Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PLEKHN1	84069	broad.mit.edu	37	1	907763	907764	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:907763_907764insCC	uc001ace.2	+	9	1152_1153	c.1117_1118insCC	c.(1117-1119)GCCfs	p.A373fs	PLEKHN1_uc001acd.2_Frame_Shift_Ins_p.A321fs|PLEKHN1_uc001acf.2_Frame_Shift_Ins_p.A333fs	NM_032129	NP_115505	Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N	373											0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20200621	20200623	+	IGR	DEL	CAC	-	-	rs144954291		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200621_20200623delCAC								RNF186 (58850 upstream) : OTUD3 (8265 downstream)																																			---	---	---	---
CDCA8	55143	broad.mit.edu	37	1	38171451	38171458	+	Intron	DEL	TGTTTTTT	-	-	rs138530458		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38171451_38171458delTGTTTTTT	uc001cbr.2	+						CDCA8_uc001cbs.2_Intron	NM_018101	NP_060571			cell division cycle associated 8						cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
FNDC7	163479	broad.mit.edu	37	1	109275558	109275558	+	Intron	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109275558delT	uc001dvx.2	+						FNDC7_uc010ova.1_Intron	NM_001144937	NP_001138409			fibronectin type III domain containing 7							extracellular region				ovary(1)|skin(1)	2		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)														---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177250856	177250857	+	3'UTR	DEL	AC	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250856_177250857delAC	uc001glf.2	+	8					FAM5B_uc001glg.2_3'UTR	NM_021165	NP_066988			family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
THADA	63892	broad.mit.edu	37	2	43808704	43808704	+	Intron	DEL	A	-	-	rs74506936		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43808704delA	uc002rsw.3	-						THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc002rsz.2_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Intron|THADA_uc002rtc.3_Intron|THADA_uc002rtd.2_Intron	NM_001083953	NP_001077422			thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)																---	---	---	---
NEB	4703	broad.mit.edu	37	2	152518497	152518497	+	Intron	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152518497delT	uc010fnx.2	-							NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179470523	179470524	+	Intron	INS	-	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179470523_179470524insA	uc010zfg.1	-						uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869			titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179578136	179578137	+	Intron	INS	-	AAAC	AAAC			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179578136_179578137insAAAC	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869			titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
C2orf80	389073	broad.mit.edu	37	2	209036457	209036458	+	Intron	INS	-	CCACTCCAT	CCACTCCAT	rs149518601	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209036457_209036458insCCACTCCAT	uc002vcr.2	-							NM_001099334	NP_001092804			hypothetical protein LOC389073											skin(1)	1																		---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225719571	225719572	+	Intron	INS	-	CCAA	CCAA	rs149704568	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225719571_225719572insCCAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
NFKBIZ	64332	broad.mit.edu	37	3	101574898	101574899	+	Intron	INS	-	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101574898_101574899insT	uc003dvp.2	+						NFKBIZ_uc003dvo.2_Intron|NFKBIZ_uc010hpo.2_Intron|NFKBIZ_uc003dvq.2_Intron	NM_031419	NP_113607			nuclear factor of kappa light polypeptide gene						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2																		---	---	---	---
MORC1	27136	broad.mit.edu	37	3	108819089	108819090	+	Intron	INS	-	A	A	rs75347730		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108819089_108819090insA	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244			MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8																		---	---	---	---
BBS7	55212	broad.mit.edu	37	4	122768876	122768876	+	Intron	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122768876delT	uc003ied.2	-						BBS7_uc003iee.1_Intron	NM_176824	NP_789794			Bardet-Biedl syndrome 7 protein isoform a						cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1														Bardet-Biedl_syndrome				---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147438036	147438037	+	Intron	INS	-	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147438036_147438037insA	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron|SLC10A7_uc003ikt.2_Intron|SLC10A7_uc003iku.3_Intron	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
GIN1	54826	broad.mit.edu	37	5	102432045	102432045	+	Intron	DEL	A	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102432045delA	uc003koa.1	-						GIN1_uc003kob.1_Intron|GIN1_uc003koc.1_Intron	NM_017676	NP_060146			zinc finger, H2C2 domain containing						DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)														---	---	---	---
CNOT8	9337	broad.mit.edu	37	5	154251142	154251142	+	Intron	DEL	G	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154251142delG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770			CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)										Direct_reversal_of_damage					---	---	---	---
Unknown	0	broad.mit.edu	37	6	41275845	41275845	+	IGR	DEL	T	-	-	rs71702533		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41275845delT								TREM1 (21388 upstream) : NCR2 (27683 downstream)																																			---	---	---	---
FAM162B	221303	broad.mit.edu	37	6	117082917	117082918	+	Intron	DEL	AT	-	-	rs73765851		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117082917_117082918delAT	uc003pxi.2	-							NM_001085480	NP_001078949			hypothetical protein LOC221303							integral to membrane					0																		---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123786032	123786033	+	Intron	INS	-	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123786032_123786033insA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Frame_Shift_Ins_p.S297fs|uc003pzm.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
UBN2	254048	broad.mit.edu	37	7	138978319	138978319	+	Intron	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138978319delT	uc011kqr.1	+							NM_173569	NP_775840			ubinuclein 2											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	152144400	152144400	+	IGR	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152144400delT								FABP5L3 (4302 upstream) : LOC100128822 (16809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	100463030	100463030	+	IGR	DEL	G	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100463030delG								XPA (3339 upstream) : FOXE1 (152507 downstream)																																			---	---	---	---
FBXW5	54461	broad.mit.edu	37	9	139837701	139837701	+	Intron	DEL	C	-	-	rs11339872		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139837701delC	uc004cjx.2	-						FBXW5_uc010nbx.2_5'Flank|FBXW5_uc004cjy.2_Intron|FBXW5_uc004cjz.2_Intron|C8G_uc004cka.2_5'Flank	NM_018998	NP_061871			F-box and WD repeat domain containing 5								catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)														---	---	---	---
DNAJC1	64215	broad.mit.edu	37	10	22193337	22193337	+	Intron	DEL	A	-	-	rs77439330		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22193337delA	uc001irc.2	-						DNAJC1_uc001ird.2_Intron	NM_022365	NP_071760			DnaJ (Hsp40) homolog, subfamily C, member 1						negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)																---	---	---	---
ARMC4	55130	broad.mit.edu	37	10	28149387	28149387	+	Intron	DEL	A	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28149387delA	uc009xky.2	-						ARMC4_uc010qds.1_Intron|ARMC4_uc010qdt.1_Intron|ARMC4_uc001itz.2_Intron	NM_018076	NP_060546			armadillo repeat containing 4								binding			ovary(4)|skin(2)	6																		---	---	---	---
PIK3AP1	118788	broad.mit.edu	37	10	98380759	98380759	+	Intron	DEL	C	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98380759delC	uc001kmq.2	-						PIK3AP1_uc001kmo.2_Intron|PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522			phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)														---	---	---	---
LBX1	10660	broad.mit.edu	37	10	102986827	102986828	+	3'UTR	INS	-	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102986827_102986828insG	uc001ksx.2	-	2					uc010qpy.1_5'Flank	NM_006562	NP_006553			ladybird homeobox 1						muscle organ development		sequence-specific DNA binding				0		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)														---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83585289	83585290	+	Intron	INS	-	GGAAGGAAGGAAGGAGAGAGGGAA	GGAAGGAAGGAAGGAGAGAGGGAA	rs144508115	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83585289_83585290insGGAAGGAAGGAAGGAGAGAGGGAA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
EI24	9538	broad.mit.edu	37	11	125448376	125448376	+	Intron	DEL	C	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125448376delC	uc001qca.2	+						EI24_uc001qcb.2_Intron|EI24_uc010sbd.1_Intron|EI24_uc009zbl.2_Intron|EI24_uc001qcc.2_Intron|EI24_uc010sbe.1_Intron|EI24_uc010sbf.1_Intron	NM_004879	NP_004870			etoposide induced 2.4 isoform 1						apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	69594093	69594102	+	IGR	DEL	AGAAAGAGAT	-	-	rs80081772		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594093_69594102delAGAAAGAGAT								CPM (237073 upstream) : CPSF6 (39215 downstream)																																			---	---	---	---
OLFM4	10562	broad.mit.edu	37	13	53624990	53624991	+	3'UTR	DEL	TA	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53624990_53624991delTA	uc001vhl.2	+	5					OLFM4_uc001vhk.1_3'UTR	NM_006418	NP_006409			olfactomedin 4 precursor						cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)														---	---	---	---
BNIP2	663	broad.mit.edu	37	15	59974853	59974856	+	Intron	DEL	TTTT	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59974853_59974856delTTTT	uc010uhc.1	-						BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321			BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1																		---	---	---	---
IQCK	124152	broad.mit.edu	37	16	19830814	19830814	+	Intron	DEL	A	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19830814delA	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940			IQ motif containing K											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	55819508	55819508	+	IGR	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55819508delT								CES4 (10684 upstream) : CES1 (17258 downstream)																																			---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81253526	81253527	+	Intron	INS	-	TTATT	TTATT	rs141224532	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81253526_81253527insTTATT	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	65042306	65042307	+	IGR	INS	-	T	T	rs75002100		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042306_65042307insT								CDH19 (771090 upstream) : DSEL (131512 downstream)																																			---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5218213	5218214	+	Intron	INS	-	A	A	rs149426302		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5218213_5218214insA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841			protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
ANKRD27	84079	broad.mit.edu	37	19	33134791	33134791	+	Intron	DEL	C	-	-	rs259227	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33134791delC	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515			ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)																	---	---	---	---
IRGQ	126298	broad.mit.edu	37	19	44098825	44098825	+	Intron	DEL	A	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44098825delA	uc002oww.2	-						IRGQ_uc010eiv.2_Intron|ZNF576_uc002owy.2_5'Flank|ZNF576_uc002owz.2_5'Flank|SRRM5_uc002oxb.2_5'Flank	NM_001007561	NP_001007562			immunity-related GTPase family, Q								protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)																---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50909217	50909218	+	Intron	DEL	CT	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50909217_50909218delCT	uc002psb.3	+						POLD1_uc002psc.3_Intron|POLD1_uc010enx.2_Intron|POLD1_uc010eny.2_Intron	NM_002691	NP_002682			DNA-directed DNA polymerase delta 1						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
RBCK1	10616	broad.mit.edu	37	20	391382	391384	+	Intron	DEL	AAT	-	-	rs10611249		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:391382_391384delAAT	uc002wdp.3	+						RBCK1_uc010zpl.1_Intron|RBCK1_uc010zpm.1_Intron|RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_Intron|RBCK1_uc002wdr.3_Intron|RBCK1_uc002wdo.2_RNA	NM_031229	NP_112506			RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)																---	---	---	---
SLC2A10	81031	broad.mit.edu	37	20	45353514	45353515	+	Intron	INS	-	GGATGGAT	GGATGGAT	rs139655963	by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45353514_45353515insGGATGGAT	uc002xsl.2	+							NM_030777	NP_110404			solute carrier family 2 member 10							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	16419352	16419352	+	IGR	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16419352delT								POTEH (131415 upstream) : OR11H1 (29474 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
TAB1	10454	broad.mit.edu	37	22	39815792	39815792	+	Intron	DEL	A	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39815792delA	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_Intron|TAB1_uc003axu.1_Intron	NM_006116	NP_006107			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	3442824	3442829	+	IGR	DEL	CATCAT	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3442824_3442829delCATCAT								MXRA5 (178140 upstream) : PRKX (79584 downstream)																																			---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53652829	53652852	+	Intron	DEL	GCCGGGGCCGGGGCCGGGGCCGGT	-	-	rs78801842	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652829_53652852delGCCGGGGCCGGGGCCGGGGCCGGT	uc004dsp.2	-							NM_031407	NP_113584			HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
ODZ1	10178	broad.mit.edu	37	X	123663987	123663987	+	Intron	DEL	T	-	-			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123663987delT	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068			odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23																		---	---	---	---
CPSF3L	54973	broad.mit.edu	37	1	1249187	1249187	+	Silent	SNP	G	A	A	rs12142199	byFrequency;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1249187G>A	uc001aee.1	-	9	940	c.882C>T	c.(880-882)TTC>TTT	p.F294F	CPSF3L_uc009vjy.1_RNA|CPSF3L_uc001aef.1_Silent_p.F300F|CPSF3L_uc009vjz.1_Silent_p.F272F|CPSF3L_uc010nyj.1_Silent_p.F265F|CPSF3L_uc001aeg.1_Silent_p.F170F|CPSF3L_uc001aeh.1_Silent_p.F193F|CPSF3L_uc001aei.1_Silent_p.F196F|CPSF3L_uc001aej.1_Silent_p.F121F|CPSF3L_uc001aek.1_Silent_p.F36F	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	294						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22211060	22211060	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22211060G>T	uc001bfj.2	-	13	1655	c.1615C>A	c.(1615-1617)CAG>AAG	p.Q539K	HSPG2_uc009vqd.2_Missense_Mutation_p.Q540K	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	539	Laminin IV type A 1.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
S100PBP	64766	broad.mit.edu	37	1	33291908	33291908	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33291908G>A	uc001bvz.2	+	3	485	c.208G>A	c.(208-210)GAG>AAG	p.E70K	S100PBP_uc001bwa.1_Missense_Mutation_p.E70K|S100PBP_uc001bwb.1_Missense_Mutation_p.E70K|S100PBP_uc001bwc.2_Missense_Mutation_p.E70K|S100PBP_uc001bwd.2_RNA	NM_022753	NP_073590	Q96BU1	S1PBP_HUMAN	S100P binding protein isoform a	70						nucleus	calcium-dependent protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)																---	---	---	---
STK40	83931	broad.mit.edu	37	1	36807526	36807526	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36807526G>A	uc001cak.1	-	12	1545	c.1138C>T	c.(1138-1140)CGT>TGT	p.R380C	STK40_uc001cal.1_Missense_Mutation_p.R385C|STK40_uc001cam.1_Missense_Mutation_p.R380C|STK40_uc009vva.1_3'UTR|STK40_uc001can.1_3'UTR	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	380						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)																---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54059815	54059815	+	Missense_Mutation	SNP	C	T	T	rs145199173		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54059815C>T	uc001cvr.1	-	3	1328	c.761G>A	c.(760-762)CGA>CAA	p.R254Q		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	254	C2H2-type 2; atypical.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
DIRAS3	9077	broad.mit.edu	37	1	68512693	68512693	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68512693G>A	uc001ded.2	-	2	583	c.288C>T	c.(286-288)GAC>GAT	p.D96D	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	96					regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70397227	70397227	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70397227C>T	uc001dep.2	+	6	601	c.571C>T	c.(571-573)CTA>TTA	p.L191L	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	191	LRR 8.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75685560	75685560	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75685560G>C	uc001dgu.2	-	15	1247	c.1103C>G	c.(1102-1104)CCT>CGT	p.P368R	SLC44A5_uc001dgt.2_Missense_Mutation_p.P368R|SLC44A5_uc001dgs.2_Missense_Mutation_p.P326R|SLC44A5_uc001dgr.2_Missense_Mutation_p.P326R|SLC44A5_uc010oqz.1_Missense_Mutation_p.P407R|SLC44A5_uc010ora.1_Missense_Mutation_p.P362R|SLC44A5_uc010orb.1_Missense_Mutation_p.P238R	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	368	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79386012	79386012	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79386012C>T	uc001diq.3	-	10	1473	c.1317G>A	c.(1315-1317)CTG>CTA	p.L439L		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	439	Helical; Name=1; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108152584	108152584	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108152584G>A	uc001dvk.1	-	22	2038	c.1984C>T	c.(1984-1986)CCC>TCC	p.P662S	VAV3_uc010ouu.1_Missense_Mutation_p.P66S|VAV3_uc001dvj.1_Missense_Mutation_p.P102S|VAV3_uc010ouv.1_Missense_Mutation_p.P66S|VAV3_uc010ouw.1_Missense_Mutation_p.P662S	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	662					angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
TTF2	8458	broad.mit.edu	37	1	117618400	117618400	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117618400C>T	uc001egy.2	+	5	1214	c.1194C>T	c.(1192-1194)GCC>GCT	p.A398A	TTF2_uc001egx.1_Silent_p.A398A	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	398					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)														---	---	---	---
DENND4B	9909	broad.mit.edu	37	1	153914789	153914789	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153914789C>T	uc001fdd.1	-	5	1085	c.684G>A	c.(682-684)CCG>CCA	p.P228P		NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	228	UDENN.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
CD5L	922	broad.mit.edu	37	1	157803082	157803082	+	Silent	SNP	A	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157803082A>T	uc001frk.3	-	5	1082	c.939T>A	c.(937-939)GTT>GTA	p.V313V		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	313	SRCR 3.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)															---	---	---	---
DUSP27	92235	broad.mit.edu	37	1	167095080	167095080	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095080G>A	uc001geb.1	+	5	712	c.712G>A	c.(712-714)GCC>ACC	p.A238T		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	238	Tyrosine-protein phosphatase.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3																		---	---	---	---
TIPRL	261726	broad.mit.edu	37	1	168169139	168169139	+	Splice_Site	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168169139A>G	uc001gfg.2	+	7	821	c.676_splice	c.e7-2	p.H226_splice	TIPRL_uc001gfh.2_Splice_Site_p.T227_splice	NM_152902	NP_690866			TIP41, TOR signalling pathway regulator-like						DNA damage checkpoint|negative regulation of protein phosphatase type 2A activity	cytoplasm	protein binding			ovary(1)	1	all_hematologic(923;0.215)																	---	---	---	---
CEP350	9857	broad.mit.edu	37	1	179989418	179989418	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179989418A>C	uc001gnt.2	+	12	2892	c.2509A>C	c.(2509-2511)AGC>CGC	p.S837R	CEP350_uc009wxl.2_Missense_Mutation_p.S836R|CEP350_uc001gnu.2_Missense_Mutation_p.S671R	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	837						centrosome|nucleus|spindle				ovary(4)	4																		---	---	---	---
ASPM	259266	broad.mit.edu	37	1	197112225	197112225	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197112225G>A	uc001gtu.2	-	3	1414	c.1157C>T	c.(1156-1158)TCA>TTA	p.S386L	ASPM_uc001gtv.2_Missense_Mutation_p.S386L|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	386					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---
LAMB3	3914	broad.mit.edu	37	1	209804029	209804029	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209804029G>A	uc001hhg.2	-	8	1264	c.874C>T	c.(874-876)CGC>TGC	p.R292C	LAMB3_uc009xco.2_Missense_Mutation_p.R292C|LAMB3_uc001hhh.2_Missense_Mutation_p.R292C|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Missense_Mutation_p.R228C	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	292	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)														---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24949571	24949571	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24949571G>A	uc002rfk.2	+	13	2971	c.2713G>A	c.(2713-2715)GAA>AAA	p.E905K	NCOA1_uc010eye.2_Missense_Mutation_p.E905K|NCOA1_uc002rfi.2_Missense_Mutation_p.E754K|NCOA1_uc002rfj.2_Missense_Mutation_p.E905K|NCOA1_uc002rfl.2_Missense_Mutation_p.E905K	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	905	Interaction with CREBBP.								PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
PPM1B	5495	broad.mit.edu	37	2	44428441	44428441	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44428441G>C	uc002rtt.2	+	2	531	c.103G>C	c.(103-105)GAA>CAA	p.E35Q	PPM1B_uc002rts.2_Missense_Mutation_p.E35Q|PPM1B_uc002rtu.2_Missense_Mutation_p.E35Q|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.E35Q|PPM1B_uc002rtx.2_Missense_Mutation_p.E35Q	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	35					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
FER1L5	90342	broad.mit.edu	37	2	97370354	97370354	+	Silent	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97370354T>C	uc010fia.2	+	52	6207	c.6207T>C	c.(6205-6207)CAT>CAC	p.H2069H	FER1L5_uc002sws.3_Silent_p.H778H|FER1L5_uc002swt.3_Silent_p.H778H|FER1L5_uc010yus.1_Silent_p.H777H	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	2069						integral to membrane				ovary(1)	1																		---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100912008	100912008	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100912008G>T	uc002tal.3	-	8	2124	c.1484C>A	c.(1483-1485)GCA>GAA	p.A495E	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	495					proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
GCC2	9648	broad.mit.edu	37	2	109087107	109087107	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109087107A>G	uc002tec.2	+	6	1476	c.1322A>G	c.(1321-1323)AAT>AGT	p.N441S	GCC2_uc002ted.2_Missense_Mutation_p.N340S	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	441	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116538567	116538567	+	Silent	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116538567T>C	uc002tla.1	+	16	1936	c.1479T>C	c.(1477-1479)TGT>TGC	p.C493C	DPP10_uc002tlb.1_Silent_p.C443C|DPP10_uc002tlc.1_Silent_p.C489C|DPP10_uc002tle.2_Silent_p.C497C|DPP10_uc002tlf.1_Silent_p.C486C	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	493	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
KCNJ3	3760	broad.mit.edu	37	2	155566118	155566118	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155566118C>T	uc002tyv.1	+	2	901	c.706C>T	c.(706-708)CGG>TGG	p.R236W	KCNJ3_uc010zce.1_Intron	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	236	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)													---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166799845	166799845	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166799845C>T	uc002udk.2	-	5	569	c.436G>A	c.(436-438)GTT>ATT	p.V146I	TTC21B_uc002udl.2_Missense_Mutation_p.V146I|uc002udm.1_Intron	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	146	TPR 2.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
SCN1A	6323	broad.mit.edu	37	2	166847826	166847826	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166847826C>T	uc010zcz.1	-	26	5944	c.5926G>A	c.(5926-5928)GAC>AAC	p.D1976N		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1987						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168100087	168100087	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168100087G>T	uc002udx.2	+	8	2203	c.2185G>T	c.(2185-2187)GTT>TTT	p.V729F	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.V554F|XIRP2_uc010fpq.2_Missense_Mutation_p.V507F|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	554	Xin 6.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179482993	179482993	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179482993C>T	uc010zfg.1	-	201	39712	c.39488G>A	c.(39487-39489)CGT>CAT	p.R13163H	TTN_uc010zfh.1_Missense_Mutation_p.R6858H|TTN_uc010zfi.1_Missense_Mutation_p.R6791H|TTN_uc010zfj.1_Missense_Mutation_p.R6666H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14090							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ADAM23	8745	broad.mit.edu	37	2	207429756	207429756	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207429756C>A	uc002vbq.2	+	14	1581	c.1358C>A	c.(1357-1359)ACA>AAA	p.T453K	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	453	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)														---	---	---	---
OXSM	54995	broad.mit.edu	37	3	25833434	25833434	+	Nonsense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25833434C>G	uc003cdn.2	+	2	1030	c.923C>G	c.(922-924)TCA>TGA	p.S308*	NGLY1_uc011awo.1_5'Flank|OXSM_uc011awp.1_Nonsense_Mutation_p.S33*|OXSM_uc010hfh.2_Intron	NM_017897	NP_060367	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial isoform 1	308					acyl-CoA metabolic process|medium-chain fatty acid biosynthetic process|short-chain fatty acid biosynthetic process	mitochondrion	3-oxoacyl-[acyl-carrier-protein] synthase activity			ovary(1)|breast(1)	2																		---	---	---	---
ITGA9	3680	broad.mit.edu	37	3	37845379	37845379	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37845379C>T	uc003chd.2	+	27	3008	c.2955C>T	c.(2953-2955)ATC>ATT	p.I985I		NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	985	Helical; (Potential).				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)														---	---	---	---
CCDC13	152206	broad.mit.edu	37	3	42788762	42788762	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42788762C>T	uc003cly.3	-	6	791	c.707G>A	c.(706-708)CGG>CAG	p.R236Q	CCDC13_uc003clz.2_Missense_Mutation_p.R236Q|CCDC13_uc011azq.1_3'UTR	NM_144719	NP_653320	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	236	Potential.									ovary(1)	1																		---	---	---	---
CXCR6	10663	broad.mit.edu	37	3	45988608	45988608	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45988608C>T	uc003cpc.1	+	2	716	c.635C>T	c.(634-636)TCA>TTA	p.S212L	FYCO1_uc003cpb.3_Intron|FYCO1_uc011bal.1_Intron|CXCR6_uc010hix.1_Missense_Mutation_p.S212L	NM_006564	NP_006555	O00574	CXCR6_HUMAN	G protein-coupled receptor TYMSTR	212	Helical; Name=5; (Potential).				viral genome replication	integral to plasma membrane	coreceptor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)														---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47378200	47378200	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47378200G>A	uc003crd.2	+	7	1200	c.1074G>A	c.(1072-1074)CCG>CCA	p.P358P	KLHL18_uc003crc.2_Silent_p.P358P|KLHL18_uc011bav.1_Silent_p.P246P|KLHL18_uc010hjq.1_Silent_p.P214P	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	358	Kelch 2.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
MAP4	4134	broad.mit.edu	37	3	47913507	47913507	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47913507C>A	uc003csb.2	-	11	2932	c.2406G>T	c.(2404-2406)AAG>AAT	p.K802N	MAP4_uc003csc.3_Missense_Mutation_p.K802N|MAP4_uc003crw.2_5'Flank|MAP4_uc003crx.2_Missense_Mutation_p.K62N|MAP4_uc011bbe.1_Missense_Mutation_p.K553N|MAP4_uc003cry.2_Missense_Mutation_p.K537N|MAP4_uc003csa.3_Missense_Mutation_p.K537N|MAP4_uc003crz.3_RNA|MAP4_uc003csd.2_Missense_Mutation_p.K537N	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1	802					negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)														---	---	---	---
C3orf63	23272	broad.mit.edu	37	3	56657367	56657367	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56657367T>C	uc003did.3	-	23	4629	c.4528A>G	c.(4528-4530)AGA>GGA	p.R1510G	C3orf63_uc003dib.3_Missense_Mutation_p.R629G|C3orf63_uc003dic.3_Missense_Mutation_p.R1134G|C3orf63_uc003die.3_3'UTR	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	1571										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)														---	---	---	---
IL17RD	54756	broad.mit.edu	37	3	57131679	57131679	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57131679C>T	uc003dil.2	-	12	2141	c.2052G>A	c.(2050-2052)ACG>ACA	p.T684T	IL17RD_uc003dik.2_Silent_p.T660T|IL17RD_uc010hna.2_Silent_p.T540T|IL17RD_uc011bex.1_Silent_p.T540T	NM_017563	NP_060033	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D precursor	684	Cytoplasmic (Potential).					Golgi membrane|integral to membrane|plasma membrane	receptor activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)														---	---	---	---
PROS1	5627	broad.mit.edu	37	3	93646135	93646135	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93646135T>C	uc003drb.3	-	2	534	c.193A>G	c.(193-195)AAA>GAA	p.K65E	PROS1_uc010hoo.2_Translation_Start_Site|PROS1_uc003dqz.3_Translation_Start_Site	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	65	Gla.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)													---	---	---	---
OR5H1	26341	broad.mit.edu	37	3	97851811	97851811	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851811G>A	uc011bgt.1	+	1	270	c.270G>A	c.(268-270)AAG>AAA	p.K90K		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2																		---	---	---	---
GOLGB1	2804	broad.mit.edu	37	3	121448741	121448741	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121448741G>A	uc003eei.3	-	3	346	c.220C>T	c.(220-222)CAA>TAA	p.Q74*	GOLGB1_uc010hrc.2_Nonsense_Mutation_p.Q74*|GOLGB1_uc003eej.3_Nonsense_Mutation_p.Q35*|GOLGB1_uc011bjm.1_Nonsense_Mutation_p.Q35*|GOLGB1_uc010hrd.1_Nonsense_Mutation_p.Q74*	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	74	Potential.|Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)														---	---	---	---
ACPP	55	broad.mit.edu	37	3	132075578	132075578	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132075578G>A	uc010htp.2	+	10	1107	c.1017G>A	c.(1015-1017)CCG>CCA	p.P339P	ACPP_uc003eon.3_Silent_p.P306P|ACPP_uc003eop.3_Silent_p.P339P	NM_001099	NP_001090	P15309	PPAP_HUMAN	acid phosphatase, prostate short isoform	339						extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134851754	134851754	+	Missense_Mutation	SNP	C	T	T	rs56396912		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134851754C>T	uc003eqt.2	+	5	1380	c.1160C>T	c.(1159-1161)ACG>ATG	p.T387M	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_3'UTR|EPHB1_uc003equ.2_Translation_Start_Site	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	387	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	p.T387M(4)|p.T387T(1)		lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173322864	173322864	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173322864A>G	uc003fio.1	+	3	899	c.476A>G	c.(475-477)TAT>TGT	p.Y159C	NLGN1_uc010hww.1_Missense_Mutation_p.Y159C|NLGN1_uc003fip.1_Missense_Mutation_p.Y159C	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	159	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
MAP3K13	9175	broad.mit.edu	37	3	185169161	185169161	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185169161A>G	uc010hyf.2	+	8	1522	c.1256A>G	c.(1255-1257)CAA>CGA	p.Q419R	MAP3K13_uc011brt.1_Missense_Mutation_p.Q212R|MAP3K13_uc003fph.3_Missense_Mutation_p.Q187R|MAP3K13_uc011bru.1_Missense_Mutation_p.Q275R|MAP3K13_uc003fpi.2_Missense_Mutation_p.Q419R|MAP3K13_uc010hyg.2_Missense_Mutation_p.Q109R	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	419					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)															---	---	---	---
SPON2	10417	broad.mit.edu	37	4	1165840	1165840	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1165840G>A	uc003gcn.3	-	1	47	c.20C>T	c.(19-21)GCC>GTC	p.A7V	SPON2_uc003gco.3_Missense_Mutation_p.A7V|SPON2_uc010ibr.2_Missense_Mutation_p.A7V|SPON2_uc003gcm.1_5'Flank	NM_012445	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	7					axon guidance|cell adhesion|innate immune response	proteinaceous extracellular matrix	metal ion binding			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)														---	---	---	---
POLN	353497	broad.mit.edu	37	4	2200309	2200309	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2200309G>C	uc003ger.2	-	4	850	c.850C>G	c.(850-852)CAA>GAA	p.Q284E	POLN_uc010ich.1_5'UTR|POLN_uc011bvi.1_Missense_Mutation_p.Q284E	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	284					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
LAP3	51056	broad.mit.edu	37	4	17609194	17609194	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17609194C>T	uc003gph.1	+	13	1704	c.1542C>T	c.(1540-1542)TTC>TTT	p.F514F		NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3	514					proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0																		---	---	---	---
NCAPG	64151	broad.mit.edu	37	4	17814759	17814759	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17814759G>C	uc003gpp.2	+	3	711	c.535G>C	c.(535-537)GTG>CTG	p.V179L	NCAPG_uc011bxj.1_5'UTR|DCAF16_uc003gpn.2_5'Flank	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	179	HEAT 3.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)														---	---	---	---
PCDH7	5099	broad.mit.edu	37	4	31144151	31144151	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31144151G>A	uc011bxx.1	+	3	4432	c.3424G>A	c.(3424-3426)GAG>AAG	p.E1142K	PCDH7_uc011bxw.1_Missense_Mutation_p.E1095K	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	Error:Variant_position_missing_in_O60245_after_alignment					homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4																		---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36069743	36069743	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36069743T>G	uc003gsq.1	-	33	5239	c.4901A>C	c.(4900-4902)AAC>ACC	p.N1634T	ARAP2_uc003gso.2_Intron	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1634					regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
WDR19	57728	broad.mit.edu	37	4	39269633	39269633	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39269633C>T	uc003gtv.2	+	30	3434	c.3280C>T	c.(3280-3282)CGC>TGC	p.R1094C	WDR19_uc011byi.1_Missense_Mutation_p.R934C|WDR19_uc003gtw.1_Missense_Mutation_p.R691C	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1094					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1																		---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66467877	66467877	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66467877T>G	uc003hcy.2	-	3	585	c.392A>C	c.(391-393)AAA>ACA	p.K131T	EPHA5_uc003hcx.2_Missense_Mutation_p.K62T|EPHA5_uc003hcz.2_Missense_Mutation_p.K131T|EPHA5_uc011cah.1_Missense_Mutation_p.K131T|EPHA5_uc011cai.1_Missense_Mutation_p.K131T|EPHA5_uc003hda.2_Missense_Mutation_p.K131T	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	131	Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
SDAD1	55153	broad.mit.edu	37	4	76902521	76902521	+	Intron	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76902521C>T	uc003hje.3	-						SDAD1_uc003hjf.3_Intron|SDAD1_uc011cbr.1_Intron	NM_018115	NP_060585			SDA1 domain containing 1						protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
BMP2K	55589	broad.mit.edu	37	4	79793071	79793071	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79793071C>T	uc003hlk.2	+	12	1743	c.1577C>T	c.(1576-1578)CCA>CTA	p.P526L	BMP2K_uc003hlj.2_Missense_Mutation_p.P526L|BMP2K_uc003hll.2_5'Flank	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	526	Gln/His-rich.					nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1																		---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96127903	96127903	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96127903C>A	uc003htp.1	-	11	1932	c.1778G>T	c.(1777-1779)AGC>ATC	p.S593I	UNC5C_uc010ilc.1_Missense_Mutation_p.S612I	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	593	Cytoplasmic (Potential).|ZU5.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)														---	---	---	---
MFAP3L	9848	broad.mit.edu	37	4	170913336	170913336	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170913336G>A	uc003isp.3	-	3	601	c.423C>T	c.(421-423)CGC>CGT	p.R141R	MFAP3L_uc003isn.3_Silent_p.R38R	NM_021647	NP_067679	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like isoform	141	Extracellular (Potential).|Ig-like C2-type.					integral to membrane|plasma membrane				ovary(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)														---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183696162	183696162	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183696162G>A	uc003ivd.1	+	23	5197	c.5160G>A	c.(5158-5160)CCG>CCA	p.P1720P		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1720	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
TERT	7015	broad.mit.edu	37	5	1264673	1264673	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1264673C>T	uc003jcb.1	-	11	2747	c.2689G>A	c.(2689-2691)GTG>ATG	p.V897M	TERT_uc003jbz.1_Missense_Mutation_p.V93M|TERT_uc003jca.1_Missense_Mutation_p.V885M|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	897	Reverse transcriptase.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)											TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				---	---	---	---
KIAA0947	23379	broad.mit.edu	37	5	5461956	5461956	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5461956C>T	uc003jdm.3	+	13	2731	c.2509C>T	c.(2509-2511)CTT>TTT	p.L837F		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	837										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13754330	13754330	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13754330G>A	uc003jfd.2	-	62	10579	c.10537C>T	c.(10537-10539)CAA>TAA	p.Q3513*	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3513					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	32100956	32100956	+	Intron	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32100956C>T	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc003jhn.2_RNA	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
CCNH	902	broad.mit.edu	37	5	86700776	86700776	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86700776C>T	uc003kjb.2	-	5	806	c.574G>A	c.(574-576)GAT>AAT	p.D192N	CCNH_uc003kiy.1_Intron|CCNH_uc003kiz.1_Missense_Mutation_p.D139N|CCNH_uc003kja.2_Missense_Mutation_p.D139N	NM_001239	NP_001230	P51946	CCNH_HUMAN	cyclin H	192					G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cyclin-dependent protein kinase activating kinase holoenzyme complex|holo TFIIH complex	protein kinase binding			ovary(2)|kidney(1)	3		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)									Direct_reversal_of_damage|NER					---	---	---	---
PCDHGA3	56112	broad.mit.edu	37	5	140725213	140725213	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725213G>A	uc003ljm.1	+	1	1613	c.1613G>A	c.(1612-1614)GGG>GAG	p.G538E	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.G298E|PCDHGA3_uc011dap.1_Missense_Mutation_p.G538E	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	538	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA6	56109	broad.mit.edu	37	5	140755983	140755983	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755983C>T	uc003ljy.1	+	1	2333	c.2333C>T	c.(2332-2334)ACG>ATG	p.T778M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.T778M	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	778	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PDGFRB	5159	broad.mit.edu	37	5	149512350	149512350	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149512350C>T	uc003lro.2	-	7	1559	c.1090G>A	c.(1090-1092)GAA>AAA	p.E364K	PDGFRB_uc010jhd.2_Missense_Mutation_p.E203K|PDGFRB_uc011dcg.1_3'UTR	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	364	Ig-like C2-type 4.|Extracellular (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								---	---	---	---
GABRG2	2566	broad.mit.edu	37	5	161576273	161576273	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161576273G>A	uc003lyz.3	+	8	1440	c.1082G>A	c.(1081-1083)AGC>AAC	p.S361N	GABRG2_uc010jjc.2_Missense_Mutation_p.S401N|GABRG2_uc003lyy.3_Missense_Mutation_p.S361N|GABRG2_uc011dej.1_Missense_Mutation_p.S266N	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	361	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)														---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16328031	16328031	+	Missense_Mutation	SNP	G	A	A	rs148032129		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16328031G>A	uc003nbt.2	-	8	1482	c.511C>T	c.(511-513)CGC>TGC	p.R171C	ATXN1_uc010jpi.2_Missense_Mutation_p.R171C|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	171					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38702323	38702323	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38702323G>A	uc003ooe.1	+	3	633	c.33G>A	c.(31-33)CCG>CCA	p.P11P	DNAH8_uc003ood.1_Silent_p.P228P	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8									p.P11P(1)		skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
PGC	5225	broad.mit.edu	37	6	41711094	41711094	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41711094G>A	uc003ora.1	-	4	411	c.362C>T	c.(361-363)TCC>TTC	p.S121F		NM_002630	NP_002621	P20142	PEPC_HUMAN	progastricsin (pepsinogen C) precursor	121					digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)															---	---	---	---
CD164	8763	broad.mit.edu	37	6	109691643	109691643	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109691643G>A	uc003pte.2	-	5	579	c.398C>T	c.(397-399)TCT>TTT	p.S133F	CD164_uc003ptd.2_Missense_Mutation_p.S133F|CD164_uc003ptf.2_Intron|CD164_uc011eap.1_Missense_Mutation_p.S133F|CD164_uc010kdn.2_Missense_Mutation_p.S120F	NM_006016	NP_006007	Q04900	MUC24_HUMAN	CD164 molecule, sialomucin isoform 1	133	Thr-rich.|Extracellular (Potential).				hemopoiesis|heterophilic cell-cell adhesion|immune response|muscle organ development|negative regulation of cell adhesion|negative regulation of cell proliferation|signal transduction	endosome membrane|extracellular region|integral to plasma membrane|lysosomal membrane	protein binding				0		all_cancers(87;4.65e-22)|all_epithelial(87;2.54e-20)|all_lung(197;1.6e-05)|Lung NSC(302;2.92e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.0175)		Epithelial(106;7.83e-46)|all cancers(137;1.15e-45)|OV - Ovarian serous cystadenocarcinoma(136;2.89e-26)|BRCA - Breast invasive adenocarcinoma(108;0.00128)|GBM - Glioblastoma multiforme(226;0.16)														---	---	---	---
EPB41L2	2037	broad.mit.edu	37	6	131191249	131191249	+	Silent	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131191249C>G	uc003qch.2	-	15	2243	c.2061G>C	c.(2059-2061)CTG>CTC	p.L687L	EPB41L2_uc003qce.1_Silent_p.L65L|EPB41L2_uc003qcf.1_Intron|EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Silent_p.L617L|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_Silent_p.L617L|EPB41L2_uc003qcd.1_5'Flank|EPB41L2_uc003qcj.1_Silent_p.L84L	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	687					cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)														---	---	---	---
VTA1	51534	broad.mit.edu	37	6	142539792	142539792	+	3'UTR	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142539792G>A	uc003qiw.2	+	8					VTA1_uc011edt.1_RNA|VTA1_uc011edu.1_3'UTR	NM_016485	NP_057569			Vps20-associated 1 homolog						cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152563502	152563502	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152563502C>G	uc010kiw.2	-	107	20368	c.19766G>C	c.(19765-19767)AGT>ACT	p.S6589T	SYNE1_uc010kiv.2_Missense_Mutation_p.S1113T|SYNE1_uc003qos.3_Missense_Mutation_p.S1113T|SYNE1_uc003qot.3_Missense_Mutation_p.S6518T|SYNE1_uc003qou.3_Missense_Mutation_p.S6589T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6589	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152642497	152642497	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152642497C>T	uc010kiw.2	-	84	16714	c.16112G>A	c.(16111-16113)CGA>CAA	p.R5371Q	SYNE1_uc003qot.3_Missense_Mutation_p.R5300Q|SYNE1_uc003qou.3_Missense_Mutation_p.R5371Q|SYNE1_uc010kiz.2_Missense_Mutation_p.R1126Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5371	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
SUN1	23353	broad.mit.edu	37	7	908977	908977	+	Intron	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:908977T>G	uc011jvp.1	+						GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_Intron|SUN1_uc003sji.2_Intron|SUN1_uc003sjk.2_Intron	NM_001130965	NP_001124437			unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0																		---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	944770	944770	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944770T>G	uc003sjo.3	-	5	604	c.428A>C	c.(427-429)AAC>ACC	p.N143T	ADAP1_uc003sjm.3_5'UTR|ADAP1_uc011jvs.1_Missense_Mutation_p.N48T|ADAP1_uc003sjn.3_Missense_Mutation_p.N71T|ADAP1_uc010ksc.2_Missense_Mutation_p.N71T	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1	143	PH 1.				cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11419331	11419331	+	Silent	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11419331A>G	uc003ssf.3	-	24	4768	c.4516T>C	c.(4516-4518)TTG>CTG	p.L1506L	uc003ssb.2_Intron|THSD7A_uc003ssd.3_Silent_p.L10L	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1506	Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)											HNSCC(18;0.044)			---	---	---	---
MIR1183	100302122	broad.mit.edu	37	7	21510759	21510759	+	RNA	SNP	A	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21510759A>T	hsa-mir-1183|MI0006276	+			c.84A>T			SP4_uc003sva.2_Intron|SP4_uc003svb.2_Intron																	0																		---	---	---	---
HIBADH	11112	broad.mit.edu	37	7	27672037	27672037	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27672037C>T	uc003szf.2	-	3	475	c.280G>A	c.(280-282)GAA>AAA	p.E94K	HIBADH_uc003szg.2_Missense_Mutation_p.E45K|HIBADH_uc003szh.2_5'UTR|HIBADH_uc003szi.2_Missense_Mutation_p.E45K	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor	94					branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)													---	---	---	---
EEPD1	80820	broad.mit.edu	37	7	36194426	36194426	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36194426C>T	uc003tfa.2	+	2	1133	c.493C>T	c.(493-495)CGC>TGC	p.R165C		NM_030636	NP_085139	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family	165					DNA repair		DNA binding				0																		---	---	---	---
C7orf42	55069	broad.mit.edu	37	7	66410149	66410149	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66410149A>G	uc003tvk.2	+	3	610	c.346A>G	c.(346-348)ATC>GTC	p.I116V	C7orf42_uc010lah.2_RNA|C7orf42_uc003tvl.2_Missense_Mutation_p.I116V	NM_017994	NP_060464	Q9NWD8	CG042_HUMAN	hypothetical protein LOC55069	116						integral to membrane				ovary(1)	1																		---	---	---	---
HGF	3082	broad.mit.edu	37	7	81372669	81372669	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81372669C>T	uc003uhl.2	-	7	1030	c.865G>A	c.(865-867)GCT>ACT	p.A289T	HGF_uc003uhm.2_Missense_Mutation_p.A284T|HGF_uc003uhn.1_Missense_Mutation_p.E289K|HGF_uc003uho.1_Missense_Mutation_p.E284K	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	289					epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
MGC26647	219557	broad.mit.edu	37	7	88423644	88423644	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88423644G>A	uc003ujv.2	-	2	795	c.613C>T	c.(613-615)CCT>TCT	p.P205S	ZNF804B_uc011khi.1_Intron	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	hypothetical protein LOC219557	205											0	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		STAD - Stomach adenocarcinoma(171;0.229)															---	---	---	---
AKAP9	10142	broad.mit.edu	37	7	91700267	91700267	+	Missense_Mutation	SNP	T	C	C	rs76177450	byFrequency	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91700267T>C	uc003ulg.2	+	28	6781	c.6556T>C	c.(6556-6558)TCC>CCC	p.S2186P	AKAP9_uc003ulf.2_Missense_Mutation_p.S2178P|AKAP9_uc003uli.2_Missense_Mutation_p.S1809P|AKAP9_uc003ulj.2_5'UTR	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2198	Potential.|Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)					T	BRAF	papillary thyroid								---	---	---	---
CDHR3	222256	broad.mit.edu	37	7	105658403	105658403	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105658403G>C	uc003vdl.3	+	12	1646	c.1538G>C	c.(1537-1539)TGG>TCG	p.W513S	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.W500S|CDHR3_uc011klt.1_Missense_Mutation_p.W425S|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	513	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
PIK3CG	5294	broad.mit.edu	37	7	106508257	106508257	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508257C>T	uc003vdv.3	+	2	336	c.251C>T	c.(250-252)GCG>GTG	p.A84V	PIK3CG_uc003vdu.2_Missense_Mutation_p.A84V|PIK3CG_uc003vdw.2_Missense_Mutation_p.A84V	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	84					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38																		---	---	---	---
TES	26136	broad.mit.edu	37	7	115889214	115889214	+	Missense_Mutation	SNP	C	T	T	rs78197118	byFrequency;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115889214C>T	uc003vho.2	+	3	435	c.254C>T	c.(253-255)CCC>CTC	p.P85L	TES_uc011kmx.1_Missense_Mutation_p.P85L|TES_uc011kmy.1_Intron|TES_uc010lka.1_Missense_Mutation_p.P76L|TES_uc003vhp.2_Missense_Mutation_p.P76L	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	85					negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
IMPDH1	3614	broad.mit.edu	37	7	128038597	128038597	+	Silent	SNP	G	A	A	rs1042253		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128038597G>A	uc011kol.1	-	7	796	c.690C>T	c.(688-690)AAC>AAT	p.N230N	IMPDH1_uc011kom.1_Silent_p.N225N|IMPDH1_uc003vmt.2_Silent_p.N205N|IMPDH1_uc003vmu.2_Silent_p.N315N|IMPDH1_uc003vmw.2_Silent_p.N305N|IMPDH1_uc011kon.1_Silent_p.N282N|IMPDH1_uc003vmv.2_Silent_p.N279N|IMPDH1_uc003vmx.2_Silent_p.N238N|IMPDH1_uc003vmy.2_Silent_p.N246N	NM_001142573	NP_001136045	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform e	230	CBS 2.				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)											OREG0018292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129367210	129367210	+	Intron	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129367210G>C	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
AKR1B10	57016	broad.mit.edu	37	7	134221529	134221529	+	Intron	SNP	A	G	G	rs56272174		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134221529A>G	uc003vrr.2	+							NM_020299	NP_064695			aldo-keto reductase family 1, member B10						cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding			skin(5)	5																		---	---	---	---
C7orf49	78996	broad.mit.edu	37	7	134852517	134852517	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134852517C>T	uc003vsl.2	-	3	447	c.180G>A	c.(178-180)GAG>GAA	p.E60E	C7orf49_uc003vsh.2_Intron|C7orf49_uc003vsj.2_Silent_p.E31E|C7orf49_uc003vsk.2_RNA|C7orf49_uc003vsm.2_RNA|C7orf49_uc003vsn.2_Silent_p.E59E|C7orf49_uc003vso.2_Silent_p.E5E	NM_024033	NP_076938	Q9BWK5	MRI_HUMAN	modulator of retrovirus infection	60						cytoplasm				large_intestine(1)|ovary(1)	2																		---	---	---	---
TAS2R4	50832	broad.mit.edu	37	7	141478883	141478883	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141478883C>A	uc003vwq.1	+	1	595	c.595C>A	c.(595-597)CTA>ATA	p.L199I		NM_016944	NP_058640	Q9NYW5	TA2R4_HUMAN	taste receptor T2R4	199	Cytoplasmic (Potential).				sensory perception of taste	cilium membrane	taste receptor activity				0	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157874021	157874021	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157874021G>A	uc003wno.2	-	11	1813	c.1692C>T	c.(1690-1692)AAC>AAT	p.N564N	PTPRN2_uc003wnp.2_Silent_p.N547N|PTPRN2_uc003wnq.2_Silent_p.N535N|PTPRN2_uc003wnr.2_Silent_p.N526N|PTPRN2_uc011kwa.1_Silent_p.N587N	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	564	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
RP1	6101	broad.mit.edu	37	8	55534700	55534700	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55534700C>T	uc003xsd.1	+	3	787	c.639C>T	c.(637-639)ATC>ATT	p.I213I	RP1_uc011ldy.1_Silent_p.I213I	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	213	Doublecortin 2.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55539117	55539117	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55539117C>T	uc003xsd.1	+	4	2823	c.2675C>T	c.(2674-2676)GCA>GTA	p.A892V	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	892					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
TOX	9760	broad.mit.edu	37	8	59739435	59739435	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59739435C>T	uc003xtw.1	-	6	1172	c.951G>A	c.(949-951)GCG>GCA	p.A317A		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	317	HMG box.					nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61765949	61765949	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765949A>G	uc003xue.2	+	31	7142	c.6665A>G	c.(6664-6666)GAG>GGG	p.E2222G		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2222	Glu-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
GGH	8836	broad.mit.edu	37	8	63930164	63930164	+	Silent	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63930164G>C	uc003xuw.2	-	8	1006	c.723C>G	c.(721-723)GTC>GTG	p.V241V		NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor	241	Gamma-glutamyl hydrolase.				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)													---	---	---	---
MTFR1	9650	broad.mit.edu	37	8	66631645	66631645	+	Missense_Mutation	SNP	G	A	A	rs143063031		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66631645G>A	uc003xvo.1	+	7	1044	c.934G>A	c.(934-936)GTG>ATG	p.V312M	PDE7A_uc003xvq.2_Silent_p.H443H|PDE7A_uc003xvp.2_Silent_p.H417H	NM_014637	NP_055452	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1 isoform 1	Error:Variant_position_missing_in_Q15390_after_alignment						mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)															---	---	---	---
DNAJC5B	85479	broad.mit.edu	37	8	66989024	66989024	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66989024C>T	uc003xvs.1	+	4	540	c.249C>T	c.(247-249)TAC>TAT	p.Y83Y	DNAJC5B_uc003xvt.1_RNA	NM_033105	NP_149096	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	83	J.				protein folding	membrane	heat shock protein binding|unfolded protein binding				0		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)															---	---	---	---
TRIM55	84675	broad.mit.edu	37	8	67049353	67049353	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67049353C>T	uc003xvv.2	+	4	757	c.531C>T	c.(529-531)GCC>GCT	p.A177A	TRIM55_uc003xvu.2_Silent_p.A177A|TRIM55_uc003xvw.2_Silent_p.A177A|TRIM55_uc003xvx.2_Silent_p.A177A	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	177	Potential.					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)															---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72977723	72977723	+	Missense_Mutation	SNP	G	A	A	rs144784837	byFrequency	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72977723G>A	uc003xza.2	-	4	690	c.515C>T	c.(514-516)GCG>GTG	p.A172V		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	172	Cytoplasmic (Potential).|ANK 4.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77765033	77765033	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765033T>G	uc003yav.2	+	10	6128	c.5741T>G	c.(5740-5742)CTT>CGT	p.L1914R	ZFHX4_uc003yau.1_Missense_Mutation_p.L1959R|ZFHX4_uc003yaw.1_Missense_Mutation_p.L1914R	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1914	C2H2-type 14.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85799972	85799972	+	Silent	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85799972G>C	uc003ycq.3	+	9	1235	c.819G>C	c.(817-819)GGG>GGC	p.G273G	RALYL_uc003ycr.3_Silent_p.G273G|RALYL_uc003ycs.3_Silent_p.G273G|RALYL_uc010lzy.2_Silent_p.G262G|RALYL_uc003yct.3_Silent_p.G286G|RALYL_uc003ycu.3_Silent_p.G200G|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	273							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
CA13	377677	broad.mit.edu	37	8	86171655	86171655	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86171655C>T	uc003ydg.2	+	3	583	c.241C>T	c.(241-243)CGT>TGT	p.R81C	CA13_uc003ydf.1_RNA	NM_198584	NP_940986	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	81					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92352728	92352728	+	Silent	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92352728T>C	uc003yex.2	+	9	1253	c.975T>C	c.(973-975)GCT>GCC	p.A325A	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Silent_p.A325A|SLC26A7_uc003yfa.2_Silent_p.A325A	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	325	Helical; (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100133672	100133672	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100133672A>C	uc003yiv.2	+	8	1316	c.1205A>C	c.(1204-1206)AAA>ACA	p.K402T	VPS13B_uc003yiw.2_Missense_Mutation_p.K402T|VPS13B_uc003yit.2_Missense_Mutation_p.K402T|VPS13B_uc003yiu.1_Missense_Mutation_p.K402T|VPS13B_uc003yis.2_Missense_Mutation_p.K402T|VPS13B_uc011lgy.1_Missense_Mutation_p.K278T	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	402					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
ATP6V1C1	528	broad.mit.edu	37	8	104063345	104063345	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104063345G>A	uc003ykz.3	+	5	599	c.354G>A	c.(352-354)CTG>CTA	p.L118L	ATP6V1C1_uc010mbz.2_Silent_p.L43L|ATP6V1C1_uc003yla.2_Silent_p.L118L|ATP6V1C1_uc011lhl.1_Silent_p.L43L	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	118					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)															---	---	---	---
KCNK9	51305	broad.mit.edu	37	8	140630698	140630698	+	Missense_Mutation	SNP	G	A	A	rs145490321		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630698G>A	uc003yvf.1	-	2	992	c.928C>T	c.(928-930)CGC>TGC	p.R310C	KCNK9_uc003yvg.1_Missense_Mutation_p.R310C|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	310	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)															---	---	---	---
OR13C4	138804	broad.mit.edu	37	9	107289090	107289090	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107289090A>G	uc011lvn.1	-	1	401	c.401T>C	c.(400-402)ATC>ACC	p.I134T		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	134	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
OR13D1	286365	broad.mit.edu	37	9	107457263	107457263	+	Silent	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107457263C>A	uc011lvs.1	+	1	561	c.561C>A	c.(559-561)ACC>ACA	p.T187T		NM_001004484	NP_001004484	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D,	187	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
KIAA0368	23392	broad.mit.edu	37	9	114128912	114128912	+	Intron	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114128912G>T	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0																		---	---	---	---
KIAA0368	23392	broad.mit.edu	37	9	114148718	114148718	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114148718C>G	uc004bfe.1	-	33	4000	c.4000G>C	c.(4000-4002)GAA>CAA	p.E1334Q		NM_001080398	NP_001073867			KIAA0368 protein												0																		---	---	---	---
ST6GALNAC6	30815	broad.mit.edu	37	9	130648957	130648957	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130648957C>T	uc004bso.1	-	7	1042	c.923G>A	c.(922-924)CGC>CAC	p.R308H	ST6GALNAC6_uc004bsn.1_Missense_Mutation_p.R274H|ST6GALNAC6_uc011man.1_Missense_Mutation_p.R108H|ST6GALNAC6_uc004bsp.1_Missense_Mutation_p.A307T|ST6GALNAC6_uc004bsq.1_Missense_Mutation_p.R274H|ST6GALNAC6_uc004bsr.2_Missense_Mutation_p.R274H|ST6GALNAC6_uc010mxp.1_RNA	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN	sialytransferase 7F	308	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane|plasma membrane					0																		---	---	---	---
SURF2	6835	broad.mit.edu	37	9	136227269	136227269	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136227269G>A	uc004cdi.2	+	5	694	c.646G>A	c.(646-648)GAG>AAG	p.E216K		NM_017503	NP_059973	Q15527	SURF2_HUMAN	surfeit 2	216							protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)														---	---	---	---
SEC16A	9919	broad.mit.edu	37	9	139342536	139342536	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139342536C>T	uc004chx.2	-	24	6699	c.6390G>A	c.(6388-6390)TCG>TCA	p.S2130S	SEC16A_uc004chp.2_5'Flank|SEC16A_uc004chq.2_5'Flank|SEC16A_uc011mea.1_5'Flank|SEC16A_uc004chr.2_Silent_p.S136S|SEC16A_uc004chs.2_5'UTR|SEC16A_uc004cht.2_Silent_p.S161S|SEC16A_uc004chu.2_Silent_p.S315S|SEC16A_uc004chv.3_Silent_p.S1520S|SEC16A_uc004chw.2_Silent_p.S2130S|SEC16A_uc010nbn.2_Silent_p.S2130S	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1952	Required for interaction with SEC23A.|Pro-rich.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)														---	---	---	---
PITRM1	10531	broad.mit.edu	37	10	3180484	3180484	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3180484G>T	uc010qah.1	-	23	2701	c.2669C>A	c.(2668-2670)GCC>GAC	p.A890D	PITRM1_uc001igr.1_3'UTR|PITRM1_uc001igs.1_Missense_Mutation_p.A93D|PITRM1_uc001igt.1_Missense_Mutation_p.A988D|PITRM1_uc009xhv.1_Missense_Mutation_p.A554D|PITRM1_uc001igu.1_Missense_Mutation_p.A914D|PITRM1_uc010qai.1_Missense_Mutation_p.A959D			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	890					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1																		---	---	---	---
ITIH2	3698	broad.mit.edu	37	10	7759715	7759715	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7759715C>T	uc001ijs.2	+	6	756	c.594C>T	c.(592-594)ATC>ATT	p.I198I		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	198					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
PGBD3	267004	broad.mit.edu	37	10	50732318	50732318	+	Translation_Start_Site	SNP	G	A	A	rs141391984	byFrequency	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50732318G>A	uc001jht.2	-	1	9	c.-246C>T	c.(-248--244)GACGA>GATGA		ERCC6_uc001jhs.3_Silent_p.D386D|PGBD3_uc009xoe.2_Silent_p.D386D|PGBD3_uc001jhu.2_Silent_p.D386D	NM_170753	NP_736609			hypothetical protein LOC267004											pancreas(1)|breast(1)|skin(1)	3																		---	---	---	---
A1CF	29974	broad.mit.edu	37	10	52603780	52603780	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52603780A>C	uc001jjj.2	-	4	390	c.202T>G	c.(202-204)TTT>GTT	p.F68V	A1CF_uc010qhn.1_Missense_Mutation_p.F76V|A1CF_uc001jji.2_Missense_Mutation_p.F68V|A1CF_uc001jjh.2_Missense_Mutation_p.F76V|A1CF_uc010qho.1_Missense_Mutation_p.F76V|A1CF_uc009xov.2_Missense_Mutation_p.F68V|A1CF_uc001jjk.1_Missense_Mutation_p.F68V	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	68	RRM 1.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1																		---	---	---	---
TMEM26	219623	broad.mit.edu	37	10	63170253	63170253	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63170253G>A	uc001jlo.2	-	6	1303	c.934C>T	c.(934-936)CGT>TGT	p.R312C	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlp.1_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	312						integral to membrane					0	Prostate(12;0.0112)																	---	---	---	---
RUFY2	55680	broad.mit.edu	37	10	70143864	70143864	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70143864G>A	uc001job.2	-	9	1198	c.871C>T	c.(871-873)CAT>TAT	p.H291Y	RUFY2_uc001jnz.1_RNA|RUFY2_uc001joc.2_Missense_Mutation_p.H222Y|RUFY2_uc010qiw.1_Missense_Mutation_p.H198Y|RUFY2_uc001jod.1_Missense_Mutation_p.H256Y|RUFY2_uc009xpv.1_Missense_Mutation_p.H139Y	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	305	Potential.					nucleus	metal ion binding			ovary(1)	1																		---	---	---	---
BLNK	29760	broad.mit.edu	37	10	97983645	97983645	+	Silent	SNP	C	T	T	rs149698554		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97983645C>T	uc001kls.3	-	6	640	c.462G>A	c.(460-462)CCG>CCA	p.P154P	BLNK_uc001kme.3_Silent_p.P72P|BLNK_uc001klt.3_Silent_p.P68P|BLNK_uc009xvc.2_Intron|BLNK_uc001klu.3_Silent_p.P72P|BLNK_uc001klv.3_Intron|BLNK_uc001klw.3_RNA|BLNK_uc001klx.3_Silent_p.P154P|BLNK_uc001kly.3_Silent_p.P154P|BLNK_uc001klz.3_Intron|BLNK_uc001kma.3_Silent_p.P154P|BLNK_uc001kmb.3_Intron|BLNK_uc001kmc.3_RNA|BLNK_uc001kmd.3_Silent_p.P72P|BLNK_uc009xvd.2_Intron	NM_013314	NP_037446	Q8WV28	BLNK_HUMAN	B-cell linker isoform 1	154	Pro-rich.				B cell differentiation|humoral immune response|inflammatory response|intracellular signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(2)	2		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)														---	---	---	---
HPS1	3257	broad.mit.edu	37	10	100183378	100183378	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100183378C>T	uc010qpf.1	-	16	1826	c.1580G>A	c.(1579-1581)AGG>AAG	p.R527K	HPS1_uc001kpi.1_Missense_Mutation_p.R527K|HPS1_uc001kpj.1_Missense_Mutation_p.R434K|HPS1_uc001kpk.1_Missense_Mutation_p.R351K|HPS1_uc010qpg.1_Missense_Mutation_p.R147K|HPS1_uc009xwb.2_RNA	NM_000195	NP_000186	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1 protein isoform a	527					lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity			skin(1)	1		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)										Hermansky-Pudlak_syndrome				---	---	---	---
NFKB2	4791	broad.mit.edu	37	10	104161026	104161026	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104161026G>A	uc001kvb.2	+	19	2426	c.2161G>A	c.(2161-2163)GAG>AAG	p.E721K	NFKB2_uc001kva.2_Missense_Mutation_p.E721K|NFKB2_uc001kvd.2_Missense_Mutation_p.E721K|NFKB2_uc009xxc.2_Missense_Mutation_p.E721K	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	721			Missing (in truncated form p80HT).|Missing (in truncated form LB40).|Missing (in truncated form EB308).		innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)				T	IGH@	B-NHL								---	---	---	---
KNDC1	85442	broad.mit.edu	37	10	135015105	135015105	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135015105C>T	uc001llz.1	+	17	3091	c.3090C>T	c.(3088-3090)TTC>TTT	p.F1030F	KNDC1_uc001lma.1_Silent_p.F965F|KNDC1_uc001lmb.1_Silent_p.F442F	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1030					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)														---	---	---	---
ART1	417	broad.mit.edu	37	11	3681342	3681342	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3681342G>A	uc001lye.1	+	3	694	c.593G>A	c.(592-594)GGG>GAG	p.G198E	ART1_uc009yeb.1_Missense_Mutation_p.G198E	NM_004314	NP_004305	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1 precursor	198					protein ADP-ribosylation	anchored to membrane|integral to plasma membrane|sarcoplasmic reticulum membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)	Becaplermin(DB00102)													---	---	---	---
HBG1	3047	broad.mit.edu	37	11	5269581	5269581	+	3'UTR	SNP	C	A	A	rs34752752		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5269581C>A	uc001mah.1	-	3					HBG2_uc001mai.1_3'UTR	NM_000559	NP_000550			A-gamma globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity|protein binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
HBE1	3046	broad.mit.edu	37	11	5290725	5290725	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5290725G>A	uc001mal.1	-	2	527	c.274C>T	c.(274-276)CTG>TTG	p.L92L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Silent_p.L92L	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	92					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR51M1	390059	broad.mit.edu	37	11	5410661	5410661	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5410661C>T	uc010qzc.1	+	1	33	c.33C>T	c.(31-33)TTC>TTT	p.F11F	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	11						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
MICAL2	9645	broad.mit.edu	37	11	12241844	12241844	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12241844T>A	uc001mjz.2	+	9	1333	c.1045T>A	c.(1045-1047)TAC>AAC	p.Y349N	MICAL2_uc010rch.1_Missense_Mutation_p.Y349N|MICAL2_uc001mka.2_Missense_Mutation_p.Y349N|MICAL2_uc010rci.1_Missense_Mutation_p.Y349N|MICAL2_uc001mkb.2_Missense_Mutation_p.Y349N|MICAL2_uc001mkc.2_Missense_Mutation_p.Y349N|MICAL2_uc001mkd.2_Missense_Mutation_p.Y178N|MICAL2_uc010rcj.1_5'Flank	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	349						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)														---	---	---	---
TSG101	7251	broad.mit.edu	37	11	18505570	18505570	+	Silent	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18505570G>C	uc001mor.2	-	8	816	c.690C>G	c.(688-690)CTC>CTG	p.L230L		NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101	230					cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0																		---	---	---	---
SPTY2D1	144108	broad.mit.edu	37	11	18636652	18636652	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18636652G>T	uc001moy.2	-	3	1385	c.1169C>A	c.(1168-1170)ACA>AAA	p.T390K	SPTY2D1_uc010rdi.1_Missense_Mutation_p.T390K	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	390	Ser-rich.									breast(1)	1																		---	---	---	---
ANO5	203859	broad.mit.edu	37	11	22249057	22249057	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22249057C>T	uc001mqi.2	+	7	890	c.573C>T	c.(571-573)TTC>TTT	p.F191F	ANO5_uc001mqj.2_Silent_p.F190F	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	191	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
LIN7C	55327	broad.mit.edu	37	11	27520261	27520261	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27520261C>T	uc001mrl.2	-	5	556	c.529G>A	c.(529-531)GTC>ATC	p.V177I	LIN7C_uc009yii.2_Missense_Mutation_p.V153I	NM_018362	NP_060832	Q9NUP9	LIN7C_HUMAN	lin-7 homolog C	177					exocytosis|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction					0																		---	---	---	---
KIF18A	81930	broad.mit.edu	37	11	28090850	28090850	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28090850C>T	uc001msc.2	-	11	1728	c.1546G>A	c.(1546-1548)GAA>AAA	p.E516K		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	516					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2																		---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61071504	61071504	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61071504G>A	uc001nrc.3	-	22	2891	c.2665C>T	c.(2665-2667)CGG>TGG	p.R889W	DDB1_uc010rle.1_Missense_Mutation_p.R200W|DDB1_uc010rlf.1_Missense_Mutation_p.R889W	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	889	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
CST6	1474	broad.mit.edu	37	11	65780867	65780867	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65780867T>A	uc001ogr.2	+	3	500	c.446T>A	c.(445-447)ATG>AAG	p.M149K	CST6_uc001ogs.1_3'UTR	NM_001323	NP_001314	Q15828	CYTM_HUMAN	cystatin M precursor	149					anatomical structure morphogenesis	extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1																		---	---	---	---
CD248	57124	broad.mit.edu	37	11	66083690	66083690	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66083690C>T	uc001ohm.1	-	1	826	c.809G>A	c.(808-810)AGT>AAT	p.S270N		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	270	Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)													---	---	---	---
RBM4	5936	broad.mit.edu	37	11	66411369	66411369	+	Silent	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66411369T>C	uc009yrj.2	+	3	1349	c.861T>C	c.(859-861)GCT>GCC	p.A287A	RBM4_uc009yrk.2_Silent_p.A262A|RBM4_uc001oiw.1_Silent_p.A287A|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Silent_p.A287A|RBM4_uc001oiz.1_Silent_p.A287A	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	287	Interaction with TNPO3.|Poly-Ala.				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)														---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77635908	77635908	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77635908G>A	uc001oys.2	-	12	1430	c.1402C>T	c.(1402-1404)CAT>TAT	p.H468Y	INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.H468Y	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	468	HEAT 8.				snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
CEP57	9702	broad.mit.edu	37	11	95552026	95552026	+	Missense_Mutation	SNP	A	C	C	rs142615007		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95552026A>C	uc001pfp.1	+	6	878	c.657A>C	c.(655-657)GAA>GAC	p.E219D	CEP57_uc001pfo.1_Missense_Mutation_p.E219D|CEP57_uc010ruh.1_Missense_Mutation_p.E210D|CEP57_uc010rui.1_Missense_Mutation_p.E219D|CEP57_uc009ywn.1_Missense_Mutation_p.E67D|CEP57_uc001pfq.1_Missense_Mutation_p.E219D|CEP57_uc001pfr.1_Missense_Mutation_p.E67D	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN	translokin	219	Potential.|centrosome localization domain (CLD) (By similarity).				fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)												Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
DDI1	414301	broad.mit.edu	37	11	103907617	103907617	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103907617C>A	uc001phr.2	+	1	310	c.67C>A	c.(67-69)CCC>ACC	p.P23T	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	23	Ubiquitin-like.				proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)														---	---	---	---
LAYN	143903	broad.mit.edu	37	11	111414845	111414845	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111414845G>T	uc001plr.1	+	3	643	c.307G>T	c.(307-309)GAC>TAC	p.D103Y	LAYN_uc001plp.1_Missense_Mutation_p.D95Y|LAYN_uc001plq.1_Missense_Mutation_p.D103Y|LAYN_uc001pls.1_Missense_Mutation_p.D95Y|LAYN_uc010rwg.1_Silent_p.V2V|LAYN_uc010rwh.1_5'UTR	NM_178834	NP_849156	Q6UX15	LAYN_HUMAN	layilin	103	C-type lectin.|Extracellular (Potential).					cell surface|integral to membrane|ruffle	hyaluronic acid binding|sugar binding				0		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)														---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2778210	2778210	+	Intron	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2778210G>A	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
SLCO1C1	53919	broad.mit.edu	37	12	20903643	20903643	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20903643G>C	uc001rej.3	+	15	2188	c.1833G>C	c.(1831-1833)TTG>TTC	p.L611F	SLCO1C1_uc010sii.1_Missense_Mutation_p.L611F|SLCO1C1_uc010sij.1_Missense_Mutation_p.L562F|SLCO1C1_uc009zip.2_Missense_Mutation_p.L445F|SLCO1C1_uc001rei.2_Missense_Mutation_p.L611F|SLCO1C1_uc010sik.1_Missense_Mutation_p.L493F	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	611	Helical; Name=11; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)																	---	---	---	---
ALG10B	144245	broad.mit.edu	37	12	38714150	38714150	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38714150G>A	uc001rln.3	+	3	696	c.557G>A	c.(556-558)CGG>CAG	p.R186Q	ALG10B_uc001rlo.3_Missense_Mutation_p.R156Q|ALG10B_uc010skk.1_Missense_Mutation_p.R126Q	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	186	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)																---	---	---	---
DNAJC22	79962	broad.mit.edu	37	12	49743129	49743129	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49743129C>T	uc001rua.2	+	2	875	c.474C>T	c.(472-474)GCC>GCT	p.A158A	DNAJC22_uc001rub.2_Silent_p.A158A	NM_024902	NP_079178	Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	158	Helical; (Potential).				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			ovary(1)	1																		---	---	---	---
B4GALNT1	2583	broad.mit.edu	37	12	58024855	58024855	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58024855G>A	uc001spg.1	-	4	830	c.398C>T	c.(397-399)GCT>GTT	p.A133V	B4GALNT1_uc010sru.1_Missense_Mutation_p.A78V|B4GALNT1_uc010srv.1_Missense_Mutation_p.A133V|B4GALNT1_uc001sph.2_Missense_Mutation_p.A133V|B4GALNT1_uc001spi.2_Missense_Mutation_p.A133V	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	133	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
WIF1	11197	broad.mit.edu	37	12	65460505	65460505	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65460505G>A	uc001ssk.2	-	6	791	c.646C>T	c.(646-648)CCA>TCA	p.P216S		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	216	EGF-like 2.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)				T	HMGA2	pleomorphic salivary gland adenoma								---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66742945	66742945	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66742945C>T	uc001stk.2	-	24	3326	c.3085G>A	c.(3085-3087)GTT>ATT	p.V1029I	GRIP1_uc001stj.2_Missense_Mutation_p.V796I	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	1081	PDZ 7.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	73056851	73056851	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73056851A>T	uc001sxa.2	+	19	2981	c.2951A>T	c.(2950-2952)AAC>ATC	p.N984I		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	984	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
SELPLG	6404	broad.mit.edu	37	12	109017971	109017971	+	Missense_Mutation	SNP	C	T	T	rs149021318	byFrequency;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109017971C>T	uc001tni.2	-	2	273	c.113G>A	c.(112-114)CGG>CAG	p.R38Q	SELPLG_uc001tnh.2_Missense_Mutation_p.R38Q|SELPLG_uc010sxe.1_Missense_Mutation_p.R54Q	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	38	Extracellular (Potential).			Missing (in Ref. 3; BAC05283).	blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0																		---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120598006	120598006	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120598006C>T	uc001txo.2	-	23	2503	c.2490G>A	c.(2488-2490)CAG>CAA	p.Q830Q		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	830					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
WDR66	144406	broad.mit.edu	37	12	122398586	122398586	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122398586C>G	uc009zxk.2	+	14	2371	c.2229C>G	c.(2227-2229)AGC>AGG	p.S743R		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	743							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122845543	122845543	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122845543G>A	uc001ucg.1	-	4	1074	c.968C>T	c.(967-969)GCC>GTC	p.A323V	CLIP1_uc001uch.1_Missense_Mutation_p.A323V|CLIP1_uc001uci.1_Missense_Mutation_p.A323V|CLIP1_uc001ucj.1_Missense_Mutation_p.A24V|CLIP1_uc010tae.1_Missense_Mutation_p.A323V	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	323	Ser-rich.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
EP400	57634	broad.mit.edu	37	12	132514347	132514347	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132514347G>A	uc001ujn.2	+	27	5518	c.5483G>A	c.(5482-5484)GGC>GAC	p.G1828D	EP400_uc001ujl.2_Missense_Mutation_p.G1827D|EP400_uc001ujm.2_Missense_Mutation_p.G1747D|SNORA49_uc001ujo.2_5'Flank	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1864					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)														---	---	---	---
C1QTNF9B	387911	broad.mit.edu	37	13	24465804	24465804	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24465804G>A	uc010tcw.1	-	3	626	c.626C>T	c.(625-627)ACG>ATG	p.T209M	MIPEP_uc001uox.3_5'Flank|PCOTH_uc001uoy.2_Missense_Mutation_p.V20M|PCOTH_uc009zzx.2_Missense_Mutation_p.V29M|C1QTNF9B_uc010tcv.1_Intron|C1QTNF9B_uc001uoz.1_Intron|C1QTNF9B_uc010tcx.1_Missense_Mutation_p.T209M	NM_001007537	NP_001007538	B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	209	C1q.					collagen					0																		---	---	---	---
C1QTNF9	338872	broad.mit.edu	37	13	24895530	24895530	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24895530C>T	uc001upj.2	+	4	687	c.626C>T	c.(625-627)ACG>ATG	p.T209M	C1QTNF9_uc001upe.2_RNA	NM_178540	NP_848635	P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	209	C1q.					collagen	hormone activity				0		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)														---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39266549	39266549	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39266549G>A	uc001uwv.2	+	1	5377	c.5068G>A	c.(5068-5070)GAC>AAC	p.D1690N		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1690	Extracellular (Potential).|CSPG 12.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
THSD1	55901	broad.mit.edu	37	13	52952350	52952350	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52952350G>C	uc001vgo.2	-	5	2300	c.1755C>G	c.(1753-1755)TTC>TTG	p.F585L	THSD1_uc001vgp.2_Missense_Mutation_p.F532L|THSD1_uc010tgz.1_Missense_Mutation_p.F206L|THSD1_uc010aea.2_Missense_Mutation_p.F46L	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	585	Cytoplasmic (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)														---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60240797	60240797	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60240797G>A	uc001vht.2	-	28	3722	c.3503C>T	c.(3502-3504)ACG>ATG	p.T1168M	DIAPH3_uc001vhs.2_RNA	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	1168					actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76374837	76374837	+	5'UTR	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76374837C>G	uc001vjv.2	+	4					LMO7_uc010thv.1_Missense_Mutation_p.S212R|LMO7_uc001vjt.1_Missense_Mutation_p.S160R|LMO7_uc010thw.1_Missense_Mutation_p.S121R|LMO7_uc001vju.1_RNA	NM_015842	NP_056667			LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
EDNRB	1910	broad.mit.edu	37	13	78492651	78492651	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492651C>T	uc001vko.2	-	1	316	c.58G>A	c.(58-60)GGC>AGC	p.G20S	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Missense_Mutation_p.G20S|EDNRB_uc010aez.1_Missense_Mutation_p.G20S|EDNRB_uc001vkp.1_Missense_Mutation_p.G103S|EDNRB_uc010afa.1_Missense_Mutation_p.G20S	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	20					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
OR4N2	390429	broad.mit.edu	37	14	20295827	20295827	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20295827T>G	uc010tkv.1	+	1	220	c.220T>G	c.(220-222)TCC>GCC	p.S74A		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
LRFN5	145581	broad.mit.edu	37	14	42356201	42356201	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356201C>T	uc001wvm.2	+	3	1571	c.373C>T	c.(373-375)CTT>TTT	p.L125F	LRFN5_uc010ana.2_Missense_Mutation_p.L125F	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	125	Extracellular (Potential).|LRR 4.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)											HNSCC(30;0.082)			---	---	---	---
SIX4	51804	broad.mit.edu	37	14	61190693	61190693	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190693C>A	uc001xfc.2	-	1	100	c.100G>T	c.(100-102)GAA>TAA	p.E34*	SIX4_uc010app.1_Nonsense_Mutation_p.E26*	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	34						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)														---	---	---	---
C14orf43	91748	broad.mit.edu	37	14	74206166	74206166	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74206166C>G	uc001xot.2	-	2	1329	c.546G>C	c.(544-546)ATG>ATC	p.M182I	C14orf43_uc001xou.2_Missense_Mutation_p.M182I|C14orf43_uc010tud.1_Missense_Mutation_p.M182I|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	182					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)														---	---	---	---
FAM161B	145483	broad.mit.edu	37	14	74411425	74411425	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74411425G>A	uc001xpd.1	-	3	644	c.538C>T	c.(538-540)CGC>TGC	p.R180C		NM_152445	NP_689658			hypothetical protein LOC145483											ovary(1)	1																		---	---	---	---
COQ6	51004	broad.mit.edu	37	14	74428508	74428508	+	Missense_Mutation	SNP	A	G	G	rs150656371		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74428508A>G	uc001xph.2	+	11	1359	c.1279A>G	c.(1279-1281)ACA>GCA	p.T427A	ENTPD5_uc001xpi.2_Intron|COQ6_uc001xpe.2_Missense_Mutation_p.T352A|COQ6_uc001xpf.2_Missense_Mutation_p.T352A|COQ6_uc010tuk.1_Missense_Mutation_p.T402A|COQ6_uc001xpg.2_Intron	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a	427					ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)														---	---	---	---
TRIP11	9321	broad.mit.edu	37	14	92469890	92469890	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92469890G>C	uc001xzy.2	-	11	5218	c.4430C>G	c.(4429-4431)ACA>AGA	p.T1477R	TRIP11_uc010auf.1_Missense_Mutation_p.T1213R	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1477	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)				T	PDGFRB	AML								---	---	---	---
SERPINA1	5265	broad.mit.edu	37	14	94847294	94847294	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94847294G>A	uc001ycx.3	-	3	1092	c.831C>T	c.(829-831)TTC>TTT	p.F277F	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Silent_p.F277F|SERPINA1_uc010aux.2_Silent_p.F277F|SERPINA1_uc001ycy.3_Silent_p.F277F|SERPINA1_uc010auy.2_Silent_p.F277F|SERPINA1_uc001ycz.3_Silent_p.F277F|SERPINA1_uc010auz.2_Silent_p.F277F|SERPINA1_uc010ava.2_Silent_p.F277F|SERPINA1_uc001ydb.3_Silent_p.F277F|SERPINA1_uc010avb.2_Silent_p.F277F|SERPINA1_uc001ydc.3_Silent_p.F277F|SERPINA1_uc001yda.1_Silent_p.F277F	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	277					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)									Alpha-1-Antitrypsin_Deficiency				---	---	---	---
UBE3A	7337	broad.mit.edu	37	15	25616180	25616180	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25616180C>A	uc001zaq.2	-	4	1150	c.1150G>T	c.(1150-1152)GTG>TTG	p.V384L	uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.V361L|UBE3A_uc001zas.2_Missense_Mutation_p.V381L|UBE3A_uc001zat.2_Missense_Mutation_p.V361L	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	384					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)														---	---	---	---
MYO5C	55930	broad.mit.edu	37	15	52539115	52539115	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52539115C>G	uc010bff.2	-	16	2115	c.1978G>C	c.(1978-1980)GAA>CAA	p.E660Q	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	660	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)														---	---	---	---
CCPG1	9236	broad.mit.edu	37	15	55651934	55651934	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55651934C>T	uc002acv.1	-	8	2202	c.2037G>A	c.(2035-2037)CAG>CAA	p.Q679Q	CCPG1_uc002acy.2_Silent_p.Q679Q|CCPG1_uc002acu.1_Silent_p.Q535Q|CCPG1_uc002acw.1_Silent_p.Q404Q|CCPG1_uc002acx.2_Intron|CCPG1_uc010bfk.1_Silent_p.Q679Q|CCPG1_uc002acz.1_Silent_p.Q679Q	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2	679	Lumenal (Potential).				cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)														---	---	---	---
GP2	2813	broad.mit.edu	37	16	20331776	20331776	+	Silent	SNP	A	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20331776A>G	uc002dgv.2	-	6	758	c.675T>C	c.(673-675)CCT>CCC	p.P225P	GP2_uc002dgw.2_Silent_p.P222P|GP2_uc002dgx.2_Silent_p.P78P|GP2_uc002dgy.2_Silent_p.P75P	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	225	EGF-like.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---
GTF3C1	2975	broad.mit.edu	37	16	27480772	27480772	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27480772C>T	uc002dov.1	-	32	4954	c.4914G>A	c.(4912-4914)GCG>GCA	p.A1638A	GTF3C1_uc002dou.2_Silent_p.A1638A	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1638						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5																		---	---	---	---
SLC9A5	6553	broad.mit.edu	37	16	67293838	67293838	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67293838C>T	uc002esm.2	+	12	1894	c.1831C>T	c.(1831-1833)CCG>TCG	p.P611S	SLC9A5_uc010cee.2_Missense_Mutation_p.P316S|SLC9A5_uc010vji.1_Missense_Mutation_p.P115S|uc002esn.1_5'Flank	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	611					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)														---	---	---	---
CDH1	999	broad.mit.edu	37	16	68853297	68853297	+	Silent	SNP	G	A	A	rs35741240	byFrequency;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68853297G>A	uc002ewg.1	+	11	1804	c.1680G>A	c.(1678-1680)ACG>ACA	p.T560T	CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Silent_p.T499T	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	560	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
NQO1	1728	broad.mit.edu	37	16	69745175	69745175	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69745175G>C	uc002exp.2	-	6	720	c.529C>G	c.(529-531)CTG>GTG	p.L177V	NQO1_uc010cfm.2_Missense_Mutation_p.L156V|NQO1_uc002exq.2_Missense_Mutation_p.L143V|NQO1_uc002exr.2_Missense_Mutation_p.L139V|NQO1_uc010vll.1_Missense_Mutation_p.L105V	NM_000903	NP_000894	P15559	NQO1_HUMAN	NAD(P)H menadione oxidoreductase 1,	177					nitric oxide biosynthetic process|regulation of cellular amino acid metabolic process|response to toxin|synaptic transmission, cholinergic|xenobiotic metabolic process	cytosol	coenzyme binding|cytochrome-b5 reductase activity|electron carrier activity|NAD(P)H dehydrogenase (quinone) activity				0					Dicumarol(DB00266)|Menadione(DB00170)													---	---	---	---
COG4	25839	broad.mit.edu	37	16	70515668	70515668	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70515668C>T	uc002ezc.2	-	17	2116	c.2105G>A	c.(2104-2106)CGG>CAG	p.R702Q	COG4_uc002eza.2_Missense_Mutation_p.R39Q|COG4_uc002ezb.2_Missense_Mutation_p.R158Q|COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Missense_Mutation_p.R681Q|COG4_uc002eze.2_Missense_Mutation_p.R396Q	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	698	D domain.				Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)																---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89350371	89350371	+	Missense_Mutation	SNP	G	A	A	rs145730800		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89350371G>A	uc002fmx.1	-	9	3040	c.2579C>T	c.(2578-2580)TCG>TTG	p.S860L	ANKRD11_uc002fmy.1_Missense_Mutation_p.S860L|ANKRD11_uc002fnc.1_Missense_Mutation_p.S860L|ANKRD11_uc002fnb.1_Missense_Mutation_p.S817L	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	860	Lys-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
RPA1	6117	broad.mit.edu	37	17	1782886	1782886	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1782886G>A	uc002fto.2	+	11	1100	c.985G>A	c.(985-987)GCC>ACC	p.A329T		NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1	329					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0													NER					---	---	---	---
NUP88	4927	broad.mit.edu	37	17	5312217	5312217	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5312217G>A	uc002gbo.1	-	5	719	c.693C>T	c.(691-693)ACC>ACT	p.T231T	NUP88_uc010vsx.1_Silent_p.T231T|NUP88_uc010cle.1_Silent_p.T230T|NUP88_uc010vsy.1_Silent_p.T231T	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa	231					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578526C>A	uc002gim.2	-	5	598	c.404G>T	c.(403-405)TGC>TTC	p.C135F	TP53_uc002gig.1_Missense_Mutation_p.C135F|TP53_uc002gih.2_Missense_Mutation_p.C135F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C3F|TP53_uc010cng.1_Missense_Mutation_p.C3F|TP53_uc002gii.1_Missense_Mutation_p.C3F|TP53_uc010cnh.1_Missense_Mutation_p.C135F|TP53_uc010cni.1_Missense_Mutation_p.C135F|TP53_uc002gij.2_Missense_Mutation_p.C135F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C42F|TP53_uc002gio.2_Missense_Mutation_p.C3F|TP53_uc010vug.1_Missense_Mutation_p.C96F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	135	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> S (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C135Y(51)|p.C135F(34)|p.C135W(19)|p.C135S(10)|p.C135fs*35(9)|p.0?(7)|p.C135*(7)|p.C135G(6)|p.C135R(6)|p.C135C(5)|p.C135fs*14(2)|p.N131fs*27(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*36(1)|p.C135fs*15(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.C42Y(1)|p.C3Y(1)|p.M133fs*13(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
PFAS	5198	broad.mit.edu	37	17	8172417	8172417	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8172417C>T	uc002gkr.2	+	28	3993	c.3852C>T	c.(3850-3852)ATC>ATT	p.I1284I	PFAS_uc010vuv.1_Silent_p.I860I|PFAS_uc002gks.2_3'UTR	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1284	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34093640	34093640	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34093640C>T	uc002hjy.1	-	10	1701	c.1442G>A	c.(1441-1443)CGA>CAA	p.R481Q	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	481	Hemopexin-like 4.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
CCL5	6352	broad.mit.edu	37	17	34199417	34199417	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34199417C>G	uc002hkf.2	-	3	308	c.240G>C	c.(238-240)TGG>TGC	p.W80C		NM_002985	NP_002976	P13501	CCL5_HUMAN	small inducible cytokine A5 precursor	80					activation of phospholipase D activity|cell-cell signaling|cellular protein complex assembly|chemokine-mediated signaling pathway|dendritic cell chemotaxis|eosinophil chemotaxis|immune response|leukocyte cell-cell adhesion|macrophage chemotaxis|negative regulation of T cell apoptosis|negative regulation of viral genome replication|neutrophil activation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell-cell adhesion mediated by integrin|positive regulation of homotypic cell-cell adhesion|positive regulation of innate immune response|positive regulation of macrophage chemotaxis|positive regulation of monocyte chemotaxis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of T cell apoptosis|positive regulation of T cell chemotaxis|positive regulation of T cell proliferation|positive regulation of translational initiation|positive regulation of tyrosine phosphorylation of STAT protein|positive regulation of viral genome replication|protein tetramerization|regulation of chronic inflammatory response|response to virus	extracellular space	CCR1 chemokine receptor binding|CCR4 chemokine receptor binding|CCR5 chemokine receptor binding|chemoattractant activity|chemokine activity|chemokine receptor antagonist activity|protein homodimerization activity|protein self-association|receptor signaling protein tyrosine kinase activator activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0183)														---	---	---	---
ACLY	47	broad.mit.edu	37	17	40049326	40049326	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40049326G>A	uc002hyg.2	-	15	1724	c.1561C>T	c.(1561-1563)CGA>TGA	p.R521*	ACLY_uc002hyh.2_Nonsense_Mutation_p.R511*|ACLY_uc002hyi.2_Nonsense_Mutation_p.R575*|ACLY_uc010wfx.1_Nonsense_Mutation_p.R565*|ACLY_uc010wfy.1_Nonsense_Mutation_p.R250*	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	521					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)																---	---	---	---
DHX58	79132	broad.mit.edu	37	17	40261296	40261296	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40261296G>A	uc002hyw.3	-	6	893	c.670C>T	c.(670-672)CGC>TGC	p.R224C	DHX58_uc002hyv.3_RNA|DHX58_uc010wgf.1_Missense_Mutation_p.R217C	NM_024119	NP_077024	Q96C10	DHX58_HUMAN	RNA helicase LGP2	224					innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding				0		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)														---	---	---	---
RAMP2	10266	broad.mit.edu	37	17	40914636	40914636	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40914636T>G	uc002ibg.2	+	4	362	c.294T>G	c.(292-294)GAT>GAG	p.D98E	LOC100190938_uc002ibd.1_5'Flank|LOC100190938_uc002ibe.3_5'Flank|LOC100190938_uc002ibf.3_5'Flank|RAMP2_uc010cyt.2_Missense_Mutation_p.D103E|RAMP2_uc002ibh.2_Missense_Mutation_p.I62S	NM_005854	NP_005845	O60895	RAMP2_HUMAN	receptor activity modifying protein 2 precursor	98	Extracellular (Potential).				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	coated pit|integral to plasma membrane|lysosome	protein transporter activity				0		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)													---	---	---	---
RUNDC1	146923	broad.mit.edu	37	17	41141403	41141403	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41141403G>A	uc002ici.1	+	3	715	c.703G>A	c.(703-705)GAG>AAG	p.E235K	RUNDC1_uc010whi.1_Missense_Mutation_p.E5K	NM_173079	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	235	Potential.										0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)														---	---	---	---
GFAP	2670	broad.mit.edu	37	17	42987519	42987519	+	Intron	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42987519C>T	uc002ihq.2	-						GFAP_uc002ihr.2_Silent_p.P427P	NM_002055	NP_002046			glial fibrillary acidic protein isoform 1							cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)																---	---	---	---
ABCA9	10350	broad.mit.edu	37	17	67016572	67016572	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67016572G>A	uc002jhu.2	-	19	2700	c.2557C>T	c.(2557-2559)CGC>TGC	p.R853C	ABCA9_uc010dez.2_Missense_Mutation_p.R853C	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	853					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)																	---	---	---	---
DNAH17	8632	broad.mit.edu	37	17	76471408	76471408	+	5'Flank	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76471408G>A	uc002jvs.2	-											Homo sapiens mRNA for DNAH17 variant protein, partial cds.											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)															---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7567872	7567872	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7567872C>T	uc002knn.3	+	1	559	c.56C>T	c.(55-57)GCG>GTG	p.A19V	PTPRM_uc010dkv.2_Missense_Mutation_p.A19V	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	19					homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8069752	8069752	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8069752G>A	uc002knn.3	+	8	1704	c.1201G>A	c.(1201-1203)GAG>AAG	p.E401K	PTPRM_uc010dkv.2_Missense_Mutation_p.E401K|PTPRM_uc010wzl.1_Missense_Mutation_p.E188K	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	401	Fibronectin type-III 2.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
NPC1	4864	broad.mit.edu	37	18	21124448	21124448	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21124448C>T	uc002kum.3	-	13	2264	c.1990G>A	c.(1990-1992)GTG>ATG	p.V664M	NPC1_uc010xaz.1_Missense_Mutation_p.V397M|NPC1_uc010xba.1_Missense_Mutation_p.V509M	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	664	SSD.|Helical; (Potential).		V -> M (in NPC1).		autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
ZNF521	25925	broad.mit.edu	37	18	22805849	22805849	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22805849G>A	uc002kvk.2	-	4	2280	c.2033C>T	c.(2032-2034)TCC>TTC	p.S678F	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.S678F|ZNF521_uc002kvl.2_Missense_Mutation_p.S458F	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	678	C2H2-type 15.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)							T	PAX5	ALL								---	---	---	---
DSG1	1828	broad.mit.edu	37	18	28934291	28934291	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28934291G>A	uc002kwp.2	+	15	2344	c.2132G>A	c.(2131-2133)GGA>GAA	p.G711E	DSG1_uc010xbp.1_Missense_Mutation_p.G70E	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	711	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)															---	---	---	---
ZNF397OS	100101467	broad.mit.edu	37	18	32834016	32834016	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32834016C>G	uc002kym.2	-	4	1111	c.883G>C	c.(883-885)GAC>CAC	p.D295H	ZNF397_uc010dmq.2_Intron|ZNF397_uc010dmr.2_Intron|ZNF397_uc002kyj.2_Intron|ZNF397OS_uc002kyl.2_5'Flank|ZNF397OS_uc010xce.1_Missense_Mutation_p.D295H	NM_001112734	NP_001106205	Q86W11	ZSC30_HUMAN	zinc finger protein 397 opposite strand	295					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
C3	718	broad.mit.edu	37	19	6712411	6712411	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6712411C>G	uc002mfm.2	-	11	1188	c.1126G>C	c.(1126-1128)GTG>CTG	p.V376L		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	376					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
VAV1	7409	broad.mit.edu	37	19	6833745	6833745	+	Splice_Site	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6833745G>A	uc002mfu.1	+	18	1828	c.1731_splice	c.e18+1	p.K577_splice	VAV1_uc010xjh.1_Splice_Site_p.K545_splice|VAV1_uc010dva.1_Splice_Site_p.K577_splice|VAV1_uc002mfv.1_Splice_Site_p.K522_splice	NM_005428	NP_005419			vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16																		---	---	---	---
CCDC151	115948	broad.mit.edu	37	19	11545634	11545634	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11545634G>T	uc002mrs.2	-	1	347	c.204C>A	c.(202-204)CAC>CAA	p.H68Q	CCDC151_uc010dxz.2_Missense_Mutation_p.H68Q|PRKCSH_uc002mrt.2_5'Flank|PRKCSH_uc002mru.2_5'Flank|PRKCSH_uc010xlz.1_5'Flank|PRKCSH_uc010dya.2_5'Flank|PRKCSH_uc002mrv.1_5'Flank|PRKCSH_uc010dyb.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	68										ovary(1)	1																OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MEF2B	100271849	broad.mit.edu	37	19	19261546	19261546	+	Translation_Start_Site	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19261546G>A	uc002nlm.2	-	2	113	c.-1C>T	c.(-3-1)GACGA>GATGA		MEF2B_uc002nln.2_Missense_Mutation_p.T47M|MEF2B_uc002nll.2_Translation_Start_Site|LOC729991-MEF2B_uc010xqo.1_Translation_Start_Site|LOC729991-MEF2B_uc010xqp.1_Translation_Start_Site|LOC729991-MEF2B_uc002nlo.2_Translation_Start_Site|LOC729991-MEF2B_uc002nlp.2_Translation_Start_Site|MEF2B_uc002nlk.2_Translation_Start_Site	NM_001145785	NP_001139257			myocyte enhancer factor 2B isoform a											skin(1)	1			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)															---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22156661	22156661	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156661G>T	uc002nqp.2	-	4	1324	c.1175C>A	c.(1174-1176)ACT>AAT	p.T392N	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZC3H4	23211	broad.mit.edu	37	19	47575163	47575163	+	Missense_Mutation	SNP	G	A	A	rs149041592		TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47575163G>A	uc002pga.3	-	13	2056	c.2018C>T	c.(2017-2019)CCC>CTC	p.P673L	ZC3H4_uc002pgb.1_Intron	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	673	Pro-rich.						nucleic acid binding|zinc ion binding	p.P673L(1)		skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)														---	---	---	---
CHMP2A	27243	broad.mit.edu	37	19	59065483	59065483	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59065483G>A	uc002qti.2	-	1	523	c.97C>T	c.(97-99)CGA>TGA	p.R33*	CHMP2A_uc002qtj.2_Nonsense_Mutation_p.R33*|CHMP2A_uc002qtk.2_Nonsense_Mutation_p.R33*	NM_198426	NP_940818	O43633	CHM2A_HUMAN	chromatin modifying protein 2A	33	Potential.				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein domain specific binding				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)														---	---	---	---
CENPB	1059	broad.mit.edu	37	20	3765799	3765799	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3765799C>T	uc002wjk.2	-	1	1539	c.1332G>A	c.(1330-1332)GAG>GAA	p.E444E	CDC25B_uc010zqk.1_5'Flank|CDC25B_uc010zql.1_5'Flank|CDC25B_uc010zqm.1_5'Flank	NM_001810	NP_001801	P07199	CENPB_HUMAN	centromere protein B	444	Glu-rich (acidic).				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|satellite DNA binding				0																		---	---	---	---
COMMD7	149951	broad.mit.edu	37	20	31291840	31291840	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31291840C>T	uc002wya.3	-	8	1128	c.511G>A	c.(511-513)GAA>AAA	p.E171K	COMMD7_uc010ged.2_Missense_Mutation_p.E170K|COMMD7_uc002wyb.2_Missense_Mutation_p.E171K	NM_053041	NP_444269	Q86VX2	COMD7_HUMAN	COMM domain containing 7 isoform 1	171	COMM.			E -> K (in Ref. 1; AAS22244 and 5; AAH47440).	negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1																		---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35060202	35060202	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35060202G>A	uc002xff.2	+	3	517	c.82G>A	c.(82-84)GAC>AAC	p.D28N	DLGAP4_uc010zvp.1_Missense_Mutation_p.D28N	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	28					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
SLA2	84174	broad.mit.edu	37	20	35261111	35261111	+	Intron	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35261111C>T	uc002xfv.2	-						SLA2_uc002xfu.2_Intron	NM_032214	NP_115590			Src-like-adaptor 2 isoform a						antigen receptor-mediated signaling pathway|B cell mediated immunity|intracellular receptor mediated signaling pathway|negative regulation of B cell activation|negative regulation of calcium-mediated signaling|negative regulation of transcription from RNA polymerase II promoter|T cell activation	cytoplasmic membrane-bounded vesicle|endosome membrane|plasma membrane	protein N-terminus binding|SH3/SH2 adaptor activity				0	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
ZNF217	7764	broad.mit.edu	37	20	52193761	52193761	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52193761C>T	uc002xwq.3	-	3	1813	c.1542G>A	c.(1540-1542)CTG>CTA	p.L514L	ZNF217_uc010gij.1_Silent_p.L506L	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	514	C2H2-type 7.				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)															---	---	---	---
SPO11	23626	broad.mit.edu	37	20	55918512	55918512	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55918512T>C	uc002xye.2	+	13	1280	c.1187T>C	c.(1186-1188)ATA>ACA	p.I396T	SPO11_uc002xyf.2_Missense_Mutation_p.I358T	NM_012444	NP_036576	Q9Y5K1	SPO11_HUMAN	meiotic recombination protein SPO11 isoform a	396					female gamete generation|reciprocal meiotic recombination	chromosome|nucleus	ATP binding|DNA binding|hydrolase activity			breast(2)|skin(1)	3	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)										Editing_and_processing_nucleases					---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60907448	60907448	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60907448C>T	uc002ycq.2	-	28	3599	c.3532G>A	c.(3532-3534)GAA>AAA	p.E1178K		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1178	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62126392	62126392	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62126392C>T	uc002yfd.1	-	3	488	c.387G>A	c.(385-387)AAG>AAA	p.K129K	EEF1A2_uc002yfe.1_Silent_p.K129K|EEF1A2_uc010gkg.1_Silent_p.K129K	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	129						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
C20orf135	140701	broad.mit.edu	37	20	62493340	62493340	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62493340C>G	uc002ygx.1	+	1	775	c.447C>G	c.(445-447)GAC>GAG	p.D149E		NM_080622	NP_542189	Q9H3Z7	ABHGB_HUMAN	hypothetical protein LOC140701	149							hydrolase activity				0	all_cancers(38;1.77e-12)|all_epithelial(29;3.12e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)																	---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10970031	10970031	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10970031C>T	uc002yip.1	-	6	465	c.97G>A	c.(97-99)GAG>AAG	p.E33K	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.E33K|TPTE_uc002yir.1_Missense_Mutation_p.E33K|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	33					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36171641	36171641	+	Silent	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36171641G>A	uc002yuh.2	-	5	2421	c.843C>T	c.(841-843)AGC>AGT	p.S281S	RUNX1_uc002yui.2_Silent_p.S217S|RUNX1_uc010gmu.2_Silent_p.S308S|RUNX1_uc010gmv.2_Silent_p.S308S|RUNX1_uc002yuj.3_Silent_p.S176S|RUNX1_uc002yuk.3_Silent_p.S308S|RUNX1_uc002yul.1_Silent_p.S73S|RUNX1_uc002yum.1_Silent_p.S112S	NM_001001890	NP_001001890	Q01196	RUNX1_HUMAN	runt-related transcription factor 1 isoform	281	Pro/Ser/Thr-rich.			Missing: No DNA-binding.	myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	p.Y281*(1)		haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41710048	41710048	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41710048C>T	uc002yyq.1	-	8	2215	c.1763G>A	c.(1762-1764)AGC>AAC	p.S588N	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	588	Extracellular (Potential).|Ig-like C2-type 6.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
C21orf58	54058	broad.mit.edu	37	21	47735383	47735383	+	Intron	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47735383C>T	uc002zjf.2	-						C21orf58_uc002ziz.2_Intron|C21orf58_uc002zja.2_Intron|C21orf58_uc011afw.1_Intron|C21orf58_uc002zjc.2_Intron|C21orf58_uc011afx.1_Intron|C21orf58_uc010gqj.1_Intron|C21orf58_uc002zjg.1_Intron	NM_058180	NP_478060			hypothetical protein LOC54058											pancreas(1)	1	Breast(49;0.112)			Colorectal(79;0.239)														---	---	---	---
C22orf31	25770	broad.mit.edu	37	22	29456681	29456681	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456681T>C	uc003aej.1	-	2	281	c.154A>G	c.(154-156)AAT>GAT	p.N52D		NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770	52											0																		---	---	---	---
SSTR3	6753	broad.mit.edu	37	22	37602944	37602944	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37602944G>A	uc003ara.2	-	2	961	c.899C>T	c.(898-900)GCG>GTG	p.A300V	SSTR3_uc003arb.2_Missense_Mutation_p.A300V	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	300	Helical; Name=7; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity			lung(1)	1																		---	---	---	---
PHKA2	5256	broad.mit.edu	37	X	18926989	18926989	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18926989C>G	uc004cyv.3	-	21	2720	c.2290G>C	c.(2290-2292)GTT>CTT	p.V764L	PHKA2_uc004cyu.3_Missense_Mutation_p.V62L	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	764					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)																	---	---	---	---
CXorf58	254158	broad.mit.edu	37	X	23953497	23953497	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23953497C>T	uc004daz.1	+	7	1084	c.740C>T	c.(739-741)ACG>ATG	p.T247M	CXorf58_uc011mju.1_Missense_Mutation_p.T247M	NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	247											0																		---	---	---	---
SYTL5	94122	broad.mit.edu	37	X	37893211	37893211	+	Silent	SNP	C	A	A	rs73632432	byFrequency;by1000genomes	TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37893211C>A	uc004ddu.2	+	3	603	c.69C>A	c.(67-69)GGC>GGA	p.G23G	SYTL5_uc004ddv.2_Silent_p.G23G|SYTL5_uc004ddx.2_Silent_p.G23G	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	23	RabBD.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1																		---	---	---	---
CCNB3	85417	broad.mit.edu	37	X	50051783	50051783	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50051783C>T	uc004dox.3	+	6	912	c.614C>T	c.(613-615)GCG>GTG	p.A205V	CCNB3_uc004doy.2_Missense_Mutation_p.A205V|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	205					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)																	---	---	---	---
TSIX	9383	broad.mit.edu	37	X	73045210	73045210	+	RNA	SNP	T	C	C			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73045210T>C	uc004ebn.2	+	1		c.33171T>C			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0																		---	---	---	---
RAB40A	142684	broad.mit.edu	37	X	102755046	102755046	+	Silent	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102755046C>T	uc004ekk.2	-	3	981	c.639G>A	c.(637-639)CCG>CCA	p.P213P		NM_080879	NP_543155	Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	213	SOCS box.				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0																		---	---	---	---
ZIC3	7547	broad.mit.edu	37	X	136652214	136652214	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136652214C>A	uc004fak.2	+	3	1894	c.1389C>A	c.(1387-1389)AAC>AAA	p.N463K		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	463					cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
PLXNB3	5365	broad.mit.edu	37	X	153036318	153036318	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153036318C>T	uc004fii.2	+	11	2290	c.2116C>T	c.(2116-2118)CGG>TGG	p.R706W	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Missense_Mutation_p.R388W|PLXNB3_uc010nuk.2_Missense_Mutation_p.R729W|PLXNB3_uc011mzd.1_Missense_Mutation_p.R345W	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	706	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
PDZD4	57595	broad.mit.edu	37	X	153069135	153069135	+	Silent	SNP	C	A	A			TCGA-CD-5800-01	TCGA-CD-5800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153069135C>A	uc004fiz.1	-	8	2233	c.1983G>T	c.(1981-1983)ACG>ACT	p.T661T	PDZD4_uc004fiy.1_Silent_p.T586T|PDZD4_uc004fix.2_Silent_p.T565T|PDZD4_uc004fja.1_Silent_p.T667T|PDZD4_uc011mze.1_Silent_p.T552T	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	661						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
