Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CELSR2	1952	broad.mit.edu	37	1	109816863	109816864	+	3'UTR	INS	-	C	C	rs145508961	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109816863_109816864insC	uc001dxa.3	+	34						NM_001408	NP_001399			cadherin EGF LAG seven-pass G-type receptor 2						dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)														---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236590676	236590676	+	Intron	DEL	T	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236590676delT	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10539468	10539469	+	Intron	INS	-	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10539468_10539469insC	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron|HPCAL1_uc010exf.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	64574341	64574342	+	IGR	INS	-	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64574341_64574342insT								PELI1 (202736 upstream) : HSPC159 (106985 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152370225	152370226	+	Intron	INS	-	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152370225_152370226insA	uc010fnx.2	-						NEB_uc002txr.2_Intron|NEB_uc002txt.3_Intron	NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	172755720	172755725	+	IGR	DEL	CCTCTC	-	-	rs147378241	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172755720_172755725delCCTCTC								SLC25A12 (4907 upstream) : HAT1 (23210 downstream)																																			---	---	---	---
SPEG	10290	broad.mit.edu	37	2	220330663	220330674	+	Intron	DEL	GTGTGCGTGCAT	-	-	rs148714215	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220330663_220330674delGTGTGCGTGCAT	uc010fwg.2	+						SPEG_uc002vlm.2_Intron|SPEG_uc010fwh.1_Intron|SPEG_uc002vln.1_3'UTR|SPEG_uc002vlp.1_3'UTR|SPEG_uc002vlq.2_Intron	NM_005876	NP_005867			SPEG complex locus						muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)														---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31405874	31405874	+	Intron	DEL	C	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31405874delC	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
AGXT2	64902	broad.mit.edu	37	5	35026700	35026700	+	Intron	DEL	A	-	-	rs72168991		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35026700delA	uc003jjf.2	-						AGXT2_uc003jje.1_5'Flank|AGXT2_uc011com.1_Intron	NM_031900	NP_114106			alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)													---	---	---	---
LIFR	3977	broad.mit.edu	37	5	38496666	38496667	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38496666_38496667insT	uc010ive.1	-	13	2034_2035	c.1702_1703insA	c.(1702-1704)ATAfs	p.I568fs	LIFR_uc003jli.2_Frame_Shift_Ins_p.I568fs	NM_001127671	NP_001121143	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor	568	Extracellular (Potential).|Fibronectin type-III 4.				positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)							T	PLAG1	salivary adenoma								---	---	---	---
SPINK5	11005	broad.mit.edu	37	5	147445109	147445114	+	Intron	DEL	CACACA	-	-	rs3036741		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147445109_147445114delCACACA	uc003lox.2	+						SPINK5_uc010jgq.1_Intron|SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837			serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75855328	75855328	+	Intron	DEL	T	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855328delT	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
MICALL2	79778	broad.mit.edu	37	7	1482299	1482331	+	Intron	DEL	GCCTCCCCCACCATTGCACCAGGCTGCCCCTCT	-	-	rs148012484	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1482299_1482331delGCCTCCCCCACCATTGCACCAGGCTGCCCCTCT	uc003skj.3	-						MICALL2_uc003ski.3_5'Flank	NM_182924	NP_891554			MICAL-like 2 isoform 1							cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64975181	64975184	+	IGR	DEL	TTTG	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975181_64975184delTTTG								ZNF92 (109184 upstream) : INTS4L2 (137593 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157615022	157615025	+	Intron	DEL	CATC	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157615022_157615025delCATC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PIWIL2	55124	broad.mit.edu	37	8	22165710	22165711	+	Intron	INS	-	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22165710_22165711insT	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538			piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	76858719	76858720	+	IGR	INS	-	TTCC	TTCC	rs148513973	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76858719_76858720insTTCC								HNF4G (379660 upstream) : LOC100192378 (664395 downstream)																																			---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141545538	141545539	+	Intron	DEL	CT	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141545538_141545539delCT	uc003yvn.2	-						EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Intron	NM_012154	NP_036286			argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
ANKRD20A3	441425	broad.mit.edu	37	9	67934791	67934794	+	Frame_Shift_Del	DEL	AAAG	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67934791_67934794delAAAG	uc004aeu.2	+	4	673_676	c.561_564delAAAG	c.(559-564)AAAAGGfs	p.K187fs	ANKRD20A3_uc010mnn.2_Frame_Shift_Del_p.K187fs	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	187_188	ANK 4.										0																		---	---	---	---
NR6A1	2649	broad.mit.edu	37	9	127360949	127360949	+	Intron	DEL	C	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127360949delC	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591			nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ATL3	25923	broad.mit.edu	37	11	63400292	63400293	+	Intron	INS	-	CAAAA	CAAAA			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63400292_63400293insCAAAA	uc001nxk.1	-						ATL3_uc010rms.1_Intron|ATL3_uc010rmr.1_Intron	NM_015459	NP_056274			atlastin 3						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			pancreas(1)	1																		---	---	---	---
MON2	23041	broad.mit.edu	37	12	62894781	62894783	+	Intron	DEL	TAT	-	-	rs113437686		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62894781_62894783delTAT	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_5'Flank|MON2_uc001srd.1_Intron	NM_015026	NP_055841			MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)														---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64816642	64816646	+	Intron	DEL	CACTG	-	-	rs151118213		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64816642_64816646delCACTG	uc001ssb.2	+							NM_007235	NP_009166			tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
CCDC64	92558	broad.mit.edu	37	12	120510172	120510172	+	Intron	DEL	A	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120510172delA	uc001txl.1	+						CCDC64_uc001txk.2_Intron|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Intron	NM_207311	NP_997194			coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
CDX2	1045	broad.mit.edu	37	13	28538846	28538849	+	Intron	DEL	AAAA	-	-	rs66744020		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28538846_28538849delAAAA	uc001urv.2	-							NM_001265	NP_001256			caudal type homeobox 2						organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)				T	ETV6	AML								---	---	---	---
FNTB	2342	broad.mit.edu	37	14	65507322	65507323	+	Intron	INS	-	T	T	rs35890649		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65507322_65507323insT	uc001xia.2	+						FNTB_uc010tsl.1_Intron|FNTB_uc010tsm.1_Intron|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_Intron|FNTB_uc010tso.1_Intron	NM_002028	NP_002019			farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)														---	---	---	---
RAB11FIP3	9727	broad.mit.edu	37	16	554129	554130	+	Intron	INS	-	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:554129_554130insT	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515			rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)																---	---	---	---
XPO6	23214	broad.mit.edu	37	16	28124447	28124447	+	Intron	DEL	A	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28124447delA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986			exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
MBTPS1	8720	broad.mit.edu	37	16	84094451	84094451	+	Intron	DEL	T	-	-	rs71920773		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84094451delT	uc002fhi.2	-						MBTPS1_uc002fhh.2_Intron	NM_003791	NP_003782			membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
CA5A	763	broad.mit.edu	37	16	87926753	87926753	+	Intron	DEL	T	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87926753delT	uc002fkn.1	-							NM_001739	NP_001730			carbonic anhydrase VA, mitochondrial precursor						one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)														---	---	---	---
TBC1D29	26083	broad.mit.edu	37	17	28885450	28885451	+	5'Flank	INS	-	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28885450_28885451insT	uc002hfh.2	+						uc002hfg.1_5'Flank|TBC1D29_uc002hfi.2_5'Flank	NM_015594	NP_056409			TBC1 domain family, member 29							intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)																---	---	---	---
FNDC8	54752	broad.mit.edu	37	17	33449007	33449007	+	Intron	DEL	T	-	-	rs67915235		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33449007delT	uc002hix.2	+						RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank|RAD51L3_uc002hiw.1_5'Flank|RAD51L3_uc002hiv.1_5'Flank|RAD51L3_uc010ctl.1_5'Flank|RAD51L3_uc010ctm.1_5'Flank	NM_017559	NP_060029			fibronectin type III domain containing 8											ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)														---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	58888882	58888882	+	Intron	DEL	A	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58888882delA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80544375	80544375	+	Intron	DEL	C	-	-	rs72318042		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544375delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
ENOSF1	55556	broad.mit.edu	37	18	690702	690703	+	Intron	INS	-	AGCTGTTTCCCCTGGAGAGTCC	AGCTGTTTCCCCTGGAGAGTCC	rs145372402	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:690702_690703insAGCTGTTTCCCCTGGAGAGTCC	uc002kku.3	-						ENOSF1_uc002kkt.3_Intron|ENOSF1_uc010dke.2_Intron|ENOSF1_uc010dkf.2_Intron|ENOSF1_uc002kkv.3_Intron|ENOSF1_uc002kkw.3_5'UTR|ENOSF1_uc002kkx.3_Intron	NM_017512	NP_059982			enolase superfamily 1 isoform rTS beta						cellular amino acid catabolic process	mitochondrion	isomerase activity|metal ion binding			ovary(1)	1																		---	---	---	---
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958			scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)														---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50918996	50918996	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50918996delC	uc002psb.3	+	22	2789	c.2733delC	c.(2731-2733)GACfs	p.D911fs	POLD1_uc002psc.3_Frame_Shift_Del_p.D911fs|POLD1_uc010enx.2_Intron|POLD1_uc010eny.2_Frame_Shift_Del_p.D937fs	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	911					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
EPS8L1	54869	broad.mit.edu	37	19	55598003	55598004	+	Intron	INS	-	C	C	rs143222343	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55598003_55598004insC	uc002qis.3	+						EPS8L1_uc010yfr.1_Intron|EPS8L1_uc002qiu.2_Intron|EPS8L1_uc002qiv.2_Intron|EPS8L1_uc002qiw.2_Intron	NM_133180	NP_573441			epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)														---	---	---	---
PANK2	80025	broad.mit.edu	37	20	3897857	3897857	+	Intron	DEL	T	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3897857delT	uc002wkc.2	+						PANK2_uc002wkb.2_Intron|PANK2_uc002wkd.2_Intron|PANK2_uc002wke.2_Intron|PANK2_uc002wkf.2_Intron|uc002wkg.2_5'Flank|MIR103-2_hsa-mir-103-2|MI0000108_5'Flank	NM_153638	NP_705902			pantothenate kinase 2 isoform 1 preproprotein						cell death|coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial intermembrane space|nucleus	ATP binding|pantothenate kinase activity|protein binding				0																		---	---	---	---
LSM14B	149986	broad.mit.edu	37	20	60699938	60699939	+	Intron	INS	-	T	T	rs142325994		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60699938_60699939insT	uc010gjy.1	+						LSM14B_uc002ybt.2_Intron|LSM14B_uc010gjx.1_Intron|LSM14B_uc002ybv.2_Intron|LSM14B_uc010gjz.1_Intron|LSM14B_uc010zzz.1_Intron	NM_144703	NP_653304			LSM14 homolog B						multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)															---	---	---	---
MLC1	23209	broad.mit.edu	37	22	50502209	50502210	+	Intron	INS	-	T	T	rs67059183		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50502209_50502210insT	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941			megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)														---	---	---	---
PLXNB2	23654	broad.mit.edu	37	22	50722939	50722940	+	Intron	INS	-	C	C	rs146267024	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50722939_50722940insC	uc003bkv.3	-						PLXNB2_uc003bkt.1_5'Flank|PLXNB2_uc003bku.1_5'Flank	NM_012401	NP_036533			plexin B2 precursor						regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	48307150	48307150	+	IGR	DEL	T	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48307150delT								SSX4 (54365 upstream) : SLC38A5 (9778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	101033653	101033653	+	IGR	DEL	C	-	-			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101033653delC								ARMCX2 (118790 upstream) : NXF5 (53432 downstream)																																			---	---	---	---
TNFRSF9	3604	broad.mit.edu	37	1	7980916	7980916	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7980916T>G	uc001aot.2	-	8	875	c.747A>C	c.(745-747)GAA>GAC	p.E249D		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	249	Cytoplasmic (Potential).|Interaction with LRR-1.				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PRAMEF6	440561	broad.mit.edu	37	1	13001286	13001286	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13001286T>G	uc001auq.2	-	3	483	c.397A>C	c.(397-399)ACA>CCA	p.T133P	PRAMEF5_uc001aur.2_Intron	NM_001010889	NP_001010889	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	133											0	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
SDHB	6390	broad.mit.edu	37	1	17349180	17349180	+	Missense_Mutation	SNP	G	A	A	rs138996609	by1000genomes	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17349180G>A	uc001bae.2	-	7	839	c.688C>T	c.(688-690)CGC>TGC	p.R230C		NM_003000	NP_002991	P21912	DHSB_HUMAN	succinate dehydrogenase complex, subunit B, iron	230			R -> C (in pheochromocytoma).		respiratory electron transport chain|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	2 iron, 2 sulfur cluster binding|3 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|protein binding|succinate dehydrogenase (ubiquinone) activity|ubiquinone binding			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)			Mis|N|F			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37356689	37356689	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37356689A>C	uc001caz.2	-	2	259	c.124T>G	c.(124-126)TTC>GTC	p.F42V	GRIK3_uc001cba.1_Missense_Mutation_p.F42V	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	42	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
MTF1	4520	broad.mit.edu	37	1	38323055	38323055	+	Silent	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38323055A>C	uc001cce.1	-	2	417	c.276T>G	c.(274-276)GGT>GGG	p.G92G	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	92						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
DHCR24	1718	broad.mit.edu	37	1	55337221	55337221	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55337221G>A	uc001cyc.1	-	5	807	c.678C>T	c.(676-678)GCC>GCT	p.A226A	DHCR24_uc010ooj.1_Silent_p.A88A|DHCR24_uc010ook.1_Silent_p.A185A	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	226	FAD-binding PCMH-type.				anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1																		---	---	---	---
C8B	732	broad.mit.edu	37	1	57420479	57420479	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57420479A>C	uc001cyp.2	-	4	480	c.413T>G	c.(412-414)CTT>CGT	p.L138R	C8B_uc010oon.1_Missense_Mutation_p.L76R|C8B_uc010ooo.1_Missense_Mutation_p.L86R	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	138	LDL-receptor class A.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4																		---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75037488	75037488	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037488G>T	uc001dgg.2	-	14	4125	c.3906C>A	c.(3904-3906)TGC>TGA	p.C1302*		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1302	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
GBP1	2633	broad.mit.edu	37	1	89520508	89520508	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89520508C>G	uc001dmx.2	-	10	1742	c.1522G>C	c.(1522-1524)GAA>CAA	p.E508Q		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	508					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)														---	---	---	---
HFM1	164045	broad.mit.edu	37	1	91859732	91859732	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91859732G>T	uc001doa.3	-	4	512	c.412C>A	c.(412-414)CCT>ACT	p.P138T	HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Missense_Mutation_p.P138T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	138							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)														---	---	---	---
OR6N1	128372	broad.mit.edu	37	1	158736261	158736261	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158736261A>C	uc010piq.1	-	1	212	c.212T>G	c.(211-213)CTT>CGT	p.L71R		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
ATP1A2	477	broad.mit.edu	37	1	160097392	160097392	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160097392C>T	uc001fvc.2	+	8	931	c.799C>T	c.(799-801)CGC>TGC	p.R267C	ATP1A2_uc001fvb.2_Missense_Mutation_p.R267C|ATP1A2_uc010piz.1_Missense_Mutation_p.R112C|ATP1A2_uc001fvd.2_Missense_Mutation_p.R3C|ATP1A2_uc009wtg.1_5'Flank	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	267	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)															---	---	---	---
C1orf111	284680	broad.mit.edu	37	1	162344042	162344042	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162344042G>A	uc001gbx.2	-	3	646	c.582C>T	c.(580-582)ACC>ACT	p.T194T		NM_182581	NP_872387	Q5T0L3	CA111_HUMAN	hypothetical protein LOC284680	194										ovary(1)	1	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)															---	---	---	---
FMO2	2327	broad.mit.edu	37	1	171154909	171154909	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171154909G>A	uc001ghk.1	+	2	174	c.57G>A	c.(55-57)AAG>AAA	p.K19K	FMO2_uc010pmd.1_Intron	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	19					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177245501	177245501	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177245501G>A	uc001glf.2	+	6	1255	c.943G>A	c.(943-945)GCC>ACC	p.A315T	FAM5B_uc010pna.1_Missense_Mutation_p.A65T|FAM5B_uc001glg.2_Missense_Mutation_p.A210T	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	315						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
CFH	3075	broad.mit.edu	37	1	196716376	196716376	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196716376G>A	uc001gtj.3	+	22	3869	c.3629G>A	c.(3628-3630)CGT>CAT	p.R1210H		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	1210	Sushi 20.		R -> C (in CFH deficiency).		complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6																		---	---	---	---
CR1	1378	broad.mit.edu	37	1	207796402	207796402	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207796402G>T	uc001hfy.2	+	37	6131	c.5991G>T	c.(5989-5991)AAG>AAT	p.K1997N	CR1_uc001hfx.2_Missense_Mutation_p.K2447N	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1997	Cytoplasmic (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
OR2L13	284521	broad.mit.edu	37	1	248263095	248263095	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263095T>A	uc001ids.2	+	3	755	c.418T>A	c.(418-420)TGT>AGT	p.C140S		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	140	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457972	248457972	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457972C>T	uc010pzj.1	-	1	909	c.909G>A	c.(907-909)CTG>CTA	p.L303L		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
RAB10	10890	broad.mit.edu	37	2	26350094	26350094	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26350094G>A	uc002rgv.2	+	4	1158	c.409G>A	c.(409-411)GGA>AGA	p.G137R		NM_016131	NP_057215	P61026	RAB10_HUMAN	ras-related GTP-binding protein RAB10	137					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
KIAA1841	84542	broad.mit.edu	37	2	61333807	61333807	+	Intron	SNP	T	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61333807T>A	uc002saw.3	+						KIAA1841_uc002sax.3_Intron|KIAA1841_uc002say.2_Intron	NM_001129993	NP_001123465			KIAA1841 protein isoform a												0			Epithelial(17;0.193)															---	---	---	---
VAX2	25806	broad.mit.edu	37	2	71160232	71160232	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71160232T>A	uc002shh.2	+	3	803	c.771T>A	c.(769-771)GAT>GAA	p.D257E	ATP6V1B1_uc002shi.1_5'Flank|ATP6V1B1_uc002shj.2_5'Flank|ATP6V1B1_uc010fdv.2_5'Flank|ATP6V1B1_uc010fdw.2_5'Flank	NM_012476	NP_036608	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	257					ectoderm development|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160245918	160245918	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160245918C>G	uc002uao.2	-	21	3506	c.3154G>C	c.(3154-3156)GAA>CAA	p.E1052Q	BAZ2B_uc002uap.2_Missense_Mutation_p.E1016Q	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1052	Lys-rich.|Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167301492	167301492	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167301492T>G	uc002udu.1	-	12	1533	c.1406A>C	c.(1405-1407)AAG>ACG	p.K469T	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	469					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179594026	179594026	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179594026A>C	uc010zfg.1	-	61	15349	c.15125T>G	c.(15124-15126)GTT>GGT	p.V5042G	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V1703G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5969							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
THAP4	51078	broad.mit.edu	37	2	242573185	242573185	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242573185C>T	uc002wbt.2	-	2	610	c.387G>A	c.(385-387)CCG>CCA	p.P129P		NM_015963	NP_057047	Q8WY91	THAP4_HUMAN	THAP domain containing 4 isoform 1	129							DNA binding|metal ion binding				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2908444	2908444	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2908444T>A	uc003bpc.2	+	7	684	c.463T>A	c.(463-465)TAT>AAT	p.Y155N	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.Y155N	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	155	Ig-like C2-type 2.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
TTLL3	26140	broad.mit.edu	37	3	9868870	9868870	+	Missense_Mutation	SNP	G	A	A	rs35644696	byFrequency	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9868870G>A	uc003btg.2	+	9	1280	c.1064G>A	c.(1063-1065)CGC>CAC	p.R355H	ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Missense_Mutation_p.R322H|TTLL3_uc003btf.3_Intron|TTLL3_uc010hco.1_Missense_Mutation_p.R291H|TTLL3_uc003bth.3_Missense_Mutation_p.R143H|TTLL3_uc011atj.1_Missense_Mutation_p.R291H|TTLL3_uc003btj.3_Missense_Mutation_p.R143H|TTLL3_uc003bti.3_Missense_Mutation_p.R143H|TTLL3_uc003btk.2_Missense_Mutation_p.R158H	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	355	TTL.				axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)																	---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35758839	35758839	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35758839C>T	uc003cgb.2	+	13	1249	c.985C>T	c.(985-987)CAG>TAG	p.Q329*	ARPP21_uc003cga.2_Intron|ARPP21_uc011axy.1_Nonsense_Mutation_p.Q295*|ARPP21_uc003cgf.2_Nonsense_Mutation_p.Q130*	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	329						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3																		---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46307574	46307574	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46307574C>T	uc003cpg.1	+	4	1468	c.925C>T	c.(925-927)CGG>TGG	p.R309W	CCR3_uc003cpi.1_Missense_Mutation_p.R309W|CCR3_uc003cpj.1_Missense_Mutation_p.R309W|CCR3_uc003cpk.1_Missense_Mutation_p.R330W|CCR3_uc010hjb.1_Missense_Mutation_p.R327W|CCR3_uc003cpl.1_Missense_Mutation_p.R342W	NM_178329	NP_847899	P51677	CCR3_HUMAN	CC chemokine receptor 3 isoform 1	309	Cytoplasmic (Potential).				cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
BSN	8927	broad.mit.edu	37	3	49694711	49694711	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49694711C>T	uc003cxe.3	+	5	7836	c.7722C>T	c.(7720-7722)CCC>CCT	p.P2574P		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2574					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
NAA50	80218	broad.mit.edu	37	3	113440597	113440597	+	3'UTR	SNP	T	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113440597T>C	uc003ean.1	-	5					NAA50_uc010hqm.1_3'UTR|NAA50_uc011bij.1_3'UTR	NM_025146	NP_079422			N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0																		---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123385057	123385057	+	Intron	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123385057G>A	uc003ego.2	-						MYLK_uc010hrr.2_5'Flank|MYLK_uc011bjv.1_Intron|MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
ACPL2	92370	broad.mit.edu	37	3	141011729	141011729	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141011729C>T	uc003etu.2	+	8	1424	c.1125C>T	c.(1123-1125)TAC>TAT	p.Y375Y	ACPL2_uc003etv.2_Silent_p.Y375Y|ACPL2_uc011bna.1_Silent_p.Y337Y|ACPL2_uc011bnb.1_Silent_p.Y358Y	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor	375						extracellular region	acid phosphatase activity			skin(1)	1																		---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174814828	174814828	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174814828C>A	uc003fit.2	+	2	379	c.292C>A	c.(292-294)CAG>AAG	p.Q98K	NAALADL2_uc003fiu.1_Missense_Mutation_p.Q91K	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	98	Cytoplasmic (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
RGS12	6002	broad.mit.edu	37	4	3318625	3318625	+	Missense_Mutation	SNP	C	T	T	rs149618433		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3318625C>T	uc003ggw.2	+	2	1632	c.728C>T	c.(727-729)ACG>ATG	p.T243M	RGS12_uc003ggu.2_Missense_Mutation_p.T243M|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Missense_Mutation_p.T243M|RGS12_uc003ggx.1_Missense_Mutation_p.T243M	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	243	PID.					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20535276	20535276	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20535276G>A	uc003gpr.1	+	18	1974	c.1770G>A	c.(1768-1770)ACG>ACA	p.T590T	SLIT2_uc003gps.1_Silent_p.T582T	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	590	LRR 14.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87610307	87610307	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87610307A>C	uc003hpz.2	+	5	990	c.510A>C	c.(508-510)AAA>AAC	p.K170N	PTPN13_uc003hpy.2_Missense_Mutation_p.K170N|PTPN13_uc003hqa.2_Missense_Mutation_p.K170N|PTPN13_uc003hqb.2_Missense_Mutation_p.K170N	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	170	KIND.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119026264	119026264	+	Intron	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119026264A>G	uc003ibx.2	+						NDST3_uc011cgf.1_Intron	NM_004784	NP_004775			N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
ANP32C	23520	broad.mit.edu	37	4	165118489	165118489	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165118489G>A	uc011cjk.1	-	1	375	c.375C>T	c.(373-375)AAC>AAT	p.N125N	MARCH1_uc003iqs.1_Intron	NM_012403	NP_036535	O43423	AN32C_HUMAN	acidic nuclear phosphoprotein 32C	125	LRR 4.										0	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)		KIRC - Kidney renal clear cell carcinoma(143;0.242)														---	---	---	---
TLL1	7092	broad.mit.edu	37	4	166924594	166924594	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166924594C>G	uc003irh.1	+	6	1331	c.684C>G	c.(682-684)ATC>ATG	p.I228M	TLL1_uc011cjn.1_Missense_Mutation_p.I228M|TLL1_uc011cjo.1_Missense_Mutation_p.I52M	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	228	Metalloprotease (By similarity).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)														---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187516942	187516942	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187516942G>A	uc003izf.2	-	26	13227	c.13039C>T	c.(13039-13041)CCT>TCT	p.P4347S	FAT1_uc010isn.2_5'UTR|FAT1_uc003ize.2_Missense_Mutation_p.P238S	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	4347	Cytoplasmic (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---
TAS2R1	50834	broad.mit.edu	37	5	9629933	9629933	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629933A>C	uc003jem.1	-	1	531	c.212T>G	c.(211-213)TTC>TGC	p.F71C		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	71	Helical; Name=2; (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3																		---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13786317	13786317	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13786317A>G	uc003jfd.2	-	52	8833	c.8791T>C	c.(8791-8793)TTT>CTT	p.F2931L		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2931	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
IL31RA	133396	broad.mit.edu	37	5	55204248	55204248	+	Intron	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55204248G>A	uc003jql.2	+						IL31RA_uc003jqk.2_Missense_Mutation_p.A504T|IL31RA_uc011cqj.1_Missense_Mutation_p.A362T|IL31RA_uc003jqm.2_Intron|IL31RA_uc003jqn.2_Intron|IL31RA_uc010iwa.1_Intron|IL31RA_uc003jqo.2_Intron	NM_139017	NP_620586			gp130-like monocyte receptor						anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)																---	---	---	---
P4HA2	8974	broad.mit.edu	37	5	131553527	131553527	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131553527G>T	uc003kwh.2	-	3	661	c.97C>A	c.(97-99)CTG>ATG	p.L33M	P4HA2_uc003kwg.2_Missense_Mutation_p.L33M|P4HA2_uc003kwi.2_Missense_Mutation_p.L33M|P4HA2_uc003kwk.2_Missense_Mutation_p.L33M|P4HA2_uc003kwl.2_Missense_Mutation_p.L33M|P4HA2_uc003kwj.2_Missense_Mutation_p.L33M	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	33						endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)													---	---	---	---
UQCRQ	27089	broad.mit.edu	37	5	132203255	132203255	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132203255C>G	uc003kya.1	+	3	304	c.230C>G	c.(229-231)GCC>GGC	p.A77G	GDF9_uc003kxz.1_5'Flank|GDF9_uc011cxj.1_5'Flank	NM_014402	NP_055217	O14949	QCR8_HUMAN	ubiquinol-cytochrome c reductase, complex III	77				KNPAAYENDK -> RIQLPMKMTNEQRIRMTVPCL (in Ref. 1; BAA23321).	respiratory electron transport chain	mitochondrial inner membrane|respiratory chain	ubiquinol-cytochrome-c reductase activity				0		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
PCDHA1	56147	broad.mit.edu	37	5	140166387	140166387	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166387C>T	uc003lhb.2	+	1	512	c.512C>T	c.(511-513)ACG>ATG	p.T171M	PCDHA1_uc003lha.2_Missense_Mutation_p.T171M|PCDHA1_uc003lgz.2_Missense_Mutation_p.T171M	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	171	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB5	26167	broad.mit.edu	37	5	140517197	140517197	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140517197C>T	uc003liq.2	+	1	2398	c.2181C>T	c.(2179-2181)CCC>CCT	p.P727P		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	727	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	31733364	31733364	+	IGR	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31733364C>T								MSH5 (742 upstream) : C6orf27 (8 downstream)																																			---	---	---	---
AARS2	57505	broad.mit.edu	37	6	44270562	44270562	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44270562C>T	uc010jza.1	-	17	2344	c.2341G>A	c.(2341-2343)GTC>ATC	p.V781I	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	781					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)													---	---	---	---
DDX43	55510	broad.mit.edu	37	6	74104733	74104733	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74104733G>C	uc003pgw.2	+	1	449	c.105G>C	c.(103-105)TTG>TTC	p.L35F	OOEP_uc003pgv.3_5'UTR|DDX43_uc011dyn.1_RNA	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	35						intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4																		---	---	---	---
FAM184A	79632	broad.mit.edu	37	6	119345242	119345242	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119345242C>T	uc003pyj.2	-	2	1244	c.896G>A	c.(895-897)CGA>CAA	p.R299Q	FAM184A_uc003pyk.3_Missense_Mutation_p.R179Q|FAM184A_uc003pyl.3_Missense_Mutation_p.R179Q	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	299	Potential.									ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7																		---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143081659	143081659	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143081659G>A	uc003qjd.2	-	9	6509	c.5766C>T	c.(5764-5766)GAC>GAT	p.D1922D		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1922	Asp/Glu-rich (acidic).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
TULP4	56995	broad.mit.edu	37	6	158919781	158919781	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158919781G>A	uc003qrf.2	+	12	3308	c.1951G>A	c.(1951-1953)GAC>AAC	p.D651N	TULP4_uc003qrg.2_Missense_Mutation_p.D651N	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	651					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)														---	---	---	---
GNA12	2768	broad.mit.edu	37	7	2770956	2770956	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2770956G>A	uc003smu.2	-	4	1169	c.1005C>T	c.(1003-1005)TTC>TTT	p.F335F	GNA12_uc011jwb.1_Silent_p.F318F|GNA12_uc003smt.2_Silent_p.F276F	NM_007353	NP_031379	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein)	335					G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)														---	---	---	---
PAPOLB	56903	broad.mit.edu	37	7	4900190	4900190	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4900190T>C	uc003snk.2	-	1	1436	c.1252A>G	c.(1252-1254)AAT>GAT	p.N418D	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	417					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)														---	---	---	---
FSCN1	6624	broad.mit.edu	37	7	5642914	5642914	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5642914G>A	uc003sou.2	+	2	973	c.859G>A	c.(859-861)GAG>AAG	p.E287K	FSCN1_uc003sov.2_Missense_Mutation_p.E9K|FSCN1_uc003sow.2_Missense_Mutation_p.E9K	NM_003088	NP_003079	Q16658	FSCN1_HUMAN	fascin 1	287					actin filament bundle assembly|cell migration|cell proliferation	cell junction|cytoplasm|filopodium|invadopodium|stress fiber	actin filament binding|drug binding|protein binding, bridging			ovary(1)	1		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)														---	---	---	---
BUD31	8896	broad.mit.edu	37	7	99015077	99015077	+	Silent	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99015077A>G	uc003uqf.2	+	5	444	c.243A>G	c.(241-243)GAA>GAG	p.E81E	BUD31_uc011kiu.1_Silent_p.E81E|BUD31_uc011kiv.1_Silent_p.E81E|BUD31_uc003uqg.3_Silent_p.E81E	NM_003910	NP_003901	P41223	BUD31_HUMAN	G10 protein	81					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
MCM7	4176	broad.mit.edu	37	7	99694968	99694968	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99694968G>T	uc003usw.1	-	10	1667	c.1157C>A	c.(1156-1158)GCC>GAC	p.A386D	MCM7_uc003usv.1_Missense_Mutation_p.A210D|MCM7_uc003usx.1_Missense_Mutation_p.A210D	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	386	MCM.|ATP (Potential).				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)													---	---	---	---
CTTNBP2	83992	broad.mit.edu	37	7	117432148	117432148	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117432148C>T	uc003vjf.2	-	4	1194	c.1102G>A	c.(1102-1104)GCT>ACT	p.A368T		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	368										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
OR2F2	135948	broad.mit.edu	37	7	143633227	143633227	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143633227G>A	uc011ktv.1	+	1	902	c.902G>A	c.(901-903)TGG>TAG	p.W301*		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	301	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)																	---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27297748	27297748	+	Intron	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27297748C>A	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron|PTK2B_uc003xfr.1_Intron	NM_173174	NP_775266			PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48817430	48817430	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48817430A>G	uc003xqi.2	-	26	3098	c.3041T>C	c.(3040-3042)TTG>TCG	p.L1014S	PRKDC_uc003xqj.2_Missense_Mutation_p.L1014S|PRKDC_uc011ldh.1_Missense_Mutation_p.L1014S	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1014	HEAT 2.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
MOS	4342	broad.mit.edu	37	8	57025798	57025798	+	Silent	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025798C>A	uc011leb.1	-	1	744	c.744G>T	c.(742-744)CCG>CCT	p.P248P		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	248	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)															---	---	---	---
HRSP12	10247	broad.mit.edu	37	8	99118518	99118518	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99118518C>T	uc003yii.1	-	3	302	c.208G>A	c.(208-210)GGC>AGC	p.G70S		NM_005836	NP_005827	P52758	UK114_HUMAN	heat-responsive protein 12	70					regulation of translational termination	nucleus	endonuclease activity			ovary(1)	1	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)															---	---	---	---
SLC27A4	10999	broad.mit.edu	37	9	131117991	131117991	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131117991C>T	uc004but.2	+	12	1974	c.1690C>T	c.(1690-1692)CGC>TGC	p.R564C	SLC27A4_uc004buu.2_Missense_Mutation_p.R158C	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid	564					long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0																		---	---	---	---
C9orf9	11092	broad.mit.edu	37	9	135762802	135762802	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135762802G>A	uc004cbx.1	+	3	302	c.191G>A	c.(190-192)CGG>CAG	p.R64Q	C9orf9_uc004cby.1_Missense_Mutation_p.R64Q|C9orf9_uc004cbz.1_Missense_Mutation_p.R64Q	NM_018956	NP_061829	Q96E40	CI009_HUMAN	Rsb-66 protein	64								p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)														---	---	---	---
REXO4	57109	broad.mit.edu	37	9	136272968	136272968	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136272968A>C	uc004cdm.2	-	7	1312	c.1112T>G	c.(1111-1113)ATC>AGC	p.I371S	REXO4_uc011mde.1_Missense_Mutation_p.I234S|REXO4_uc011mdf.1_Missense_Mutation_p.I234S|REXO4_uc004cdn.2_Missense_Mutation_p.I122S|REXO4_uc004cdo.2_Missense_Mutation_p.I199S	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog	371	Exonuclease.					nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)														---	---	---	---
BRD3	8019	broad.mit.edu	37	9	136907002	136907002	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136907002C>T	uc004cew.2	-	8	1475	c.1287G>A	c.(1285-1287)GCG>GCA	p.A429A	BRD3_uc004cex.2_Silent_p.A429A	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3	429						nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)				T	NUT|C15orf55	lethal midline carcinoma of young people								---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137687154	137687154	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137687154G>A	uc004cfe.2	+	34	3174	c.2792G>A	c.(2791-2793)GGC>GAC	p.G931D		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	931	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
CAMK2G	818	broad.mit.edu	37	10	75612948	75612948	+	Splice_Site	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75612948A>G	uc001jvv.1	-	4	375	c.251_splice	c.e4+1	p.L84_splice	CAMK2G_uc001jvm.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvo.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvq.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvr.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvp.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvs.1_Splice_Site_p.L92_splice|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Splice_Site_p.L92_splice|CAMK2G_uc010qkv.1_Intron	NM_172171	NP_751911			calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)																	---	---	---	---
HIF1AN	55662	broad.mit.edu	37	10	102304792	102304792	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102304792C>T	uc001krj.3	+	4	737	c.662C>T	c.(661-663)CCG>CTG	p.P221L		NM_017902	NP_060372	Q9NWT6	HIF1N_HUMAN	hypoxia-inducible factor 1, alpha subunit	221	JmjC.|Interaction with HIF1A.|Interaction with VHL.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding				0		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)														---	---	---	---
LZTS2	84445	broad.mit.edu	37	10	102762419	102762419	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102762419C>T	uc001ksj.2	+	2	193	c.124C>T	c.(124-126)CCA>TCA	p.P42S	LZTS2_uc010qpw.1_Missense_Mutation_p.P42S|LZTS2_uc001ksk.2_Missense_Mutation_p.P42S|LZTS2_uc001ksl.2_Missense_Mutation_p.P42S|LZTS2_uc001ksm.2_RNA	NM_032429	NP_115805	Q9BRK4	LZTS2_HUMAN	leucine zipper, putative tumor suppressor 2	42	Required for centrosomal localization (By similarity).				cell division|mitosis|Wnt receptor signaling pathway	membrane|microtubule|microtubule organizing center				ovary(2)|large_intestine(1)|breast(1)	4				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)														---	---	---	---
SMC3	9126	broad.mit.edu	37	10	112341745	112341745	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112341745G>T	uc001kze.2	+	9	738	c.612G>T	c.(610-612)GAG>GAT	p.E204D		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	204	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
OR51I1	390063	broad.mit.edu	37	11	5461820	5461820	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5461820A>C	uc010qze.1	-	1	925	c.925T>G	c.(925-927)TTC>GTC	p.F309V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
APBB1	322	broad.mit.edu	37	11	6416887	6416887	+	Silent	SNP	G	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6416887G>C	uc001mdb.1	-	14	2110	c.2010C>G	c.(2008-2010)ACC>ACG	p.T670T	APBB1_uc001mcz.1_Silent_p.T289T|APBB1_uc001mdd.3_Silent_p.T448T|APBB1_uc001mda.2_Silent_p.T195T|APBB1_uc001mdc.1_Silent_p.T668T|APBB1_uc001mcy.1_Missense_Mutation_p.P108R	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	670	PID 2.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)														---	---	---	---
HPX	3263	broad.mit.edu	37	11	6452560	6452560	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6452560C>T	uc001mdg.2	-	10	1331	c.1270G>A	c.(1270-1272)GGC>AGC	p.G424S	HPX_uc001mdf.2_Missense_Mutation_p.G170S|HPX_uc009yfc.2_RNA	NM_000613	NP_000604	P02790	HEMO_HUMAN	hemopexin precursor	424					cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)														---	---	---	---
SLC17A6	57084	broad.mit.edu	37	11	22360124	22360124	+	Silent	SNP	G	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22360124G>C	uc001mqk.2	+	1	458	c.45G>C	c.(43-45)GGG>GGC	p.G15G		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	15	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4																		---	---	---	---
CRY2	1408	broad.mit.edu	37	11	45880279	45880279	+	Intron	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45880279C>T	uc010rgn.1	+						CRY2_uc009ykw.2_Intron	NM_021117	NP_066940			cryptochrome 2 (photolyase-like) isoform 1						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1																		---	---	---	---
OR5D18	219438	broad.mit.edu	37	11	55587672	55587672	+	Silent	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587672T>G	uc010rin.1	+	1	567	c.567T>G	c.(565-567)TCT>TCG	p.S189S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)																---	---	---	---
TCIRG1	10312	broad.mit.edu	37	11	67814973	67814973	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67814973G>A	uc001one.2	+	11	1347	c.1239G>A	c.(1237-1239)ATG>ATA	p.M413I	TCIRG1_uc001ong.2_Missense_Mutation_p.M197I|TCIRG1_uc001onh.2_Missense_Mutation_p.M115I|TCIRG1_uc001oni.2_5'UTR|TCIRG1_uc009ysd.2_5'Flank	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a	413	Helical; (Potential).				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
C11orf63	79864	broad.mit.edu	37	11	122817487	122817487	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122817487G>T	uc001pym.2	+	6	2213	c.1916G>T	c.(1915-1917)AGA>ATA	p.R639I		NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	639										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)														---	---	---	---
OR6T1	219874	broad.mit.edu	37	11	123813599	123813599	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123813599A>G	uc010sab.1	-	1	947	c.947T>C	c.(946-948)CTG>CCG	p.L316P		NM_001005187	NP_001005187	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T,	316	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)														---	---	---	---
HDAC7	51564	broad.mit.edu	37	12	48183352	48183352	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48183352C>T	uc010slo.1	-	18	2296	c.2101G>A	c.(2101-2103)GCT>ACT	p.A701T	HDAC7_uc009zku.2_Intron|HDAC7_uc001rqe.2_Missense_Mutation_p.A135T|HDAC7_uc001rqj.3_Missense_Mutation_p.A664T|HDAC7_uc001rqk.3_Missense_Mutation_p.A684T|HDAC7_uc010slp.1_5'Flank	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a	662	Histone deacetylase.				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)														---	---	---	---
NCKAP1L	3071	broad.mit.edu	37	12	54913027	54913027	+	Silent	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54913027C>A	uc001sgc.3	+	16	1615	c.1536C>A	c.(1534-1536)GCC>GCA	p.A512A	NCKAP1L_uc010sox.1_Silent_p.A54A|NCKAP1L_uc010soy.1_Silent_p.A462A	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	512					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78513023	78513023	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78513023C>T	uc001syp.2	+	15	3220	c.3047C>T	c.(3046-3048)ACC>ATC	p.T1016I	NAV3_uc001syo.2_Missense_Mutation_p.T1016I|NAV3_uc010sub.1_Missense_Mutation_p.T516I|NAV3_uc009zsf.2_Missense_Mutation_p.T24I	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1016						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124824647	124824647	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124824647G>A	uc010tay.1	-	39	5778	c.5622C>T	c.(5620-5622)ACC>ACT	p.T1874T	NCOR2_uc010taz.1_Silent_p.T1858T|NCOR2_uc010tax.1_5'UTR	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1	1875					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129566427	129566427	+	Silent	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566427T>G	uc009zyl.1	-	7	2128	c.1800A>C	c.(1798-1800)TCA>TCC	p.S600S	TMEM132D_uc001uia.2_Silent_p.S138S	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	600	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	A	A	rs12366766		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547087G>A	uc001ujn.2	+	46	8210	c.8175G>A	c.(8173-8175)CAG>CAA	p.Q2725Q	EP400_uc001ujl.2_Silent_p.Q2724Q|EP400_uc001ujm.2_Silent_p.Q2644Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)														---	---	---	---
SACS	26278	broad.mit.edu	37	13	23912948	23912948	+	Silent	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23912948A>G	uc001uon.2	-	10	5656	c.5067T>C	c.(5065-5067)AGT>AGC	p.S1689S	SACS_uc001uoo.2_Silent_p.S1542S|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1689					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---
SOHLH2	54937	broad.mit.edu	37	13	36768007	36768007	+	Intron	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36768007G>A	uc001uvj.2	-						SOHLH2_uc010tei.1_Intron	NM_017826	NP_060296			spermatogenesis and oogenesis specific basic						cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)														---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101735457	101735457	+	Silent	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101735457A>G	uc001vox.1	-	32	3865	c.3676T>C	c.(3676-3678)TTG>CTG	p.L1226L		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1226	Helical; Name=S1 of repeat IV; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
DAOA	267012	broad.mit.edu	37	13	106142294	106142294	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106142294G>C	uc001vqb.2	+	4	600	c.326G>C	c.(325-327)AGA>ACA	p.R109T	DAOA_uc010tjf.1_Missense_Mutation_p.R38T|DAOA_uc001vpz.2_RNA|DAOA_uc010agd.2_RNA|DAOA_uc010tjg.1_Missense_Mutation_p.R81T|DAOA_uc001vqc.2_RNA|DAOA_uc001vqe.2_RNA	NM_172370	NP_758958	P59103	DAOA_HUMAN	D-amino acid oxidase activator isoform 1	109						Golgi apparatus					0	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
OR4Q3	441669	broad.mit.edu	37	14	20215736	20215736	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20215736A>C	uc010tkt.1	+	1	150	c.150A>C	c.(148-150)CAA>CAC	p.Q50H		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	50	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92909097	92909097	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92909097C>T	uc001yak.2	+	6	492	c.468C>T	c.(466-468)ATC>ATT	p.I156I	SLC24A4_uc001yai.2_Silent_p.I109I|SLC24A4_uc010twm.1_Silent_p.I173I|SLC24A4_uc001yaj.2_Silent_p.I156I|SLC24A4_uc010auj.2_Silent_p.I64I|SLC24A4_uc010twn.1_5'Flank	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	173	Alpha-1.|Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94044282	94044282	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94044282G>A	uc001ybv.1	+	15	1858	c.1775G>A	c.(1774-1776)CGT>CAT	p.R592H	KIAA1409_uc001ybs.1_Missense_Mutation_p.R592H	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	769						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
RTL1	388015	broad.mit.edu	37	14	101348302	101348302	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101348302C>T	uc010txj.1	-	1	2883	c.2824G>A	c.(2824-2826)GAG>AAG	p.E942K	MIR433_hsa-mir-433|MI0001723_RNA|uc001yig.3_5'Flank|MIR127_hsa-mir-127|MI0000472_5'Flank|MIR432_hsa-mir-432|MI0003133_5'Flank|uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	NM_001134888	NP_001128360	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	942										pancreas(1)	1																		---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105418547	105418547	+	Silent	SNP	A	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105418547A>G	uc010axc.1	-	7	3361	c.3241T>C	c.(3241-3243)TTG>CTG	p.L1081L	AHNAK2_uc001ypx.2_Silent_p.L981L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1081						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33831637	33831637	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33831637G>A	uc001zhi.2	+	6	590	c.520G>A	c.(520-522)GTC>ATC	p.V174I	RYR3_uc010bar.2_Missense_Mutation_p.V174I	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	174	MIR 2.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
CASC5	57082	broad.mit.edu	37	15	40915077	40915077	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40915077T>C	uc010bbs.1	+	11	2854	c.2693T>C	c.(2692-2694)ATG>ACG	p.M898T	CASC5_uc010ucq.1_Missense_Mutation_p.M722T|CASC5_uc001zme.2_Missense_Mutation_p.M872T|CASC5_uc010bbt.1_Missense_Mutation_p.M872T	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	898	1.|2 X 104 AA approximate repeats.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)														---	---	---	---
TMEM62	80021	broad.mit.edu	37	15	43438759	43438759	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43438759C>T	uc001zqr.2	+	5	824	c.545C>T	c.(544-546)TCG>TTG	p.S182L	TMEM62_uc010bda.2_Missense_Mutation_p.S52L	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	182						integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)														---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86122866	86122866	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86122866G>A	uc002blv.1	+	7	1737	c.1567G>A	c.(1567-1569)GTC>ATC	p.V523I	AKAP13_uc002blt.1_Missense_Mutation_p.V523I|AKAP13_uc002blu.1_Missense_Mutation_p.V523I	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	523					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
ACAN	176	broad.mit.edu	37	15	89389036	89389036	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89389036G>A	uc010upo.1	+	7	1726	c.1352G>A	c.(1351-1353)GGC>GAC	p.G451D	ACAN_uc002bmx.2_Missense_Mutation_p.G451D|ACAN_uc010upp.1_Missense_Mutation_p.G451D|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	451					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)															---	---	---	---
ASB7	140460	broad.mit.edu	37	15	101169958	101169958	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101169958C>T	uc002bwk.2	+	5	1297	c.528C>T	c.(526-528)ATC>ATT	p.I176I	ASB7_uc002bwj.2_Silent_p.I176I	NM_198243	NP_937886	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box-containing protein 7	176	ANK 5.				intracellular signal transduction					skin(1)	1	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)															---	---	---	---
OR4F15	390649	broad.mit.edu	37	15	102358889	102358889	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358889C>T	uc010uts.1	+	1	500	c.500C>T	c.(499-501)CCT>CTT	p.P167L		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)															---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16215891	16215891	+	Silent	SNP	G	A	A	rs4148377		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16215891G>A	uc010bvi.2	+	24	3625	c.3450G>A	c.(3448-3450)CCG>CCA	p.P1150P	ABCC1_uc010bvj.2_Silent_p.P1091P|ABCC1_uc010bvk.2_Silent_p.P1094P|ABCC1_uc010bvl.2_Silent_p.P1150P|ABCC1_uc010bvm.2_Silent_p.P1035P|ABCC1_uc002del.3_Silent_p.P1044P	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1150	Cytoplasmic.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70926295	70926295	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70926295T>G	uc002ezr.2	-	56	9511	c.9383A>C	c.(9382-9384)AAG>ACG	p.K3128T		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3129										ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
EFNB3	1949	broad.mit.edu	37	17	7611470	7611470	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7611470G>A	uc002gis.2	+	2	714	c.317G>A	c.(316-318)CGC>CAC	p.R106H		NM_001406	NP_001397	Q15768	EFNB3_HUMAN	ephrin-B3 precursor	106	Extracellular (Potential).				cell-cell signaling|interspecies interaction between organisms	integral to plasma membrane	ephrin receptor binding|transmembrane-ephrin receptor activity			ovary(1)	1		all_cancers(10;1.14e-06)|Prostate(122;0.081)																---	---	---	---
OTOP3	347741	broad.mit.edu	37	17	72938070	72938070	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72938070C>T	uc010wrr.1	+	3	565	c.565C>T	c.(565-567)CGC>TGC	p.R189C	OTOP3_uc010wrq.1_Missense_Mutation_p.R171C	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3	189						integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)																	---	---	---	---
CASKIN2	57513	broad.mit.edu	37	17	73499210	73499210	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73499210C>T	uc002joc.2	-	18	2495	c.1945G>A	c.(1945-1947)GAG>AAG	p.E649K	CASKIN2_uc010wsc.1_Missense_Mutation_p.E567K	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	649						cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
ITGB4	3691	broad.mit.edu	37	17	73732147	73732147	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73732147C>A	uc002jpg.2	+	14	1860	c.1673C>A	c.(1672-1674)TCC>TAC	p.S558Y	ITGB4_uc002jph.2_Missense_Mutation_p.S558Y|ITGB4_uc010dgo.2_Missense_Mutation_p.S558Y|ITGB4_uc002jpi.3_Missense_Mutation_p.S558Y|ITGB4_uc010dgp.1_Missense_Mutation_p.S558Y|ITGB4_uc002jpj.2_Missense_Mutation_p.S558Y|ITGB4_uc010wsh.1_Missense_Mutation_p.S113Y	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	558	III.|Extracellular (Potential).|Cysteine-rich tandem repeats.				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
SLC38A10	124565	broad.mit.edu	37	17	79219698	79219698	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79219698G>A	uc002jzz.1	-	16	3393	c.3018C>T	c.(3016-3018)GAC>GAT	p.D1006D	SLC38A10_uc002jzy.1_Silent_p.D924D	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	1006					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)															---	---	---	---
BAHCC1	57597	broad.mit.edu	37	17	79429767	79429767	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79429767G>A	uc002kaf.2	+	25	7385	c.7385G>A	c.(7384-7386)CGG>CAG	p.R2462Q		NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	2462							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---
CETN1	1068	broad.mit.edu	37	18	580610	580610	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580610G>A	uc002kko.1	+	1	244	c.202G>A	c.(202-204)GAG>AAG	p.E68K		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	68	EF-hand 2.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25593761	25593761	+	Silent	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25593761G>T	uc002kwg.2	-	3	744	c.285C>A	c.(283-285)CTC>CTA	p.L95L	CDH2_uc010xbn.1_Silent_p.L64L	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	95					adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65178313	65178313	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65178313T>G	uc002lke.1	-	2	4787	c.3563A>C	c.(3562-3564)AAT>ACT	p.N1188T		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1178						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
MED16	10025	broad.mit.edu	37	19	879980	879980	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:879980G>A	uc002lqd.1	-	8	1461	c.1310C>T	c.(1309-1311)TCG>TTG	p.S437L	MED16_uc010drw.1_Missense_Mutation_p.S262L|MED16_uc002lqe.2_Missense_Mutation_p.S426L|MED16_uc002lqf.2_Missense_Mutation_p.S426L|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Missense_Mutation_p.S426L|MED16_uc010xfx.1_Missense_Mutation_p.S282L|MED16_uc010xfy.1_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	437					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
FZR1	51343	broad.mit.edu	37	19	3533300	3533300	+	Silent	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3533300G>T	uc010dtk.2	+	11	1285	c.1251G>T	c.(1249-1251)ACG>ACT	p.T417T	FZR1_uc002lxt.2_Silent_p.T417T|FZR1_uc002lxv.2_Silent_p.T328T	NM_001136198	NP_001129670	Q9UM11	FZR_HUMAN	Fzr1 protein isoform 1	417	WD 6.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding			lung(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF562	54811	broad.mit.edu	37	19	9764240	9764240	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9764240G>A	uc010xks.1	-	6	829	c.666C>T	c.(664-666)CAC>CAT	p.H222H	ZNF562_uc002mly.2_Silent_p.H222H|ZNF562_uc002mlx.2_Silent_p.H150H|ZNF562_uc010xkt.1_Silent_p.H185H|ZNF562_uc010xku.1_Silent_p.H153H|ZNF562_uc010xkv.1_Silent_p.H221H|ZNF562_uc010xkw.1_Silent_p.H106H	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a	222	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
MEF2B	100271849	broad.mit.edu	37	19	19257410	19257410	+	Silent	SNP	G	A	A	rs142032500		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19257410G>A	uc002nlm.2	-	7	837	c.723C>T	c.(721-723)CCC>CCT	p.P241P	MEF2B_uc002nln.2_Missense_Mutation_p.R244W|MEF2B_uc002nll.2_Silent_p.P241P|LOC729991-MEF2B_uc010xqo.1_Silent_p.P241P|LOC729991-MEF2B_uc010xqp.1_Silent_p.P241P|LOC729991-MEF2B_uc002nlo.2_Silent_p.P241P|LOC729991-MEF2B_uc002nlp.2_Silent_p.P241P|MEF2B_uc002nlk.2_Silent_p.P244P	NM_001145785	NP_001139257			myocyte enhancer factor 2B isoform a											skin(1)	1			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)															---	---	---	---
ATP4A	495	broad.mit.edu	37	19	36050871	36050871	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36050871C>T	uc002oal.1	-	7	921	c.892G>A	c.(892-894)GAG>AAG	p.E298K	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	298	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)													---	---	---	---
PAPL	390928	broad.mit.edu	37	19	39592115	39592115	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39592115G>A	uc002oki.2	+	11	1325	c.1051G>A	c.(1051-1053)GGC>AGC	p.G351S	PAPL_uc010egl.2_Silent_p.T309T	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	351						extracellular region	acid phosphatase activity|metal ion binding				0																		---	---	---	---
ZNF677	342926	broad.mit.edu	37	19	53741786	53741786	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53741786T>G	uc002qbf.1	-	5	379	c.194A>C	c.(193-195)AAG>ACG	p.K65T	ZNF677_uc002qbg.1_Missense_Mutation_p.K65T	NM_182609	NP_872415	Q86XU0	ZN677_HUMAN	zinc finger protein 677	65	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)														---	---	---	---
ZNF606	80095	broad.mit.edu	37	19	58490018	58490018	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58490018T>C	uc002qqw.2	-	7	2648	c.2030A>G	c.(2029-2031)GAG>GGG	p.E677G	ZNF606_uc010yhp.1_Missense_Mutation_p.E587G	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	677					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)														---	---	---	---
ACSS1	84532	broad.mit.edu	37	20	24993556	24993556	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24993556G>A	uc002wub.2	-	11	2477	c.1599C>T	c.(1597-1599)GAC>GAT	p.D533D	ACSS1_uc002wuc.2_Silent_p.D531D|ACSS1_uc010gdc.2_Silent_p.D328D|ACSS1_uc002wud.1_RNA|ACSS1_uc002wua.2_Silent_p.D450D	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	533					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41420056	41420056	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41420056G>T	uc002xkg.2	-	3	449	c.265C>A	c.(265-267)CAC>AAC	p.H89N	PTPRT_uc010ggj.2_Missense_Mutation_p.H89N	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	89	Extracellular (Potential).|MAM.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
TP53TG5	27296	broad.mit.edu	37	20	44002629	44002629	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44002629G>A	uc002xny.2	-	5	872	c.791C>T	c.(790-792)GCC>GTC	p.A264V	SYS1_uc002xnw.1_Intron|SYS1-DBNDD2_uc002xnx.2_Intron	NM_014477	NP_055292	Q9Y2B4	T53G5_HUMAN	TP53-target gene 5 protein	264					intracellular signal transduction|negative regulation of cell growth	cytoplasm|nucleus				central_nervous_system(1)	1																OREG0025981	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PTK6	5753	broad.mit.edu	37	20	62165514	62165514	+	Silent	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62165514G>A	uc002yfg.2	-	3	547	c.507C>T	c.(505-507)CCC>CCT	p.P169P	PTK6_uc011aay.1_Silent_p.P68P|PTK6_uc011aaz.1_5'Flank	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	169	SH2.					cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)															---	---	---	---
ADAMTS5	11096	broad.mit.edu	37	21	28338365	28338365	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28338365C>T	uc002ymg.2	-	1	1075	c.346G>A	c.(346-348)GCA>ACA	p.A116T		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	116					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
DSCR3	10311	broad.mit.edu	37	21	38612909	38612909	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38612909C>A	uc002ywf.1	-	3	328	c.89G>T	c.(88-90)AGT>ATT	p.S30I	DSCR3_uc010gnm.1_RNA|DSCR3_uc010gnn.1_5'UTR|DSCR3_uc010gnl.2_Missense_Mutation_p.S30I|DSCR3_uc011aeg.1_Missense_Mutation_p.S30I|DSCR3_uc011aeh.1_Intron	NM_006052	NP_006043	O14972	DSCR3_HUMAN	Down syndrome critical region protein 3	30					vacuolar transport	nucleus|retromer complex					0																		---	---	---	---
TRPM2	7226	broad.mit.edu	37	21	45833814	45833814	+	Silent	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45833814C>T	uc002zet.1	+	21	3216	c.3003C>T	c.(3001-3003)ACC>ACT	p.T1001T	TRPM2_uc002zeu.1_Silent_p.T1001T|TRPM2_uc002zew.1_Silent_p.T1001T|TRPM2_uc010gpt.1_Silent_p.T1001T|TRPM2_uc002zex.1_Silent_p.T787T|TRPM2_uc002zey.1_Silent_p.T514T	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	1001	Extracellular (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
EIF4ENIF1	56478	broad.mit.edu	37	22	31851888	31851888	+	Missense_Mutation	SNP	C	T	T	rs138781990		TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31851888C>T	uc003akz.1	-	8	1213	c.1049G>A	c.(1048-1050)CGA>CAA	p.R350Q	EIF4ENIF1_uc003akx.1_Missense_Mutation_p.R29Q|EIF4ENIF1_uc003aky.1_Missense_Mutation_p.R29Q|EIF4ENIF1_uc003ala.1_Missense_Mutation_p.R350Q|EIF4ENIF1_uc003alb.1_Missense_Mutation_p.R187Q	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	350						nucleus	protein binding|protein transporter activity			ovary(1)	1																OREG0003517	type=REGULATORY REGION|Gene=LOC486366|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
EP300	2033	broad.mit.edu	37	22	41572924	41572924	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41572924C>T	uc003azl.3	+	31	5604	c.5209C>T	c.(5209-5211)CGC>TGC	p.R1737C		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1737	Binding region for E1A adenovirus.|TAZ-type 2.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64								T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				---	---	---	---
MOV10L1	54456	broad.mit.edu	37	22	50555597	50555597	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50555597G>A	uc003bjj.2	+	9	1354	c.1271G>A	c.(1270-1272)CGC>CAC	p.R424H	MOV10L1_uc003bjk.3_Missense_Mutation_p.R424H|MOV10L1_uc011arp.1_Missense_Mutation_p.R404H|MOV10L1_uc011arq.1_Missense_Mutation_p.R185H|MOV10L1_uc010hao.1_RNA	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	424					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)														---	---	---	---
PPP2R3B	28227	broad.mit.edu	37	X	299398	299398	+	Silent	SNP	C	T	T	rs140356111	byFrequency	TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:299398C>T	uc004cpg.2	-	12	1719	c.1518G>A	c.(1516-1518)GCG>GCA	p.A506A	PPP2R3B_uc004cpf.2_Silent_p.A107A	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',	506					cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
ARMCX6	54470	broad.mit.edu	37	X	100871324	100871324	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100871324C>T	uc004ehx.2	-	3	632	c.287G>A	c.(286-288)CGA>CAA	p.R96Q	ARMCX6_uc004ehy.2_Missense_Mutation_p.R96Q	NM_019007	NP_061880	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	96						integral to membrane					0																		---	---	---	---
ZMAT1	84460	broad.mit.edu	37	X	101139163	101139163	+	Silent	SNP	A	C	C			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101139163A>C	uc004eim.2	-	2	4221	c.723T>G	c.(721-723)ACT>ACG	p.T241T	ZMAT1_uc011mrl.1_Silent_p.T412T|ZMAT1_uc004ein.2_Silent_p.T241T|ZMAT1_uc011mrm.1_Silent_p.T241T	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin type 1 isoform 3	241						nucleus	zinc ion binding			ovary(1)	1																		---	---	---	---
DCAF12L2	340578	broad.mit.edu	37	X	125298907	125298907	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4441-01	TCGA-CG-4441-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125298907G>A	uc004euk.1	-	1	1028	c.1001C>T	c.(1000-1002)CCG>CTG	p.P334L		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	334										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7																		---	---	---	---
