Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	4204599	4204601	+	IGR	DEL	CAT	-	-	rs143636971		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4204599_4204601delCAT								LOC100133612 (370722 upstream) : LOC284661 (267510 downstream)																																			---	---	---	---
KANK4	163782	broad.mit.edu	37	1	62713000	62713000	+	Intron	DEL	G	-	-	rs111297754		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62713000delG	uc001dah.3	-						KANK4_uc001dai.3_Intron|KANK4_uc001daf.3_Intron|KANK4_uc001dag.3_Intron	NM_181712	NP_859063			ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6																		---	---	---	---
RPF1	80135	broad.mit.edu	37	1	84948418	84948418	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84948418delA	uc001djv.3	+							NM_025065	NP_079341			RNA processing factor 1						rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0																		---	---	---	---
NUP210L	91181	broad.mit.edu	37	1	154100028	154100029	+	Intron	DEL	TC	-	-	rs10531787		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154100028_154100029delTC	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191			nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)															---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158582347	158582348	+	Intron	INS	-	AA	AA	rs141202227	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158582347_158582348insAA	uc001fst.1	-							NM_003126	NP_003117			spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
IPO9	55705	broad.mit.edu	37	1	201841735	201841743	+	Intron	DEL	AACAACAAC	-	-	rs35521088		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201841735_201841743delAACAACAAC	uc001gwz.2	+							NM_018085	NP_060555			importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2																		---	---	---	---
LGTN	1939	broad.mit.edu	37	1	206766826	206766827	+	Intron	DEL	GA	-	-	rs113332386		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766826_206766827delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824			ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
ADI1	55256	broad.mit.edu	37	2	3504893	3504894	+	Intron	INS	-	A	A	rs144556875	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3504893_3504894insA	uc002qxp.3	-						ADI1_uc010yiq.1_Intron	NM_018269	NP_060739			acireductone dioxygenase 1						L-methionine salvage from methylthioadenosine	cytoplasm|nucleus|plasma membrane	acireductone dioxygenase (Ni2+-requiring) activity|metal ion binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)														---	---	---	---
DDX1	1653	broad.mit.edu	37	2	15739605	15739606	+	Intron	INS	-	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15739605_15739606insT	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930			DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)														---	---	---	---
DHX57	90957	broad.mit.edu	37	2	39085574	39085575	+	Intron	DEL	TG	-	-	rs144247886		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39085574_39085575delTG	uc002rrf.2	-						DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314			DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)																---	---	---	---
RGPD1	400966	broad.mit.edu	37	2	88091357	88091357	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091357delA	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628			RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0																		---	---	---	---
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes;by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435			RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
PASK	23178	broad.mit.edu	37	2	242075147	242075148	+	Intron	INS	-	C	C	rs140491962	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242075147_242075148insC	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_5'Flank|PASK_uc002waq.2_Intron	NM_015148	NP_055963			PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41288555	41288556	+	Intron	INS	-	C	C	rs143939899	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41288555_41288556insC	uc003ckv.3	-						ULK4_uc003cku.3_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
NT5DC2	64943	broad.mit.edu	37	3	52559179	52559181	+	Intron	DEL	GGT	-	-	rs58050076		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52559179_52559181delGGT	uc003deo.2	-						NT5DC2_uc003dem.2_Intron|NT5DC2_uc003den.2_Intron|NT5DC2_uc010hmi.2_Intron|NT5DC2_uc010hmj.2_Intron	NM_022908	NP_075059			5'-nucleotidase domain containing 2 isoform 2								hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)														---	---	---	---
C3orf49	132200	broad.mit.edu	37	3	63820037	63820037	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63820037delA	uc003dls.3	+						THOC7_uc003dlt.3_Intron|THOC7_uc003dlu.3_Intron	NR_026866				RecName: Full=Putative uncharacterized protein C3orf49;												0																		---	---	---	---
C3orf55	152078	broad.mit.edu	37	3	157295937	157295938	+	Intron	INS	-	T	T	rs112996272		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157295937_157295938insT	uc003fbp.3	+						C3orf55_uc003fbo.2_Intron|C3orf55_uc011bot.1_Intron|C3orf55_uc010hvv.2_Intron	NM_001130002	NP_001123474			hypothetical protein LOC152078 isoform 1												0			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)															---	---	---	---
TBL1XR1	79718	broad.mit.edu	37	3	176744032	176744032	+	Intron	DEL	A	-	-	rs112275760		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176744032delA	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941			transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)															---	---	---	---
ZBTB49	166793	broad.mit.edu	37	4	4317206	4317207	+	Intron	INS	-	A	A	rs147128078	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4317206_4317207insA	uc003ghu.2	+						ZBTB49_uc003ghv.2_Intron|ZBTB49_uc010icy.2_Intron|ZBTB49_uc010icz.2_Intron	NM_145291	NP_660334			zinc finger protein 509						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
NFXL1	152518	broad.mit.edu	37	4	47856958	47856958	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47856958delA	uc010igh.2	-						NFXL1_uc003gxo.2_Intron|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540			nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
PRKG2	5593	broad.mit.edu	37	4	82031931	82031932	+	Intron	INS	-	GACA	GACA	rs60262864	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82031931_82031932insGACA	uc003hmh.2	-						PRKG2_uc011ccf.1_Intron|PRKG2_uc011ccg.1_Intron|PRKG2_uc011cch.1_Intron	NM_006259	NP_006250			protein kinase, cGMP-dependent, type II						platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7																		---	---	---	---
PKD2	5311	broad.mit.edu	37	4	88940482	88940482	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88940482delA	uc003hre.2	+							NM_000297	NP_000288			polycystin 2							basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)														---	---	---	---
PET112L	5188	broad.mit.edu	37	4	152625233	152625233	+	Intron	DEL	T	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152625233delT	uc003iml.2	-						PET112L_uc003imm.3_Intron	NM_004564	NP_004555			PET112-like precursor							mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---
FBXW7	55294	broad.mit.edu	37	4	153247487	153247487	+	Intron	DEL	T	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247487delT	uc003ims.2	-						FBXW7_uc011cii.1_Intron|FBXW7_uc003imt.2_Intron|FBXW7_uc011cih.1_Intron|FBXW7_uc003imq.2_Intron|FBXW7_uc003imr.2_Intron	NM_033632	NP_361014			F-box and WD repeat domain containing 7 isoform						interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)						Mis|N|D|F		colorectal|endometrial|T-ALL								---	---	---	---
ELL2	22936	broad.mit.edu	37	5	95234666	95234667	+	Intron	INS	-	AAAC	AAAC	rs143997177	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95234666_95234667insAAAC	uc003klr.3	-							NM_012081	NP_036213			elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687			hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
GABRP	2568	broad.mit.edu	37	5	170235946	170235947	+	Intron	INS	-	T	T	rs150989217	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170235946_170235947insT	uc003mau.2	+						GABRP_uc011dev.1_Intron	NM_014211	NP_055026			gamma-aminobutyric acid (GABA) A receptor, pi							cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32497712	32497713	+	Intron	INS	-	A	A	rs146725750	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32497712_32497713insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
ZNF76	7629	broad.mit.edu	37	6	35253702	35253703	+	Intron	INS	-	C	C	rs142304763	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35253702_35253703insC	uc003oki.1	+						ZNF76_uc011dsy.1_Intron|ZNF76_uc011dsz.1_Intron|ZNF76_uc003okj.1_Intron|ZNF76_uc011dsx.1_Intron	NM_003427	NP_003418			zinc finger protein 76 (expressed in testis)						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
GPR126	57211	broad.mit.edu	37	6	142630883	142630883	+	Intron	DEL	T	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142630883delT	uc010khc.2	+						GPR126_uc010khd.2_Intron|GPR126_uc010khe.2_Intron|GPR126_uc010khf.2_Intron|GPR126_uc003qix.2_Intron	NM_020455	NP_065188			G protein-coupled receptor 126 alpha 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)														---	---	---	---
SYNJ2	8871	broad.mit.edu	37	6	158495956	158495964	+	Intron	DEL	TTTTTTTTT	-	-	rs7765766		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158495956_158495964delTTTTTTTTT	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889			synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)														---	---	---	---
SEMA4G	57715	broad.mit.edu	37	10	102733533	102733533	+	Intron	DEL	T	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102733533delT	uc010qpt.1	+						SEMA4G_uc001krv.2_Intron|SEMA4G_uc001krw.1_Intron|SEMA4G_uc001krx.2_Intron|MIR608_hsa-mir-608|MI0003621_5'Flank	NM_017893	NP_060363			semaphorin 4G						cell differentiation|nervous system development	integral to membrane	receptor activity			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)														---	---	---	---
DCHS1	8642	broad.mit.edu	37	11	6654458	6654470	+	Intron	DEL	CATTCCTATGCCT	-	-	rs72514313		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6654458_6654470delCATTCCTATGCCT	uc001mem.1	-							NM_003737	NP_003728			dachsous 1 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
DCHS1	8642	broad.mit.edu	37	11	6662745	6662746	+	In_Frame_Ins	INS	-	CAG	CAG			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6662745_6662746insCAG	uc001mem.1	-	2	509_510	c.99_100insCTG	c.(97-102)insCTG	p.33_34insL		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	33_34					calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099			spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
HRASLS5	117245	broad.mit.edu	37	11	63256148	63256148	+	Intron	DEL	T	-	-	rs35614311		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63256148delT	uc001nwy.2	-						HRASLS5_uc001nwz.2_Intron|HRASLS5_uc010rmq.1_Intron|HRASLS5_uc009yos.2_Intron	NM_054108	NP_473449			HRAS-like suppressor family, member 5 isoform 1											ovary(1)	1																		---	---	---	---
PDE1B	5153	broad.mit.edu	37	12	54967640	54967641	+	Intron	INS	-	GA	GA	rs142403478	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54967640_54967641insGA	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915			phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109881128	109881131	+	Intron	DEL	TGTA	-	-	rs10545295		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881128_109881131delTGTA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron					SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0																		---	---	---	---
EFNB2	1948	broad.mit.edu	37	13	107147847	107147850	+	Intron	DEL	TATC	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107147847_107147850delTATC	uc001vqi.2	-							NM_004093	NP_004084			ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48054097	48054099	+	Intron	DEL	AAG	-	-	rs149404019		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054097_48054099delAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871			semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
SMG1	23049	broad.mit.edu	37	16	18869474	18869475	+	Intron	INS	-	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18869474_18869475insA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907			PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69059675	69059675	+	Intron	DEL	T	-	-	rs112403015		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059675delT	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
HSBP1	3281	broad.mit.edu	37	16	83843062	83843062	+	Intron	DEL	C	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83843062delC	uc002fgy.1	+							NM_001537	NP_001528			heat shock factor binding protein 1						negative regulation of transcription from RNA polymerase II promoter	nucleus	transcription corepressor activity				0		all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)														---	---	---	---
USP36	57602	broad.mit.edu	37	17	76808780	76808780	+	Intron	DEL	A	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76808780delA	uc002jvz.1	-						USP36_uc002jwa.1_Intron|USP36_uc002jwb.1_Intron|USP36_uc002jwc.1_Intron	NM_025090	NP_079366			ubiquitin specific peptidase 36						ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)															---	---	---	---
HNRNPM	4670	broad.mit.edu	37	19	8520629	8520630	+	Intron	INS	-	T	T	rs151081584	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8520629_8520630insT	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron	NM_005968	NP_005959			heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20243445	20243446	+	Intron	DEL	TG	-	-	rs79559760	by1000genomes	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243445_20243446delTG	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
ATXN10	25814	broad.mit.edu	37	22	46136597	46136598	+	Intron	INS	-	AT	AT	rs67765053		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136597_46136598insAT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368			ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)														---	---	---	---
CRLF2	64109	broad.mit.edu	37	X	1331332	1331332	+	Intron	DEL	G	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1331332delG	uc004cpm.1	-											Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)						Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	X	24447607	24447608	+	IGR	DEL	TT	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24447607_24447608delTT								FAM48B1 (64067 upstream) : PDK3 (35736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	67012555	67012555	+	IGR	DEL	T	-	-			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67012555delT								AR (68436 upstream) : OPHN1 (249633 downstream)																																			---	---	---	---
ATP2B3	492	broad.mit.edu	37	X	152807627	152807627	+	Intron	DEL	C	-	-	rs148248851		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152807627delC	uc004fht.1	+						ATP2B3_uc004fhs.1_Intron	NM_001001344	NP_001001344			plasma membrane calcium ATPase 3 isoform 3b						ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27059176	27059176	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27059176C>T	uc001bmv.1	+	4	2186	c.1813C>T	c.(1813-1815)CAA>TAA	p.Q605*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q605*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q605*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q222*	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	605					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108247235	108247235	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108247235C>T	uc001dvk.1	-	17	1696	c.1642G>A	c.(1642-1644)GGA>AGA	p.G548R	VAV3_uc010ouw.1_Missense_Mutation_p.G548R|VAV3_uc001dvl.1_Missense_Mutation_p.G372R|VAV3_uc010oux.1_Missense_Mutation_p.G548R	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	548	Phorbol-ester/DAG-type.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
TTC13	79573	broad.mit.edu	37	1	231081205	231081205	+	Intron	SNP	T	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231081205T>G	uc001huf.3	-						TTC13_uc009xfi.2_Intron|TTC13_uc009xfj.2_Intron|TTC13_uc001hug.3_Intron|TTC13_uc009xfk.1_Intron	NM_024525	NP_078801			tetratricopeptide repeat domain 13 isoform a								binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)														---	---	---	---
OR2T27	403239	broad.mit.edu	37	1	248813773	248813773	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248813773C>T	uc010pzo.1	-	1	413	c.413G>A	c.(412-414)CGC>CAC	p.R138H		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	90193007	90193007	+	Intron	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90193007G>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125660527	125660527	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125660527G>A	uc002tno.2	+	22	3866	c.3502G>A	c.(3502-3504)GTC>ATC	p.V1168I	CNTNAP5_uc010flu.2_Missense_Mutation_p.V1169I	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1168	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding	p.V1168I(1)		ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
RHBDD1	84236	broad.mit.edu	37	2	227732045	227732045	+	Intron	SNP	T	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227732045T>C	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron	NM_032276	NP_115652			rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)														---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10081483	10081483	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10081483G>A	uc003buw.2	+	9	727	c.649G>A	c.(649-651)GAG>AAG	p.E217K	FANCD2_uc003bux.1_Missense_Mutation_p.E217K|FANCD2_uc003buy.1_Missense_Mutation_p.E217K|FANCD2_uc003buv.2_Missense_Mutation_p.E217K	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	217	Interaction with FANCE.				DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
SLC6A20	54716	broad.mit.edu	37	3	45814049	45814049	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45814049C>A	uc011bai.1	-	5	765	c.641G>T	c.(640-642)GGC>GTC	p.G214V	SLC6A20_uc003cow.2_5'Flank|SLC6A20_uc011baj.1_Intron	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	214	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)														---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89390228	89390228	+	Intron	SNP	A	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89390228A>G	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89480342	89480342	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89480342C>A	uc003dqy.2	+	13	2404	c.2179C>A	c.(2179-2181)CTT>ATT	p.L727I	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	727	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
RASA2	5922	broad.mit.edu	37	3	141305519	141305519	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141305519C>T	uc003etz.1	+	19	1858	c.1858C>T	c.(1858-1860)CGG>TGG	p.R620W	RASA2_uc010huq.1_Missense_Mutation_p.R620W|RASA2_uc003eua.1_Missense_Mutation_p.R620W|RASA2_uc011bnc.1_Missense_Mutation_p.R212W	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	620	PH.				intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6																		---	---	---	---
OTOL1	131149	broad.mit.edu	37	3	161221712	161221712	+	Silent	SNP	T	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161221712T>C	uc011bpb.1	+	4	1416	c.1416T>C	c.(1414-1416)ACT>ACC	p.T472T		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	472	C1q.					collagen					0																		---	---	---	---
SPATA18	132671	broad.mit.edu	37	4	52945045	52945045	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52945045C>A	uc003gzl.2	+	8	1443	c.1165C>A	c.(1165-1167)CAA>AAA	p.Q389K	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.Q357K|SPATA18_uc003gzk.1_Missense_Mutation_p.Q389K	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	389					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)															---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	55155048	55155048	+	Silent	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55155048C>T	uc003han.3	+	20	3088	c.2757C>T	c.(2755-2757)GAC>GAT	p.D919D	PDGFRA_uc003haa.2_Silent_p.D679D	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	919	Protein kinase.|Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57189672	57189672	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57189672C>T	uc003hbk.2	+	9	3708	c.3317C>T	c.(3316-3318)ACG>ATG	p.T1106M	KIAA1211_uc010iha.2_Missense_Mutation_p.T1099M	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1106										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
AGXT2	64902	broad.mit.edu	37	5	35033593	35033593	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35033593T>C	uc003jjf.2	-	6	726	c.647A>G	c.(646-648)GAA>GGA	p.E216G	AGXT2_uc011com.1_Missense_Mutation_p.E216G|AGXT2_uc011con.1_Missense_Mutation_p.E124G	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor	216					glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)													---	---	---	---
WNT8A	7478	broad.mit.edu	37	5	137426675	137426675	+	Silent	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137426675G>A	uc003lcd.1	+	6	974	c.969G>A	c.(967-969)AAG>AAA	p.K323K	BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Silent_p.K341K|WNT8A_uc011cyk.1_Silent_p.K341K	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family,	323					brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			ovary(1)|lung(1)|breast(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
KDM3B	51780	broad.mit.edu	37	5	137734048	137734048	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137734048G>C	uc003lcy.1	+	10	3213	c.3013G>C	c.(3013-3015)GAG>CAG	p.E1005Q	KDM3B_uc010jew.1_Missense_Mutation_p.E661Q|KDM3B_uc011cys.1_Missense_Mutation_p.E37Q	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1005					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11																		---	---	---	---
PCDHA8	56140	broad.mit.edu	37	5	140222519	140222519	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140222519G>A	uc003lhs.2	+	1	1613	c.1613G>A	c.(1612-1614)CGC>CAC	p.R538H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.R538H	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	538	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
CNR1	1268	broad.mit.edu	37	6	88854334	88854334	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854334C>A	uc011dzq.1	-	2	4223	c.660G>T	c.(658-660)AGG>AGT	p.R220S	CNR1_uc010kbz.2_Missense_Mutation_p.R220S|CNR1_uc011dzr.1_Missense_Mutation_p.R220S|CNR1_uc011dzs.1_Missense_Mutation_p.R220S|CNR1_uc003pmq.3_Missense_Mutation_p.R220S|CNR1_uc011dzt.1_Missense_Mutation_p.R220S|CNR1_uc010kca.2_Missense_Mutation_p.R187S	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	220	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)													---	---	---	---
TRA2A	29896	broad.mit.edu	37	7	23545745	23545745	+	Intron	SNP	T	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23545745T>G	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425			transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
KRIT1	889	broad.mit.edu	37	7	91864228	91864228	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91864228C>T	uc003ulq.1	-	7	910	c.739G>A	c.(739-741)GTG>ATG	p.V247M	KRIT1_uc010lev.1_Missense_Mutation_p.V40M|KRIT1_uc003ulr.1_Missense_Mutation_p.V247M|KRIT1_uc003uls.1_Missense_Mutation_p.V247M|KRIT1_uc003ult.1_Missense_Mutation_p.V247M|KRIT1_uc003ulu.1_Missense_Mutation_p.V247M|KRIT1_uc003ulv.1_Missense_Mutation_p.V247M	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1	247					angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)											Familial_Cerebral_Cavernous_Angioma				---	---	---	---
ORAI2	80228	broad.mit.edu	37	7	102079422	102079422	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102079422G>A	uc010lhz.1	+	3	254	c.19G>A	c.(19-21)GTG>ATG	p.V7M	ORAI2_uc003uzj.2_Missense_Mutation_p.V7M|ORAI2_uc003uzk.2_Missense_Mutation_p.V7M|ORAI2_uc011kks.1_Intron	NM_001126340	NP_001119812	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator	7						integral to membrane	protein binding			ovary(1)|kidney(1)	2																		---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139829297	139829297	+	Silent	SNP	A	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139829297A>G	uc003vvm.2	-	4	559	c.555T>C	c.(553-555)TAT>TAC	p.Y185Y		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	185					midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
ATAD2	29028	broad.mit.edu	37	8	124357296	124357296	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124357296G>C	uc003yqh.3	-	19	2654	c.2546C>G	c.(2545-2547)GCT>GGT	p.A849G	ATAD2_uc011lii.1_Missense_Mutation_p.A640G|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.A849G	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	849					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1230815	1230815	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1230815G>A	uc009xhq.2	-	9	2403	c.2029C>T	c.(2029-2031)CGG>TGG	p.R677W	ADARB2_uc009xhp.2_Missense_Mutation_p.R61W|ADARB2_uc001igl.3_Missense_Mutation_p.R39W|ADARB2_uc001igm.3_Missense_Mutation_p.R186W	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	677	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
NLRP14	338323	broad.mit.edu	37	11	7064427	7064427	+	Silent	SNP	A	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7064427A>T	uc001mfb.1	+	4	1493	c.1170A>T	c.(1168-1170)ACA>ACT	p.T390T		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	390	NACHT.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)														---	---	---	---
KBTBD4	55709	broad.mit.edu	37	11	47595060	47595060	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47595060G>A	uc001nfx.2	-	4	1150	c.979C>T	c.(979-981)CCC>TCC	p.P327S	NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.P352S|KBTBD4_uc001nfz.2_Missense_Mutation_p.P343S|KBTBD4_uc001nfy.2_Missense_Mutation_p.P327S	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	327	Kelch 2.									ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SLC22A8	9376	broad.mit.edu	37	11	62763206	62763206	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62763206C>T	uc001nwo.2	-	7	1107	c.971G>A	c.(970-972)CGC>CAC	p.R324H	SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Missense_Mutation_p.R324H|SLC22A8_uc009yom.2_Missense_Mutation_p.R201H|SLC22A8_uc010rmm.1_Missense_Mutation_p.R233H|SLC22A8_uc009yon.2_Missense_Mutation_p.R324H	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	324	Cytoplasmic (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3																		---	---	---	---
M6PR	4074	broad.mit.edu	37	12	9096098	9096098	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9096098T>C	uc001qvf.2	-	5	657	c.487A>G	c.(487-489)AAA>GAA	p.K163E		NM_002355	NP_002346	P20645	MPRD_HUMAN	cation-dependent mannose-6-phosphate receptor	163	Lumenal (Potential).				endosome to lysosome transport|receptor-mediated endocytosis	cell surface|endosome|integral to plasma membrane|lysosomal membrane	mannose binding|mannose transmembrane transporter activity|transmembrane receptor activity				0		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)														---	---	---	---
PYROXD1	79912	broad.mit.edu	37	12	21593302	21593302	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21593302T>G	uc001rew.2	+	2	212	c.85T>G	c.(85-87)TTG>GTG	p.L29V	PYROXD1_uc009ziq.2_5'UTR|PYROXD1_uc009zir.2_Intron	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase	29							oxidoreductase activity			ovary(1)	1																		---	---	---	---
AVIL	10677	broad.mit.edu	37	12	58193602	58193602	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58193602C>G	uc001sqj.1	-	18	2351	c.2322G>C	c.(2320-2322)GAG>GAC	p.E774D	AVIL_uc009zqe.1_Missense_Mutation_p.E767D	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	774	Headpiece (By similarity).|HP.				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)																	---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117768788	117768788	+	Silent	SNP	T	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117768788T>A	uc001twm.1	-	2	773	c.87A>T	c.(85-87)GGA>GGT	p.G29G		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	29	Interaction with NOSIP (By similarity).|PDZ.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
CABP1	9478	broad.mit.edu	37	12	121098064	121098064	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121098064G>T	uc001tyu.2	+	3	818	c.751G>T	c.(751-753)GGC>TGC	p.G251C	CABP1_uc001tyv.2_Missense_Mutation_p.G108C|CABP1_uc001tyw.2_Missense_Mutation_p.G48C|CABP1_uc001tyx.2_Missense_Mutation_p.G93C	NM_001033677	NP_001028849	Q9NZU7	CABP1_HUMAN	calcium binding protein 1 isoform 3	251	EF-hand 1.					cell cortex|cell junction|Golgi apparatus|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|calcium-dependent protein binding|enzyme inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44867122	44867122	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44867122A>G	uc001ztx.2	-	31	6015	c.5984T>C	c.(5983-5985)CTC>CCC	p.L1995P	SPG11_uc010bdw.2_Intron|SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Missense_Mutation_p.L1995P|SPG11_uc001zty.1_Missense_Mutation_p.L724P	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1995	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
MYEF2	50804	broad.mit.edu	37	15	48460981	48460981	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48460981C>T	uc001zwi.3	-	2	341	c.217G>A	c.(217-219)GGA>AGA	p.G73R	MYEF2_uc001zwj.3_Missense_Mutation_p.G73R|MYEF2_uc001zwl.2_5'UTR	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	73					transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)														---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23197794	23197794	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23197794C>G	uc002dlm.1	+	2	341	c.202C>G	c.(202-204)CTC>GTC	p.L68V		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	68	Helical; (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
GPT2	84706	broad.mit.edu	37	16	46918617	46918617	+	5'UTR	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46918617G>A	uc002eel.2	+	2					GPT2_uc002eem.2_5'Flank	NM_133443	NP_597700			glutamic pyruvate transaminase 2 isoform 1						2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72992611	72992611	+	Silent	SNP	T	C	C			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72992611T>C	uc002fck.2	-	2	2107	c.1434A>G	c.(1432-1434)GAA>GAG	p.E478E	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	478	Poly-Glu.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
DSC2	1824	broad.mit.edu	37	18	28671077	28671077	+	Silent	SNP	G	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28671077G>A	uc002kwl.3	-	4	842	c.388C>T	c.(388-390)CTA>TTA	p.L130L	DSC2_uc002kwk.3_Silent_p.L130L	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	130					homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)															---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2389803	2389803	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2389803A>G	uc010xgx.1	+	1	20	c.20A>G	c.(19-21)GAC>GGC	p.D7G	TMPRSS9_uc002lvv.1_Missense_Mutation_p.D7G	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	7	Cytoplasmic (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5258067	5258067	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5258067C>T	uc002mbv.2	-	8	901	c.667G>A	c.(667-669)GGC>AGC	p.G223S	PTPRS_uc002mbu.1_Missense_Mutation_p.G214S|PTPRS_uc010xin.1_Missense_Mutation_p.G214S|PTPRS_uc002mbw.2_Missense_Mutation_p.G214S|PTPRS_uc002mbx.2_Missense_Mutation_p.G214S|PTPRS_uc002mby.2_Missense_Mutation_p.G214S	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	223	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
SLC5A5	6528	broad.mit.edu	37	19	18001723	18001723	+	Silent	SNP	G	A	A	rs149937279		TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18001723G>A	uc002nhr.3	+	14	2027	c.1680G>A	c.(1678-1680)CCG>CCA	p.P560P		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	560	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
ZNF461	92283	broad.mit.edu	37	19	37130636	37130636	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37130636T>A	uc002oem.2	-	6	839	c.611A>T	c.(610-612)CAT>CTT	p.H204L	ZNF461_uc002oen.2_Missense_Mutation_p.H173L|ZNF461_uc010xtj.1_Missense_Mutation_p.H181L	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	204	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)															---	---	---	---
CCDC114	93233	broad.mit.edu	37	19	48806042	48806042	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48806042C>A	uc002pir.2	-	10	1721	c.1038G>T	c.(1036-1038)TTG>TTT	p.L346F	CCDC114_uc002piq.2_Missense_Mutation_p.L155F|CCDC114_uc002pio.2_Missense_Mutation_p.L383F|CCDC114_uc002pis.1_Missense_Mutation_p.L26F|CCDC114_uc002pit.1_Missense_Mutation_p.L383F	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	346	Potential.									ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)														---	---	---	---
ZNF132	7691	broad.mit.edu	37	19	58946280	58946280	+	Silent	SNP	G	A	A	rs150467107	byFrequency	TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58946280G>A	uc002qst.3	-	3	932	c.531C>T	c.(529-531)GAC>GAT	p.D177D		NM_003433	NP_003424	P52740	ZN132_HUMAN	zinc finger protein 132	177						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)														---	---	---	---
TLR8	51311	broad.mit.edu	37	X	12939190	12939190	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12939190G>T	uc004cve.2	+	2	2099	c.2031G>T	c.(2029-2031)AAG>AAT	p.K677N	TLR8_uc004cvd.2_Missense_Mutation_p.K695N	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	677	Extracellular (Potential).|LRR 20.				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7																		---	---	---	---
COL4A5	1287	broad.mit.edu	37	X	107802349	107802349	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5803-01	TCGA-CD-5803-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107802349G>T	uc004enz.1	+	3	399	c.197G>T	c.(196-198)GGT>GTT	p.G66V	COL4A5_uc011mso.1_Missense_Mutation_p.G66V	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	66	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
