Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
VPS13D	55187	broad.mit.edu	37	1	12398046	12398046	+	Intron	DEL	A	-	-	rs145613907		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12398046delA	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
PADI6	353238	broad.mit.edu	37	1	17723476	17723477	+	Intron	INS	-	CA	CA	rs144056968	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17723476_17723477insCA	uc001bak.1	+							NM_207421	NP_997304			peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)													---	---	---	---
ZCCHC11	23318	broad.mit.edu	37	1	52991038	52991038	+	Intron	DEL	T	-	-	rs112941788		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52991038delT	uc001ctx.2	-						ZCCHC11_uc001cty.2_Intron|ZCCHC11_uc001ctz.2_Intron|ZCCHC11_uc009vze.1_Intron|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cub.2_Intron|ZCCHC11_uc001cuc.2_Intron|ZCCHC11_uc001cud.2_Intron	NM_015269	NP_056084			zinc finger, CCHC domain containing 11 isoform						miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
IL12RB2	3595	broad.mit.edu	37	1	67787765	67787766	+	Intron	DEL	TC	-	-	rs71945445		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787765_67787766delTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550			interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
TTF2	8458	broad.mit.edu	37	1	117628869	117628870	+	Intron	INS	-	TG	TG	rs151081029	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117628869_117628870insTG	uc001egy.2	+							NM_003594	NP_003585			transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142726719	142726719	+	Intron	DEL	A	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142726719delA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
PTGS2	5743	broad.mit.edu	37	1	186647652	186647653	+	Intron	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186647652_186647653insA	uc001gsb.2	-						PTGS2_uc009wyo.2_Intron	NM_000963	NP_000954			prostaglandin-endoperoxide synthase 2 precursor						cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)													---	---	---	---
KIAA1804	84451	broad.mit.edu	37	1	233511747	233511748	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233511747_233511748insA	uc001hvt.3	+	7	2022_2023	c.1761_1762insA	c.(1759-1764)AAGAAAfs	p.K587fs	KIAA1804_uc001hvu.3_Frame_Shift_Ins_p.K33fs	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	587_588					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)																---	---	---	---
ADAM17	6868	broad.mit.edu	37	2	9661116	9661117	+	Intron	DEL	GG	-	-	rs56178152		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9661116_9661117delGG	uc002qzu.2	-						ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174			a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)														---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128896088	128896089	+	Intron	INS	-	A	A	rs112766490		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128896088_128896089insA	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505			UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201280997	201280997	+	Intron	DEL	A	-	-	rs67907833		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201280997delA	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
STAC	6769	broad.mit.edu	37	3	36484666	36484667	+	Intron	INS	-	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36484666_36484667insG	uc003cgh.1	+						STAC_uc010hgd.1_Intron|STAC_uc011aya.1_Intron	NM_003149	NP_003140			SH3 and cysteine rich domain						intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52952675	52952676	+	Intron	INS	-	TA	TA	rs140785077	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52952675_52952676insTA	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159			Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53098198	53098199	+	IGR	INS	-	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53098198_53098199insT								SFMBT1 (18128 upstream) : RFT1 (24304 downstream)																																			---	---	---	---
PHC3	80012	broad.mit.edu	37	3	169847493	169847494	+	Intron	INS	-	T	T	rs79158343		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169847493_169847494insT	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron	NM_024947	NP_079223			polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180605395	180605395	+	IGR	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180605395delT								CCDC39 (149733 upstream) : FXR1 (25057 downstream)																																			---	---	---	---
EVC2	132884	broad.mit.edu	37	4	5633294	5633295	+	Intron	INS	-	GG	GG	rs138720670	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5633294_5633295insGG	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338			limbin							integral to membrane				large_intestine(3)|ovary(2)	5																		---	---	---	---
ANKRD17	26057	broad.mit.edu	37	4	73963152	73963152	+	Intron	DEL	T	-	-	rs55834843		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963152delT	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593			ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
C5orf35	133383	broad.mit.edu	37	5	56209591	56209591	+	Intron	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209591delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917			hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)														---	---	---	---
AKD1	221264	broad.mit.edu	37	6	109816378	109816402	+	Intron	DEL	ATTTTAACCACTACATATAAACAAA	-	-	rs57523914		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109816378_109816402delATTTTAACCACTACATATAAACAAA	uc003ptn.2	-						AKD1_uc011eas.1_Intron	NM_001145128	NP_001138600			adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1																		---	---	---	---
AVL9	23080	broad.mit.edu	37	7	33066270	33066270	+	Intron	DEL	T	-	-	rs34317509		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33066270delT	uc011kai.1	+						NT5C3_uc003tdi.2_Intron|NT5C3_uc003tdj.2_Intron|NT5C3_uc003tdk.2_Intron	NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42263043	42263043	+	Intron	DEL	A	-	-	rs35625471		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42263043delA	uc011kbh.1	-							NM_000168	NP_000159			GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
C7orf63	79846	broad.mit.edu	37	7	89929478	89929479	+	Intron	INS	-	T	T	rs35447757		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89929478_89929479insT	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795			hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1																		---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133876636	133876637	+	Intron	INS	-	T	T	rs111830556		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133876636_133876637insT	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151855607	151855608	+	Intron	INS	-	T	T	rs77253307		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151855607_151855608insT	uc003wla.2	-						MLL3_uc003wkz.2_Intron|MLL3_uc003wkx.2_5'Flank|MLL3_uc003wky.2_Intron	NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
RBPMS	11030	broad.mit.edu	37	8	30407259	30407260	+	Intron	INS	-	TTTCTTTGCT	TTTCTTTGCT	rs139991132	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30407259_30407260insTTTCTTTGCT	uc003xic.1	+						RBPMS_uc003xid.1_Intron|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron	NM_006867	NP_006858			RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)														---	---	---	---
NFX1	4799	broad.mit.edu	37	9	33332531	33332531	+	Intron	DEL	C	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33332531delC	uc003zsq.2	+						SUGT1P1_uc010mjq.1_Intron|NFX1_uc011lnw.1_Intron|NFX1_uc003zso.2_Intron|NFX1_uc003zsp.1_Intron|NFX1_uc010mjr.1_Intron|NFX1_uc003zsr.2_Intron	NM_002504	NP_002495			nuclear transcription factor, X-box binding 1						inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)														---	---	---	---
SLC27A4	10999	broad.mit.edu	37	9	131116023	131116023	+	Intron	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131116023delT	uc004but.2	+						SLC27A4_uc004buu.2_Intron	NM_005094	NP_005085			solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	54148810	54148810	+	IGR	DEL	T	-	-	rs78612093		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54148810delT								DKK1 (71394 upstream) : MBL2 (376331 downstream)																																			---	---	---	---
BTAF1	9044	broad.mit.edu	37	10	93702042	93702043	+	Intron	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93702042_93702043insA	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963			BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)																---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116304544	116304544	+	Intron	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116304544delT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304			actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951			DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099			spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19735105	19735105	+	5'UTR	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19735105delT	uc010rdm.1	+	1					NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_5'UTR|LOC100126784_uc010rdl.1_3'UTR	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	30932782	30932783	+	Intron	INS	-	T	T	rs72110565		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30932782_30932783insT	uc001mss.1	-						uc009yjk.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																														---	---	---	---
FAM180B	399888	broad.mit.edu	37	11	47606232	47606232	+	5'Flank	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47606232delT	uc001ngb.1	+											RecName: Full=Protein FAM180B;							integral to membrane					0																		---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20706079	20706080	+	Intron	INS	-	T	T	rs145227642		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20706079_20706080insT	uc001reh.1	+							NM_000921	NP_000912			phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
C12orf39	80763	broad.mit.edu	37	12	21684076	21684077	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21684076_21684077insA	uc001rfa.1	+	6	449_450	c.298_299insA	c.(298-300)GAAfs	p.E100fs	C12orf39_uc009ziv.1_RNA|C12orf39_uc009ziw.1_RNA	NM_030572	NP_085049	Q9BT56	SPXN_HUMAN	spexin precursor	100						extracellular region|nucleus|transport vesicle					0																		---	---	---	---
SLC11A2	4891	broad.mit.edu	37	12	51388601	51388601	+	Intron	DEL	C	-	-	rs11353962		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51388601delC	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc001rxg.1_5'UTR|SLC11A2_uc010smx.1_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608			solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1																		---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52515068	52515069	+	Intron	INS	-	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52515068_52515069insC	uc001vfw.2	-						ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Intron|ATP7B_uc001vfy.2_Intron|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Intron|ATP7B_uc010tgv.1_Intron|ATP7B_uc001vfv.2_Intron|ATP7B_uc010tgs.1_Intron	NM_000053	NP_000044			ATPase, Cu++ transporting, beta polypeptide						ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
METT11D1	64745	broad.mit.edu	37	14	21462442	21462443	+	Intron	INS	-	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21462442_21462443insT	uc001vyn.2	+						METT11D1_uc001vym.2_Intron|METT11D1_uc001vyo.2_Intron|METT11D1_uc001vyp.2_Intron|METT11D1_uc001vyq.2_Intron	NM_022734	NP_073571			methyltransferase 11 domain containing 1 isoform						translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)														---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64607928	64607929	+	Intron	DEL	GT	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64607928_64607929delGT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_5'Flank	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
UBR7	55148	broad.mit.edu	37	14	93685400	93685401	+	Intron	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93685400_93685401insA	uc001ybm.3	+						UBR7_uc001ybn.3_Intron|UBR7_uc010auq.2_Intron	NM_175748	NP_786924			ubiquitin protein ligase E3 component n-recognin								ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
VRK1	7443	broad.mit.edu	37	14	97342131	97342131	+	Intron	DEL	A	-	-	rs34525141		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97342131delA	uc001yft.2	+							NM_003384	NP_003375			vaccinia related kinase 1							cytoplasm|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity			large_intestine(1)|stomach(1)	2		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)														---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0																		---	---	---	---
RAD51	5888	broad.mit.edu	37	15	40993575	40993575	+	Intron	DEL	T	-	-	rs67977099		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40993575delT	uc001zmi.3	+						RAD51_uc010bbw.2_Intron|RAD51_uc010bbx.2_Intron|RAD51_uc001zmk.3_Intron|RAD51_uc001zml.3_Intron|RAD51_uc001zmm.1_Intron|RAD51_uc001zmn.1_Intron	NM_002875	NP_002866			RAD51 homolog protein isoform 1						DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)									Homologous_recombination					---	---	---	---
VPS13C	54832	broad.mit.edu	37	15	62199248	62199249	+	Intron	INS	-	T	T	rs146884252	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62199248_62199249insT	uc002agz.2	-						VPS13C_uc002aha.2_Intron|VPS13C_uc002ahb.1_Intron|VPS13C_uc002ahc.1_Intron|VPS13C_uc002ahd.1_3'UTR	NM_020821	NP_065872			vacuolar protein sorting 13C protein isoform 2A						protein localization					ovary(2)	2																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17294074	17294075	+	Intron	INS	-	A	A	rs142484142	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17294074_17294075insA	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70894832	70894832	+	Intron	DEL	T	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70894832delT	uc002ezr.2	-						HYDIN_uc010cfy.2_Intron	NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	51759465	51759466	+	IGR	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51759465_51759466insA								None (None upstream) : KIF2B (140773 downstream)																																			---	---	---	---
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501			ankyrin repeat domain 30B											ovary(1)|skin(1)	2																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50432877	50432877	+	Intron	DEL	T	-	-	rs74178690		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50432877delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	36448398	36448398	+	IGR	DEL	T	-	-	rs74172775		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36448398delT								LRFN3 (12303 upstream) : SDHAF1 (37703 downstream)																																			---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35696195	35696195	+	Intron	DEL	C	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35696195delC	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886			retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
GEMIN8	54960	broad.mit.edu	37	X	14039552	14039553	+	Intron	INS	-	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14039552_14039553insA	uc004cwb.2	-						GEMIN8_uc004cwc.2_Intron|GEMIN8_uc004cwd.2_Intron	NM_017856	NP_060326			gem (nuclear organelle) associated protein 8						spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0																		---	---	---	---
KLF8	11279	broad.mit.edu	37	X	56296838	56296839	+	Intron	DEL	AG	-	-			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56296838_56296839delAG	uc004dur.2	+						KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_Intron	NM_007250	NP_009181			Kruppel-like factor 8 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7805036	7805036	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7805036A>T	uc001aoi.2	+	17	4531	c.4324A>T	c.(4324-4326)AGT>TGT	p.S1442C	CAMTA1_uc010nzv.1_Missense_Mutation_p.S529C|CAMTA1_uc001aok.3_Missense_Mutation_p.S485C|CAMTA1_uc001aoj.2_Missense_Mutation_p.S398C|CAMTA1_uc009vmf.2_Missense_Mutation_p.S46C	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1442					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12336690	12336690	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12336690T>A	uc001atv.2	+	19	3186	c.3045T>A	c.(3043-3045)GAT>GAA	p.D1015E	VPS13D_uc001atw.2_Missense_Mutation_p.D1015E|VPS13D_uc001atx.2_Missense_Mutation_p.D203E	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1015					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)												OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
HP1BP3	50809	broad.mit.edu	37	1	21072091	21072091	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21072091C>T	uc001bdw.1	-	12	1452	c.1312G>A	c.(1312-1314)GAA>AAA	p.E438K	HP1BP3_uc001bdv.1_Missense_Mutation_p.E400K|HP1BP3_uc010odh.1_Missense_Mutation_p.E400K|HP1BP3_uc001bdy.1_Missense_Mutation_p.E438K|HP1BP3_uc010odf.1_Missense_Mutation_p.E97K|HP1BP3_uc010odg.1_Missense_Mutation_p.E286K	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74	438					nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22203131	22203131	+	Silent	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22203131C>A	uc001bfj.2	-	22	2740	c.2700G>T	c.(2698-2700)GGG>GGT	p.G900G	HSPG2_uc009vqd.2_Silent_p.G901G	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	900	Laminin EGF-like 4; truncated.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
LUZP1	7798	broad.mit.edu	37	1	23419314	23419314	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23419314C>T	uc001bgk.2	-	4	1825	c.1441G>A	c.(1441-1443)GCT>ACT	p.A481T	LUZP1_uc010odv.1_Missense_Mutation_p.A481T|LUZP1_uc001bgl.2_Missense_Mutation_p.A481T|LUZP1_uc001bgm.1_Missense_Mutation_p.A481T	NM_033631	NP_361013	Q86V48	LUZP1_HUMAN	leucine zipper protein 1	481						nucleus					0		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)														---	---	---	---
EIF3I	8668	broad.mit.edu	37	1	32694410	32694410	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32694410A>G	uc001bur.3	+	9	1255	c.722A>G	c.(721-723)TAT>TGT	p.Y241C	EIF3I_uc009vuc.2_Missense_Mutation_p.Y241C|EIF3I_uc001bus.2_Missense_Mutation_p.Y193C	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,	241						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)																---	---	---	---
EIF2C1	26523	broad.mit.edu	37	1	36359271	36359271	+	Intron	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36359271C>G	uc001bzl.2	+						EIF2C1_uc001bzk.2_Intron|EIF2C1_uc009vuy.2_5'Flank	NM_012199	NP_036331			eukaryotic translation initiation factor 2C, 1						negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|polysome	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
MYCL1	4610	broad.mit.edu	37	1	40366767	40366767	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40366767C>A	uc001cer.1	-	2	557	c.340G>T	c.(340-342)GCT>TCT	p.A114S	MYCL1_uc001ces.1_Missense_Mutation_p.A114S|MYCL1_uc001cet.1_Missense_Mutation_p.A114S	NM_001033082	NP_001028254	P12524	MYCL1_HUMAN	l-myc-1 proto-oncogene isoform 1	114						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|liver(1)	2	all_cancers(7;1.73e-14)|all_lung(5;2.77e-17)|all_epithelial(6;6.81e-17)|Lung SC(1;2.85e-13)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.51e-19)|Epithelial(16;3.36e-18)|all cancers(16;8.43e-17)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)					A		small cell lung 								---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70504992	70504992	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70504992A>T	uc001dep.2	+	19	3401	c.3371A>T	c.(3370-3372)GAA>GTA	p.E1124V	LRRC7_uc009wbg.2_Missense_Mutation_p.E408V|LRRC7_uc001deq.2_Missense_Mutation_p.E365V	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1124						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
CD2	914	broad.mit.edu	37	1	117297531	117297531	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117297531G>A	uc001egu.3	+	2	369	c.340G>A	c.(340-342)GGA>AGA	p.G114R	CD2_uc010owz.1_Missense_Mutation_p.G114R|CD2_uc010oxa.1_Missense_Mutation_p.G114R	NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor	114	Extracellular (Potential).|LFA-3 (CD58) binding region 2.|Ig-like V-type.				blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)													---	---	---	---
ANXA9	8416	broad.mit.edu	37	1	150955588	150955588	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150955588G>C	uc001ewa.2	+	3	477	c.7G>C	c.(7-9)GTG>CTG	p.V3L		NM_003568	NP_003559	O76027	ANXA9_HUMAN	annexin A9	3					cell-cell adhesion	cell surface|cytosol	acetylcholine receptor activity|calcium ion binding|calcium-dependent phospholipid binding|phosphatidylserine binding|protein homodimerization activity				0	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152187485	152187485	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187485C>T	uc001ezt.1	-	3	6696	c.6620G>A	c.(6619-6621)CGT>CAT	p.R2207H		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2207	24.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152281606	152281606	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281606C>A	uc001ezu.1	-	3	5792	c.5756G>T	c.(5755-5757)AGC>ATC	p.S1919I		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1919	Ser-rich.|Filaggrin 11.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
SEMA4A	64218	broad.mit.edu	37	1	156128511	156128511	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156128511A>T	uc001fnl.2	+	6	568	c.464A>T	c.(463-465)GAA>GTA	p.E155V	SEMA4A_uc009wrq.2_Missense_Mutation_p.E155V|SEMA4A_uc001fnm.2_Missense_Mutation_p.E155V|SEMA4A_uc001fnn.2_Missense_Mutation_p.E23V|SEMA4A_uc001fno.2_Missense_Mutation_p.E155V	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor	155	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)																	---	---	---	---
MEF2D	4209	broad.mit.edu	37	1	156452386	156452386	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156452386T>G	uc001fpc.2	-	3	491	c.101A>C	c.(100-102)GAG>GCG	p.E34A	MEF2D_uc001fpb.2_Missense_Mutation_p.E34A|MEF2D_uc001fpd.2_Missense_Mutation_p.E34A|MEF2D_uc001fpe.1_Missense_Mutation_p.E34A|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	34	MADS-box.				apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158621190	158621190	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158621190T>C	uc001fst.1	-	24	3643	c.3444A>G	c.(3442-3444)GGA>GGG	p.G1148G		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1148	Spectrin 11.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164815824	164815824	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164815824A>G	uc001gct.2	+	9	1462	c.1204A>G	c.(1204-1206)AAT>GAT	p.N402D	PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Missense_Mutation_p.N319D|PBX1_uc001gcs.2_3'UTR|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	402					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186084089	186084089	+	Intron	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186084089G>A	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186092230	186092230	+	Missense_Mutation	SNP	G	A	A	rs141573564	by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186092230G>A	uc001grq.1	+	81	12606	c.12377G>A	c.(12376-12378)CGC>CAC	p.R4126H		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4126	Ig-like C2-type 40.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
REN	5972	broad.mit.edu	37	1	204125386	204125386	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204125386C>T	uc001haq.2	-	8	924	c.880G>A	c.(880-882)GGT>AGT	p.G294S		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	294					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)													---	---	---	---
TMCC2	9911	broad.mit.edu	37	1	205210799	205210799	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205210799G>A	uc001hbz.1	+	3	818	c.374G>A	c.(373-375)CGC>CAC	p.R125H	TMCC2_uc010prf.1_Missense_Mutation_p.R47H	NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	125						integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)															---	---	---	---
CAPN2	824	broad.mit.edu	37	1	223958166	223958166	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223958166C>T	uc001hob.3	+	18	2066	c.1842C>T	c.(1840-1842)ATC>ATT	p.I614I	CAPN2_uc010puy.1_Silent_p.I536I|CAPN2_uc001hoc.2_Silent_p.I195I	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1	614	Domain IV.|EF-hand 2.				proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)														---	---	---	---
KCNK1	3775	broad.mit.edu	37	1	233802387	233802387	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233802387C>T	uc010pxo.1	+	2	570	c.402C>T	c.(400-402)TGC>TGT	p.C134C	KCNK1_uc001hvw.2_RNA|KCNK1_uc001hvx.2_RNA	NM_002245	NP_002236	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	134	Helical; (Potential).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			central_nervous_system(1)	1		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine(DB00908)													---	---	---	---
NLRP3	114548	broad.mit.edu	37	1	247587155	247587155	+	Missense_Mutation	SNP	G	A	A	rs138946894	byFrequency	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587155G>A	uc001icr.2	+	5	548	c.410G>A	c.(409-411)CGT>CAT	p.R137H	NLRP3_uc001ics.2_Missense_Mutation_p.R137H|NLRP3_uc001icu.2_Missense_Mutation_p.R137H|NLRP3_uc001icw.2_Missense_Mutation_p.R137H|NLRP3_uc001icv.2_Missense_Mutation_p.R137H|NLRP3_uc010pyw.1_Missense_Mutation_p.R135H|NLRP3_uc001ict.1_Missense_Mutation_p.R135H	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	137					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)															---	---	---	---
ROCK2	9475	broad.mit.edu	37	2	11332458	11332458	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11332458G>C	uc002rbd.1	-	32	4428	c.3979C>G	c.(3979-3981)CTG>GTG	p.L1327V		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	1327	PH.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)														---	---	---	---
AGBL5	60509	broad.mit.edu	37	2	27278683	27278683	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278683T>C	uc002rie.2	+	7	1259	c.1042T>C	c.(1042-1044)TCT>CCT	p.S348P	AGBL5_uc002ric.2_Missense_Mutation_p.S348P|AGBL5_uc002rid.2_Missense_Mutation_p.S348P|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	348					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ALK	238	broad.mit.edu	37	2	29416542	29416542	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29416542C>T	uc002rmy.2	-	29	5318	c.4411G>A	c.(4411-4413)GTG>ATG	p.V1471M	ALK_uc010ymo.1_Missense_Mutation_p.V403M	NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	1471	Cytoplasmic (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	p.V1471fs*45(1)	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
LCLAT1	253558	broad.mit.edu	37	2	30863490	30863490	+	3'UTR	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30863490A>G	uc002rnj.2	+	7					LCLAT1_uc010ymp.1_3'UTR|LCLAT1_uc002rnl.2_3'UTR|LCLAT1_uc010ymq.1_3'UTR	NM_182551	NP_872357			lysocardiolipin acyltransferase 1 isoform 1						multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2																		---	---	---	---
QPCT	25797	broad.mit.edu	37	2	37580008	37580008	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37580008G>T	uc002rqg.2	+	2	319	c.197G>T	c.(196-198)TGG>TTG	p.W66L	QPCT_uc002rqh.2_Intron	NM_012413	NP_036545	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase precursor	66					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding			central_nervous_system(1)	1		Ovarian(717;0.051)|all_hematologic(82;0.21)																---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46386767	46386767	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46386767A>C	uc002rut.2	+	14	2140	c.1943A>C	c.(1942-1944)AAG>ACG	p.K648T		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	648	Protein kinase.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
CALM2	805	broad.mit.edu	37	2	47388867	47388867	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47388867T>C	uc002rvt.2	-	5	574	c.416A>G	c.(415-417)TAT>TGT	p.Y139C	C2orf61_uc010fbd.2_Intron|CALM2_uc010fbe.2_RNA	NM_001743	NP_001734	P62158	CALM_HUMAN	calmodulin 2	139	4.|EF-hand 4.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding	p.0?(2)			0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)													---	---	---	---
REG3G	130120	broad.mit.edu	37	2	79255329	79255329	+	Intron	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79255329C>G	uc002snw.2	+						REG3G_uc002snx.2_Intron|REG3G_uc010ffu.2_Intron	NM_198448	NP_940850			regenerating islet-derived 3 gamma precursor						acute-phase response	extracellular region	sugar binding				0																		---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144966261	144966261	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144966261C>T	uc002tvp.2	-	4	367	c.88G>A	c.(88-90)GTT>ATT	p.V30I	GTDC1_uc002tvo.2_Missense_Mutation_p.V30I|GTDC1_uc002tvq.2_Missense_Mutation_p.V30I|GTDC1_uc002tvr.2_Missense_Mutation_p.V30I|GTDC1_uc010fnn.2_Missense_Mutation_p.V30I|GTDC1_uc002tvs.2_5'UTR|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Missense_Mutation_p.V30I	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	30					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)														---	---	---	---
PHOSPHO2	493911	broad.mit.edu	37	2	170557915	170557915	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170557915A>G	uc002ufg.2	+	4	822	c.434A>G	c.(433-435)AAT>AGT	p.N145S	KLHL23_uc002ufh.1_Intron	NM_001008489	NP_001008489	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	145							metal ion binding|pyridoxal phosphatase activity			skin(1)	1																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179395102	179395102	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395102C>G	uc010zfg.1	-	307	98760	c.98536G>C	c.(98536-98538)GAA>CAA	p.E32846Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E26541Q|TTN_uc010zfi.1_Missense_Mutation_p.E26474Q|TTN_uc010zfj.1_Missense_Mutation_p.E26349Q|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33773							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179411375	179411375	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179411375T>G	uc010zfg.1	-	290	87300	c.87076A>C	c.(87076-87078)AGC>CGC	p.S29026R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S22721R|TTN_uc010zfi.1_Missense_Mutation_p.S22654R|TTN_uc010zfj.1_Missense_Mutation_p.S22529R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29953							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
HIBCH	26275	broad.mit.edu	37	2	191069954	191069954	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191069954T>C	uc002uru.2	-	14	1133	c.1050A>G	c.(1048-1050)TTA>TTG	p.L350L	HIBCH_uc002urv.2_Silent_p.*339*	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform	350					branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)															---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197172769	197172769	+	Silent	SNP	G	A	A	rs141027520		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197172769G>A	uc002utm.1	-	11	2658	c.2475C>T	c.(2473-2475)TAC>TAT	p.Y825Y	HECW2_uc002utl.1_Silent_p.Y469Y	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	825	Interaction with TP73.|WW 1.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212295795	212295795	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212295795C>T	uc002veg.1	-	21	2616	c.2518G>A	c.(2518-2520)GTT>ATT	p.V840I	ERBB4_uc002veh.1_Missense_Mutation_p.V840I|ERBB4_uc010zji.1_Missense_Mutation_p.V830I|ERBB4_uc010zjj.1_Missense_Mutation_p.V830I	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	840	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215884365	215884365	+	Silent	SNP	G	A	A	rs143605938		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215884365G>A	uc002vew.2	-	12	1663	c.1443C>T	c.(1441-1443)ACC>ACT	p.T481T	ABCA12_uc002vev.2_Silent_p.T163T|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	481					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
SP100	6672	broad.mit.edu	37	2	231371119	231371119	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231371119A>C	uc002vqt.2	+	22	2113	c.1972A>C	c.(1972-1974)AGT>CGT	p.S658R	SP100_uc002vqs.2_Missense_Mutation_p.S658R|SP100_uc002vqu.1_Missense_Mutation_p.S658R|SP100_uc010fxp.1_5'UTR	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2	658	SAND.				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)														---	---	---	---
NCL	4691	broad.mit.edu	37	2	232327294	232327294	+	Intron	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232327294A>T	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372			nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)														---	---	---	---
UGT1A5	54579	broad.mit.edu	37	2	234622228	234622228	+	Silent	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234622228A>G	uc002vuw.2	+	1	591	c.591A>G	c.(589-591)TTA>TTG	p.L197L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Silent_p.L197L	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	197					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)														---	---	---	---
KLHL30	377007	broad.mit.edu	37	2	239059620	239059620	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239059620C>T	uc002vxr.1	+	7	1630	c.1597C>T	c.(1597-1599)CGG>TGG	p.R533W		NM_198582	NP_940984	Q0D2K2	KLH30_HUMAN	kelch-like 30	551	Kelch 6.										0		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	405076	405076	+	Intron	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:405076T>G	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron|uc003box.1_RNA	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2861193	2861193	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2861193A>G	uc003bpc.2	+	6	603	c.382A>G	c.(382-384)ACA>GCA	p.T128A	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.T128A	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	128	Ig-like C2-type 2.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20193869	20193869	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20193869C>G	uc003cbq.2	+	18	2797	c.2351C>G	c.(2350-2352)TCT>TGT	p.S784C		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	784	Bromo.				cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
KBTBD5	131377	broad.mit.edu	37	3	42733363	42733363	+	Intron	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42733363C>G	uc003clv.1	+							NM_152393	NP_689606			kelch repeat and BTB (POZ) domain containing 5											ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
CCBP2	1238	broad.mit.edu	37	3	42906025	42906025	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42906025G>A	uc003cme.2	+	3	210	c.31G>A	c.(31-33)GCC>ACC	p.A11T	CCBP2_uc003cmd.1_Missense_Mutation_p.A11T|CCBP2_uc003cmf.2_Missense_Mutation_p.A11T|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	11	Extracellular (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)														---	---	---	---
LAMB2	3913	broad.mit.edu	37	3	49162318	49162318	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49162318G>A	uc003cwe.2	-	21	3224	c.2925C>T	c.(2923-2925)GAC>GAT	p.D975D	LAMB2_uc003cwf.1_Silent_p.D975D	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	975	Laminin EGF-like 9.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
GRM2	2912	broad.mit.edu	37	3	51749896	51749896	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51749896C>G	uc010hlv.2	+	4	2346	c.2107C>G	c.(2107-2109)CCG>GCG	p.P703A	GRM2_uc003dbo.3_Missense_Mutation_p.P85A|GRM2_uc010hlu.2_RNA	NM_000839	NP_000830	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2 isoform a	703	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)													---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52613217	52613217	+	Splice_Site	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52613217T>G	uc003des.2	-	21	3400	c.3388_splice	c.e21-1	p.E1130_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.E1130_splice|PBRM1_uc003der.2_Splice_Site_p.E1098_splice|PBRM1_uc003det.2_Splice_Site_p.E1145_splice|PBRM1_uc003deu.2_Splice_Site_p.E1145_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.E1130_splice|PBRM1_uc010hmk.1_Splice_Site_p.E1105_splice|PBRM1_uc003dey.2_Splice_Site_p.E1105_splice|PBRM1_uc003dez.1_Splice_Site_p.E1129_splice	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62739191	62739191	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62739191C>T	uc003dll.2	-	3	1173	c.813G>A	c.(811-813)GAG>GAA	p.E271E	CADPS_uc003dlm.2_Silent_p.E271E|CADPS_uc003dln.2_Silent_p.E271E	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	271					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
PRICKLE2	166336	broad.mit.edu	37	3	64133178	64133178	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64133178T>C	uc003dmf.2	-	7	1574	c.988A>G	c.(988-990)AGG>GGG	p.R330G		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	330						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	66023967	66023967	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66023967T>A	uc003dmn.2	-	1	543	c.17A>T	c.(16-18)CAG>CTG	p.Q6L	MAGI1_uc003dmm.2_Missense_Mutation_p.Q6L|MAGI1_uc003dmo.2_Missense_Mutation_p.Q6L|MAGI1_uc003dmp.2_Missense_Mutation_p.Q6L|MAGI1_uc003dmr.2_Missense_Mutation_p.Q6L	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	6					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89462426	89462426	+	Intron	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89462426A>G	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
CRYBG3	131544	broad.mit.edu	37	3	97596094	97596094	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97596094G>C	uc003drx.2	+	1	276	c.212G>C	c.(211-213)AGA>ACA	p.R71T		NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134514496	134514496	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134514496T>A	uc003eqt.2	+	1	243	c.23T>A	c.(22-24)CTG>CAG	p.L8Q	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Missense_Mutation_p.L8Q	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	8						integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134968251	134968251	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134968251G>A	uc003eqt.2	+	15	2984	c.2764G>A	c.(2764-2766)GCC>ACC	p.A922T	EPHB1_uc003equ.2_Missense_Mutation_p.A483T	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	922	Cytoplasmic (Potential).|SAM.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
PPP2R3A	5523	broad.mit.edu	37	3	135801212	135801212	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135801212G>A	uc003eqv.1	+	8	3302	c.2737G>A	c.(2737-2739)GAT>AAT	p.D913N	PPP2R3A_uc011blz.1_Missense_Mutation_p.D177N|PPP2R3A_uc003eqw.1_Missense_Mutation_p.D292N|PPP2R3A_uc011bma.1_RNA	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	913					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136062737	136062737	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136062737G>T	uc003era.1	-	30	3675	c.3383C>A	c.(3382-3384)CCC>CAC	p.P1128H	STAG1_uc003erb.1_Missense_Mutation_p.P1128H	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1128					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
HAUS3	79441	broad.mit.edu	37	4	2242267	2242267	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2242267C>G	uc003ges.1	-	2	637	c.407G>C	c.(406-408)AGG>ACG	p.R136T	POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Missense_Mutation_p.R136T|HAUS3_uc003get.1_Missense_Mutation_p.R136T	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	136	Potential.				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				large_intestine(2)|breast(2)	4																		---	---	---	---
REST	5978	broad.mit.edu	37	4	57797539	57797539	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797539G>T	uc003hch.2	+	4	2862	c.2515G>T	c.(2515-2517)GAA>TAA	p.E839*	REST_uc003hci.2_Nonsense_Mutation_p.E839*|REST_uc010ihf.2_Nonsense_Mutation_p.E513*	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	839					cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---
TET2	54790	broad.mit.edu	37	4	106158510	106158510	+	Splice_Site	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106158510T>C	uc003hxk.2	+	3	3795	c.3409_splice	c.e3+2	p.E1137_splice	TET2_uc011cez.1_Splice_Site_p.E1158_splice|TET2_uc003hxj.2_Splice_Site|TET2_uc010ilp.1_Splice_Site_p.E1137_splice|TET2_uc003hxi.1_Silent_p.G1137G	NM_001127208	NP_001120680			tet oncogene family member 2 isoform a						cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)				Mis N|F		MDS								---	---	---	---
ANKRD50	57182	broad.mit.edu	37	4	125590479	125590479	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125590479G>A	uc003ifg.3	-	3	4219	c.3953C>T	c.(3952-3954)CCA>CTA	p.P1318L	ANKRD50_uc011cgo.1_Missense_Mutation_p.P1139L|ANKRD50_uc010inw.2_Missense_Mutation_p.P1318L	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1318										central_nervous_system(1)	1																		---	---	---	---
CCT5	22948	broad.mit.edu	37	5	10262642	10262642	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10262642G>A	uc003jeq.2	+	9	1400	c.1229G>A	c.(1228-1230)CGG>CAG	p.R410Q	CCT5_uc003jer.2_Missense_Mutation_p.R410Q|CCT5_uc010its.2_Missense_Mutation_p.R410Q|CCT5_uc011cmr.1_Missense_Mutation_p.R355Q|CCT5_uc011cms.1_Missense_Mutation_p.R372Q|CCT5_uc011cmt.1_Missense_Mutation_p.R317Q	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	410					'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2																		---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19591325	19591325	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19591325T>C	uc003jgc.2	-	6	1217	c.840A>G	c.(838-840)TCA>TCG	p.S280S	CDH18_uc003jgd.2_Silent_p.S280S|CDH18_uc011cnm.1_Silent_p.S280S	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	280	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
CDH9	1007	broad.mit.edu	37	5	26889953	26889953	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26889953G>A	uc003jgs.1	-	9	1673	c.1504C>T	c.(1504-1506)CCT>TCT	p.P502S	CDH9_uc011cnv.1_Missense_Mutation_p.P95S	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	502	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9																		---	---	---	---
OSMR	9180	broad.mit.edu	37	5	38919169	38919169	+	Intron	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38919169G>C	uc003jln.1	+						OSMR_uc011cpj.1_Intron	NM_003999	NP_003990			oncostatin M receptor precursor						cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)																	---	---	---	---
TTC37	9652	broad.mit.edu	37	5	94849310	94849310	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94849310C>T	uc003klb.2	-	27	3013	c.2743G>A	c.(2743-2745)GAT>AAT	p.D915N		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	915							binding			ovary(3)|pancreas(1)	4																		---	---	---	---
SLC25A46	91137	broad.mit.edu	37	5	110091222	110091222	+	Splice_Site	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110091222G>A	uc003koz.2	+	6	687	c.620_splice	c.e6+1	p.S207_splice	SLC25A46_uc011cvi.1_Splice_Site_p.S116_splice	NM_138773	NP_620128			solute carrier family 25, member 46						transport	integral to membrane|mitochondrial inner membrane					0		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)														---	---	---	---
YTHDC2	64848	broad.mit.edu	37	5	112884712	112884712	+	Silent	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112884712T>A	uc003kqn.2	+	12	1866	c.1683T>A	c.(1681-1683)TCT>TCA	p.S561S	YTHDC2_uc010jce.1_Silent_p.S561S|YTHDC2_uc010jcf.1_Silent_p.S261S	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	561	ANK 2.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)														---	---	---	---
KCNN2	3781	broad.mit.edu	37	5	113822818	113822818	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113822818G>C	uc003kqo.2	+	6	1783	c.1326G>C	c.(1324-1326)AAG>AAC	p.K442N	KCNN2_uc003kqp.2_Missense_Mutation_p.K94N|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	442	Calmodulin-binding (By similarity).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)														---	---	---	---
PCDH12	51294	broad.mit.edu	37	5	141334943	141334943	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141334943G>A	uc003llx.2	-	1	3685	c.2474C>T	c.(2473-2475)ACG>ATG	p.T825M		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	825	Cytoplasmic (Potential).				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167643779	167643779	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167643779C>T	uc010jjd.2	+	22	4058	c.4058C>T	c.(4057-4059)GCA>GTA	p.A1353V	ODZ2_uc003lzr.3_Missense_Mutation_p.A1123V|ODZ2_uc003lzt.3_Missense_Mutation_p.A726V|ODZ2_uc010jje.2_Missense_Mutation_p.A617V	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
DDX41	51428	broad.mit.edu	37	5	176941731	176941731	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176941731G>A	uc003mho.2	-	9	927	c.906C>T	c.(904-906)TCC>TCT	p.S302S	DDX41_uc003mhm.2_Silent_p.S82S|DDX41_uc003mhn.2_Silent_p.S171S|DDX41_uc003mhp.2_Silent_p.S171S|DDX41_uc003mhq.1_Silent_p.S82S	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	302	Helicase ATP-binding.				apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)															---	---	---	---
GCM2	9247	broad.mit.edu	37	6	10876784	10876784	+	Missense_Mutation	SNP	G	T	T	rs35786951	byFrequency;by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10876784G>T	uc003mzn.3	-	3	422	c.350C>A	c.(349-351)GCA>GAA	p.A117E	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	117	GCM.				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)																---	---	---	---
BTN2A3	54718	broad.mit.edu	37	6	26431045	26431045	+	Silent	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26431045G>C	uc011dkl.1	+	6	993	c.963G>C	c.(961-963)GTG>GTC	p.V321V	BTN2A3_uc011dkm.1_Intron					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0																		---	---	---	---
BAI3	577	broad.mit.edu	37	6	70049307	70049307	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70049307C>T	uc003pev.3	+	26	3818	c.3370C>T	c.(3370-3372)CGC>TGC	p.R1124C	BAI3_uc010kak.2_Missense_Mutation_p.R1124C|BAI3_uc011dxx.1_Missense_Mutation_p.R330C|BAI3_uc003pex.1_Missense_Mutation_p.R254C	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1124	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	p.R1124C(1)		lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
DOPEY1	23033	broad.mit.edu	37	6	83847707	83847707	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83847707G>C	uc003pjs.1	+	21	4206	c.3946G>C	c.(3946-3948)GAA>CAA	p.E1316Q	DOPEY1_uc011dyy.1_Missense_Mutation_p.E1307Q|DOPEY1_uc010kbl.1_Missense_Mutation_p.E1307Q|DOPEY1_uc003pjt.2_RNA	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	1316					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)														---	---	---	---
C6orf168	84553	broad.mit.edu	37	6	99797102	99797102	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99797102A>C	uc003ppj.3	-	1	430	c.147T>G	c.(145-147)GAT>GAG	p.D49E		NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553	49										ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)														---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14775679	14775679	+	Silent	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14775679A>T	uc003ssz.2	-	4	496	c.309T>A	c.(307-309)GCT>GCA	p.A103A	DGKB_uc011jxt.1_Silent_p.A96A|DGKB_uc003sta.2_Silent_p.A103A|DGKB_uc011jxu.1_Silent_p.A103A|DGKB_uc011jxv.1_Silent_p.A103A	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	103					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
PRPS1L1	221823	broad.mit.edu	37	7	18067043	18067043	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18067043C>T	uc003stz.2	-	1	444	c.363G>A	c.(361-363)GCG>GCA	p.A121A		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	121					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)																	---	---	---	---
C7orf41	222166	broad.mit.edu	37	7	30185788	30185788	+	Intron	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30185788C>T	uc011kab.1	+						C7orf41_uc010kvr.1_Intron|C7orf41_uc003tar.1_Intron	NM_152793	NP_690006			hypothetical protein LOC222166												0																		---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	31815302	31815302	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31815302A>T	uc003tcm.1	-	17	2405	c.1936T>A	c.(1936-1938)TCC>ACC	p.S646T	PDE1C_uc003tcn.1_Missense_Mutation_p.S646T|PDE1C_uc003tco.1_Missense_Mutation_p.S706T	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	646					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43547678	43547678	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43547678C>T	uc003tid.1	+	23	4419	c.3814C>T	c.(3814-3816)CGG>TGG	p.R1272W	HECW1_uc011kbi.1_Missense_Mutation_p.R1238W	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1272	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
VWC2	375567	broad.mit.edu	37	7	49951740	49951740	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49951740C>T	uc003tot.1	+	4	1493	c.937C>T	c.(937-939)CGG>TGG	p.R313W		NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	313					negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space					0																		---	---	---	---
GBAS	2631	broad.mit.edu	37	7	56062651	56062651	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56062651G>T	uc003tre.1	+	8	690	c.682G>T	c.(682-684)GGG>TGG	p.G228W	GBAS_uc003trf.1_Missense_Mutation_p.G189W	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2	228						integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66474641	66474641	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66474641A>T	uc003tvn.2	+	4	494	c.345A>T	c.(343-345)GAA>GAT	p.E115D	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	115	Flavodoxin-like.				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
SLC26A3	1811	broad.mit.edu	37	7	107408210	107408210	+	Splice_Site	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107408210C>T	uc003ver.2	-	19	2416	c.2205_splice	c.e19+1	p.Q735_splice	SLC26A3_uc003ves.2_Splice_Site_p.Q622_splice	NM_000111	NP_000102			solute carrier family 26, member 3						excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4																		---	---	---	---
NUP205	23165	broad.mit.edu	37	7	135301844	135301844	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135301844G>A	uc003vsw.2	+	26	3570	c.3539G>A	c.(3538-3540)CGA>CAA	p.R1180Q	NUP205_uc003vsx.2_5'Flank	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1180					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
TRIM24	8805	broad.mit.edu	37	7	138269538	138269538	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138269538G>A	uc003vuc.2	+	19	3210	c.2995G>A	c.(2995-2997)GAA>AAA	p.E999K	TRIM24_uc003vub.2_Missense_Mutation_p.E965K	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	999					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8																		---	---	---	---
CASP2	835	broad.mit.edu	37	7	143000938	143000938	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143000938C>T	uc003wco.2	+	9	1176	c.1029C>T	c.(1027-1029)TGC>TGT	p.C343C	CASP2_uc003wcp.2_3'UTR|CASP2_uc011kta.1_Silent_p.C227C|CASP2_uc003wcq.2_RNA|CASP2_uc011ktb.1_Silent_p.C93C	NM_032982	NP_116764	P42575	CASP2_HUMAN	caspase 2 isoform 1 preproprotein	343					apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding			lung(2)|ovary(1)	3	Melanoma(164;0.059)																	---	---	---	---
REPIN1	29803	broad.mit.edu	37	7	150066881	150066881	+	5'UTR	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150066881C>T	uc010lpq.1	+	2					REPIN1_uc003whd.2_5'UTR|REPIN1_uc010lpr.1_Silent_p.C27C|REPIN1_uc003whc.2_Intron|REPIN1_uc003whe.2_5'Flank	NM_013400	NP_037532			replication initiator 1 isoform 1						DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)															---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27292021	27292021	+	Intron	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27292021C>T	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron|PTK2B_uc010luq.1_Intron|PTK2B_uc003xfr.1_Intron	NM_173174	NP_775266			PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
SOX17	64321	broad.mit.edu	37	8	55372564	55372564	+	3'UTR	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55372564T>C	uc003xsb.3	+	2						NM_022454	NP_071899			SRY-box 17						angiogenesis|cardiac cell fate determination|endocardial cell differentiation|endocardium formation|endoderm formation|heart formation|heart looping|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|outflow tract morphogenesis|positive regulation of transcription, DNA-dependent|protein destabilization|protein stabilization|regulation of embryonic development|renal system development|vasculogenesis|Wnt receptor signaling pathway	transcription factor complex	beta-catenin binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			lung(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)															---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68123821	68123821	+	Silent	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68123821A>T	uc003xxo.1	-	34	5106	c.4716T>A	c.(4714-4716)ATT>ATA	p.I1572I	ARFGEF1_uc003xxl.1_Silent_p.I1026I|ARFGEF1_uc003xxn.1_Silent_p.I549I	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1572					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	p.I1572V(1)		ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68999988	68999988	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68999988G>A	uc003xxv.1	+	19	2084	c.2057G>A	c.(2056-2058)GGA>GAA	p.G686E	PREX2_uc003xxu.1_Missense_Mutation_p.G686E|PREX2_uc011lez.1_Missense_Mutation_p.G621E	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	686	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69031757	69031757	+	Intron	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69031757C>T	uc003xxv.1	+							NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PAG1	55824	broad.mit.edu	37	8	81897177	81897177	+	Missense_Mutation	SNP	C	T	T	rs138317242		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81897177C>T	uc003ybz.2	-	7	1421	c.710G>A	c.(709-711)CGT>CAT	p.R237H		NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid	237	Cytoplasmic (Potential).				epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)															---	---	---	---
CDH17	1015	broad.mit.edu	37	8	95186360	95186360	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95186360T>A	uc003ygh.2	-	6	678	c.553A>T	c.(553-555)AAA>TAA	p.K185*	CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Nonsense_Mutation_p.K185*	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	185	Extracellular (Potential).|Cadherin 2.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)															---	---	---	---
PTDSS1	9791	broad.mit.edu	37	8	97318782	97318782	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97318782G>A	uc003yht.1	+	8	1107	c.1005G>A	c.(1003-1005)GTG>GTA	p.V335V	PTDSS1_uc003yhu.1_Silent_p.V189V	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	335					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)													---	---	---	---
DPYS	1807	broad.mit.edu	37	8	105441868	105441868	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105441868C>A	uc003yly.3	-	5	984	c.855G>T	c.(853-855)TGG>TGT	p.W285C		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	285					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106456569	106456569	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106456569G>A	uc003ymd.2	+	3	284	c.261G>A	c.(259-261)CCG>CCA	p.P87P		NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	87					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
KCNV1	27012	broad.mit.edu	37	8	110984700	110984700	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110984700G>A	uc003ynr.3	-	2	1120	c.778C>T	c.(778-780)CGC>TGC	p.R260C	KCNV1_uc010mcw.2_Missense_Mutation_p.R260C	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	260	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114326985	114326985	+	Silent	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114326985A>G	uc003ynu.2	-	2	375	c.216T>C	c.(214-216)CTT>CTC	p.L72L	CSMD3_uc003ynt.2_Silent_p.L32L|CSMD3_uc011lhx.1_Silent_p.L72L|CSMD3_uc010mcx.1_Silent_p.L72L|CSMD3_uc003ynx.3_Silent_p.L72L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	72	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139190937	139190937	+	Intron	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139190937G>T	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
KIAA1432	57589	broad.mit.edu	37	9	5763255	5763255	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5763255G>C	uc003zji.2	+	18	2084	c.1991G>C	c.(1990-1992)GGT>GCT	p.G664A	KIAA1432_uc003zjh.2_Missense_Mutation_p.G664A|KIAA1432_uc003zjl.3_Missense_Mutation_p.G627A|KIAA1432_uc003zjj.1_Missense_Mutation_p.G206A	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	743						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18777842	18777842	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18777842C>T	uc003zne.3	+	19	3742	c.3615C>T	c.(3613-3615)ATC>ATT	p.I1205I		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1205	Ig-like C2-type 2.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77397699	77397699	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77397699G>A	uc004ajl.1	-	22	3228	c.2990C>T	c.(2989-2991)GCC>GTC	p.A997V	TRPM6_uc004ajk.1_Missense_Mutation_p.A992V|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Missense_Mutation_p.A283V	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	997	Extracellular (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CYLC2	1539	broad.mit.edu	37	9	105767382	105767382	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105767382G>C	uc004bbs.2	+	5	539	c.469G>C	c.(469-471)GCA>CCA	p.A157P		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	157	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.|1.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)																---	---	---	---
OR13C8	138802	broad.mit.edu	37	9	107332160	107332160	+	Missense_Mutation	SNP	T	C	C	rs150811269	byFrequency;by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107332160T>C	uc011lvo.1	+	1	712	c.712T>C	c.(712-714)TTC>CTC	p.F238L		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	238	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
TXNDC8	255220	broad.mit.edu	37	9	113091581	113091581	+	Intron	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113091581A>T	uc004bes.2	-						TXNDC8_uc011lwl.1_Intron	NM_001003936	NP_001003936			thioredoxin domain containing 8						cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	Golgi apparatus	electron carrier activity|protein disulfide oxidoreductase activity				0																		---	---	---	---
DFNB31	25861	broad.mit.edu	37	9	117188662	117188662	+	Missense_Mutation	SNP	C	T	T	rs139193948	byFrequency;by1000genomes	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117188662C>T	uc004biz.3	-	4	1644	c.995G>A	c.(994-996)CGG>CAG	p.R332Q	DFNB31_uc004bix.2_5'Flank|DFNB31_uc004biy.3_5'UTR|DFNB31_uc004bja.3_Missense_Mutation_p.R332Q	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	332	PDZ 2.				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
TNC	3371	broad.mit.edu	37	9	117786383	117786383	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117786383A>T	uc004bjj.3	-	27	6726	c.6364T>A	c.(6364-6366)TTC>ATC	p.F2122I	TNC_uc010mvf.2_Missense_Mutation_p.F1849I	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	2122	Fibrinogen C-terminal.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
SCAI	286205	broad.mit.edu	37	9	127733666	127733666	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127733666T>G	uc004bpe.2	-	17	1738	c.1657A>C	c.(1657-1659)ATG>CTG	p.M553L	SCAI_uc004bpd.2_Missense_Mutation_p.M576L|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	553				M -> T (in Ref. 1; BAC05217).	negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5																		---	---	---	---
NUP214	8021	broad.mit.edu	37	9	134022974	134022974	+	Intron	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134022974A>T	uc004cag.2	+						NUP214_uc004cah.2_Intron|NUP214_uc004cai.2_Intron|NUP214_uc004caf.1_Intron|NUP214_uc010mzf.2_Intron	NM_005085	NP_005076			nucleoporin 214kDa						carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)				T	DEK|SET|ABL1	AML|T-ALL								---	---	---	---
ADAMTS13	11093	broad.mit.edu	37	9	136309974	136309974	+	Intron	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136309974C>T	uc004cdv.3	+						ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Intron|ADAMTS13_uc004cdu.1_Intron|ADAMTS13_uc004cdw.3_Intron|ADAMTS13_uc004cdx.3_Intron|ADAMTS13_uc004cdy.1_Intron|ADAMTS13_uc004cdz.3_Intron|ADAMTS13_uc004cds.1_Intron|ADAMTS13_uc004cdr.1_Intron	NM_139025	NP_620594			ADAM metallopeptidase with thrombospondin type 1						cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)														---	---	---	---
HSPA14	51182	broad.mit.edu	37	10	14881921	14881921	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14881921G>A	uc001inf.2	+	2	216	c.75G>A	c.(73-75)GTG>GTA	p.V25V	CDNF_uc001inb.1_5'Flank|CDNF_uc010qbv.1_5'Flank|CDNF_uc001inc.1_5'Flank|HSPA14_uc001ind.2_5'UTR|HSPA14_uc001ine.2_Silent_p.V25V|HSPA14_uc010qbw.1_Silent_p.V25V	NM_016299	NP_057383	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14 isoform 1	25					'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding			ovary(2)|breast(2)|lung(1)	5																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56424016	56424016	+	Nonsense_Mutation	SNP	G	A	A	rs137853001		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56424016G>A	uc001jju.1	-	2	402	c.7C>T	c.(7-9)CGA>TGA	p.R3*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qht.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.R3*|PCDH15_uc001jjv.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhv.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qia.1_Nonsense_Mutation_p.R3*|PCDH15_uc010qib.1_Nonsense_Mutation_p.R3*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.R3*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	3					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
UNC5B	219699	broad.mit.edu	37	10	73048388	73048388	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73048388G>A	uc001jro.2	+	7	1410	c.965G>A	c.(964-966)CGT>CAT	p.R322H	UNC5B_uc001jrp.2_Missense_Mutation_p.R322H	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor	322	TSP type-1 2.|Extracellular (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3																		---	---	---	---
CNNM1	26507	broad.mit.edu	37	10	101147700	101147700	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101147700C>T	uc001kpp.3	+	8	2753	c.2464C>T	c.(2464-2466)CCC>TCC	p.P822S	CNNM1_uc010qpi.1_Missense_Mutation_p.P843S|CNNM1_uc009xwf.2_Missense_Mutation_p.P822S|CNNM1_uc009xwg.2_Missense_Mutation_p.P222S	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1	822					ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)														---	---	---	---
ABCC2	1244	broad.mit.edu	37	10	101590609	101590609	+	Splice_Site	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101590609G>A	uc001kqf.2	+	21	3022	c.2883_splice	c.e21+1	p.K961_splice		NM_000392	NP_000383			ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
TRIM5	85363	broad.mit.edu	37	11	5686494	5686494	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5686494T>A	uc001mbm.1	-	8	1284	c.1027A>T	c.(1027-1029)AAT>TAT	p.N343Y	TRIM78P_uc009yer.2_RNA|TRIM5_uc001mbl.1_RNA|TRIM5_uc001mbn.2_Intron|TRIM5_uc001mbo.2_Intron|TRIM5_uc001mbp.2_3'UTR	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha	343	B30.2/SPRY.				interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)														---	---	---	---
OR10A4	283297	broad.mit.edu	37	11	6898541	6898541	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6898541C>T	uc010rat.1	+	1	663	c.663C>T	c.(661-663)CGC>CGT	p.R221R		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---
F2	2147	broad.mit.edu	37	11	46744726	46744726	+	Intron	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46744726G>A	uc001ndf.3	+						F2_uc001ndg.3_Intron	NM_000506	NP_000497			coagulation factor II preproprotein						activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62291859	62291859	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62291859C>T	uc001ntl.2	-	5	10330	c.10030G>A	c.(10030-10032)GAA>AAA	p.E3344K	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	3344					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
CCDC88B	283234	broad.mit.edu	37	11	64108164	64108164	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64108164T>C	uc001nzy.2	+	2	190	c.146T>C	c.(145-147)TTG>TCG	p.L49S	CCDC88B_uc009ypo.1_Missense_Mutation_p.L49S|CCDC88B_uc001nzz.1_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	49					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4																		---	---	---	---
SNX15	29907	broad.mit.edu	37	11	64802601	64802601	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64802601C>T	uc001oci.3	+	8	1096	c.443C>T	c.(442-444)ACC>ATC	p.T148I	SNX15_uc009ypy.2_Missense_Mutation_p.T148I|SNX15_uc001ocj.2_Missense_Mutation_p.T148I|SNX15_uc001ock.2_Missense_Mutation_p.T148I	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	148					cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1																		---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88780945	88780945	+	Silent	SNP	C	T	T	rs78028403	byFrequency	TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780945C>T	uc001pcq.2	-	1	296	c.96G>A	c.(94-96)CCG>CCA	p.P32P	GRM5_uc009yvm.2_Silent_p.P32P|GRM5_uc009yvn.1_Silent_p.P32P	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	32	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	p.P32L(1)		central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92495088	92495088	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92495088G>T	uc001pdj.3	+	4	3753	c.3736G>T	c.(3736-3738)GAT>TAT	p.D1246Y		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1246	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
TBCEL	219899	broad.mit.edu	37	11	120957792	120957792	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120957792C>A	uc009zay.2	+	8	1340	c.1262C>A	c.(1261-1263)TCC>TAC	p.S421Y	TBCEL_uc001pxo.2_Missense_Mutation_p.S421Y|TBCEL_uc001pxp.2_Missense_Mutation_p.S277Y|TBCEL_uc001pxq.2_RNA	NM_001130047	NP_001123519	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	421	Ubiquitin-like.					cytoplasm|cytoskeleton				skin(1)	1		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)														---	---	---	---
HSPA8	3312	broad.mit.edu	37	11	122931927	122931927	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122931927G>C	uc001pyo.2	-	2	184	c.106C>G	c.(106-108)CGA>GGA	p.R36G	HSPA8_uc009zbc.2_5'Flank|HSPA8_uc001pyp.2_Missense_Mutation_p.R36G|HSPA8_uc010rzu.1_Missense_Mutation_p.R36G|HSPA8_uc009zbd.1_Missense_Mutation_p.R36G|HSPA8_uc010rzv.1_Missense_Mutation_p.R36G	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	36					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)														---	---	---	---
OR10S1	219873	broad.mit.edu	37	11	123847671	123847671	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123847671C>T	uc001pzm.1	-	1	728	c.728G>A	c.(727-729)CGC>CAC	p.R243H		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	243	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)														---	---	---	---
OR8A1	390275	broad.mit.edu	37	11	124439973	124439973	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124439973C>A	uc010san.1	+	1	9	c.9C>A	c.(7-9)TTC>TTA	p.F3L		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	3	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)														---	---	---	---
LOH12CR1	118426	broad.mit.edu	37	12	12618516	12618516	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12618516C>A	uc001ral.2	+	4	763	c.397C>A	c.(397-399)CAG>AAG	p.Q133K	LOH12CR1_uc009zhu.2_Missense_Mutation_p.Q85K	NM_058169	NP_477517	Q969J3	L12R1_HUMAN	LOH1CR12	133										ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	24737025	24737025	+	RNA	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737025G>T	uc001rgb.1	-	1		c.78C>A								Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																														---	---	---	---
BHLHE41	79365	broad.mit.edu	37	12	26277452	26277452	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26277452C>T	uc001rhb.2	-	2	417	c.126G>A	c.(124-126)AAG>AAA	p.K42K		NM_030762	NP_110389	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix domain containing, class	42					cell differentiation|cell proliferation|organ morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
ATP5B	506	broad.mit.edu	37	12	57037245	57037245	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57037245T>C	uc001slr.2	-	5	839	c.734A>G	c.(733-735)GAT>GGT	p.D245G		NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	245					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1																		---	---	---	---
NACA	4666	broad.mit.edu	37	12	57106973	57106973	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57106973A>G	uc001slz.2	-	6	732	c.383T>C	c.(382-384)ATC>ACC	p.I128T	NACA_uc001sly.2_Missense_Mutation_p.I128T|NACA_uc009zoy.1_Missense_Mutation_p.I1991T|NACA_uc001smc.2_Missense_Mutation_p.I128T|NACA_uc001sma.2_Missense_Mutation_p.I838T|NACA_uc001smb.2_Missense_Mutation_p.I128T|NACA_uc010squ.1_RNA	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha	128	NAC-A/B.				interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding	p.I128M(1)		ovary(1)	1								T	BCL6	NHL								---	---	---	---
CAND1	55832	broad.mit.edu	37	12	67675753	67675753	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67675753T>C	uc001stn.2	+	2	569	c.132T>C	c.(130-132)GAT>GAC	p.D44D		NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	44	HEAT 2.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)														---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85500366	85500366	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85500366A>C	uc001tac.2	+	15	3461	c.3350A>C	c.(3349-3351)AAC>ACC	p.N1117T	LRRIQ1_uc001tab.1_Missense_Mutation_p.N1117T	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1117	LRRCT.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
NR1H4	9971	broad.mit.edu	37	12	100897210	100897210	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100897210T>C	uc001tht.1	+	1	73	c.45T>C	c.(43-45)AGT>AGC	p.S15S	NR1H4_uc001thp.1_Intron|NR1H4_uc001thq.1_Intron|NR1H4_uc010svj.1_Intron|NR1H4_uc001thr.1_Intron|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Silent_p.S15S	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	15					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
IFT81	28981	broad.mit.edu	37	12	110600787	110600787	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110600787T>C	uc001tqi.2	+	11	1235	c.1105T>C	c.(1105-1107)TTA>CTA	p.L369L	IFT81_uc001tqh.2_Silent_p.L369L|IFT81_uc001tqj.2_RNA|IFT81_uc001tqg.2_Silent_p.L369L	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1	369	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1																		---	---	---	---
RNF17	56163	broad.mit.edu	37	13	25367266	25367266	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25367266C>G	uc001upr.2	+	10	1063	c.1022C>G	c.(1021-1023)CCA>CGA	p.P341R	RNF17_uc010tdd.1_Missense_Mutation_p.P200R|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.P341R|RNF17_uc001ups.2_Missense_Mutation_p.P280R|RNF17_uc001upq.1_Missense_Mutation_p.P341R	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	341					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)														---	---	---	---
CPB2	1361	broad.mit.edu	37	13	46632517	46632517	+	Splice_Site	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46632517C>T	uc001vaw.2	-	9	864	c.797_splice	c.e9-1	p.E266_splice	uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Splice_Site_p.E229_splice	NM_001872	NP_001863			plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)														---	---	---	---
HTR2A	3356	broad.mit.edu	37	13	47409413	47409413	+	Silent	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47409413C>A	uc001vbq.2	-	3	1109	c.975G>T	c.(973-975)CTG>CTT	p.L325L	HTR2A_uc001vbr.2_Silent_p.L225L|HTR2A_uc010acr.2_Silent_p.L325L	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	325	Helical; Name=6; (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)													---	---	---	---
MIR622	693207	broad.mit.edu	37	13	90883437	90883437	+	RNA	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90883437G>A	hsa-mir-622|MI0003636	+			c.2G>A																				0																		---	---	---	---
TMTC4	84899	broad.mit.edu	37	13	101266575	101266575	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101266575T>C	uc001vou.2	-	15	2049	c.1889A>G	c.(1888-1890)AAT>AGT	p.N630S	TMTC4_uc001vot.2_Missense_Mutation_p.N649S|TMTC4_uc010tja.1_Missense_Mutation_p.N519S	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	630	TPR 6.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
DHRS4	10901	broad.mit.edu	37	14	24435636	24435636	+	Intron	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24435636G>T	uc001wla.2	+						DHRS4_uc010aky.2_Intron|DHRS4_uc001wlb.2_Intron|DHRS4_uc010akz.2_Intron|DHRS4_uc001wlc.3_Intron|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron	NM_021004	NP_066284			peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)													---	---	---	---
DHRS4	10901	broad.mit.edu	37	14	24470736	24470736	+	Intron	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24470736G>T	uc001wlc.3	+						DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Intron|DHRS4L2_uc001wli.3_Intron|DHRS4L2_uc010alb.2_Intron	NM_021004	NP_066284			peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)													---	---	---	---
SIP1	8487	broad.mit.edu	37	14	39591622	39591622	+	Intron	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39591622T>G	uc001wuq.2	+						SIP1_uc001wur.2_Intron|SIP1_uc001wus.2_Intron|SIP1_uc010amx.2_Intron	NM_003616	NP_003607			SMN-interacting protein 1 isoform alpha						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)														---	---	---	---
ARID4A	5926	broad.mit.edu	37	14	58811468	58811468	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58811468A>C	uc001xdp.2	+	12	1216	c.962A>C	c.(961-963)AAG>ACG	p.K321T	ARID4A_uc001xdo.2_Missense_Mutation_p.K321T|ARID4A_uc001xdq.2_Missense_Mutation_p.K321T|ARID4A_uc010apg.1_5'UTR	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	321	ARID.				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6																		---	---	---	---
C14orf115	55237	broad.mit.edu	37	14	74824989	74824989	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74824989G>T	uc001xpw.3	+	2	1694	c.1503G>T	c.(1501-1503)AGG>AGT	p.R501S		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	501					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)														---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102470852	102470852	+	Intron	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102470852T>C	uc001yks.2	+							NM_001376	NP_001367			cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102507909	102507909	+	Splice_Site	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102507909A>G	uc001yks.2	+	65	12106	c.11942_splice	c.e65-2	p.T3981_splice		NM_001376	NP_001367			cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
APBA2	321	broad.mit.edu	37	15	29346923	29346923	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346923C>T	uc001zck.2	+	3	1043	c.836C>T	c.(835-837)GCG>GTG	p.A279V	APBA2_uc010azj.2_Missense_Mutation_p.A279V|APBA2_uc010uat.1_Missense_Mutation_p.A279V|APBA2_uc001zcl.2_Missense_Mutation_p.A279V|APBA2_uc010uas.1_Missense_Mutation_p.A279V	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	279					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)														---	---	---	---
TRPM1	4308	broad.mit.edu	37	15	31355442	31355442	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31355442C>T	uc001zfm.2	-	7	906	c.778G>A	c.(778-780)GTG>ATG	p.V260M	TRPM1_uc010azy.2_Missense_Mutation_p.V173M|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	260	Extracellular (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34105725	34105725	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34105725C>T	uc001zhi.2	+	74	10517	c.10447C>T	c.(10447-10449)CGG>TGG	p.R3483W	RYR3_uc010bar.2_Missense_Mutation_p.R3478W	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3483					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	p.R3483W(1)		ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
SLC12A6	9990	broad.mit.edu	37	15	34543254	34543254	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34543254A>T	uc001zhw.2	-	10	1502	c.1338T>A	c.(1336-1338)AAT>AAA	p.N446K	SLC12A6_uc001zhv.2_Missense_Mutation_p.N395K|SLC12A6_uc001zhx.2_Missense_Mutation_p.N431K|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.N387K|SLC12A6_uc001zib.2_Missense_Mutation_p.N437K|SLC12A6_uc001zic.2_Missense_Mutation_p.N446K|SLC12A6_uc010bau.2_Missense_Mutation_p.N446K|SLC12A6_uc001zid.2_Missense_Mutation_p.N387K|SLC12A6_uc001zht.2_5'Flank|SLC12A6_uc001zhu.2_Missense_Mutation_p.N258K	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	446	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)													---	---	---	---
LCMT2	9836	broad.mit.edu	37	15	43621774	43621774	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43621774T>C	uc001zrg.2	-	1	1118	c.914A>G	c.(913-915)CAT>CGT	p.H305R	LCMT2_uc010udn.1_5'UTR|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	305					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)													---	---	---	---
MYO1E	4643	broad.mit.edu	37	15	59506484	59506484	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59506484A>C	uc002aga.2	-	12	1590	c.1218T>G	c.(1216-1218)AAT>AAG	p.N406K		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	406	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)														---	---	---	---
CORO2B	10391	broad.mit.edu	37	15	69011828	69011828	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69011828G>T	uc002arj.3	+	11	1277	c.1248G>T	c.(1246-1248)AAG>AAT	p.K416N	CORO2B_uc010bic.2_Missense_Mutation_p.K411N|CORO2B_uc002ark.2_Missense_Mutation_p.K183N	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	416					actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6																		---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72338496	72338496	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72338496G>A	uc002atl.3	-	2	882	c.409C>T	c.(409-411)CGG>TGG	p.R137W	MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Missense_Mutation_p.R137W|MYO9A_uc002atn.1_Missense_Mutation_p.R137W	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	137					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
CSPG4	1464	broad.mit.edu	37	15	75980816	75980816	+	Missense_Mutation	SNP	G	A	A	rs140979403		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75980816G>A	uc002baw.2	-	3	2683	c.2590C>T	c.(2590-2592)CGT>TGT	p.R864C		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	864	CSPG 4.|Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1 (By similarity).|Interaction with COL6A2 (By similarity).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3																		---	---	---	---
C16orf42	115939	broad.mit.edu	37	16	1400082	1400082	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1400082T>C	uc002cll.2	-	4	748	c.680A>G	c.(679-681)GAG>GGG	p.E227G	GNPTG_uc002clm.2_5'Flank	NM_001001410	NP_001001410	Q9UJK0	TSR3_HUMAN	hypothetical protein LOC115939	227					rRNA processing						0		Hepatocellular(780;0.0893)																---	---	---	---
ATXN2L	11273	broad.mit.edu	37	16	28844803	28844803	+	Missense_Mutation	SNP	A	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28844803A>T	uc002drc.2	+	15	2167	c.1999A>T	c.(1999-2001)AAT>TAT	p.N667Y	uc010vct.1_Intron|ATXN2L_uc002drb.2_Missense_Mutation_p.N667Y|ATXN2L_uc002dqy.2_Missense_Mutation_p.N667Y|ATXN2L_uc002dra.2_Missense_Mutation_p.N667Y|ATXN2L_uc002dqz.2_Missense_Mutation_p.N667Y|ATXN2L_uc010vdb.1_Missense_Mutation_p.N673Y|ATXN2L_uc002dre.2_Missense_Mutation_p.N667Y|ATXN2L_uc002drf.2_Missense_Mutation_p.N76Y|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	667						membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
KCTD19	146212	broad.mit.edu	37	16	67325250	67325250	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67325250T>C	uc002esu.2	-	14	2578	c.2527A>G	c.(2527-2529)ATC>GTC	p.I843V	KCTD19_uc002est.2_Missense_Mutation_p.I615V|KCTD19_uc010vjj.1_Missense_Mutation_p.I586V	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	843						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)														---	---	---	---
FAM65A	79567	broad.mit.edu	37	16	67573777	67573777	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67573777G>A	uc010vjp.1	+	6	545	c.449G>A	c.(448-450)CGA>CAA	p.R150Q	FAM65A_uc010cei.1_5'UTR|FAM65A_uc002eth.2_Missense_Mutation_p.R130Q|FAM65A_uc010cej.2_Missense_Mutation_p.R133Q|FAM65A_uc002eti.1_Missense_Mutation_p.R93Q|FAM65A_uc010vjq.1_Missense_Mutation_p.R144Q|FAM65A_uc002etj.1_Missense_Mutation_p.R129Q|FAM65A_uc002etk.2_Missense_Mutation_p.R129Q	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	134						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)														---	---	---	---
CDH1	999	broad.mit.edu	37	16	68845760	68845760	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68845760G>A	uc002ewg.1	+	7	1130	c.1006G>A	c.(1006-1008)GAG>AAG	p.E336K	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.E336K	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	336	Cadherin 2.|Extracellular (Potential).		E -> D.		adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.E336E(1)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
CYB5B	80777	broad.mit.edu	37	16	69458604	69458604	+	Silent	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69458604G>T	uc002exg.1	+	1	107	c.18G>T	c.(16-18)GCG>GCT	p.A6A	CYB5B_uc002exf.2_Silent_p.A6A|CYB5B_uc010cfl.1_Silent_p.A6A	NM_030579	NP_085056	O43169	CYB5B_HUMAN	cytochrome b5 outer mitochondrial membrane	2					electron transport chain|transport	integral to membrane|mitochondrial outer membrane	heme binding				0		Ovarian(137;0.101)																---	---	---	---
PDPR	55066	broad.mit.edu	37	16	70177509	70177509	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70177509G>A	uc002eyf.1	+	14	2659	c.1702G>A	c.(1702-1704)GAG>AAG	p.E568K	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.E468K|PDPR_uc002eyg.1_Missense_Mutation_p.E296K|PDPR_uc002eyh.2_5'Flank|PDPR_uc010vls.1_5'Flank	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	568					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)														---	---	---	---
DHX38	9785	broad.mit.edu	37	16	72139930	72139930	+	Silent	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72139930T>C	uc002fcb.2	+	19	2869	c.2514T>C	c.(2512-2514)GAT>GAC	p.D838D	DHX38_uc010vmp.1_Silent_p.D150D	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	838	Helicase C-terminal.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)																---	---	---	---
IRF8	3394	broad.mit.edu	37	16	85948116	85948116	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85948116G>A	uc002fjh.2	+	6	648	c.591G>A	c.(589-591)GCG>GCA	p.A197A	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	197			A -> T (in a breast cancer sample; somatic mutation).		interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	p.A197T(1)		breast(2)|ovary(1)	3		Prostate(104;0.0771)																---	---	---	---
ZNF594	84622	broad.mit.edu	37	17	5086827	5086827	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5086827T>C	uc010cla.1	-	2	881	c.725A>G	c.(724-726)AAT>AGT	p.N242S		NM_032530	NP_115919	Q96JF6	ZN594_HUMAN	zinc finger protein 594	242	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KSR1	8844	broad.mit.edu	37	17	25932711	25932711	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25932711C>T	uc010crg.2	+	15	1966	c.1521C>T	c.(1519-1521)GAC>GAT	p.D507D	KSR1_uc002gzj.1_RNA|KSR1_uc002gzm.2_Silent_p.D286D	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	642	Protein kinase.				Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)														---	---	---	---
SLC25A39	51629	broad.mit.edu	37	17	42397752	42397752	+	Missense_Mutation	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42397752A>G	uc002ign.2	-	10	1008	c.854T>C	c.(853-855)GTC>GCC	p.V285A	SLC25A39_uc002igm.2_Missense_Mutation_p.V277A|SLC25A39_uc002igo.2_Missense_Mutation_p.V277A|SLC25A39_uc010wiw.1_Missense_Mutation_p.V262A|SLC25A39_uc010czu.2_Missense_Mutation_p.V153A	NM_001143780	NP_001137252	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39 isoform a	285	Solcar 3.				heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane				upper_aerodigestive_tract(1)	1		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)														---	---	---	---
COL1A1	1277	broad.mit.edu	37	17	48265261	48265261	+	Silent	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48265261G>T	uc002iqm.2	-	45	3471	c.3345C>A	c.(3343-3345)GGC>GGA	p.G1115G		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1115	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48600347	48600347	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48600347C>T	uc010wmr.1	+	11	1596	c.1434C>T	c.(1432-1434)GGC>GGT	p.G478G	MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	441					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
ASXL3	80816	broad.mit.edu	37	18	31226286	31226286	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31226286C>T	uc010dmg.1	+	4	379	c.324C>T	c.(322-324)GCC>GCT	p.A108A	ASXL3_uc002kxq.2_5'UTR	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31685107	31685107	+	Silent	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31685107G>C	uc010dmi.2	-	3	661	c.432C>G	c.(430-432)GCC>GCG	p.A144A	NOL4_uc002kxr.3_5'UTR|NOL4_uc010xbt.1_Silent_p.A70A|NOL4_uc010dmh.2_Silent_p.A70A|NOL4_uc010xbu.1_Silent_p.A144A|NOL4_uc002kxt.3_Silent_p.A144A|NOL4_uc010xbw.1_Silent_p.A30A	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	144						nucleolus	RNA binding			ovary(3)	3																		---	---	---	---
ELP2	55250	broad.mit.edu	37	18	33725918	33725918	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33725918C>T	uc002kzk.1	+	10	910	c.900C>T	c.(898-900)GTC>GTT	p.V300V	ELP2_uc010xcg.1_Silent_p.V365V|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Silent_p.V274V|ELP2_uc010xch.1_Silent_p.V339V|ELP2_uc002kzn.1_Silent_p.V274V|ELP2_uc002kzo.1_Silent_p.V230V	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	300	WD 6.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
NARS	4677	broad.mit.edu	37	18	55270137	55270137	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55270137G>A	uc002lgs.2	-	12	1518	c.1290C>T	c.(1288-1290)ACC>ACT	p.T430T	NARS_uc002lgt.2_Silent_p.T429T|NARS_uc010xea.1_Silent_p.T181T	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	430					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)													---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9054231	9054231	+	Intron	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9054231C>G	uc002mkp.2	-							NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ZNF708	7562	broad.mit.edu	37	19	21476317	21476317	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21476317C>G	uc002npq.1	-	4	1649	c.1451G>C	c.(1450-1452)AGC>ACC	p.S484T	ZNF708_uc002npr.1_Missense_Mutation_p.S420T|ZNF708_uc010ecs.1_Missense_Mutation_p.S420T	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708	484	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6																		---	---	---	---
ERF	2077	broad.mit.edu	37	19	42752808	42752808	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42752808G>A	uc002ote.3	-	4	1614	c.1456C>T	c.(1456-1458)CGG>TGG	p.R486W	ERF_uc002otd.3_Missense_Mutation_p.R217W	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	486					cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)																---	---	---	---
RELB	5971	broad.mit.edu	37	19	45540895	45540895	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45540895C>T	uc002paj.1	+	13	1713	c.1587C>T	c.(1585-1587)CCC>CCT	p.P529P	SFRS16_uc002pak.2_5'Flank|SFRS16_uc002pal.2_5'Flank|SFRS16_uc010xxh.1_5'Flank|SFRS16_uc002pam.2_5'Flank|SFRS16_uc002pan.1_5'Flank	NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B	529						nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)														---	---	---	---
LIG1	3978	broad.mit.edu	37	19	48626468	48626468	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48626468G>A	uc002pia.1	-	22	2232	c.2112C>T	c.(2110-2112)ATC>ATT	p.I704I	LIG1_uc010xze.1_Silent_p.I397I|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Silent_p.I636I|LIG1_uc010xzg.1_Silent_p.I673I	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	704					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)								NER					---	---	---	---
PRMT1	3276	broad.mit.edu	37	19	50189487	50189487	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50189487C>T	uc010enf.1	+	9	939	c.897C>T	c.(895-897)ACC>ACT	p.T299T	PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Silent_p.T275T|PRMT1_uc002ppe.2_Silent_p.T281T|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Silent_p.T246T|PRMT1_uc010yba.1_RNA|PRMT1_uc010ybb.1_5'Flank|C19orf76_uc002pph.2_5'Flank	NM_001536	NP_001527	Q8WUW5	Q8WUW5_HUMAN	HMT1 hnRNP methyltransferase-like 2 isoform 1	280						cytoplasm	protein methyltransferase activity			ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)														---	---	---	---
ZNF615	284370	broad.mit.edu	37	19	52496341	52496341	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52496341C>T	uc002pye.1	-	6	2280	c.1988G>A	c.(1987-1989)CGC>CAC	p.R663H	ZNF615_uc002pyf.1_Missense_Mutation_p.R674H|ZNF615_uc002pyg.1_Missense_Mutation_p.R555H|ZNF615_uc002pyh.1_Missense_Mutation_p.R674H|ZNF615_uc010epi.1_Missense_Mutation_p.R670H|ZNF615_uc010ydg.1_Missense_Mutation_p.R668H	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615	663	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)														---	---	---	---
NLRP12	91662	broad.mit.edu	37	19	54304551	54304551	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54304551G>T	uc002qch.3	-	7	2906	c.2686C>A	c.(2686-2688)CTG>ATG	p.L896M	NLRP12_uc010eqw.2_Missense_Mutation_p.L179M|NLRP12_uc002qci.3_Missense_Mutation_p.L896M|NLRP12_uc002qcj.3_Missense_Mutation_p.L897M|NLRP12_uc002qck.3_Intron|NLRP12_uc010eqx.2_Intron	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	896	LRR 3.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)														---	---	---	---
NLRP2	55655	broad.mit.edu	37	19	55493754	55493754	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55493754T>G	uc002qij.2	+	6	774	c.688T>G	c.(688-690)TGG>GGG	p.W230G	NLRP2_uc010yfp.1_Missense_Mutation_p.W207G|NLRP2_uc010esn.2_Missense_Mutation_p.W206G|NLRP2_uc010eso.2_Missense_Mutation_p.W227G|NLRP2_uc010esp.2_Missense_Mutation_p.W208G	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	230	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)														---	---	---	---
BRSK1	84446	broad.mit.edu	37	19	55816953	55816953	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55816953C>G	uc002qkg.2	+	16	2166	c.1889C>G	c.(1888-1890)TCG>TGG	p.S630W	BRSK1_uc002qkf.2_Missense_Mutation_p.S646W|BRSK1_uc002qkh.2_Missense_Mutation_p.S325W	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	630					establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)														---	---	---	---
ZNF154	7710	broad.mit.edu	37	19	58213860	58213860	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58213860T>A	uc010euf.2	-	3	697	c.457A>T	c.(457-459)AGA>TGA	p.R153*	ZNF776_uc002qpx.2_Intron|ZNF154_uc002qpy.2_RNA	NM_001085384	NP_001078853	Q13106	ZN154_HUMAN	zinc finger protein 154	153	C2H2-type 2; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
TRIB3	57761	broad.mit.edu	37	20	377208	377208	+	Missense_Mutation	SNP	G	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:377208G>C	uc002wdm.2	+	4	1457	c.951G>C	c.(949-951)CAG>CAC	p.Q317H	TRIB3_uc002wdn.2_Missense_Mutation_p.Q344H	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN	tribbles 3	317					apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)														---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20079326	20079326	+	Missense_Mutation	SNP	A	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20079326A>C	uc002wru.2	+	8	803	c.727A>C	c.(727-729)AGT>CGT	p.S243R	C20orf26_uc010gcw.1_Missense_Mutation_p.S197R|C20orf26_uc010zse.1_Missense_Mutation_p.S243R|C20orf26_uc010zsf.1_Missense_Mutation_p.S243R	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	243										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
HCK	3055	broad.mit.edu	37	20	30662536	30662536	+	Intron	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30662536A>G	uc002wxh.2	+						HCK_uc010gdy.2_Intron|HCK_uc002wxi.2_Intron	NM_002110	NP_002101			hemopoietic cell kinase isoform p61HCK						interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
STK4	6789	broad.mit.edu	37	20	43615770	43615770	+	Intron	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43615770C>A	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron|STK4_uc010ggw.1_Intron	NM_006282	NP_006273			serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SEMG1	6406	broad.mit.edu	37	20	43836886	43836886	+	Missense_Mutation	SNP	C	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836886C>G	uc002xni.2	+	2	1005	c.948C>G	c.(946-948)AGC>AGG	p.S316R	SEMG1_uc002xnj.2_Intron|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.S316R	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	316	58 AA repeat 1.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SAMSN1	64092	broad.mit.edu	37	21	15858410	15858410	+	Silent	SNP	A	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15858410A>G	uc002yju.1	-	8	1027	c.945T>C	c.(943-945)CCT>CCC	p.P315P	SAMSN1_uc010gky.1_Silent_p.P147P|SAMSN1_uc002yjv.1_Silent_p.P383P	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	315					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)														---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37603142	37603142	+	Missense_Mutation	SNP	T	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37603142T>A	uc002yvg.2	+	14	2139	c.2060T>A	c.(2059-2061)ATC>AAC	p.I687N	DOPEY2_uc011aeb.1_Missense_Mutation_p.I687N	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	687					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46900409	46900409	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46900409T>C	uc011afs.1	+	11	2693	c.2672T>C	c.(2671-2673)TTC>TCC	p.F891S	COL18A1_uc002zhg.2_Missense_Mutation_p.F476S|COL18A1_uc002zhi.2_Missense_Mutation_p.F656S	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	891	Nonhelical region 3 (NC3).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
YDJC	150223	broad.mit.edu	37	22	21982820	21982820	+	Missense_Mutation	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21982820C>T	uc002zvb.2	-	5	896	c.859G>A	c.(859-861)GCC>ACC	p.A287T	YDJC_uc002zvc.2_RNA|YDJC_uc002zvd.2_3'UTR	NM_001017964	NP_001017964	A8MPS7	YDJC_HUMAN	YdjC homolog	287					carbohydrate metabolic process		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds				0	Colorectal(54;0.105)																	---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25019156	25019156	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25019156G>A	uc003aan.1	+	10	1303	c.816G>A	c.(814-816)GTG>GTA	p.V272V	GGT1_uc003aas.1_Silent_p.V272V|GGT1_uc003aat.1_Silent_p.V272V|GGT1_uc003aau.1_Silent_p.V272V|GGT1_uc003aav.1_Silent_p.V272V|GGT1_uc003aaw.1_Silent_p.V272V|GGT1_uc003aax.1_Silent_p.V272V	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	272	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
FBXO7	25793	broad.mit.edu	37	22	32894361	32894361	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32894361G>A	uc003amq.2	+	9	1696	c.1413G>A	c.(1411-1413)ACG>ACA	p.T471T	FBXO7_uc003amr.2_Silent_p.T357T|FBXO7_uc003ams.2_Silent_p.T315T|FBXO7_uc003amt.2_Silent_p.T392T|FBXO7_uc003amu.2_Silent_p.T357T|FBXO7_uc003amv.2_Silent_p.T170T	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1	471					cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
TCF20	6942	broad.mit.edu	37	22	42609403	42609403	+	Silent	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42609403T>G	uc003bcj.1	-	1	2043	c.1909A>C	c.(1909-1911)AGG>CGG	p.R637R	TCF20_uc003bck.1_Silent_p.R637R|TCF20_uc003bnt.2_Silent_p.R637R	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	637					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5																		---	---	---	---
TCF20	6942	broad.mit.edu	37	22	42611293	42611293	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42611293G>A	uc003bcj.1	-	1	153	c.19C>T	c.(19-21)CAA>TAA	p.Q7*	TCF20_uc003bck.1_Nonsense_Mutation_p.Q7*|TCF20_uc003bnt.2_Nonsense_Mutation_p.Q7*	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5																		---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3238447	3238447	+	Missense_Mutation	SNP	C	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3238447C>A	uc004crg.3	-	5	5436	c.5279G>T	c.(5278-5280)AGA>ATA	p.R1760I		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1760						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
ASB11	140456	broad.mit.edu	37	X	15315756	15315756	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15315756G>T	uc004cwp.1	-	3	309	c.309C>A	c.(307-309)CAC>CAA	p.H103Q	ASB11_uc004cwo.1_Missense_Mutation_p.H82Q|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Intron	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box-containing protein	103	ANK 2.				intracellular signal transduction					breast(2)|skin(1)	3	Hepatocellular(33;0.183)																	---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111698562	111698562	+	Missense_Mutation	SNP	G	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111698562G>T	uc004epo.1	+	3	1047	c.606G>T	c.(604-606)ATG>ATT	p.M202I		NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	202							nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
KIAA1210	57481	broad.mit.edu	37	X	118221772	118221772	+	Missense_Mutation	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118221772G>A	uc004era.3	-	11	3421	c.3421C>T	c.(3421-3423)CGG>TGG	p.R1141W		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1141										ovary(4)|skin(1)	5																		---	---	---	---
C1GALT1C1	29071	broad.mit.edu	37	X	119760150	119760150	+	Missense_Mutation	SNP	T	C	C			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119760150T>C	uc004esy.2	-	3	1219	c.872A>G	c.(871-873)TAT>TGT	p.Y291C	C1GALT1C1_uc004esz.2_Missense_Mutation_p.Y291C	NM_152692	NP_689905	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	291	Lumenal (Potential).					integral to membrane					0																		---	---	---	---
XIAP	331	broad.mit.edu	37	X	123019704	123019704	+	Missense_Mutation	SNP	T	G	G			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123019704T>G	uc010nqu.2	+	2	318	c.192T>G	c.(190-192)TTT>TTG	p.F64L	XIAP_uc004etx.2_Missense_Mutation_p.F64L|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	64	BIR 1.				anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2														X-linked_Lymphoproliferative_syndrome				---	---	---	---
CXorf40B	541578	broad.mit.edu	37	X	149101841	149101841	+	Silent	SNP	C	T	T			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149101841C>T	uc004fdy.2	-	4	768	c.252G>A	c.(250-252)GCG>GCA	p.A84A	CXorf40B_uc011mxs.1_RNA	NM_001013845	NP_001013867	Q96DE9	CX04B_HUMAN	hypothetical protein LOC541578	84											0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
FLNA	2316	broad.mit.edu	37	X	153594996	153594996	+	Silent	SNP	G	A	A			TCGA-CD-5813-01	TCGA-CD-5813-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153594996G>A	uc004fkk.2	-	7	1248	c.999C>T	c.(997-999)ACC>ACT	p.T333T	FLNA_uc010nuu.1_Silent_p.T333T	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	333	Filamin 1.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)																	---	---	---	---
