Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
USP33	23032	broad.mit.edu	37	1	78163754	78163754	+	Intron	DEL	T	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78163754delT	uc001dht.2	-						USP33_uc009wca.1_5'Flank|USP33_uc001dhs.2_Intron|USP33_uc001dhu.2_Intron	NM_015017	NP_055832			ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3																		---	---	---	---
CAPZA1	829	broad.mit.edu	37	1	113202197	113202198	+	Intron	DEL	TC	-	-	rs113906793		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113202197_113202198delTC	uc001ecj.1	+							NM_006135	NP_006126			F-actin capping protein alpha-1 subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex|WASH complex	actin binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	24110911	24110912	+	Intron	INS	-	A	A	rs145193037	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24110911_24110912insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
SMYD5	10322	broad.mit.edu	37	2	73448561	73448561	+	Intron	DEL	T	-	-	rs112717194		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73448561delT	uc002siw.2	+						SMYD5_uc010yre.1_Intron|SMYD5_uc002six.1_5'Flank	NM_006062	NP_006053			SMYD family member 5								metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113103847	113103848	+	IGR	INS	-	CAT	CAT			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103847_113103848insCAT								ZC3H6 (6207 upstream) : RGPD8 (22118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126064831	126064831	+	IGR	DEL	G	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126064831delG								CNTNAP5 (391970 upstream) : None (None downstream)																																			---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100570788	100570788	+	Intron	DEL	A	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100570788delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
RHO	6010	broad.mit.edu	37	3	129252686	129252686	+	3'UTR	DEL	T	-	-	rs71811187		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129252686delT	uc003emt.2	+	5						NM_000539	NP_000530			rhodopsin						protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding				0		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	166062679	166062694	+	IGR	DEL	GAAGGAAGGAAGGAAG	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166062679_166062694delGAAGGAAGGAAGGAAG								BCHE (507426 upstream) : ZBBX (895387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26687123	26687123	+	IGR	DEL	C	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26687123delC								ZNF322A (27160 upstream) : GUSBL1 (152143 downstream)																																			---	---	---	---
GABRR1	2569	broad.mit.edu	37	6	89927156	89927156	+	5'UTR	DEL	A	-	-	rs34012805		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89927156delA	uc003pna.2	-	1					GABRR1_uc011dzv.1_5'UTR|GABRR1_uc011dzw.1_RNA	NM_002042	NP_002033			gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	138156071	138156072	+	Intron	INS	-	GGAA	GGAA	rs7766931	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138156071_138156072insGGAA	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	160133097	160133113	+	IGR	DEL	CTCGGCTGCTCAGACCT	-	-	rs71551146		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160133097_160133113delCTCGGCTGCTCAGACCT								SOD2 (18744 upstream) : WTAP (15016 downstream)																																			---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168319289	168319290	+	Intron	DEL	TG	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168319289_168319290delTG	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	17125218	17125218	+	IGR	DEL	T	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17125218delT								AGR3 (203605 upstream) : AHR (213058 downstream)																																			---	---	---	---
SORBS3	10174	broad.mit.edu	37	8	22426859	22426859	+	Intron	DEL	G	-	-	rs13258049	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22426859delG	uc003xbv.2	+						SORBS3_uc003xbw.3_Intron	NM_005775	NP_005766			sorbin and SH3 domain containing 3 isoform 1						muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)														---	---	---	---
COLEC10	10584	broad.mit.edu	37	8	120103625	120103625	+	Intron	DEL	A	-	-	rs33915063		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120103625delA	uc003yoo.2	+							NM_006438	NP_006429			collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122125796	122125796	+	IGR	DEL	T	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122125796delT								SNTB1 (301487 upstream) : HAS2 (499475 downstream)																																			---	---	---	---
ST3GAL1	6482	broad.mit.edu	37	8	134575021	134575024	+	Intron	DEL	TTTC	-	-	rs6150827		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134575021_134575024delTTTC	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479			ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)															---	---	---	---
GPT	2875	broad.mit.edu	37	8	145732241	145732242	+	Intron	INS	-	TA	TA			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145732241_145732242insTA	uc011lli.1	+						GPT_uc003zdh.3_Intron|MFSD3_uc003zdi.1_5'Flank	NM_005309	NP_005300			glutamic pyruvate transaminase						gluconeogenesis	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|central_nervous_system(1)	2	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14803313	14803314	+	Intron	INS	-	TCCCCTCCCC	TCCCCTCCCC	rs141611687	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14803313_14803314insTCCCCTCCCC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161			aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)														---	---	---	---
NCS1	23413	broad.mit.edu	37	9	132985259	132985259	+	Intron	DEL	C	-	-	rs68053432		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985259delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101			frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0																		---	---	---	---
BTAF1	9044	broad.mit.edu	37	10	93702042	93702043	+	Intron	INS	-	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93702042_93702043insA	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963			BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)																---	---	---	---
SBF2	81846	broad.mit.edu	37	11	10307714	10307717	+	Intron	DEL	CACA	-	-	rs75985025	byFrequency;by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10307714_10307717delCACA	uc001mib.2	-							NM_030962	NP_112224			SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89125143	89125146	+	Intron	DEL	TTCT	-	-	rs140065127		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89125143_89125146delTTCT	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627			NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
HEPHL1	341208	broad.mit.edu	37	11	93839460	93839460	+	Intron	DEL	T	-	-	rs144455207		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93839460delT	uc001pep.2	+						uc001pen.1_Intron	NM_001098672	NP_001092142			hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)																---	---	---	---
CCDC15	80071	broad.mit.edu	37	11	124828981	124828981	+	Intron	DEL	A	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124828981delA	uc001qbm.3	+							NM_025004	NP_079280			coiled-coil domain containing 15							centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	80752174	80752175	+	Intron	INS	-	T	T	rs146138915	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80752174_80752175insT	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																														---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112657406	112657407	+	Intron	INS	-	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112657406_112657407insT	uc009zwc.2	-						C12orf51_uc001ttr.1_Intron	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
GOLGA9P	283796	broad.mit.edu	37	15	23261549	23261550	+	Intron	INS	-	GTCTCAGT	GTCTCAGT			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23261549_23261550insGTCTCAGT	uc001yvh.1	+						uc001yvl.2_5'Flank	NR_024074				RecName: Full=Putative golgin subfamily A member 6-like protein 11;												0																		---	---	---	---
MAPKBP1	23005	broad.mit.edu	37	15	42102937	42102938	+	Intron	DEL	AG	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42102937_42102938delAG	uc001zok.3	+						MAPKBP1_uc001zoj.3_Intron|MAPKBP1_uc010bcj.2_Intron|MAPKBP1_uc010bci.2_Intron|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_Intron|MAPKBP1_uc010bcl.2_5'Flank	NM_001128608	NP_001122080			mitogen-activated protein kinase binding protein											central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	62563039	62563040	+	IGR	INS	-	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62563039_62563040insA								C2CD4B (105557 upstream) : MGC15885 (366331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	25452363	25452364	+	IGR	INS	-	TGTG	TGTG	rs141496461	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25452363_25452364insTGTG								ZKSCAN2 (183508 upstream) : HS3ST4 (250983 downstream)																																			---	---	---	---
MARCH2	51257	broad.mit.edu	37	19	8495419	8495419	+	Intron	DEL	A	-	-	rs74326673		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8495419delA	uc002mjv.2	+						MARCH2_uc002mjw.2_Intron|MARCH2_uc002mjx.2_Intron	NM_016496	NP_057580			membrane-associated ring finger (C3HC4) 2						endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
COL5A3	50509	broad.mit.edu	37	19	10094530	10094531	+	Intron	INS	-	A	A	rs141118767	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10094530_10094531insA	uc002mmq.1	-							NM_015719	NP_056534			collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	35136445	35136446	+	Intron	DEL	AG	-	-	rs72337452		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35136445_35136446delAG	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																														---	---	---	---
MIR518B	574474	broad.mit.edu	37	19	54204650	54204651	+	5'Flank	INS	-	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54204650_54204651insT	hsa-mir-518b|MI0003156	+																							0																		---	---	---	---
MIR527	574497	broad.mit.edu	37	19	54255877	54255878	+	5'Flank	DEL	TG	-	-	rs143274441		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54255877_54255878delTG	hsa-mir-527|MI0003179	+																							0																		---	---	---	---
NLRP2	55655	broad.mit.edu	37	19	55505987	55505987	+	Intron	DEL	T	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55505987delT	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322			NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)														---	---	---	---
HM13	81502	broad.mit.edu	37	20	30156903	30156904	+	Intron	INS	-	T	T	rs11376444		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30156903_30156904insT	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416			minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)													OREG0025852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45783459	45783462	+	Intron	DEL	TGTG	-	-	rs35643276		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45783459_45783462delTGTG	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	46824300	46824302	+	IGR	DEL	CCT	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46824300_46824302delCCT								SULF2 (408940 upstream) : LOC284749 (164352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49068651	49068651	+	IGR	DEL	A	-	-	rs71190560		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068651delA								CEBPB (259439 upstream) : PTPN1 (58240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55357295	55357295	+	IGR	DEL	A	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55357295delA								TFAP2C (142959 upstream) : BMP7 (386514 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11085681	11085683	+	Intron	DEL	ACT	-	-	rs144065331		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085681_11085683delACT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
SYN1	6853	broad.mit.edu	37	X	47467659	47467660	+	Intron	DEL	AA	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47467659_47467660delAA	uc004die.2	-						SYN1_uc004did.2_Intron	NM_006950	NP_008881			synapsin I isoform Ia							cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	51692346	51692349	+	IGR	DEL	TTTC	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51692346_51692349delTTTC								MAGED1 (46898 upstream) : MAGED4 (112576 downstream)																																			---	---	---	---
GNL3L	54552	broad.mit.edu	37	X	54585146	54585147	+	Intron	INS	-	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54585146_54585147insT	uc004dth.1	+						GNL3L_uc004dti.2_Intron	NM_019067	NP_061940			guanine nucleotide binding protein-like 3						ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1																		---	---	---	---
DIAPH2	1730	broad.mit.edu	37	X	96194492	96194515	+	Intron	DEL	TATATATGTATATATATATGTATG	-	-	rs72476044		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96194492_96194515delTATATATGTATATATATATGTATG	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720			diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	98220230	98220231	+	IGR	DEL	TC	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98220230_98220231delTC								None (None upstream) : LOC442459 (496369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	144161828	144161839	+	IGR	DEL	TTTCTTTCTTTC	-	-			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144161828_144161839delTTTCTTTCTTTC								None (None upstream) : SPANXN1 (167268 downstream)																																			---	---	---	---
OPRD1	4985	broad.mit.edu	37	1	29185716	29185716	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29185716C>A	uc001brf.1	+	2	720	c.478C>A	c.(478-480)CGC>AGC	p.R160S		NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1	160	Cytoplasmic (Potential).				immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)													---	---	---	---
SNIP1	79753	broad.mit.edu	37	1	38003386	38003386	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38003386T>A	uc001cbi.2	-	4	1227	c.1154A>T	c.(1153-1155)GAG>GTG	p.E385V	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	385	Poly-Glu.				production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding			upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)																---	---	---	---
FCRL3	115352	broad.mit.edu	37	1	157665941	157665941	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157665941C>T	uc001frb.2	-	7	1313	c.1021G>A	c.(1021-1023)GCA>ACA	p.A341T	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.A341T|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.A67T|FCRL3_uc001frc.1_Missense_Mutation_p.A341T	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	341	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)																	---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174926639	174926639	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174926639A>G	uc001gjx.2	+	20	2581	c.2386A>G	c.(2386-2388)ATG>GTG	p.M796V	RABGAP1L_uc001gkb.3_5'UTR|RABGAP1L_uc001gkc.3_Missense_Mutation_p.M103V|RABGAP1L_uc001gkd.3_Missense_Mutation_p.M122V|RABGAP1L_uc001gke.3_Missense_Mutation_p.M115V|RABGAP1L_uc001gkf.2_Missense_Mutation_p.M53V|RABGAP1L_uc001gkg.2_Missense_Mutation_p.M53V|RABGAP1L_uc001gkh.3_Missense_Mutation_p.M53V	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	796					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
CTSE	1510	broad.mit.edu	37	1	206328752	206328752	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206328752C>A	uc001hdu.2	+	7	937	c.819C>A	c.(817-819)TCC>TCA	p.S273S	CTSE_uc001hdv.2_Intron|CTSE_uc010prs.1_Intron	NM_001910	NP_001901	P14091	CATE_HUMAN	cathepsin E isoform a preproprotein	278					antigen processing and presentation of exogenous peptide antigen via MHC class II|digestion|proteolysis	endosome	aspartic-type endopeptidase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(75;0.0754)															---	---	---	---
LPGAT1	9926	broad.mit.edu	37	1	211956619	211956619	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211956619C>A	uc001hiu.2	-	5	1492	c.679G>T	c.(679-681)GCA>TCA	p.A227S	LPGAT1_uc001hiv.2_Missense_Mutation_p.A227S	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	227					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)														---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	245927347	245927347	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245927347C>G	uc001ibl.2	-	11	1276	c.1181G>C	c.(1180-1182)AGA>ACA	p.R394T	SMYD3_uc001ibk.2_Missense_Mutation_p.R335T|SMYD3_uc001ibi.2_Missense_Mutation_p.E206D|SMYD3_uc001ibj.2_Missense_Mutation_p.R205T	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	394						cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
ZNF513	130557	broad.mit.edu	37	2	27601052	27601052	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27601052C>A	uc002rkk.2	-	4	1186	c.986G>T	c.(985-987)AGT>ATT	p.S329I	ZNF513_uc002rkj.2_Missense_Mutation_p.S267I	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	329					regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
LIMS1	3987	broad.mit.edu	37	2	109293101	109293101	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109293101C>G	uc002teg.2	+	7	804	c.685C>G	c.(685-687)CAT>GAT	p.H229D	LIMS1_uc002tef.2_Missense_Mutation_p.H241D|LIMS1_uc002teh.2_Missense_Mutation_p.H229D|LIMS1_uc002tei.2_Missense_Mutation_p.H229D|LIMS1_uc002tej.2_Missense_Mutation_p.H266D|LIMS1_uc002tek.3_Missense_Mutation_p.H291D	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	229	LIM zinc-binding 4.				cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170028593	170028593	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170028593C>T	uc002ues.2	-	58	11408	c.11195G>A	c.(11194-11196)TGC>TAC	p.C3732Y		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3732	LDL-receptor class A 31.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
SP3	6670	broad.mit.edu	37	2	174820642	174820642	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174820642C>A	uc002uig.2	-	4	762	c.598G>T	c.(598-600)GAA>TAA	p.E200*	SP3_uc002uie.2_Nonsense_Mutation_p.E132*|SP3_uc002uif.2_Nonsense_Mutation_p.E147*|SP3_uc010zel.1_Nonsense_Mutation_p.E197*	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	200	Transactivation domain (Gln-rich).				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)															---	---	---	---
OBSL1	23363	broad.mit.edu	37	2	220431586	220431586	+	Silent	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220431586G>T	uc010fwk.2	-	5	2157	c.2100C>A	c.(2098-2100)CCC>CCA	p.P700P	OBSL1_uc010fwl.1_Silent_p.P175P|OBSL1_uc002vmi.2_Silent_p.P700P|OBSL1_uc002vmj.2_Silent_p.P287P	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	700					cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)														---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10401807	10401807	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10401807G>T	uc003bvt.2	-	13	2099	c.1660C>A	c.(1660-1662)CCC>ACC	p.P554T	ATP2B2_uc003bvv.2_Missense_Mutation_p.P509T|ATP2B2_uc003bvw.2_Missense_Mutation_p.P509T|ATP2B2_uc010hdo.2_Missense_Mutation_p.P259T	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	554	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
GOLGA4	2803	broad.mit.edu	37	3	37370460	37370460	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37370460C>G	uc003cgv.2	+	16	6372	c.6068C>G	c.(6067-6069)GCC>GGC	p.A2023G	GOLGA4_uc003cgw.2_Missense_Mutation_p.A2045G|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.A1904G	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	2023	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38592647	38592647	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592647C>A	uc003cio.2	-	28	5410	c.5216G>T	c.(5215-5217)CGG>CTG	p.R1739L	SCN5A_uc003cin.2_Missense_Mutation_p.R1738L|SCN5A_uc003cil.3_Missense_Mutation_p.R1739L|SCN5A_uc010hhi.2_Missense_Mutation_p.R1721L|SCN5A_uc010hhk.2_Missense_Mutation_p.R1706L|SCN5A_uc011ayr.1_Missense_Mutation_p.R1685L	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1739					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
CELSR3	1951	broad.mit.edu	37	3	48697252	48697252	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48697252G>T	uc003cul.2	-	1	3097	c.2816C>A	c.(2815-2817)CCA>CAA	p.P939Q	CELSR3_uc003cuf.1_Missense_Mutation_p.P1009Q	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	939	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)														---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123366073	123366073	+	Silent	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123366073C>T	uc003ego.2	-	27	4899	c.4617G>A	c.(4615-4617)GAG>GAA	p.E1539E	MYLK_uc010hrr.2_Intron|MYLK_uc011bjv.1_Silent_p.E339E|MYLK_uc011bjw.1_Silent_p.E1539E|MYLK_uc003egp.2_Silent_p.E1470E|MYLK_uc003egq.2_Silent_p.E1539E|MYLK_uc003egr.2_Silent_p.E1470E|MYLK_uc003egs.2_Silent_p.E1363E	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1539	Protein kinase.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123277829	123277829	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123277829C>A	uc003ieh.2	+	82	14599	c.14554C>A	c.(14554-14556)CAC>AAC	p.H4852N	KIAA1109_uc003iem.2_Missense_Mutation_p.H1208N	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4852					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
TERT	7015	broad.mit.edu	37	5	1272312	1272312	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1272312G>A	uc003jcb.1	-	7	2428	c.2370C>T	c.(2368-2370)GTC>GTT	p.V790V	TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Silent_p.V778V|TERT_uc003jcc.1_Silent_p.V790V|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	790	Reverse transcriptase.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)											TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				---	---	---	---
JMY	133746	broad.mit.edu	37	5	78595999	78595999	+	Silent	SNP	A	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78595999A>G	uc003kfx.3	+	5	2071	c.1551A>G	c.(1549-1551)ACA>ACG	p.T517T	JMY_uc003kfw.1_Silent_p.T163T	NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	517	Interaction with p300/EP300 (By similarity).|Potential.				'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)														---	---	---	---
RASA1	5921	broad.mit.edu	37	5	86670727	86670727	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86670727G>A	uc003kiw.2	+	15	2123	c.2005G>A	c.(2005-2007)GAT>AAT	p.D669N	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Missense_Mutation_p.D492N|RASA1_uc011ctv.1_Missense_Mutation_p.D502N|RASA1_uc011ctw.1_Missense_Mutation_p.D503N|RASA1_uc010jaw.2_Missense_Mutation_p.D491N	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	669	C2.				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)														---	---	---	---
P4HA2	8974	broad.mit.edu	37	5	131539839	131539839	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131539839G>A	uc003kwh.2	-	9	1651	c.1087C>T	c.(1087-1089)CGA>TGA	p.R363*	P4HA2_uc003kwg.2_Nonsense_Mutation_p.R363*|P4HA2_uc003kwi.2_Nonsense_Mutation_p.R363*|P4HA2_uc003kwk.2_Nonsense_Mutation_p.R363*|P4HA2_uc003kwl.2_Nonsense_Mutation_p.R363*|P4HA2_uc003kwj.2_Nonsense_Mutation_p.R363*	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	363						endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)													---	---	---	---
PCDHA11	56138	broad.mit.edu	37	5	140250842	140250842	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250842G>A	uc003lia.2	+	1	3012	c.2154G>A	c.(2152-2154)ACG>ACA	p.T718T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.T718T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	718	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
HTR4	3360	broad.mit.edu	37	5	147929809	147929809	+	Missense_Mutation	SNP	C	A	A	rs61733068	byFrequency;by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147929809C>A	uc003lpn.2	-	3	207	c.43G>T	c.(43-45)GGG>TGG	p.G15W	HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_Missense_Mutation_p.G15W|HTR4_uc003lpj.1_Missense_Mutation_p.G15W|HTR4_uc003lpk.2_Missense_Mutation_p.G15W|HTR4_uc011dby.1_Missense_Mutation_p.G15W|HTR4_uc003lpl.2_Missense_Mutation_p.G15W|HTR4_uc003lpm.2_Missense_Mutation_p.G15W|HTR4_uc010jgv.2_RNA|HTR4_uc003lpo.1_Missense_Mutation_p.G15W|SH3TC2_uc003lpp.1_RNA	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b	15	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)													---	---	---	---
CLINT1	9685	broad.mit.edu	37	5	157244441	157244441	+	Intron	SNP	T	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157244441T>A	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481			epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
NHLRC1	378884	broad.mit.edu	37	6	18121733	18121733	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18121733G>T	uc003ncl.1	-	1	1119	c.1105C>A	c.(1105-1107)CTT>ATT	p.L369I		NM_198586	NP_940988	Q6VVB1	NHLC1_HUMAN	NHL repeat containing 1	369	NHL 6.				proteasomal ubiquitin-dependent protein catabolic process|protein polyubiquitination	endoplasmic reticulum|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)															---	---	---	---
SCUBE3	222663	broad.mit.edu	37	6	35209384	35209384	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35209384C>A	uc003okf.1	+	11	1266	c.1260C>A	c.(1258-1260)GGC>GGA	p.G420G	SCUBE3_uc003okg.1_Silent_p.G419G|SCUBE3_uc003okh.1_Silent_p.G307G	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3	420					protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1																OREG0017372	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ARMC2	84071	broad.mit.edu	37	6	109286202	109286202	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109286202G>T	uc003pss.3	+	17	2479	c.2305G>T	c.(2305-2307)GAT>TAT	p.D769Y	ARMC2_uc011eao.1_Missense_Mutation_p.D604Y	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	769	ARM 12.						binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)														---	---	---	---
SERINC1	57515	broad.mit.edu	37	6	122777661	122777661	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122777661C>A	uc003pyy.1	-	3	406	c.336G>T	c.(334-336)AAG>AAT	p.K112N		NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1	112	Cytoplasmic (Potential).				phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)														---	---	---	---
LANCL2	55915	broad.mit.edu	37	7	55466150	55466150	+	Silent	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55466150C>G	uc003tqp.2	+	3	935	c.357C>G	c.(355-357)GTC>GTG	p.V119V		NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2	119					negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)															---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75186058	75186058	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75186058G>A	uc003uds.1	-	17	1680	c.1639C>T	c.(1639-1641)CGG>TGG	p.R547W	HIP1_uc011kfz.1_Missense_Mutation_p.R424W	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1	547	Potential.				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
DBF4	10926	broad.mit.edu	37	7	87537179	87537179	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87537179C>A	uc003ujf.1	+	12	2230	c.1726C>A	c.(1726-1728)CGA>AGA	p.R576R	DBF4_uc003ujh.1_Silent_p.R316R|DBF4_uc003ujg.1_Silent_p.R352R|DBF4_uc011khf.1_Silent_p.R343R	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase	576					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)																---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88964359	88964359	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88964359T>C	uc011khi.1	+	4	2601	c.2063T>C	c.(2062-2064)GTT>GCT	p.V688A		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	688						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98560040	98560040	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98560040C>A	uc003upp.2	+	46	7007	c.6798C>A	c.(6796-6798)TCC>TCA	p.S2266S	TRRAP_uc011kis.1_Silent_p.S2248S|TRRAP_uc003upr.2_Silent_p.S1965S	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2266	Interaction with TP53.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139305195	139305195	+	Silent	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139305195G>T	uc003vvf.3	-	7	1908	c.1734C>A	c.(1732-1734)ACC>ACA	p.T578T	HIPK2_uc003vvd.3_Silent_p.T578T	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	578	Interaction with SKI and SMAD1.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
SLC18A1	6570	broad.mit.edu	37	8	20022437	20022437	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20022437C>A	uc011kyq.1	-	11	1429	c.958G>T	c.(958-960)GAG>TAG	p.E320*	SLC18A1_uc003wzl.2_Nonsense_Mutation_p.E107*|SLC18A1_uc003wzm.2_Nonsense_Mutation_p.E320*|SLC18A1_uc011kyr.1_Nonsense_Mutation_p.E320*|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	320	Lumenal, vesicle (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)														---	---	---	---
KIAA1429	25962	broad.mit.edu	37	8	95524295	95524295	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95524295G>C	uc003ygo.1	-	12	2787	c.2774C>G	c.(2773-2775)CCA>CGA	p.P925R	KIAA1429_uc003ygp.2_Missense_Mutation_p.P925R|KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	925					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)															---	---	---	---
LY6K	54742	broad.mit.edu	37	8	143784759	143784759	+	Silent	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143784759C>T	uc011ljv.1	+	3	885	c.468C>T	c.(466-468)GCC>GCT	p.A156A	LY6K_uc011ljw.1_3'UTR|LY6K_uc011ljx.1_3'UTR	NM_017527	NP_059997	Q17RY6	LY6K_HUMAN	lymphocyte antigen 6 complex, locus K isoform 1	156						anchored to membrane|cytoplasm|extracellular region|nucleolus|plasma membrane				central_nervous_system(1)	1	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
GALT	2592	broad.mit.edu	37	9	34646774	34646774	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34646774C>A	uc003zve.2	+	1	140	c.73C>A	c.(73-75)CGG>AGG	p.R25R	GALT_uc003zvf.2_5'UTR|GALT_uc003zvg.2_5'UTR|GALT_uc003zvh.2_5'UTR|GALT_uc011lop.1_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	25					galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)										Galactosemia		OREG0019158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA1045	23349	broad.mit.edu	37	9	34976209	34976209	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34976209C>T	uc003zvq.2	+	4	803	c.625C>T	c.(625-627)CGG>TGG	p.R209W	KIAA1045_uc003zvr.2_Missense_Mutation_p.R209W	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	hypothetical protein LOC23349	209							calcium ion binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00575)															---	---	---	---
BICD2	23299	broad.mit.edu	37	9	95477436	95477436	+	Intron	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95477436C>A	uc004aso.1	-						BICD2_uc004asp.1_Nonstop_Mutation_p.*856Y	NM_015250	NP_056065			bicaudal D homolog 2 isoform 2						microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1																		---	---	---	---
FKTN	2218	broad.mit.edu	37	9	108337430	108337430	+	Intron	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108337430C>G	uc004bcr.2	+						FKTN_uc011lvx.1_Intron|FKTN_uc004bcs.2_Intron|FKTN_uc011lvy.1_Intron|FKTN_uc010mtm.2_Intron	NM_001079802	NP_001073270			fukutin						muscle organ development|negative regulation of cell proliferation|negative regulation of JNK cascade|nervous system development|regulation of protein glycosylation	cis-Golgi network|endoplasmic reticulum|extracellular space|Golgi membrane|integral to membrane|nucleus	transferase activity			breast(2)|ovary(1)	3																		---	---	---	---
DFNB31	25861	broad.mit.edu	37	9	117240980	117240980	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117240980G>A	uc004biz.3	-	2	1339	c.690C>T	c.(688-690)ACC>ACT	p.T230T	DFNB31_uc004biy.3_5'UTR|DFNB31_uc004bja.3_Silent_p.T230T|DFNB31_uc004bjb.2_Silent_p.T230T	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	230					inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
FAM166A	401565	broad.mit.edu	37	9	140140109	140140109	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140140109A>T	uc004cmi.1	-	2	308	c.253T>A	c.(253-255)TAC>AAC	p.Y85N		NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565	85										ovary(1)	1																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17152954	17152954	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17152954T>A	uc001ioo.2	-	9	1031	c.979A>T	c.(979-981)ACA>TCA	p.T327S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	327	EGF-like 4; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
GDF10	2662	broad.mit.edu	37	10	48438519	48438519	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48438519G>A	uc001jfb.2	-	1	648	c.192C>T	c.(190-192)GCC>GCT	p.A64A	GDF10_uc009xnp.2_Silent_p.A64A|GDF10_uc009xnq.1_Silent_p.A64A	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	64					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2																		---	---	---	---
A1CF	29974	broad.mit.edu	37	10	52596017	52596017	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52596017C>A	uc001jjj.2	-	6	609	c.421G>T	c.(421-423)GGG>TGG	p.G141W	A1CF_uc010qhn.1_Missense_Mutation_p.G149W|A1CF_uc001jji.2_Missense_Mutation_p.G141W|A1CF_uc001jjh.2_Missense_Mutation_p.G149W|A1CF_uc010qho.1_Missense_Mutation_p.G149W|A1CF_uc009xov.2_Missense_Mutation_p.G141W	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	141	RRM 2.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1																		---	---	---	---
RAD9A	5883	broad.mit.edu	37	11	67164770	67164770	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67164770C>A	uc001okr.2	+	10	1086	c.993C>A	c.(991-993)CCC>CCA	p.P331P	RAD9A_uc001oks.2_Silent_p.P188P	NM_004584	NP_004575	Q99638	RAD9A_HUMAN	RAD9 homolog	331	Sufficient for interaction with ABL1.				DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint	nucleoplasm	3'-5' exonuclease activity|exodeoxyribonuclease III activity|histone deacetylase binding|protein kinase binding|SH3 domain binding				0			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)										Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
ALDH3B2	222	broad.mit.edu	37	11	67431918	67431918	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67431918G>A	uc001omr.2	-	8	1261	c.822C>T	c.(820-822)ATC>ATT	p.I274I	ALDH3B2_uc001oms.2_Silent_p.I274I|ALDH3B2_uc009ysa.1_Silent_p.I274I	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	274					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)													---	---	---	---
ALDH3B2	222	broad.mit.edu	37	11	67431927	67431927	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67431927G>C	uc001omr.2	-	8	1252	c.813C>G	c.(811-813)ATC>ATG	p.I271M	ALDH3B2_uc001oms.2_Missense_Mutation_p.I271M|ALDH3B2_uc009ysa.1_Missense_Mutation_p.I271M	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	271					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)													---	---	---	---
ALDH3B2	222	broad.mit.edu	37	11	67431978	67431978	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67431978G>C	uc001omr.2	-	8	1201	c.762C>G	c.(760-762)ATC>ATG	p.I254M	ALDH3B2_uc001oms.2_Missense_Mutation_p.I254M|ALDH3B2_uc009ysa.1_Missense_Mutation_p.I254M	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	254					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)													---	---	---	---
ATM	472	broad.mit.edu	37	11	108218089	108218089	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108218089C>G	uc001pkb.1	+	59	9053	c.8668C>G	c.(8668-8670)CTA>GTA	p.L2890V	ATM_uc009yxr.1_Missense_Mutation_p.L2890V|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.L1542V	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2890	PI3K/PI4K.		L -> V (in T-prolymphocytic leukemia).		cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	p.L2890V(2)		haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)				D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			---	---	---	---
PPP2R1B	5519	broad.mit.edu	37	11	111613304	111613304	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111613304T>A	uc001plx.1	-	13	1724	c.1640A>T	c.(1639-1641)AAT>ATT	p.N547I	PPP2R1B_uc001plw.1_Missense_Mutation_p.N547I|PPP2R1B_uc010rwi.1_Missense_Mutation_p.N483I|PPP2R1B_uc010rwj.1_Missense_Mutation_p.N386I|PPP2R1B_uc010rwk.1_Missense_Mutation_p.N502I|PPP2R1B_uc010rwl.1_Missense_Mutation_p.N420I	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	547	HEAT 14.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)														---	---	---	---
NLRX1	79671	broad.mit.edu	37	11	119045756	119045756	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045756G>A	uc001pvu.2	+	6	1659	c.1444G>A	c.(1444-1446)GTG>ATG	p.V482M	NLRX1_uc010rzc.1_Missense_Mutation_p.V304M|NLRX1_uc001pvv.2_Missense_Mutation_p.V482M|NLRX1_uc001pvw.2_Missense_Mutation_p.V482M|NLRX1_uc001pvx.2_Missense_Mutation_p.V482M	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	482	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)														---	---	---	---
SMARCC2	6601	broad.mit.edu	37	12	56568558	56568558	+	Intron	SNP	A	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56568558A>G	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)															---	---	---	---
IL23A	51561	broad.mit.edu	37	12	56733273	56733273	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56733273G>A	uc001sla.2	+	2	392	c.226G>A	c.(226-228)GGC>AGC	p.G76S		NM_016584	NP_057668	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19 precursor	76					defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity				0																		---	---	---	---
ATP5B	506	broad.mit.edu	37	12	57033084	57033084	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57033084T>C	uc001slr.2	-	9	1400	c.1295A>G	c.(1294-1296)AAA>AGA	p.K432R	BAZ2A_uc001slq.1_5'Flank|BAZ2A_uc010sqr.1_5'Flank	NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	432					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1																		---	---	---	---
UBC	7316	broad.mit.edu	37	12	125398003	125398003	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125398003C>G	uc001ugs.3	-	2	763	c.315G>C	c.(313-315)AAG>AAC	p.K105N	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Missense_Mutation_p.K105N|UBC_uc001ugt.2_Missense_Mutation_p.K105N|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_5'UTR	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	105	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133235942	133235942	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133235942C>A	uc001uks.1	-	26	3258	c.3214G>T	c.(3214-3216)GCA>TCA	p.A1072S	POLE_uc001ukr.1_5'Flank|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.A1045S	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1072					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
TUBA3C	7278	broad.mit.edu	37	13	19751365	19751365	+	Missense_Mutation	SNP	G	A	A	rs139914455		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751365G>A	uc009zzj.2	-	4	807	c.758C>T	c.(757-759)ACG>ATG	p.T253M		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	253					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	p.T253T(1)		ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35770041	35770041	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35770041A>C	uc001uvb.2	+	31	5174	c.4968A>C	c.(4966-4968)GAA>GAC	p.E1656D	NBEA_uc010abi.2_Missense_Mutation_p.E312D	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1656						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101936302	101936302	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101936302G>A	uc001vox.1	-	10	1305	c.1116C>T	c.(1114-1116)CGC>CGT	p.R372R	NALCN_uc001voy.2_Silent_p.R87R|NALCN_uc001voz.2_Silent_p.R372R|NALCN_uc001vpa.2_Silent_p.R372R	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	372	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
SDCCAG1	9147	broad.mit.edu	37	14	50247048	50247048	+	Intron	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50247048C>A	uc010anj.1	-						KLHDC2_uc001wwx.2_Intron|KLHDC2_uc001wwy.2_Intron|KLHDC2_uc010anp.2_Intron	NM_004713	NP_004704			serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)														---	---	---	---
C15orf53	400359	broad.mit.edu	37	15	38990596	38990596	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38990596C>A	uc001zkf.1	+	2	400	c.390C>A	c.(388-390)CCC>CCA	p.P130P		NM_207444	NP_997327	Q8NAA6	CO053_HUMAN	hypothetical protein LOC400359	130											0		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)														---	---	---	---
VPS39	23339	broad.mit.edu	37	15	42480042	42480042	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42480042C>A	uc001zpd.2	-	7	539	c.388G>T	c.(388-390)GGT>TGT	p.G130C	VPS39_uc001zpc.2_Missense_Mutation_p.G119C	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	130	CNH.				protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)														---	---	---	---
HCN4	10021	broad.mit.edu	37	15	73635776	73635776	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73635776G>A	uc002avp.2	-	2	2153	c.1159C>T	c.(1159-1161)CGC>TGC	p.R387C		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	387	Helical; Voltage-sensor; Name=Segment S4; (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)														---	---	---	---
BLM	641	broad.mit.edu	37	15	91312735	91312735	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91312735C>A	uc002bpr.2	+	12	2571	c.2474C>A	c.(2473-2475)CCG>CAG	p.P825Q	BLM_uc010uqh.1_Missense_Mutation_p.P825Q|BLM_uc010uqi.1_Missense_Mutation_p.P450Q|BLM_uc010bnx.2_Missense_Mutation_p.P825Q|BLM_uc002bps.1_Missense_Mutation_p.P387Q	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	825	Helicase ATP-binding.				double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)					Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				---	---	---	---
MAPK8IP3	23162	broad.mit.edu	37	16	1818346	1818346	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1818346C>A	uc002cmk.2	+	30	3826	c.3706C>A	c.(3706-3708)CGC>AGC	p.R1236S	MAPK8IP3_uc002cml.2_Missense_Mutation_p.R1230S|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.R1237S	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	1236					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
ABCC11	85320	broad.mit.edu	37	16	48201223	48201223	+	Missense_Mutation	SNP	C	T	T	rs139034695	by1000genomes	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48201223C>T	uc002eff.1	-	29	4461	c.4111G>A	c.(4111-4113)GCA>ACA	p.A1371T	ABCC11_uc002efg.1_Missense_Mutation_p.A1371T|ABCC11_uc002efh.1_Missense_Mutation_p.A1333T|ABCC11_uc010cbg.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	1371	ABC transporter 2.|Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)												Cerumen_Type				---	---	---	---
GPR97	222487	broad.mit.edu	37	16	57713776	57713776	+	Intron	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57713776C>A	uc002emh.2	+						GPR97_uc010vhv.1_Intron|GPR97_uc010cdd.2_Intron|GPR97_uc010cde.2_Intron	NM_170776	NP_740746			G protein-coupled receptor 97 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1																		---	---	---	---
CHD3	1107	broad.mit.edu	37	17	7793043	7793043	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7793043C>A	uc002gje.2	+	2	312	c.162C>A	c.(160-162)CCC>CCA	p.P54P	CHD3_uc002gjd.2_Silent_p.P113P|CHD3_uc002gjf.2_Silent_p.P54P|CHD3_uc002gjg.1_5'Flank	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	54					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)																---	---	---	---
TOM1L2	146691	broad.mit.edu	37	17	17810756	17810756	+	Intron	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17810756C>T	uc002grz.3	-						TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Intron|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc010vxb.1_Intron	NM_001082968	NP_001076437			target of myb1-like 2 isoform 3						intracellular protein transport	intracellular					0	all_neural(463;0.228)																	---	---	---	---
ITGA2B	3674	broad.mit.edu	37	17	42462574	42462574	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42462574C>A	uc002igt.1	-	6	660	c.628G>T	c.(628-630)GGA>TGA	p.G210*		NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein	210	FG-GAP 3.|Extracellular (Potential).				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)													---	---	---	---
KIF2B	84643	broad.mit.edu	37	17	51900727	51900727	+	Silent	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51900727C>T	uc002iua.2	+	1	489	c.333C>T	c.(331-333)ACC>ACT	p.T111T	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	111					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8																		---	---	---	---
MED13	9969	broad.mit.edu	37	17	60088462	60088462	+	Silent	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60088462G>T	uc002izo.2	-	9	1493	c.1416C>A	c.(1414-1416)CCC>CCA	p.P472P	MED13_uc002izp.2_Silent_p.P88P	NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	472					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
C1QTNF1	114897	broad.mit.edu	37	17	77043955	77043955	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77043955A>G	uc002jwp.2	+	4	971	c.631A>G	c.(631-633)ATC>GTC	p.I211V	C1QTNF1_uc002jwq.2_Missense_Mutation_p.I129V|C1QTNF1_uc002jwr.3_Missense_Mutation_p.I221V|C1QTNF1_uc002jws.2_Missense_Mutation_p.I211V|C1QTNF1_uc002jwt.2_Missense_Mutation_p.I309V	NM_030968	NP_112230	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	211	C1q.					collagen				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)															---	---	---	---
BAIAP2	10458	broad.mit.edu	37	17	79077849	79077849	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79077849C>T	uc002jzg.2	+	9	1115	c.1007C>T	c.(1006-1008)TCC>TTC	p.S336F	BAIAP2_uc002jyz.3_Missense_Mutation_p.S336F|BAIAP2_uc002jza.2_Missense_Mutation_p.S336F|BAIAP2_uc002jzc.2_Missense_Mutation_p.S336F|BAIAP2_uc002jzb.2_Missense_Mutation_p.S93F|BAIAP2_uc002jzd.2_Missense_Mutation_p.S336F|BAIAP2_uc002jzf.2_Missense_Mutation_p.S336F|BAIAP2_uc002jze.2_Missense_Mutation_p.S369F|BAIAP2_uc010wuh.1_Missense_Mutation_p.S258F|BAIAP2_uc002jzh.2_Missense_Mutation_p.S337F|BAIAP2_uc010wui.1_Missense_Mutation_p.S199F	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	336					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
EPB41L3	23136	broad.mit.edu	37	18	5398076	5398076	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5398076G>A	uc002kmt.1	-	17	2502	c.2416C>T	c.(2416-2418)CGA>TGA	p.R806*	EPB41L3_uc010wzh.1_Nonsense_Mutation_p.R637*|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Nonsense_Mutation_p.R111*|EPB41L3_uc010wzf.1_Nonsense_Mutation_p.R103*|EPB41L3_uc010wzg.1_Nonsense_Mutation_p.R78*|EPB41L3_uc010dkr.2_Nonsense_Mutation_p.R198*	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	806	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5																		---	---	---	---
ROCK1	6093	broad.mit.edu	37	18	18546911	18546911	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18546911G>C	uc002kte.2	-	27	4260	c.3319C>G	c.(3319-3321)CCT>GCT	p.P1107A		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1107					actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)																	---	---	---	---
DCC	1630	broad.mit.edu	37	18	50734076	50734076	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50734076A>G	uc002lfe.1	+	11	2337	c.1750A>G	c.(1750-1752)AAA>GAA	p.K584E	DCC_uc010xdr.1_Missense_Mutation_p.K432E|DCC_uc010dpf.1_Missense_Mutation_p.K239E	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	584	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5220015	5220015	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5220015G>A	uc002mbv.2	-	22	3934	c.3700C>T	c.(3700-3702)CGG>TGG	p.R1234W	PTPRS_uc002mbu.1_Missense_Mutation_p.R803W|PTPRS_uc010xin.1_Missense_Mutation_p.R803W|PTPRS_uc002mbw.2_Missense_Mutation_p.R1212W|PTPRS_uc002mbx.2_Missense_Mutation_p.R807W|PTPRS_uc002mby.2_Missense_Mutation_p.R803W	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	1234	Extracellular (Potential).				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
FUT3	2525	broad.mit.edu	37	19	5844092	5844092	+	Silent	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5844092G>T	uc002mdk.2	-	2	856	c.759C>A	c.(757-759)CCC>CCA	p.P253P	FUT3_uc002mdm.2_Silent_p.P253P|FUT3_uc002mdj.2_Silent_p.P253P|FUT3_uc002mdl.2_Silent_p.P253P	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	253	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0																		---	---	---	---
PNPLA6	10908	broad.mit.edu	37	19	7624011	7624011	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7624011G>A	uc010xjq.1	+	30	3898	c.3703G>A	c.(3703-3705)GAC>AAC	p.D1235N	PNPLA6_uc002mgq.1_Missense_Mutation_p.D1187N|PNPLA6_uc010xjp.1_Missense_Mutation_p.D1160N|PNPLA6_uc002mgr.1_Missense_Mutation_p.D1187N|PNPLA6_uc002mgs.2_Missense_Mutation_p.D1225N|PNPLA6_uc002mgt.1_RNA	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	1226	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3																		---	---	---	---
BRD4	23476	broad.mit.edu	37	19	15379809	15379809	+	Silent	SNP	T	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15379809T>A	uc002nar.2	-	3	552	c.330A>T	c.(328-330)ATA>ATT	p.I110I	BRD4_uc002nas.2_Silent_p.I110I|BRD4_uc002nat.3_Silent_p.I110I|BRD4_uc002nau.3_Silent_p.I110I	NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	110	Bromo 1.				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)					T	NUT|C15orf55	lethal midline carcinoma of young people								---	---	---	---
DDA1	79016	broad.mit.edu	37	19	17424912	17424912	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17424912G>A	uc002ngd.2	+	2	211	c.84G>A	c.(82-84)TCG>TCA	p.S28S	DDA1_uc002nge.2_5'UTR	NM_024050	NP_076955	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1	28										ovary(1)	1																		---	---	---	---
ZNF260	339324	broad.mit.edu	37	19	37004946	37004946	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37004946G>T	uc002oee.1	-	4	2039	c.1195C>A	c.(1195-1197)CAA>AAA	p.Q399K	ZNF260_uc002oed.1_Missense_Mutation_p.Q396K|ZNF260_uc010eey.1_Missense_Mutation_p.Q396K|ZNF260_uc002oef.1_Missense_Mutation_p.Q396K	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	399	C2H2-type 13.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)																	---	---	---	---
PLD3	23646	broad.mit.edu	37	19	40872764	40872764	+	Missense_Mutation	SNP	G	T	T	rs142070038	byFrequency	TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40872764G>T	uc002onm.3	+	5	585	c.187G>T	c.(187-189)GGC>TGC	p.G63C	PLD3_uc002onj.3_Missense_Mutation_p.G63C|PLD3_uc002onk.3_Missense_Mutation_p.G63C|PLD3_uc002onl.3_Missense_Mutation_p.G63C|PLD3_uc002onn.2_Missense_Mutation_p.G63C|PLD3_uc002ono.2_Missense_Mutation_p.R92L	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3	63	Lumenal (Potential).				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)															---	---	---	---
FGF21	26291	broad.mit.edu	37	19	49260235	49260235	+	Silent	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49260235C>A	uc002pkn.1	+	3	860	c.288C>A	c.(286-288)GTC>GTA	p.V96V	FUT1_uc002pkk.2_5'Flank|FUT1_uc002pkm.1_5'Flank|FGF21_uc002pko.1_Silent_p.V96V	NM_019113	NP_061986	Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21 precursor	96					cell-cell signaling|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import	extracellular region|soluble fraction	growth factor activity			breast(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)														---	---	---	---
LILRA5	353514	broad.mit.edu	37	19	54823200	54823200	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54823200G>T	uc002qfe.2	-	4	463	c.343C>A	c.(343-345)CGC>AGC	p.R115S	LILRA5_uc002qff.2_Missense_Mutation_p.R103S|LILRA5_uc010yev.1_Missense_Mutation_p.R115S|LILRA5_uc010yew.1_Missense_Mutation_p.R103S|LILRA5_uc002qfh.1_Missense_Mutation_p.R103S|LILRA5_uc002qfg.1_Missense_Mutation_p.R115S	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	115	Extracellular (Potential).|Ig-like C2-type 1.				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
GP6	51206	broad.mit.edu	37	19	55525822	55525822	+	3'UTR	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55525822G>A	uc002qik.2	-	8					GP6_uc002qil.2_Silent_p.H497H|GP6_uc010esq.2_3'UTR	NM_016363	NP_057447			glycoprotein VI (platelet) isoform 2						enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)														---	---	---	---
ZNF274	10782	broad.mit.edu	37	19	58697119	58697119	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58697119C>A	uc002qrq.1	+	3	533	c.74C>A	c.(73-75)CCG>CAG	p.P25Q	ZNF274_uc010yhu.1_RNA|ZNF274_uc010yhv.1_Intron|ZNF274_uc002qrr.1_Missense_Mutation_p.P25Q|ZNF274_uc002qrs.1_Intron|ZNF274_uc010eum.1_5'UTR	NM_133502	NP_598009	Q96GC6	ZN274_HUMAN	zinc finger protein 274 isoform c	25	KRAB 1.				viral reproduction	centrosome|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)														---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50701165	50701165	+	Silent	SNP	C	A	A	rs140821732		TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50701165C>A	uc002xwk.2	-	9	2218	c.1869G>T	c.(1867-1869)TCG>TCT	p.S623S	ZFP64_uc002xwj.2_Silent_p.S404S	NM_199427	NP_955459	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform d	468					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
C20orf85	128602	broad.mit.edu	37	20	56730598	56730598	+	Silent	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56730598G>A	uc002xyv.2	+	3	263	c.225G>A	c.(223-225)CCG>CCA	p.P75P		NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	hypothetical protein LOC128602	75										ovary(1)	1	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)															---	---	---	---
KRTAP11-1	337880	broad.mit.edu	37	21	32253653	32253653	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32253653G>A	uc002yov.2	-	1	222	c.191C>T	c.(190-192)ACT>ATT	p.T64I		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	64						keratin filament	structural molecule activity			pancreas(1)	1																		---	---	---	---
TRIOBP	11078	broad.mit.edu	37	22	38084375	38084375	+	Intron	SNP	G	C	C			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38084375G>C	uc003atq.1	+						NOL12_uc011anm.1_Intron|NOL12_uc003ato.1_Intron|NOL12_uc003atp.2_Intron	NM_001039141	NP_001034230			TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
CCDC22	28952	broad.mit.edu	37	X	49104740	49104740	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49104740C>T	uc004dnd.1	+	10	1337	c.1181C>T	c.(1180-1182)CCC>CTC	p.P394L	CCDC22_uc004dnc.1_RNA	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22	394										central_nervous_system(1)	1																		---	---	---	---
GSPT2	23708	broad.mit.edu	37	X	51487601	51487601	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51487601T>G	uc004dpl.2	+	1	1105	c.879T>G	c.(877-879)AGT>AGG	p.S293R		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	293				S -> G (in Ref. 2; BAA91612).	cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)																	---	---	---	---
ELF4	2000	broad.mit.edu	37	X	129206276	129206276	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4301-01	TCGA-CG-4301-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129206276G>A	uc004evd.3	-	5	842	c.457C>T	c.(457-459)CAG>TAG	p.Q153*	ELF4_uc004eve.3_Nonsense_Mutation_p.Q153*	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	153	RUNX1-binding.				natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1								T	ERG	AML								---	---	---	---
