	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42985400G>C	uc003otl.2	+	3	467	c.298G>C	c.(298-300)GGG>CGG	p.G100R	KLHDC3_uc003otm.2_RNA|KLHDC3_uc010jyf.2_Missense_Mutation_p.G100R|KLHDC3_uc003otn.2_Missense_Mutation_p.K22N|KLHDC3_uc003oto.2_Intron	NM_057161	NP_476502	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	100	Kelch 2.				reciprocal meiotic recombination	cytoplasm|nuclear chromatin	chromatin binding|protein binding			upper_aerodigestive_tract(1)	1			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGACACCGAAGGGGCCTGCAA	0.557													5	42	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72889509	72889509	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72889509C>T	uc003pga.2	+	5	780	c.703C>T	c.(703-705)CCC>TCC	p.P235S	RIMS1_uc011dyb.1_5'Flank|RIMS1_uc003pgc.2_5'Flank|RIMS1_uc003pgb.3_5'Flank	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	235					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGCTGCTCCTCCCAGCGCACC	0.592													7	32	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116757460	116757460	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116757460G>A	uc003pws.2	+	6	2023	c.1829G>A	c.(1828-1830)AGA>AAA	p.R610K	DSE_uc011ebg.1_Missense_Mutation_p.R629K|DSE_uc003pwt.2_Missense_Mutation_p.R610K|DSE_uc003pwu.2_Missense_Mutation_p.R277K	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	610					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		ATCAGGCAGAGAGATGGTCTC	0.498													11	38	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184649	19184649	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184649G>A	uc003suo.1	-	1	396	c.337C>T	c.(337-339)CGG>TGG	p.R113W	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	113	Helix-loop-helix motif.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						TTGAACATCCGCTTCCTTTCG	0.552													9	32	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24846529	24846529	+	Intron	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24846529G>A	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						GATCTAAGAAGAAAATAAATC	0.368													18	85	---	---	---	---	PASS
SNX10	29887	broad.mit.edu	37	7	26412102	26412102	+	Intron	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26412102C>T	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_Intron|SNX10_uc010kuw.2_Intron	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						CCCCTCTCTTCTTTTCCAGTT	0.398													18	123	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40132633	40132633	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40132633C>T	uc003thh.3	+	13	3767	c.3485C>T	c.(3484-3486)TCT>TTT	p.S1162F	CDK13_uc003thi.3_Missense_Mutation_p.S1102F|CDK13_uc003thj.2_Missense_Mutation_p.S213F|CDK13_uc003thk.2_Missense_Mutation_p.S95F	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1162					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						ATTCAGCCTTCTTCTCAGACC	0.483													27	140	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47886542	47886542	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47886542C>A	uc003tny.1	-	32	5088	c.5088G>T	c.(5086-5088)AAG>AAT	p.K1696N		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	1696	Extracellular (Potential).|GPS.				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						TCCACTCTCTCTTGTCCCAAA	0.413													13	62	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99799930	99799930	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99799930C>A	uc003utx.1	+	24	2685	c.2530C>A	c.(2530-2532)CAC>AAC	p.H844N	STAG3_uc011kjk.1_Missense_Mutation_p.H786N|GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc003uua.3_3'UTR|GATS_uc010lgt.2_RNA|STAG3_uc003uub.1_Missense_Mutation_p.H68N	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	844					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCTCATGGACCACGTCTTCAT	0.547													15	96	---	---	---	---	PASS
LAMB1	3912	broad.mit.edu	37	7	107577713	107577713	+	Silent	SNP	A	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107577713A>G	uc003vew.2	-	26	4106	c.3771T>C	c.(3769-3771)ATT>ATC	p.I1257I	LAMB1_uc003vev.2_Silent_p.I1281I	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1257	Potential.|Domain II.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TAACATCTTTAATCAGTTTCC	0.358													41	70	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122755586	122755586	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122755586C>A	uc003vkm.2	-	15	1799	c.1774G>T	c.(1774-1776)GAG>TAG	p.E592*	SLC13A1_uc010lks.2_Nonsense_Mutation_p.E468*	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	592						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	GGCATGGTCTCATTACTCATA	0.393													9	61	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151846145	151846145	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151846145C>T	uc003wla.2	-	52	13086	c.12867G>A	c.(12865-12867)GTG>GTA	p.V4289V	MLL3_uc003wkz.2_Silent_p.V3407V|MLL3_uc003wkx.2_Silent_p.V447V|MLL3_uc003wky.2_Silent_p.V1853V	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4289					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGAGACAGTGCACATCCAAAG	0.532			N		medulloblastoma								5	38	---	---	---	---	PASS
PPP2CB	5516	broad.mit.edu	37	8	30657146	30657146	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30657146C>T	uc003xik.2	-	3	463	c.228G>A	c.(226-228)CCG>CCA	p.P76P		NM_004156	NP_004147	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta	76					protein dephosphorylation	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex|spindle pole	metal ion binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	AGTTTGTATCCGGTGATTTTC	0.383													42	83	---	---	---	---	PASS
PLAT	5327	broad.mit.edu	37	8	42045026	42045026	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42045026C>A	uc003xos.2	-	6	638	c.429G>T	c.(427-429)GAG>GAT	p.E143D	PLAT_uc010lxf.1_Missense_Mutation_p.E60D|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Missense_Mutation_p.E97D|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	143	Kringle 1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CGGCGCCACTCTCCGCTGTGC	0.652													3	28	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59514055	59514055	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59514055C>A	uc003xtt.2	-	15	1379	c.1165G>T	c.(1165-1167)GGG>TGG	p.G389W	NSMAF_uc011lee.1_Missense_Mutation_p.G420W|NSMAF_uc003xtu.2_Missense_Mutation_p.G389W	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	389	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TAGTGACTCCCATACATGAAC	0.338													3	47	---	---	---	---	PASS
TERF1	7013	broad.mit.edu	37	8	73942633	73942633	+	Intron	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73942633G>A	uc003xzd.2	+						TERF1_uc003xze.2_Intron	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1						age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding			ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)			TTATTGAGGTGAAGTAAATTG	0.318													3	15	---	---	---	---	PASS
MIR1205	100302161	broad.mit.edu	37	8	128972893	128972893	+	RNA	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128972893G>C	hsa-mir-1205|MI0006338	+			c.15G>C			PVT1_uc010mdq.2_Intron|PVT1_uc003ysl.2_Intron																	0						GCCTCTGCAGGGTTTGCTTTG	0.373													15	47	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144993180	144993180	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144993180C>T	uc003zaf.1	-	32	11390	c.11220G>A	c.(11218-11220)CAG>CAA	p.Q3740Q	PLEC_uc003zab.1_Silent_p.Q3603Q|PLEC_uc003zac.1_Silent_p.Q3607Q|PLEC_uc003zad.2_Silent_p.Q3603Q|PLEC_uc003zae.1_Silent_p.Q3571Q|PLEC_uc003zag.1_Silent_p.Q3581Q|PLEC_uc003zah.2_Silent_p.Q3589Q|PLEC_uc003zaj.2_Silent_p.Q3630Q	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3740	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CAGCCATCAGCTGGGCCCGCT	0.622													21	41	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144995363	144995363	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144995363C>T	uc003zaf.1	-	32	9207	c.9037G>A	c.(9037-9039)GAG>AAG	p.E3013K	PLEC_uc003zab.1_Missense_Mutation_p.E2876K|PLEC_uc003zac.1_Missense_Mutation_p.E2880K|PLEC_uc003zad.2_Missense_Mutation_p.E2876K|PLEC_uc003zae.1_Missense_Mutation_p.E2844K|PLEC_uc003zag.1_Missense_Mutation_p.E2854K|PLEC_uc003zah.2_Missense_Mutation_p.E2862K|PLEC_uc003zaj.2_Missense_Mutation_p.E2903K	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3013	Globular 2.|Plectin 5.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						AGGCCCGTCTCGGGGTCCTCC	0.647													6	85	---	---	---	---	PASS
PIGO	84720	broad.mit.edu	37	9	35093900	35093900	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35093900G>A	uc003zwd.2	-	4	1173	c.777C>T	c.(775-777)ATC>ATT	p.I259I	PIGO_uc003zwc.1_Silent_p.I259I|PIGO_uc003zwe.2_Silent_p.I259I|PIGO_uc003zwf.2_Silent_p.I259I|PIGO_uc003zwg.1_5'UTR	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	259					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ACACTCACTGGATCACCTGGT	0.517													5	58	---	---	---	---	PASS
RUSC2	9853	broad.mit.edu	37	9	35547804	35547804	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35547804C>A	uc003zww.2	+	2	1541	c.1286C>A	c.(1285-1287)CCC>CAC	p.P429H	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.P429H	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	429						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AAGATAAGTCCCCCACCAGGC	0.542													4	170	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73225620	73225620	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73225620C>T	uc004aid.2	-	18	2780	c.2536G>A	c.(2536-2538)GAA>AAA	p.E846K	TRPM3_uc004ahu.2_Missense_Mutation_p.E676K|TRPM3_uc004ahv.2_Missense_Mutation_p.E648K|TRPM3_uc004ahw.2_Missense_Mutation_p.E718K|TRPM3_uc004ahx.2_Missense_Mutation_p.E705K|TRPM3_uc004ahy.2_Missense_Mutation_p.E708K|TRPM3_uc004ahz.2_Missense_Mutation_p.E695K|TRPM3_uc004aia.2_Missense_Mutation_p.E693K|TRPM3_uc004aib.2_Missense_Mutation_p.E683K|TRPM3_uc004aic.2_Missense_Mutation_p.E846K	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	871	Extracellular (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ACTTCCTCTTCATCCTTCTTC	0.403													13	67	---	---	---	---	PASS
WNK2	65268	broad.mit.edu	37	9	96062406	96062406	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96062406C>T	uc004ati.1	+	26	6300	c.6300C>T	c.(6298-6300)CTC>CTT	p.L2100L	WNK2_uc011lud.1_Silent_p.L2063L|WNK2_uc004atj.2_Silent_p.L2063L|WNK2_uc004atk.2_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2100					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						CTCGATTCCTCAGTGGACCCG	0.473													41	133	---	---	---	---	PASS
NTNG2	84628	broad.mit.edu	37	9	135073615	135073615	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135073615G>A	uc004cbh.2	+	3	1252	c.476G>A	c.(475-477)CGC>CAC	p.R159H		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	159	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GACAACGGGCGCACCTGGCAG	0.662													8	27	---	---	---	---	PASS
UBAC1	10422	broad.mit.edu	37	9	138847247	138847247	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138847247G>A	uc004cgt.2	-	2	371	c.153C>T	c.(151-153)AGC>AGT	p.S51S	UBAC1_uc004cgs.1_Silent_p.S51S|UBAC1_uc004cgu.2_RNA	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1	51	Ubiquitin-like.					Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GATCTTCTAAGCTCCCATGAG	0.433													137	178	---	---	---	---	PASS
CLIC3	9022	broad.mit.edu	37	9	139890114	139890114	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139890114C>T	uc004ckj.1	-	2	158	c.129G>A	c.(127-129)ACG>ACA	p.T43T		NM_004669	NP_004660	O95833	CLIC3_HUMAN	chloride intracellular channel 3	43	Required for insertion into the membrane (By similarity).|Helical; (Potential).|GST N-terminal.				signal transduction	chloride channel complex|cytoplasm|nucleus	protein binding|voltage-gated chloride channel activity				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCGTGTCCACCGTGGTGAGGG	0.711													3	17	---	---	---	---	PASS
NDOR1	27158	broad.mit.edu	37	9	140100223	140100223	+	5'UTR	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140100223C>T	uc004clw.2	+	1					TMEM203_uc004clv.2_5'Flank|NDOR1_uc004clx.2_5'UTR|NDOR1_uc011mes.1_5'UTR|NDOR1_uc004cly.2_5'UTR	NM_014434	NP_055249	Q9UHB4	NDOR1_HUMAN	NADPH dependent diflavin oxidoreductase 1						cell death	cytosol|intermediate filament cytoskeleton|nucleus|perinuclear region of cytoplasm	flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding|oxidoreductase activity|protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CCACCGGGCGCACCCCGATGC	0.692													11	61	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	11994158	11994158	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11994158C>G	uc001ila.2	-	14	3415	c.2941G>C	c.(2941-2943)GAA>CAA	p.E981Q	UPF2_uc001ilb.2_Missense_Mutation_p.E981Q|UPF2_uc001ilc.2_Missense_Mutation_p.E981Q|UPF2_uc009xiz.1_Missense_Mutation_p.E981Q	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	981	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				CTTAGCAGTTCTAGTGTATCA	0.368													35	78	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119029903	119029903	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119029903G>A	uc001ldd.1	+	15	1400	c.1369G>A	c.(1369-1371)GGG>AGG	p.G457R	SLC18A2_uc009xyy.1_Missense_Mutation_p.G254R	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	457	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GACAATTATTGGGATAATTGA	0.388													23	86	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124380784	124380784	+	Silent	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124380784C>A	uc001lgk.1	+	41	5215	c.5109C>A	c.(5107-5109)GTC>GTA	p.V1703V	DMBT1_uc001lgl.1_Silent_p.V1693V|DMBT1_uc001lgm.1_Silent_p.V1075V|DMBT1_uc009xzz.1_Silent_p.V1703V|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Silent_p.V406V|DMBT1_uc009yac.1_Silent_p.V17V	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1703	SRCR 13.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GACCCATTGTCCTGGATGATG	0.612													9	174	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	128795093	128795093	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128795093C>T	uc001ljt.2	+	7	619	c.555C>T	c.(553-555)TTC>TTT	p.F185F	DOCK1_uc010qun.1_Silent_p.F185F	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	185					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTAGTCTCTTCAGAGCTCATG	0.358													28	92	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135094896	135094896	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135094896G>A	uc001lmg.1	-	17	2811	c.2454C>T	c.(2452-2454)TTC>TTT	p.F818F	TUBGCP2_uc001lmf.1_Silent_p.F411F|TUBGCP2_uc010qvc.1_Silent_p.F846F|TUBGCP2_uc009ybk.1_Silent_p.F841F|TUBGCP2_uc010qvd.1_Silent_p.F688F|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	818					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TGGTGGCCTCGAAGCCGGACA	0.612													8	42	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1097785	1097785	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1097785A>C	uc001lsx.1	+	39	13991	c.13964A>C	c.(13963-13965)GAC>GCC	p.D4655A		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4655	VWFD 4.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CTGGTGAACGACCCCTCCAAG	0.657													6	11	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19255959	19255959	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19255959C>G	uc001mpm.2	-	6	1398	c.876G>C	c.(874-876)AAG>AAC	p.K292N	E2F8_uc009yhv.2_RNA|E2F8_uc001mpn.3_Missense_Mutation_p.K292N	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	292	Potential.				cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CAATTAAAATCTTGGCAGCAA	0.388													35	137	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35336587	35336587	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35336587A>T	uc001mwd.2	-	3	885	c.293T>A	c.(292-294)ATC>AAC	p.I98N	SLC1A2_uc001mwe.2_Missense_Mutation_p.I89N|SLC1A2_uc010rev.1_Missense_Mutation_p.I98N	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	98	Helical; (Potential).				D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	TAAGCTGGAGATGATTAGAGG	0.448													18	33	---	---	---	---	PASS
MDK	4192	broad.mit.edu	37	11	46403873	46403873	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46403873G>C	uc001nco.2	+	3	328	c.106G>C	c.(106-108)GAG>CAG	p.E36Q	MDK_uc009ykz.1_Missense_Mutation_p.E36Q|MDK_uc001ncp.2_Missense_Mutation_p.E36Q|MDK_uc009yla.2_Intron|MDK_uc009ylb.2_Missense_Mutation_p.E36Q|MDK_uc001ncq.2_Missense_Mutation_p.E36Q|MDK_uc001ncr.2_RNA|MDK_uc001ncs.2_Missense_Mutation_p.E36Q	NM_001012334	NP_001012334	P21741	MK_HUMAN	midkine	36					adrenal gland development|cell differentiation|nervous system development|positive regulation of cell division|response to wounding|signal transduction	extracellular region	growth factor activity|heparin binding				0				GBM - Glioblastoma multiforme(35;0.0252)|Lung(87;0.14)		CCCGGGGAGCGAGTGCGCTGA	0.701													12	18	---	---	---	---	PASS
MRPL21	219927	broad.mit.edu	37	11	68663993	68663993	+	Missense_Mutation	SNP	C	T	T	rs143584803		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68663993C>T	uc001ooi.2	-	4	411	c.386G>A	c.(385-387)CGA>CAA	p.R129Q	MRPL21_uc001ooh.2_Missense_Mutation_p.R44Q|MRPL21_uc010rqe.1_Missense_Mutation_p.R129Q	NM_181514	NP_852615	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21 isoform d	129					translation	mitochondrion|ribosome	RNA binding|structural constituent of ribosome				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTTCTCCAGTCGAATTCTCTC	0.537													26	82	---	---	---	---	PASS
PIWIL4	143689	broad.mit.edu	37	11	94337148	94337148	+	Splice_Site	SNP	A	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94337148A>G	uc001pfa.2	+	13	1777	c.1566_splice	c.e13-2	p.I522_splice	PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_Intron	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTTTTTATGTAGCATAAAAGT	0.303													6	24	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731208	94731208	+	Silent	SNP	A	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731208A>G	uc001pfe.2	+	3	1504	c.672A>G	c.(670-672)GAA>GAG	p.E224E		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	224	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AGCGCCTGGAACGCCTGGCCA	0.592													13	41	---	---	---	---	PASS
CASP1	834	broad.mit.edu	37	11	104970152	104970152	+	Intron	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104970152G>A	uc010rve.1	-						CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD17_uc001pir.1_Intron	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor						cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	GTTGGACCTAGAGAAAGAAGA	0.388													9	32	---	---	---	---	PASS
C11orf65	160140	broad.mit.edu	37	11	108277614	108277614	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108277614C>T	uc001pkh.2	-	5	375	c.305G>A	c.(304-306)AGA>AAA	p.R102K	C11orf65_uc010rvx.1_Missense_Mutation_p.R53K|C11orf65_uc009yxu.1_RNA	NM_152587	NP_689800	Q8NCR3	CK065_HUMAN	hypothetical protein LOC160140	102										ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TGCATAATTTCTAGGGCTGTT	0.343													12	64	---	---	---	---	PASS
MCAM	4162	broad.mit.edu	37	11	119185550	119185550	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119185550G>A	uc001pwf.2	-	3	422	c.393C>T	c.(391-393)CGC>CGT	p.R131R		NM_006500	NP_006491	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	131	Extracellular (Potential).				anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane				ovary(2)|breast(1)|central_nervous_system(1)	4		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CACTGTAGACGCGGAGCTGGA	0.607													16	33	---	---	---	---	PASS
USP2	9099	broad.mit.edu	37	11	119227897	119227897	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119227897C>A	uc001pwm.3	-	12	2025	c.1730G>T	c.(1729-1731)AGC>ATC	p.S577I	USP2_uc001pwl.3_Missense_Mutation_p.S368I|USP2_uc001pwn.3_Missense_Mutation_p.S334I	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a	577					cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		TGGCTCTCACCTGGAGTCGTT	0.423													3	45	---	---	---	---	PASS
C1S	716	broad.mit.edu	37	12	7170342	7170342	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7170342C>T	uc001qsj.2	+	7	1081	c.362C>T	c.(361-363)ACG>ATG	p.T121M	C1S_uc001qsk.2_Missense_Mutation_p.T121M|C1S_uc001qsl.2_Missense_Mutation_p.T121M|C1S_uc009zfr.2_Translation_Start_Site|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	121	CUB 1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GAGCGTTTTACGGGGTTTGCT	0.438													27	53	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9262517	9262517	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9262517C>G	uc001qvk.1	-	6	732	c.619G>C	c.(619-621)GTA>CTA	p.V207L	A2M_uc009zgk.1_Missense_Mutation_p.V57L	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	207					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TTCTTCTGTACCACCACCTTG	0.458													51	98	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52845385	52845385	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52845385G>A	uc001sak.2	-	1	526	c.478C>T	c.(478-480)CGG>TGG	p.R160W		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	160	Head.			VR -> IG (in Ref. 2; AAA59466).	ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCCTCGGCCCGCACCCGCTGG	0.602													4	92	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53454245	53454245	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53454245C>T	uc001sbp.2	+	19	2809	c.2674C>T	c.(2674-2676)CGG>TGG	p.R892W	TENC1_uc001sbl.2_Missense_Mutation_p.R768W|TENC1_uc001sbn.2_Missense_Mutation_p.R902W|TENC1_uc001sbq.2_Missense_Mutation_p.R290W|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.R387W|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	892	Pro-rich.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CACACTGCCTCGGTCTCCCCG	0.647													6	27	---	---	---	---	PASS
RPS26	6231	broad.mit.edu	37	12	56436361	56436361	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56436361C>T	uc001sjf.2	+	2	421	c.156C>T	c.(154-156)GAC>GAT	p.D52D		NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26	52					endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CAGTCAGGGACATTTCTGAAG	0.532													6	70	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56488256	56488256	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56488256G>A	uc001sjh.2	+	15	1968	c.1775G>A	c.(1774-1776)GGA>GAA	p.G592E	ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.G533E|ERBB3_uc009zok.2_Missense_Mutation_p.G34E|ERBB3_uc001sjk.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	592	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			TGCCCCCATGGAGTCCTAGGT	0.537													33	74	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66856701	66856701	+	Intron	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66856701C>T	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGGACCATCTCACCATGGTCG	0.552													10	16	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123057788	123057788	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123057788G>C	uc001ucv.2	+	26	2402	c.2239G>C	c.(2239-2241)GAA>CAA	p.E747Q	KNTC1_uc010taf.1_Missense_Mutation_p.E710Q	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	747					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTACATGAGAGAACATGACTT	0.398													37	97	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26343349	26343349	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26343349G>A	uc001uqk.2	+	26	2692	c.2550G>A	c.(2548-2550)TCG>TCA	p.S850S	ATP8A2_uc010tdi.1_Silent_p.S810S|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Silent_p.S400S	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	810	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CCAACAACTCGGATTACGCCA	0.587													3	60	---	---	---	---	PASS
TRIM9	114088	broad.mit.edu	37	14	51446219	51446219	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51446219G>T	uc001wyx.3	-	9	2721	c.1956C>A	c.(1954-1956)GAC>GAA	p.D652E	TRIM9_uc001wyy.2_Missense_Mutation_p.D733E	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	652	B30.2/SPRY.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					TTCTATTTAAGTCGAGGAGGA	0.448													37	210	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28525273	28525273	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28525273C>T	uc001zbj.2	-	5	589	c.483G>A	c.(481-483)GAG>GAA	p.E161E	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	161					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTTTGACATTCTCCTGAAAAA	0.458													35	62	---	---	---	---	PASS
SNX29	92017	broad.mit.edu	37	16	12162973	12162973	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12162973C>T	uc002dby.3	+	3	204	c.148C>T	c.(148-150)CCT>TCT	p.P50S	SNX29_uc010uyx.1_Missense_Mutation_p.P77S	NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	50					cell communication		phosphatidylinositol binding			ovary(1)	1						TCTCCCAGATCCTGGACTTCG	0.473													11	177	---	---	---	---	PASS
CES7	221223	broad.mit.edu	37	16	55883536	55883536	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55883536C>T	uc002eip.2	-	11	1572	c.1423G>A	c.(1423-1425)GAA>AAA	p.E475K	CES7_uc002eio.2_Intron|CES7_uc002eiq.2_Missense_Mutation_p.E236K|CES7_uc002eir.2_Missense_Mutation_p.E369K	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1	475						extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)		AGTCCCTTACCGAACATAACA	0.532													11	95	---	---	---	---	PASS
CX3CL1	6376	broad.mit.edu	37	16	57416399	57416399	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57416399G>A	uc002eli.2	+	3	716	c.649G>A	c.(649-651)GAG>AAG	p.E217K		NM_002996	NP_002987	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1 precursor	217	Mucin-like stalk.|Extracellular (Potential).				cell adhesion|cytokine-mediated signaling pathway|defense response|immune response|leukocyte adhesive activation|positive regulation of calcium-independent cell-cell adhesion|positive regulation of inflammatory response	cell surface|extracellular space|integral to membrane|plasma membrane	chemokine activity				0						AAAGACCTCTGAGGCCCCGTC	0.672													8	48	---	---	---	---	PASS
ALKBH5	54890	broad.mit.edu	37	17	18110256	18110256	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18110256C>T	uc010cpw.2	+	3	1670	c.979C>T	c.(979-981)CGC>TGC	p.R327C	ALKBH5_uc010cpx.2_RNA	NM_017758	NP_060228	Q6P6C2	ALKB5_HUMAN	alkB, alkylation repair homolog 5	327						integral to membrane	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_neural(463;0.228)					GCGGTCCCACCGCAAGGCAGA	0.582													96	138	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19746514	19746514	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19746514G>A	uc002gwm.3	-	8	1074	c.565C>T	c.(565-567)CAA>TAA	p.Q189*	ULK2_uc002gwn.2_Nonsense_Mutation_p.Q189*	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	189	Protein kinase.				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TCATAATGTTGAGACATAATA	0.378													70	98	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37868208	37868208	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37868208C>T	uc002hso.2	+	8	1167	c.929C>T	c.(928-930)TCC>TTC	p.S310F	ERBB2_uc002hsm.2_Missense_Mutation_p.S280F|ERBB2_uc010cwa.2_Missense_Mutation_p.S295F|ERBB2_uc002hsp.2_Missense_Mutation_p.S113F|ERBB2_uc010cwb.2_Missense_Mutation_p.S310F|ERBB2_uc010wek.1_Missense_Mutation_p.S34F|ERBB2_uc002hsl.2_Missense_Mutation_p.S280F|ERBB2_uc002hsn.1_Missense_Mutation_p.S310F	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	310	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.S310F(2)|p.S310Y(1)		lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GACGTGGGATCCTGCACCCTC	0.582		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			116	176	---	---	---	---	PASS
KCTD2	23510	broad.mit.edu	37	17	73043594	73043594	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73043594C>G	uc002jmp.2	+	1	316	c.249C>G	c.(247-249)TTC>TTG	p.F83L	KCTD2_uc010dfy.1_Intron|KCTD2_uc010dfz.2_Intron|ATP5H_uc002jmn.1_5'Flank|ATP5H_uc002jmo.1_5'Flank|KCTD2_uc002jmq.2_RNA	NM_015353	NP_056168	Q14681	KCTD2_HUMAN	potassium channel tetramerisation domain	83	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)					GCACCTACTTCGTGACCACCA	0.388													3	15	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74289415	74289415	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74289415G>C	uc002jrd.1	-	4	1075	c.895C>G	c.(895-897)CTG>GTG	p.L299V	QRICH2_uc010wsz.1_Missense_Mutation_p.L225V|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	299							protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						ACTGAAACCAGACCATGTTGG	0.478													36	54	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79409609	79409609	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79409609G>A	uc002kaf.2	+	3	1234	c.1234G>A	c.(1234-1236)GAG>AAG	p.E412K	BAHCC1_uc002kae.2_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	412							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			CCAGGCCGCCGAGGCCTGTGC	0.692													11	14	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2937748	2937748	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2937748C>T	uc002klo.2	-	7	1349	c.1110G>A	c.(1108-1110)GCG>GCA	p.A370A		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	370					fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AGGGCGCCTCCGCTAAGGCTG	0.488													7	69	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28991196	28991196	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28991196A>T	uc002kwq.2	+	15	2275	c.2140A>T	c.(2140-2142)ATC>TTC	p.I714F	DSG4_uc002kwr.2_Missense_Mutation_p.I733F	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	714	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTTTTCAGAAATCTACACCAA	0.582													23	32	---	---	---	---	PASS
DYM	54808	broad.mit.edu	37	18	46570541	46570541	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46570541C>G	uc002ldi.1	-	17	2259	c.1894G>C	c.(1894-1896)GAG>CAG	p.E632Q	DYM_uc010xdf.1_Missense_Mutation_p.E442Q|uc002ldh.2_Intron	NM_017653	NP_060123	Q7RTS9	DYM_HUMAN	dymeclin	632						Golgi apparatus					0						GGCTGCTCCTCTTCCACATAT	0.423													26	110	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19360596	19360596	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19360596G>A	uc002nlz.2	+	15	3941	c.3842G>A	c.(3841-3843)CGG>CAG	p.R1281Q	NCAN_uc002nma.2_Missense_Mutation_p.G37S	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1281					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			CATCGGATGCGGCGAcaccac	0.468													8	18	---	---	---	---	PASS
ZFP36	7538	broad.mit.edu	37	19	39898462	39898462	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39898462C>T	uc002olh.1	+	2	162	c.104C>T	c.(103-105)TCG>TTG	p.S35L	ZFP36_uc010egn.1_5'UTR	NM_003407	NP_003398	P26651	TTP_HUMAN	zinc finger protein 36, C3H type, homolog	35					positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding			pancreas(1)	1	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGGGGCTCCTCGGGACCCTGG	0.697													16	59	---	---	---	---	PASS
ZNF546	339327	broad.mit.edu	37	19	40513243	40513243	+	Silent	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40513243C>T	uc002oms.2	+	5	490	c.234C>T	c.(232-234)GAC>GAT	p.D78D	ZNF546_uc002omt.2_Silent_p.D52D	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	78	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTGCCTGGACGCTGTGCAGA	0.423													11	31	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42793213	42793213	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42793213G>C	uc002otf.1	+	7	1145	c.1105G>C	c.(1105-1107)GAC>CAC	p.D369H		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	369					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				CGGAGAAGTAGACAGTCAGGC	0.667			T	DUX4	soft tissue sarcoma								16	71	---	---	---	---	PASS
CACNG7	59284	broad.mit.edu	37	19	54418743	54418743	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54418743C>G	uc002qcr.1	+	3	423	c.408C>G	c.(406-408)ATC>ATG	p.I136M	CACNG7_uc010era.1_Missense_Mutation_p.I136M	NM_031896	NP_114102	P62955	CCG7_HUMAN	voltage-dependent calcium channel gamma-7	136	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		TCTCTGGCATCTTCTTCATAC	0.453													9	23	---	---	---	---	PASS
ZNF606	80095	broad.mit.edu	37	19	58491316	58491316	+	Silent	SNP	A	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58491316A>G	uc002qqw.2	-	7	1350	c.732T>C	c.(730-732)GCT>GCC	p.A244A	ZNF606_uc010yhp.1_Silent_p.A154A	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	244					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TCCAACTTTGAGCATGTGTAT	0.368													24	67	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33594341	33594341	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33594341G>A	uc002xbk.2	-	15	1758	c.1724C>T	c.(1723-1725)TCA>TTA	p.S575L	TRPC4AP_uc002xbj.2_RNA|TRPC4AP_uc010zuq.1_Missense_Mutation_p.S166L|TRPC4AP_uc002xbl.2_Missense_Mutation_p.S567L|TRPC4AP_uc010zur.1_Missense_Mutation_p.S536L	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	575					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CACATCCCTTGACTTACACTC	0.512													19	35	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40161771	40161771	+	Silent	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40161771G>T	uc002xka.1	-	3	650	c.472C>A	c.(472-474)CGG>AGG	p.R158R	CHD6_uc002xkd.2_Silent_p.R136R|CHD6_uc002xkc.2_Silent_p.R193R	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	158	Lys-rich.				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				GAGGCCTCCCGGGGCTTCCGT	0.587													4	211	---	---	---	---	PASS
PWP2	5822	broad.mit.edu	37	21	45546808	45546808	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45546808C>T	uc002zeb.2	+	17	2192	c.2102C>T	c.(2101-2103)CCT>CTT	p.P701L		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	701	WD 14.					cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		CACTTCAAACCTGAGATCAGG	0.552													7	114	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36682865	36682865	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36682865G>T	uc003apg.2	-	35	5191	c.4960C>A	c.(4960-4962)CTG>ATG	p.L1654M		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1654	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GTGTCATCCAGCTCGCGCATG	0.627			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated		OREG0026519	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	84	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50217002	50217002	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50217002G>A	uc003biv.2	-	1	1451	c.964C>T	c.(964-966)CGG>TGG	p.R322W	BRD1_uc011arf.1_5'UTR|BRD1_uc011arg.1_Missense_Mutation_p.R322W|BRD1_uc011arh.1_Missense_Mutation_p.R322W|BRD1_uc003biu.3_Missense_Mutation_p.R322W	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	322					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGTTTCCACCGGGCTGGAGGG	0.582													24	53	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50599416	50599416	+	Silent	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50599416G>A	uc003bjj.2	+	26	3569	c.3486G>A	c.(3484-3486)CTG>CTA	p.L1162L	MOV10L1_uc003bjk.3_Silent_p.L1116L|MOV10L1_uc011arp.1_Intron|MOV10L1_uc003bjl.2_Silent_p.L289L	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	1162					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTGCTTTGCTGGAATACAGTA	0.502													31	99	---	---	---	---	PASS
GPR143	4935	broad.mit.edu	37	X	9707573	9707573	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9707573G>C	uc004cst.1	-	8	1132	c.1132C>G	c.(1132-1134)CAA>GAA	p.Q378E		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	358	Cytoplasmic (Potential).				calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				CCACCCACTTGAGACACCTTC	0.602													3	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26178839	26178839	+	IGR	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26178839C>T								MAGEB18 (19987 upstream) : MAGEB6 (31718 downstream)																							TCTCGCTCTTCGTCATCCTCT	0.572													37	87	---	---	---	---	PASS
MAGEB10	139422	broad.mit.edu	37	X	27840298	27840298	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27840298T>G	uc004dbw.2	+	3	1102	c.875T>G	c.(874-876)TTG>TGG	p.L292W		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	292	MAGE.									lung(1)|breast(1)|central_nervous_system(1)	3						CTTGAGTTTTTGGCCAAGGTA	0.483													4	32	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47106743	47106743	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47106743G>A	uc004dhp.2	+	19	2590	c.2590G>A	c.(2590-2592)GAG>AAG	p.E864K	USP11_uc004dhq.2_Missense_Mutation_p.E590K	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	864					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						GCCACAGAATGAGTCGAATCC	0.562													9	80	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962794	73962794	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962794C>T	uc004eby.2	-	3	2215	c.1598G>A	c.(1597-1599)CGT>CAT	p.R533H		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	533					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GGGCTCCTTACGGGTTACTTT	0.423													9	83	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	110980018	110980018	+	Missense_Mutation	SNP	C	T	T	rs138712375	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110980018C>T	uc011msy.1	+	23	2640	c.2606C>T	c.(2605-2607)GCG>GTG	p.A869V	ALG13_uc011msx.1_Missense_Mutation_p.A765V|ALG13_uc011msz.1_Missense_Mutation_p.A791V|ALG13_uc011mta.1_Missense_Mutation_p.A765V|ALG13_uc011mtb.1_Missense_Mutation_p.A765V			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	869					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						AACGGTGCAGCGGCTAATCAA	0.448													15	209	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128940465	128940465	+	Intron	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128940465G>A	uc004euv.2	-						ZDHHC9_uc004euw.2_Intron	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						GTGGGGGCCTGAGAAGGAAAA	0.517													36	69	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153695476	153695476	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153695476G>A	uc004flm.2	+	18	3357	c.3184G>A	c.(3184-3186)GGC>AGC	p.G1062S		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1062	IPT/TIG 3.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAAGTACCGCGGCATTGAGAC	0.657													25	79	---	---	---	---	PASS
ZMYND12	84217	broad.mit.edu	37	1	42905858	42905859	+	Intron	INS	-	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42905858_42905859insA	uc001chj.2	-						ZMYND12_uc010ojt.1_Intron	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1							intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				tttggaagagtaaaaaaaaaaa	0.079													4	2	---	---	---	---	
TXNDC12	51060	broad.mit.edu	37	1	52507011	52507011	+	Intron	DEL	A	-	-	rs111745022		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52507011delA	uc001cti.2	-							NM_015913	NP_056997	O95831	AIFM1_HUMAN	thioredoxin domain containing 12 precursor						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(1)	1						tctcaaaaagaaaaaaaaaaa	0.134													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144220693	144220694	+	Intron	INS	-	C	C			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144220693_144220694insC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|uc010oxz.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						CTTTTTCTTTTTAAACAGTTCC	0.366													1	8	---	---	---	---	
SLAMF6	114836	broad.mit.edu	37	1	160466322	160466323	+	Intron	INS	-	A	A	rs140116847	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160466322_160466323insA	uc001fwe.1	-						SLAMF6_uc001fwd.1_Intron|SLAMF6_uc010pjh.1_Intron|SLAMF6_uc010pji.1_Intron|SLAMF6_uc010pjj.1_Intron|SLAMF6_uc009wtm.1_Intron	NM_052931	NP_443163	Q96DU3	SLAF6_HUMAN	activating NK receptor precursor							integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			TAGGAAAGGGTAGGAGATGTTT	0.475													7	11	---	---	---	---	
DHX9	1660	broad.mit.edu	37	1	182822928	182822929	+	Intron	INS	-	T	T	rs12091987		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182822928_182822929insT	uc001gpr.2	+						DHX9_uc001gps.2_Intron	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9						CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						AGAAGTTGTCATTTTTTTTTTT	0.267													3	3	---	---	---	---	
FOXN2	3344	broad.mit.edu	37	2	48586410	48586416	+	Intron	DEL	TTTAGTT	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48586410_48586416delTTTAGTT	uc002rwh.1	+							NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TTATGTTTTAtttagtttttagttttt	0.150													2	4	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86683540	86683540	+	Intron	DEL	T	-	-	rs66667635		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86683540delT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						TGCTCTAAGAttttttttttt	0.299													5	3	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109369248	109369249	+	Intron	INS	-	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109369248_109369249insA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						gactctgtctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191888074	191888074	+	Intron	DEL	A	-	-	rs11293703		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888074delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gcctcaaaagaaaaaaaaaaa	0.159													4	5	---	---	---	---	
GRK4	2868	broad.mit.edu	37	4	3038811	3038812	+	Intron	DEL	TG	-	-	rs34216391		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3038811_3038812delTG	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron	NM_182982	NP_892027	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		tgtgtgtgtatgtgtgtgtgtg	0.371													4	3	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48537632	48537633	+	Intron	DEL	AT	-	-	rs78674320	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537632_48537633delAT	uc003gyh.1	-						FRYL_uc003gyg.1_Intron|FRYL_uc003gyi.1_Intron|FRYL_uc003gyj.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						acacacacacatatatatataG	0.213													4	2	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110929469	110929470	+	Intron	DEL	CA	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110929469_110929470delCA	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CTCATTTAACCACACACACACA	0.391													10	6	---	---	---	---	
BTF3	689	broad.mit.edu	37	5	72800092	72800093	+	Intron	INS	-	TTT	TTT	rs34051700		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72800092_72800093insTTT	uc003kcr.1	+						BTF3_uc003kcq.1_Intron|BTF3_uc003kcs.1_Intron|BTF3_uc003kct.1_Intron	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		TTCATCTGttcttttttttttt	0.267													4	2	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177673154	177673171	+	Intron	DEL	GTGCAGGGACCCAGTGAG	-	-	rs35716676		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177673154_177673171delGTGCAGGGACCCAGTGAG	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GCCCTGCGAAGTGCAGGGACCCAGTGAGGTACAGGGTT	0.624													3	4	---	---	---	---	
TNXB	7148	broad.mit.edu	37	6	32020309	32020309	+	Intron	DEL	C	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32020309delC	uc003nzl.2	-							NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor						actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						tccaaatctgctttttaacaa	0.149													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32523362	32523363	+	Intron	INS	-	GATA	GATA	rs142676080	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32523362_32523363insGATA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAAGCAATGTGGATAAAGGGAC	0.431													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159946964	159946964	+	IGR	DEL	T	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159946964delT								FNDC1 (253825 upstream) : SOD2 (153187 downstream)																							ccaatcagggttttttttttt	0.085													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38284914	38284917	+	Intron	DEL	CTGA	-	-	rs147429736	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38284914_38284917delCTGA	uc003tfu.3	-						uc003tfv.2_Intron					SubName: Full=TARP protein;																		gtgtgtgtgtctgagtgtgtctgt	0.270													25	11	---	---	---	---	
ACTR3B	57180	broad.mit.edu	37	7	152513741	152513741	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152513741delA	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GGATGGAAATAAAAAAAAAAA	0.313													5	3	---	---	---	---	
CHCHD7	79145	broad.mit.edu	37	8	57129756	57129756	+	Intron	DEL	T	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57129756delT	uc003xsx.2	+						CHCHD7_uc003xss.2_Intron|CHCHD7_uc003xst.2_Intron|CHCHD7_uc003xsu.2_Intron|CHCHD7_uc003xsv.2_Intron|CHCHD7_uc003xsw.2_Intron	NM_001011671	NP_001011671	Q9BUK0	CHCH7_HUMAN	coiled-coil-helix-coiled-coil-helix domain										CHCHD7/PLAG1(12)	salivary_gland(12)	12		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00159)|all cancers(17;0.0112)			GGTTTTGGGATTTTTTTTTTA	0.289			T	PLAG1	salivary adenoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	3552650	3552651	+	IGR	INS	-	G	G	rs34642454		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3552650_3552651insG								LOC650368 (122272 upstream) : TRPC2 (85811 downstream)																							CAGCACCCCATGGGGGGGCCCT	0.376													3	3	---	---	---	---	
C11orf80	79703	broad.mit.edu	37	11	66581204	66581204	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66581204delA	uc001ojf.2	+						C11orf80_uc001ojg.2_Intron|C11orf80_uc001ojh.2_Intron|C11orf80_uc001oji.2_Intron|C11orf80_uc010rpl.1_5'Flank|C11orf80_uc001ojj.2_5'Flank	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703												0						actccatctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
DPPA3	359787	broad.mit.edu	37	12	7864317	7864328	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs3069565		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7864317_7864328delTTTTTTTTTTTT	uc001qtf.2	+							NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella							cytoplasm|nucleus					0				Kidney(36;0.0887)		GGCTGCCGTCtttttttttttttttttttttt	0.406													6	3	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTTCAGGGCTGGGGGGGGGCT	0.550													5	3	---	---	---	---	
CCT2	10576	broad.mit.edu	37	12	69986094	69986094	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69986094delA	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			tgtctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
VEZT	55591	broad.mit.edu	37	12	95675990	95675990	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95675990delA	uc001tdz.2	+						VEZT_uc009ztb.1_Intron|VEZT_uc009ztc.1_Intron|VEZT_uc001tdy.2_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						GATAAAGTGCAAAATTTAAAC	0.269													3	3	---	---	---	---	
UHRF1BP1L	23074	broad.mit.edu	37	12	100480162	100480162	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100480162delA	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron|UHRF1BP1L_uc001tgp.2_Intron	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						GGGGGGGGGGAAATATTAAGT	0.358													5	7	---	---	---	---	
VPS29	51699	broad.mit.edu	37	12	110937446	110937446	+	Intron	DEL	A	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110937446delA	uc001tqy.2	-						VPS29_uc001tqw.2_5'Flank|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron|RAD9B_uc001trc.1_5'Flank|RAD9B_uc001trf.3_5'Flank|RAD9B_uc001trg.3_5'Flank|RAD9B_uc010sya.1_5'Flank|RAD9B_uc001tre.3_5'Flank|RAD9B_uc001trd.3_5'Flank	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						aaaagaaaccaaaaaaaaaaa	0.289													4	4	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201448	+	Intron	DEL	AAA	-	-	rs35024436		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446_123201448delAAA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAAAA	0.399													4	2	---	---	---	---	
CRYL1	51084	broad.mit.edu	37	13	21013654	21013654	+	Intron	DEL	A	-	-	rs67005224		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21013654delA	uc001une.2	-						CRYL1_uc001unf.2_Intron|CRYL1_uc001ung.2_Intron|CRYL1_uc010tcp.1_Intron	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		CCTCCCCCGCaaaaaaaaaaa	0.254													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	77402068	77402071	+	IGR	DEL	GGAA	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77402068_77402071delGGAA								LMO7 (968064 upstream) : KCTD12 (52233 downstream)																							gggggaggggggaaggaaggaagg	0.152													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22933391	22933391	+	Intron	DEL	C	-	-	rs36090939		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22933391delC	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdx.3_Intron|uc010tms.1_3'UTR|uc010aju.1_3'UTR|uc001wea.3_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTAGAAATGGCTAAGAAACCA	0.408													4	3	---	---	---	---	
SIPA1L1	26037	broad.mit.edu	37	14	72204905	72204907	+	Intron	DEL	AAA	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72204905_72204907delAAA	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron|SIPA1L1_uc001xmw.2_Intron	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		aaaaaaaaacaaaCCCAGCCATG	0.394													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20172754	20172754	+	IGR	DEL	C	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20172754delC								None (None upstream) : GOLGA6L6 (564340 downstream)																							TACAATATCACGAAAGAGTCA	0.428													4	2	---	---	---	---	
SRRM2	23524	broad.mit.edu	37	16	2813800	2813801	+	Frame_Shift_Ins	INS	-	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2813800_2813801insA	uc002crk.2	+	11	3820_3821	c.3271_3272insA	c.(3271-3273)CAAfs	p.Q1091fs	SRRM2_uc002crj.1_Frame_Shift_Ins_p.Q995fs|SRRM2_uc002crl.1_Frame_Shift_Ins_p.Q1091fs|SRRM2_uc010bsu.1_Frame_Shift_Ins_p.Q995fs	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1091	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GAGCAAATCTCAAACATCACCT	0.465													46	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9250813	9250813	+	IGR	DEL	T	-	-	rs115093816	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9250813delT								C16orf72 (37268 upstream) : GRIN2A (596454 downstream)																							cggagccctcttttttttttt	0.164													4	3	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													3	3	---	---	---	---	
XPO6	23214	broad.mit.edu	37	16	28167920	28167921	+	Intron	INS	-	AA	AA	rs150507094	by1000genomes	TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28167920_28167921insAA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						AATTCTCCTTCAAAAAAatata	0.252													4	5	---	---	---	---	
DHX40P1	653645	broad.mit.edu	37	17	58086443	58086443	+	Intron	DEL	G	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58086443delG	uc002iyf.2	-						uc010woq.1_5'Flank	NR_002924				Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 40 pseudogene, mRNA (cDNA clone IMAGE:5170263).												0						AGCATCTCCAGTGAGCCCACG	0.657													7	6	---	---	---	---	
KPNA2	3838	broad.mit.edu	37	17	66037018	66037020	+	Intron	DEL	TTT	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66037018_66037020delTTT	uc002jgk.2	+						KPNA2_uc002jgl.2_Intron	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2						DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCAAATAGTATTTTTTATTTATT	0.207													4	3	---	---	---	---	
FASN	2194	broad.mit.edu	37	17	80039811	80039813	+	Intron	DEL	AGA	-	-	rs60574681		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80039811_80039813delAGA	uc002kdu.2	-						FASN_uc002kdv.1_Intron	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase						energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	ggctgcggggagaaggtgggggt	0.167													4	4	---	---	---	---	
BACE2	25825	broad.mit.edu	37	21	42598069	42598069	+	Intron	DEL	T	-	-	rs67925412		TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42598069delT	uc002yyw.2	+						BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A						membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GTCAGTATACTTTTTTTTTGT	0.303													5	6	---	---	---	---	
ZDHHC8	29801	broad.mit.edu	37	22	20130158	20130159	+	Intron	INS	-	A	A			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20130158_20130159insA	uc002zrq.2	+						ZDHHC8_uc002zrr.1_Intron|ZDHHC8_uc010gsa.2_Intron	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8							cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					ATGTGGCTCTTATGGCTCCTTG	0.663													5	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467584	1467585	+	Intron	DEL	TT	-	-			TCGA-C5-A1MJ-01	TCGA-C5-A1MJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467584_1467585delTT	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tctttctttctttttctttctt	0.045													6	4	---	---	---	---	
