Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
FAM131C	348487	broad.mit.edu	37	1	16386657	16386677	+	Intron	DEL	CACCATGATCTCCATCAGTGC	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386657_16386677delCACCATGATCTCCATCAGTGC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429			hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27307015	27307015	+	IGR	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27307015delT								C1orf172 (20118 upstream) : TRNP1 (13180 downstream)																																			---	---	---	---
SF3A3	10946	broad.mit.edu	37	1	38446097	38446098	+	Intron	INS	-	A	A	rs147744511		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38446097_38446098insA	uc001cci.2	-						SF3A3_uc010oik.1_Intron	NM_006802	NP_006793			splicing factor 3a, subunit 3						nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52703114	52703120	+	Intron	DEL	TCCAGTG	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52703114_52703120delTCCAGTG	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
PDE4B	5142	broad.mit.edu	37	1	66458598	66458599	+	Intron	DEL	AA	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66458598_66458599delAA	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Frame_Shift_Del_p.A3fs	NM_001037341	NP_001032418			phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	68126154	68126156	+	IGR	DEL	CTT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68126154_68126156delCTT								SERBP1 (230031 upstream) : GADD45A (24727 downstream)																																			---	---	---	---
ASB17	127247	broad.mit.edu	37	1	76388173	76388173	+	Intron	DEL	C	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76388173delC	uc001dhe.1	-						ASB17_uc001dhf.1_Intron	NM_080868	NP_543144			ankyrin repeat and SOCS box-containing 17						intracellular signal transduction					ovary(1)	1																		---	---	---	---
PKN2	5586	broad.mit.edu	37	1	89225729	89225730	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89225729_89225730insT	uc001dmn.2	+						PKN2_uc001dmm.1_Intron|PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron	NM_006256	NP_006247			protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)														---	---	---	---
RTCD1	8634	broad.mit.edu	37	1	100733960	100733960	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100733960delT	uc001dtc.2	+						RTCD1_uc010ouh.1_Intron|RTCD1_uc001dtd.2_Intron	NM_003729	NP_003720			RNA terminal phosphate cyclase domain 1 isoform						RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)														---	---	---	---
SLAMF6	114836	broad.mit.edu	37	1	160457160	160457160	+	Intron	DEL	C	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160457160delC	uc001fwe.1	-						SLAMF6_uc001fwd.1_Intron|SLAMF6_uc010pjh.1_Intron|SLAMF6_uc010pji.1_Intron	NM_052931	NP_443163			activating NK receptor precursor							integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)															---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172050870	172050870	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172050870delA	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	215814187	215814187	+	Intron	DEL	A	-	-	rs138417166		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215814187delA	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
DDX1	1653	broad.mit.edu	37	2	15757227	15757227	+	Intron	DEL	T	-	-	rs67926060		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15757227delT	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930			DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)														---	---	---	---
SMC6	79677	broad.mit.edu	37	2	17877525	17877526	+	Intron	INS	-	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17877525_17877526insC	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron	NM_001142286	NP_001135758			SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	65947974	65947975	+	Intron	INS	-	TGTC	TGTC	rs28483523		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65947974_65947975insTGTC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
MRPL30	51263	broad.mit.edu	37	2	99779642	99779643	+	Intron	INS	-	A	A	rs35419218		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779642_99779643insA	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214			SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1																		---	---	---	---
MRPS9	64965	broad.mit.edu	37	2	105706585	105706589	+	Intron	DEL	AAAAC	-	-	rs67433632		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105706585_105706589delAAAAC	uc002tcn.3	+							NM_182640	NP_872578			mitochondrial ribosomal protein S9 precursor						DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0																		---	---	---	---
TMEM87B	84910	broad.mit.edu	37	2	112870703	112870706	+	Intron	DEL	TACT	-	-	rs142414944		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112870703_112870706delTACT	uc002thm.2	+							NM_032824	NP_116213			transmembrane protein 87B precursor							integral to membrane					0																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116101547	116101548	+	Intron	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116101547_116101548insA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138417162	138417162	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138417162delA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
SPOPL	339745	broad.mit.edu	37	2	139318653	139318654	+	Intron	INS	-	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139318653_139318654insG	uc002tvh.2	+							NM_001001664	NP_001001664			speckle-type POZ protein-like							nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	168445377	168445380	+	IGR	DEL	TTCC	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168445377_168445380delTTCC								XIRP2 (329118 upstream) : B3GALT1 (229802 downstream)																																			---	---	---	---
OLA1	29789	broad.mit.edu	37	2	175006417	175006418	+	Intron	INS	-	T	T	rs148877495	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175006417_175006418insT	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473			Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2																		---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197093014	197093015	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197093014_197093015insT	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811			HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211476868	211476869	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211476868_211476869delGA	uc002vee.3	+	20	2551_2552	c.2419_2420delGA	c.(2419-2421)GAGfs	p.E807fs	CPS1_uc010fur.2_Frame_Shift_Del_p.E813fs|CPS1_uc010fus.2_Frame_Shift_Del_p.E356fs	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	807					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10083589	10083590	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10083589_10083590insT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron	NM_033084	NP_149075			Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
TATDN2	9797	broad.mit.edu	37	3	10302551	10302551	+	Intron	DEL	T	-	-	rs35507180		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10302551delT	uc003bvg.2	+						TATDN2_uc003bvf.2_Intron|TATDN2_uc011atr.1_Intron|TATDN2_uc011ats.1_Intron|TATDN2_uc011att.1_Intron	NM_014760	NP_055575			TatD DNase domain containing 2							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	32079077	32079077	+	IGR	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32079077delA								ZNF860 (45957 upstream) : GPD1L (69067 downstream)																																			---	---	---	---
SCN10A	6336	broad.mit.edu	37	3	38833537	38833538	+	Intron	DEL	AT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38833537_38833538delAT	uc003ciq.2	-							NM_006514	NP_006505			sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)													---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41275180	41275180	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41275180delG	uc010hia.1	+	10	1502	c.1346delG	c.(1345-1347)CGTfs	p.R449fs	CTNNB1_uc003ckp.2_Frame_Shift_Del_p.R449fs|CTNNB1_uc003ckq.2_Frame_Shift_Del_p.R449fs|CTNNB1_uc003ckr.2_Frame_Shift_Del_p.R449fs|CTNNB1_uc011azf.1_Frame_Shift_Del_p.R442fs|CTNNB1_uc011azg.1_Frame_Shift_Del_p.R377fs|CTNNB1_uc003cks.2_Frame_Shift_Del_p.R52fs|CTNNB1_uc003ckt.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	449	ARM 8.				adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89498774	89498774	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89498774delA	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
GRAMD1C	54762	broad.mit.edu	37	3	113569031	113569031	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113569031delT	uc003eaq.3	+						GRAMD1C_uc011bil.1_Intron|GRAMD1C_uc011bim.1_Intron	NM_017577	NP_060047			GRAM domain containing 1C							integral to membrane				ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	121473821	121473822	+	IGR	DEL	AA	-	-	rs146786406	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121473821_121473822delAA								GOLGB1 (5219 upstream) : IQCB1 (14788 downstream)																																			---	---	---	---
EIF4A2	1974	broad.mit.edu	37	3	186505569	186505570	+	Intron	INS	-	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186505569_186505570insG	uc003fqs.2	+						EIF4A2_uc003fqt.2_Intron|EIF4A2_uc003fqu.2_Intron|EIF4A2_uc003fqv.2_Intron|EIF4A2_uc003fqw.2_Intron|EIF4A2_uc011bsb.1_3'UTR	NM_001967	NP_001958			eukaryotic translation initiation factor 4A2						interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)				T	BCL6	NHL								---	---	---	---
TMEM207	131920	broad.mit.edu	37	3	190147698	190147698	+	Intron	DEL	G	-	-	rs5855335		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147698delG	uc003fsj.2	-							NM_207316	NP_997199			transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195494399	195494401	+	Intron	DEL	TCG	-	-	rs71743942	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494399_195494401delTCG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66218917	66218918	+	Intron	INS	-	TA	TA	rs139336386	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66218917_66218918insTA	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
ANKRD17	26057	broad.mit.edu	37	4	73963152	73963152	+	Intron	DEL	T	-	-	rs55834843		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963152delT	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593			ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	79569453	79569454	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79569453_79569454insT	uc003hlf.2	+						uc003hlg.2_Intron|uc003hlh.2_Intron|uc003hli.2_Intron					Homo sapiens cDNA FLJ32651 fis, clone SYNOV2001581.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111323431	111323447	+	IGR	DEL	TTCCTTCCTTCCTCCCT	-	-	rs6817024		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111323431_111323447delTTCCTTCCTTCCTCCCT								ELOVL6 (203611 upstream) : ENPEP (73782 downstream)																																			---	---	---	---
PRSS12	8492	broad.mit.edu	37	4	119202994	119202995	+	3'UTR	DEL	AG	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119202994_119202995delAG	uc003ica.1	-	13						NM_003619	NP_003610			neurotrypsin precursor							membrane	scavenger receptor activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	13637974	13637975	+	IGR	INS	-	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13637974_13637975insG								None (None upstream) : DNAH5 (52462 downstream)																																			---	---	---	---
MYO10	4651	broad.mit.edu	37	5	16902321	16902322	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16902321_16902322insT	uc003jft.3	-						MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Intron	NM_012334	NP_036466			myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	44716765	44716766	+	IGR	INS	-	GAAG	GAAG	rs144322268	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44716765_44716766insGAAG								FGF10 (327981 upstream) : MRPS30 (92261 downstream)																																			---	---	---	---
MAN2A1	4124	broad.mit.edu	37	5	109103182	109103182	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109103182delT	uc003kou.1	+							NM_002372	NP_002363			mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	8263423	8263424	+	IGR	DEL	TT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8263423_8263424delTT								EEF1E1 (160595 upstream) : SLC35B3 (148309 downstream)																																			---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17669073	17669074	+	Intron	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669073_17669074insA	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115			nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
KIF13A	63971	broad.mit.edu	37	6	17842232	17842233	+	Intron	DEL	GT	-	-	rs72395400		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17842232_17842233delGT	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396			kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38718240	38718241	+	Intron	INS	-	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38718240_38718241insC	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38994307	38994308	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38994307_38994308insT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	43838295	43838298	+	IGR	DEL	TCCC	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43838295_43838298delTCCC								VEGFA (84074 upstream) : LOC100132354 (20467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	67296893	67296893	+	IGR	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67296893delT								MCART3P (797518 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	73308513	73308513	+	IGR	DEL	T	-	-	rs1147570	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73308513delT								RIMS1 (196006 upstream) : KCNQ5 (23058 downstream)																																			---	---	---	---
C7orf31	136895	broad.mit.edu	37	7	25192367	25192368	+	Intron	INS	-	TT	TT			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25192367_25192368insTT	uc003sxn.1	-						C7orf31_uc003sxm.1_Intron	NM_138811	NP_620166			hypothetical protein LOC136895												0																		---	---	---	---
ZNF680	340252	broad.mit.edu	37	7	63983013	63983013	+	Intron	DEL	A	-	-	rs34852861		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63983013delA	uc003tta.2	-						ZNF680_uc010kzr.2_Intron	NM_178558	NP_848653			zinc finger protein 680 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)																---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111623915	111623916	+	Intron	INS	-	CA	CA	rs145279650		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111623915_111623916insCA	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron|DOCK4_uc003vgb.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
FAM71F1	84691	broad.mit.edu	37	7	128366695	128366696	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128366695_128366696insT	uc003vno.1	+						FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_Intron|FAM71F1_uc003vnp.1_Intron	NM_032599	NP_115988			testes development-related NYD-SP18											skin(1)	1																		---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130148869	130148870	+	Intron	INS	-	A	A	rs74631784	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130148869_130148870insA	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	148112872	148112873	+	3'UTR	INS	-	A	A	rs145619519		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148112872_148112873insA	uc003weu.1	+	24					CNTNAP2_uc003wev.1_3'UTR	NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9732116	9732117	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs145244640	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9732116_9732117insGAAGGAAG								TNKS (92261 upstream) : LOC157627 (25457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11809297	11809298	+	IGR	INS	-	TTCC	TTCC			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11809297_11809298insTTCC								CTSB (83651 upstream) : DEFB136 (22150 downstream)																																			---	---	---	---
KCNU1	157855	broad.mit.edu	37	8	36779849	36779849	+	Intron	DEL	A	-	-	rs68098747		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36779849delA	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron	NM_001031836	NP_001027006			potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	82054757	82054758	+	IGR	INS	-	T	T	rs57213604	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82054757_82054758insT								PAG1 (30454 upstream) : FABP5 (138027 downstream)																																			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104952727	104952727	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104952727delT	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113353593	113353593	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113353593delT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
TRIB1	10221	broad.mit.edu	37	8	126445449	126445452	+	Intron	DEL	ACTC	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126445449_126445452delACTC	uc003yrx.2	+						TRIB1_uc011lis.1_Intron|TRIB1_uc010mdn.2_5'Flank	NM_025195	NP_079471			G-protein-coupled receptor induced protein						JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
PVT1	5820	broad.mit.edu	37	8	129015474	129015475	+	Intron	DEL	TT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129015474_129015475delTT	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
ELAVL2	1993	broad.mit.edu	37	9	23731142	23731142	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23731142delA	uc003zpu.2	-						ELAVL2_uc003zps.2_Intron|ELAVL2_uc003zpt.2_Intron|ELAVL2_uc003zpv.2_Intron|ELAVL2_uc003zpw.2_Intron	NM_004432	NP_004423			ELAV (embryonic lethal, abnormal vision,						regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)														---	---	---	---
AQP7P1	375719	broad.mit.edu	37	9	67273773	67273774	+	Intron	INS	-	A	A	rs149463181	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67273773_67273774insA	uc004aem.1	-						AQP7P1_uc004aen.1_Intron|AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens aquaporin 7 pseudogene 1, mRNA (cDNA clone IMAGE:6191443).												0																		---	---	---	---
FLJ43950	347127	broad.mit.edu	37	9	84531279	84531279	+	3'UTR	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84531279delA	uc011lst.1	+	4						NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0																		---	---	---	---
C9orf125	84302	broad.mit.edu	37	9	104239493	104239494	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs67389871	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239493_104239494insAAACAAAC	uc004bbm.2	-						uc004bbl.1_5'Flank	NM_032342	NP_115718			hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
OR13C5	138799	broad.mit.edu	37	9	107361899	107361902	+	5'Flank	DEL	GAAT	-	-	rs10541505		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107361899_107361902delGAAT	uc011lvp.1	-							NM_001004482	NP_001004482			olfactory receptor, family 13, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
C9orf152	401546	broad.mit.edu	37	9	112962468	112962469	+	3'UTR	INS	-	AGGGAGGG	AGGGAGGG	rs117736420	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112962468_112962469insAGGGAGGG	uc011lwk.1	-	2						NM_001012993	NP_001013011			hypothetical protein LOC401546												0																		---	---	---	---
DNLZ	728489	broad.mit.edu	37	9	139257226	139257229	+	Intron	DEL	AAAT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139257226_139257229delAAAT	uc004chf.1	-						DNLZ_uc011mdv.1_Intron	NM_001080849	NP_001074318			DNL-type zinc finger								metal ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.42e-06)|Epithelial(140;3.3e-06)														---	---	---	---
DNAJC1	64215	broad.mit.edu	37	10	22193337	22193337	+	Intron	DEL	A	-	-	rs77439330		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22193337delA	uc001irc.2	-						DNAJC1_uc001ird.2_Intron	NM_022365	NP_071760			DnaJ (Hsp40) homolog, subfamily C, member 1						negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)																---	---	---	---
SPAG6	9576	broad.mit.edu	37	10	22675411	22675412	+	Intron	INS	-	A	A	rs11338059		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22675411_22675412insA	uc001iri.2	+						SPAG6_uc001irj.2_Intron|SPAG6_uc010qct.1_Intron|SPAG6_uc009xkh.2_Intron	NM_012443	NP_036575			sperm associated antigen 6 isoform 1						cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30900648	30900652	+	IGR	DEL	AAAGA	-	-	rs137937328		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900648_30900652delAAAGA								MAP3K8 (149887 upstream) : LYZL2 (57 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36597772	36597773	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs142641008	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36597772_36597773insGGAAGGAA								FZD8 (667410 upstream) : ANKRD30A (817012 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60548865	60548865	+	Intron	DEL	A	-	-	rs75442527		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60548865delA	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
NRBF2	29982	broad.mit.edu	37	10	64911791	64911799	+	Intron	DEL	TGTATCAGA	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64911791_64911799delTGTATCAGA	uc001jmj.3	+						NRBF2_uc010qip.1_Intron	NM_030759	NP_110386			nuclear receptor binding factor 2						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	cytoplasm|nucleoplasm	protein binding				0	Prostate(12;0.0119)|all_hematologic(501;0.191)																	---	---	---	---
COL13A1	1305	broad.mit.edu	37	10	71678019	71678019	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71678019delT	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194			alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74167669	74167670	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74167669_74167670insT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)																	---	---	---	---
C10orf28	27291	broad.mit.edu	37	10	99969326	99969326	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99969326delT	uc001kow.3	+	4	1750	c.1455delT	c.(1453-1455)ACTfs	p.T485fs	C10orf28_uc001kox.3_Frame_Shift_Del_p.T485fs|C10orf28_uc001koy.3_Frame_Shift_Del_p.T485fs|C10orf28_uc009xvx.2_Frame_Shift_Del_p.T485fs|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN	growth inhibition and differentiation related	485							nucleotide binding			large_intestine(1)|skin(1)	2		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)														---	---	---	---
COL17A1	1308	broad.mit.edu	37	10	105800349	105800360	+	Intron	DEL	TGGATGGATAGG	-	-	rs71993640		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105800349_105800360delTGGATGGATAGG	uc001kxr.2	-							NM_000494	NP_000485			alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)														---	---	---	---
SMC3	9126	broad.mit.edu	37	10	112363852	112363853	+	Intron	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112363852_112363853insA	uc001kze.2	+							NM_005445	NP_005436			structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	1813668	1813668	+	IGR	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1813668delA								CTSD (28446 upstream) : SYT8 (35041 downstream)																																			---	---	---	---
KIF18A	81930	broad.mit.edu	37	11	28116024	28116025	+	Intron	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28116024_28116025insA	uc001msc.2	-							NM_031217	NP_112494			kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2																		---	---	---	---
FNBP4	23360	broad.mit.edu	37	11	47774379	47774380	+	Intron	INS	-	AACG	AACG			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47774379_47774380insAACG	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123			formin binding protein 4											ovary(1)	1																		---	---	---	---
VWF	7450	broad.mit.edu	37	12	6092567	6092568	+	Intron	INS	-	GATAGATAGATA	GATAGATAGATA	rs138350612	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6092567_6092568insGATAGATAGATA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
LRRC23	10233	broad.mit.edu	37	12	7022359	7022360	+	Intron	INS	-	G	G	rs143984274	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7022359_7022360insG	uc001qrt.3	+						LRRC23_uc001qrp.2_Intron|LRRC23_uc001qrq.2_Intron|LRRC23_uc001qrr.2_Intron|LRRC23_uc001qrs.2_Intron|LRRC23_uc009zfh.2_Intron|ENO2_uc001qru.1_5'Flank|ENO2_uc009zfi.1_5'Flank|ENO2_uc010sfq.1_5'Flank|ENO2_uc001qrv.1_5'Flank	NM_001135217	NP_001128689			leucine rich repeat containing 23 isoform a											ovary(1)	1																		---	---	---	---
ANAPC7	51434	broad.mit.edu	37	12	110819758	110819759	+	Intron	INS	-	G	G	rs111406162		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110819758_110819759insG	uc001tqo.2	-						ANAPC7_uc001tqp.3_Intron	NM_016238	NP_057322			anaphase-promoting complex subunit 7 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	20444664	20444667	+	IGR	DEL	TCTT	-	-	rs146419558		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20444664_20444667delTCTT								ZMYM5 (6888 upstream) : ZMYM2 (88143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22300058	22300058	+	IGR	DEL	A	-	-	rs113330815		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300058delA								FGF9 (21418 upstream) : None (None downstream)																																			---	---	---	---
STARD13	90627	broad.mit.edu	37	13	33700058	33700059	+	Intron	INS	-	TTCAAATTAAATA	TTCAAATTAAATA	rs149849652	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33700058_33700059insTTCAAATTAAATA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron	NM_178006	NP_821074			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	35498486	35498493	+	IGR	DEL	CTTCCTTC	-	-	rs71785859		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35498486_35498493delCTTCCTTC								RFC3 (957792 upstream) : NBEA (17963 downstream)																																			---	---	---	---
EML5	161436	broad.mit.edu	37	14	89124421	89124423	+	Intron	DEL	ACC	-	-	rs143248735		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89124421_89124423delACC	uc001xxg.2	-						EML5_uc001xxf.2_Intron|EML5_uc001xxh.1_Intron	NM_183387	NP_899243			echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3																		---	---	---	---
SNORD116-5	100033417	broad.mit.edu	37	15	25304705	25304706	+	5'Flank	INS	-	A	A	rs78507856		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25304705_25304706insA	uc001yxo.2	+						SNORD116-4_uc001yxh.1_RNA|SNORD116-4_uc001yxj.1_RNA|SNORD116-4_uc001yxm.1_RNA|IPW_uc001yxn.3_RNA|SNORD116-4_uc001yxl.3_RNA	NR_003322				Homo sapiens small nucleolar RNA, C/D box 116-5 (SNORD116-5), non-coding RNA.												0																		---	---	---	---
HERC2	8924	broad.mit.edu	37	15	28517891	28517892	+	Intron	DEL	TA	-	-	rs75694916		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517891_28517892delTA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658			hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)														---	---	---	---
TRPM7	54822	broad.mit.edu	37	15	50931931	50931932	+	Intron	DEL	TT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50931931_50931932delTT	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142			transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)														---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009			dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	23777208	23777209	+	IGR	DEL	TG	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23777208_23777209delTG								CHP2 (6952 upstream) : PRKCB (70091 downstream)																																			---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57919481	57919484	+	Intron	DEL	TCTT	-	-	rs5817124	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919481_57919484delTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288			cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4																		---	---	---	---
MYH13	8735	broad.mit.edu	37	17	10216089	10216089	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10216089delT	uc002gmk.1	-							NM_003802	NP_003793			myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	45865377	45865377	+	IGR	DEL	G	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45865377delG								TBX21 (41892 upstream) : OSBPL7 (19356 downstream)																																			---	---	---	---
EPN3	55040	broad.mit.edu	37	17	48617904	48617904	+	Intron	DEL	A	-	-	rs66736597		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48617904delA	uc002ira.3	+						SPATA20_uc002irc.2_5'Flank|EPN3_uc010wms.1_Intron|EPN3_uc010wmt.1_Intron|EPN3_uc010wmu.1_Intron	NM_017957	NP_060427			epsin 3							clathrin-coated vesicle|nucleus|perinuclear region of cytoplasm	lipid binding			ovary(1)	1	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)															---	---	---	---
NME1-NME2	654364	broad.mit.edu	37	17	49231518	49231519	+	Intron	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49231518_49231519insT	uc002itk.2	+						NME1_uc010dbx.1_Intron|NME1_uc002ith.1_Intron|NME1_uc002iti.1_Intron|NME1-NME2_uc002itj.2_Intron	NM_002512	NP_002503			nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)															---	---	---	---
SRP68	6730	broad.mit.edu	37	17	74037191	74037192	+	Intron	INS	-	AACAA	AACAA	rs72463390		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74037191_74037192insAACAA	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron|SRP68_uc002jqj.1_Intron	NM_014230	NP_055045			signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1																		---	---	---	---
EIF4A3	9775	broad.mit.edu	37	17	78120808	78120809	+	Intron	INS	-	TG	TG			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78120808_78120809insTG	uc010wuc.1	-						EIF4A3_uc002jxs.2_5'UTR	NM_014740	NP_055555			eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	57429217	57429218	+	IGR	DEL	AG	-	-	rs141641247	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57429217_57429218delAG								CCBE1 (64573 upstream) : PMAIP1 (137974 downstream)																																			---	---	---	---
C19orf66	55337	broad.mit.edu	37	19	10197480	10197480	+	Intron	DEL	G	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10197480delG	uc002mmu.3	+						C19orf66_uc002mmt.2_Intron|C19orf66_uc002mmv.3_Intron|C19orf66_uc002mmw.3_5'Flank	NM_018381	NP_060851			hypothetical protein LOC55337												0																		---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17124794	17124796	+	Intron	DEL	CTA	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17124794_17124796delCTA	uc002nfb.2	-							NM_015692	NP_056507			C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20988745	20988745	+	IGR	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20988745delA								ZNF626 (144343 upstream) : ZNF85 (117335 downstream)																																			---	---	---	---
ZNF829	374899	broad.mit.edu	37	19	37398706	37398706	+	Intron	DEL	A	-	-	rs113535347		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37398706delA	uc002ofa.1	-						ZNF345_uc002oez.2_Intron|ZNF829_uc002ofb.2_3'UTR	NM_001037232	NP_001032309			zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
ZNF569	148266	broad.mit.edu	37	19	37916539	37916539	+	Intron	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37916539delT	uc002ogi.2	-						ZNF569_uc002ogh.2_Intron|ZNF569_uc002ogj.2_Intron	NM_152484	NP_689697			zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	46905456	46905483	+	IGR	DEL	AGGGAGGAAGGAAGGAAGGAAGGGAGGG	-	-	rs9676768		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46905456_46905483delAGGGAGGAAGGAAGGAAGGAAGGGAGGG								PPP5C (11353 upstream) : CCDC8 (8104 downstream)																																			---	---	---	---
FCAR	2204	broad.mit.edu	37	19	55400759	55400759	+	Intron	DEL	C	-	-	rs12976533		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55400759delC	uc002qhr.1	+						FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Intron|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Intron	NM_002000	NP_001991			Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)														---	---	---	---
BRSK1	84446	broad.mit.edu	37	19	55795213	55795214	+	5'Flank	DEL	CT	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55795213_55795214delCT	uc002qkg.2	+						BRSK1_uc002qkf.2_Intron	NM_032430	NP_115806			BR serine/threonine kinase 1						establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57591854	57591865	+	IGR	DEL	GGAAGGAAGGAA	-	-	rs71695310	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57591854_57591865delGGAAGGAAGGAA								MIMT1 (231932 upstream) : USP29 (39644 downstream)																																			---	---	---	---
TASP1	55617	broad.mit.edu	37	20	13416997	13416997	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13416997delA	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron	NM_017714	NP_060184			taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0																		---	---	---	---
RALGAPA2	57186	broad.mit.edu	37	20	20501483	20501484	+	Intron	INS	-	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20501483_20501484insC	uc002wrz.2	-						RALGAPA2_uc010gcx.2_Intron|RALGAPA2_uc010zsg.1_Intron|RALGAPA2_uc002wsa.1_Intron	NM_020343	NP_065076			akt substrate AS250						activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	22863441	22863441	+	IGR	DEL	T	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22863441delT								FOXA2 (297340 upstream) : SSTR4 (152616 downstream)																																			---	---	---	---
TFAP2C	7022	broad.mit.edu	37	20	55208252	55208253	+	Intron	INS	-	T	T	rs72357061		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55208252_55208253insT	uc002xya.2	+						TFAP2C_uc010zzi.1_Intron	NM_003222	NP_003213			transcription factor AP-2 gamma						cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	21	9590549	9590550	+	IGR	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9590549_9590550insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35024822	35024823	+	IGR	INS	-	TGCCCCTGCCCT	TGCCCCTGCCCT	rs146162499	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35024822_35024823insTGCCCCTGCCCT								LARGE (706238 upstream) : ISX (437306 downstream)																																			---	---	---	---
CPT1B	1375	broad.mit.edu	37	22	51007555	51007556	+	Intron	INS	-	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51007555_51007556insA	uc003bmk.3	-						CPT1B_uc003bml.2_Intron|CPT1B_uc003bmm.2_3'UTR|CPT1B_uc003bmo.2_Intron|CPT1B_uc011asa.1_Intron|CPT1B_uc003bmn.2_3'UTR|CPT1B_uc011asb.1_Intron|CHKB-CPT1B_uc003bmp.2_Intron|uc003bmr.1_5'Flank	NM_001145137	NP_001138609			carnitine palmitoyltransferase 1B isoform a						carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	486848	486850	+	IGR	DEL	AAG	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:486848_486850delAAG								PPP2R3B (139221 upstream) : SHOX (98229 downstream)																																			---	---	---	---
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174			interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	6444180	6444187	+	IGR	DEL	GAAGGAAG	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6444180_6444187delGAAGGAAG								NLGN4X (297474 upstream) : VCX3A (7473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	37754663	37754666	+	IGR	DEL	TTCC	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37754663_37754666delTTCC								DYNLT3 (47774 upstream) : CXorf27 (95404 downstream)																																			---	---	---	---
KLHL13	90293	broad.mit.edu	37	X	117035915	117035915	+	Intron	DEL	A	-	-			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117035915delA	uc004eql.2	-						KLHL13_uc004eqk.2_Intron|KLHL13_uc011mtn.1_Intron|KLHL13_uc011mto.1_Intron|KLHL13_uc011mtp.1_Intron|KLHL13_uc004eqm.2_Intron|KLHL13_uc011mtq.1_Intron	NM_033495	NP_277030			kelch-like 13						cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2																		---	---	---	---
C1orf174	339448	broad.mit.edu	37	1	3806547	3806547	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3806547C>T	uc001alf.2	-	4	816	c.709G>A	c.(709-711)GAC>AAC	p.D237N	C1orf174_uc009vls.2_RNA	NM_207356	NP_997239	Q8IYL3	CA174_HUMAN	hypothetical protein LOC339448	237	Poly-Asp.										0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)														---	---	---	---
PLEKHG5	57449	broad.mit.edu	37	1	6533038	6533038	+	Intron	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6533038G>A	uc001ano.1	-						PLEKHG5_uc001ann.1_Intron|PLEKHG5_uc001anq.1_Intron|PLEKHG5_uc001anp.1_Intron|PLEKHG5_uc001anj.1_5'Flank|PLEKHG5_uc009vma.1_Intron|PLEKHG5_uc010nzr.1_Intron|PLEKHG5_uc001ank.1_Intron|PLEKHG5_uc009vmb.1_Intron|PLEKHG5_uc001anl.1_Intron|PLEKHG5_uc001anm.1_Intron	NM_001042663	NP_001036128			pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12416555	12416555	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12416555C>T	uc001atv.2	+	49	10113	c.9972C>T	c.(9970-9972)TGC>TGT	p.C3324C	VPS13D_uc001atw.2_Silent_p.C3299C|VPS13D_uc001atx.2_Silent_p.C2511C	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3323					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
TCEB3	6924	broad.mit.edu	37	1	24082799	24082799	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24082799G>A	uc001bho.2	+	9	2146	c.2086G>A	c.(2086-2088)GCC>ACC	p.A696T		NM_003198	NP_003189	Q14241	ELOA1_HUMAN	elongin A	696	Activation domain (By similarity).				positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27106412	27106412	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106412T>G	uc001bmv.1	+	20	6396	c.6023T>G	c.(6022-6024)CTG>CGG	p.L2008R	ARID1A_uc001bmu.1_Missense_Mutation_p.L1791R|ARID1A_uc001bmx.1_Missense_Mutation_p.L854R|ARID1A_uc009vsm.1_Missense_Mutation_p.L336R|ARID1A_uc009vsn.1_Missense_Mutation_p.L250R	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2008					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
ATPIF1	93974	broad.mit.edu	37	1	28562926	28562926	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28562926G>C	uc001bpq.2	+	2	226	c.142G>C	c.(142-144)GGA>CGA	p.G48R	ATPIF1_uc001bpp.2_Missense_Mutation_p.G48R|ATPIF1_uc001bpr.2_Missense_Mutation_p.G48R	NM_016311	NP_057395	Q9UII2	ATIF1_HUMAN	ATPase inhibitory factor 1 isoform 1 precursor	48					angiogenesis|generation of precursor metabolites and energy|negative regulation of endothelial cell proliferation|negative regulation of hydrolase activity|negative regulation of nucleotide metabolic process|protein homotetramerization	cell surface|mitochondrion	angiostatin binding|ATPase binding|ATPase inhibitor activity|calmodulin binding|protein homodimerization activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|BRCA - Breast invasive adenocarcinoma(304;0.00574)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
HEYL	26508	broad.mit.edu	37	1	40092691	40092691	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40092691C>T	uc001cdp.2	-	5	526	c.475G>A	c.(475-477)GAG>AAG	p.E159K	HEYL_uc010oiw.1_Missense_Mutation_p.E131K	NM_014571	NP_055386	Q9NQ87	HEYL_HUMAN	hairy/enhancer-of-split related with YRPW	159					multicellular organismal development|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
ERMAP	114625	broad.mit.edu	37	1	43296699	43296699	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43296699G>A	uc001cic.1	+	4	616	c.346G>A	c.(346-348)GTG>ATG	p.V116M	ERMAP_uc010ojw.1_Missense_Mutation_p.V177M|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Missense_Mutation_p.V116M|ERMAP_uc001cif.1_Missense_Mutation_p.V26M	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein	116	Ig-like V-type.|Extracellular (Potential).		Missing (in Sc-3 allele).			integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
CYP4X1	260293	broad.mit.edu	37	1	47512210	47512210	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47512210C>T	uc001cqt.2	+	9	1395	c.1145C>T	c.(1144-1146)CCG>CTG	p.P382L	CYP4X1_uc001cqr.2_Missense_Mutation_p.P381L|CYP4X1_uc001cqs.2_Missense_Mutation_p.P317L	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	382						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2																		---	---	---	---
C8B	732	broad.mit.edu	37	1	57420479	57420479	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57420479A>C	uc001cyp.2	-	4	480	c.413T>G	c.(412-414)CTT>CGT	p.L138R	C8B_uc010oon.1_Missense_Mutation_p.L76R|C8B_uc010ooo.1_Missense_Mutation_p.L86R	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	138	LDL-receptor class A.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4																		---	---	---	---
PGM1	5236	broad.mit.edu	37	1	64114271	64114271	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64114271G>A	uc001dbh.2	+	8	1441	c.1228G>A	c.(1228-1230)GAG>AAG	p.E410K	PGM1_uc010ooy.1_Missense_Mutation_p.E213K|PGM1_uc010ooz.1_Missense_Mutation_p.E428K	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1	410					cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75684171	75684171	+	Intron	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75684171T>G	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79383608	79383608	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79383608T>A	uc001diq.3	-	11	1745	c.1589A>T	c.(1588-1590)CAC>CTC	p.H530L		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	530	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82456582	82456582	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82456582T>G	uc001dit.3	+	21	4146	c.3965T>G	c.(3964-3966)CTT>CGT	p.L1322R	LPHN2_uc001dis.2_Missense_Mutation_p.L302R|LPHN2_uc001diu.2_Missense_Mutation_p.L1322R|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.L949R	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1378	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
CDC14A	8556	broad.mit.edu	37	1	100964602	100964602	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100964602T>G	uc001dtg.3	+	15	2027	c.1539T>G	c.(1537-1539)TTT>TTG	p.F513L	CDC14A_uc010oui.1_Missense_Mutation_p.F455L|CDC14A_uc001dtf.2_Missense_Mutation_p.F513L|CDC14A_uc009wed.1_Missense_Mutation_p.F220L|CDC14A_uc009wee.2_Missense_Mutation_p.F513L	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	513					cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103449730	103449730	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103449730T>C	uc001dul.2	-	31	2838	c.2520A>G	c.(2518-2520)CCA>CCG	p.P840P	COL11A1_uc001duk.2_Missense_Mutation_p.Q31R|COL11A1_uc001dum.2_Silent_p.P852P|COL11A1_uc001dun.2_Silent_p.P801P|COL11A1_uc009weh.2_Silent_p.P724P	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	840	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
LRIG2	9860	broad.mit.edu	37	1	113657272	113657272	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113657272G>A	uc001edf.1	+	15	2502	c.2304G>A	c.(2302-2304)ATG>ATA	p.M768I	LRIG2_uc009wgn.1_Missense_Mutation_p.M665I	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	768	Ig-like C2-type 3.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)														---	---	---	---
DENND2C	163259	broad.mit.edu	37	1	115151320	115151320	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115151320T>A	uc001efd.1	-	10	2246	c.1544A>T	c.(1543-1545)CAA>CTA	p.Q515L	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.Q458L	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	515	UDENN.									skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
NGF	4803	broad.mit.edu	37	1	115829283	115829283	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115829283T>G	uc001efu.1	-	3	303	c.134A>C	c.(133-135)GAC>GCC	p.D45A		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	45					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)													---	---	---	---
SV2A	9900	broad.mit.edu	37	1	149883463	149883463	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149883463C>T	uc001etg.2	-	3	1183	c.692G>A	c.(691-693)CGG>CAG	p.R231Q	SV2A_uc001eth.2_Missense_Mutation_p.R231Q	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	231	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)													---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150936730	150936730	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150936730C>T	uc001evu.2	+	22	3956	c.3766C>T	c.(3766-3768)CGG>TGG	p.R1256W	SETDB1_uc001evv.2_Missense_Mutation_p.R1255W	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1256	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152188253	152188253	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188253C>T	uc001ezt.1	-	3	5928	c.5852G>A	c.(5851-5853)CGT>CAT	p.R1951H		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1951	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152277527	152277527	+	Missense_Mutation	SNP	C	T	T	rs115482787		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152277527C>T	uc001ezu.1	-	3	9871	c.9835G>A	c.(9835-9837)GCA>ACA	p.A3279T		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3279	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FCRL1	115350	broad.mit.edu	37	1	157773625	157773625	+	Intron	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157773625T>A	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170			Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)															---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158604450	158604450	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158604450T>C	uc001fst.1	-	39	5647	c.5448A>G	c.(5446-5448)GAA>GAG	p.E1816E		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1816	Spectrin 17.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158636127	158636127	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158636127C>G	uc001fst.1	-	16	2398	c.2199G>C	c.(2197-2199)GAG>GAC	p.E733D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	733	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
DUSP27	92235	broad.mit.edu	37	1	167095768	167095768	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095768G>A	uc001geb.1	+	5	1400	c.1400G>A	c.(1399-1401)CGC>CAC	p.R467H		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	467					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3																		---	---	---	---
F5	2153	broad.mit.edu	37	1	169524509	169524509	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169524509C>A	uc001ggg.1	-	7	1174	c.1029G>T	c.(1027-1029)CAG>CAT	p.Q343H	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	343					cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)													---	---	---	---
FMO2	2327	broad.mit.edu	37	1	171172996	171172996	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171172996C>T	uc001ghk.1	+						FMO2_uc010pmd.1_Intron	NM_001460	NP_001451			flavin containing monooxygenase 2						drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
C1orf125	126859	broad.mit.edu	37	1	179414226	179414226	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179414226G>A	uc001gmo.2	+	16	1812	c.1685G>A	c.(1684-1686)CGG>CAG	p.R562Q	C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Missense_Mutation_p.R350Q|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.R562Q	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	562											0																		---	---	---	---
ZNF648	127665	broad.mit.edu	37	1	182026551	182026551	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182026551A>C	uc001goz.2	-	2	803	c.595T>G	c.(595-597)TGG>GGG	p.W199G		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	199					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185958651	185958651	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185958651A>C	uc001grq.1	+	21	3309	c.3080A>C	c.(3079-3081)AAG>ACG	p.K1027T	HMCN1_uc001grr.1_Missense_Mutation_p.K368T	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1027	Ig-like C2-type 7.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
PTPRC	5788	broad.mit.edu	37	1	198685942	198685942	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198685942A>T	uc001gur.1	+	13	1597	c.1417A>T	c.(1417-1419)ATG>TTG	p.M473L	PTPRC_uc001gus.1_Missense_Mutation_p.M425L|PTPRC_uc001gut.1_Missense_Mutation_p.M312L|PTPRC_uc009wzf.1_Missense_Mutation_p.M361L|PTPRC_uc010ppg.1_Missense_Mutation_p.M409L	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	473	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216258095	216258095	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216258095G>A	uc001hku.1	-	25	5499	c.5112C>T	c.(5110-5112)AAC>AAT	p.N1704N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1704	Laminin G-like 1.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237617755	237617755	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237617755A>C	uc001hyl.1	+	15	1477	c.1357A>C	c.(1357-1359)AGC>CGC	p.S453R		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	453	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
OR2G2	81470	broad.mit.edu	37	1	247752079	247752079	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752079C>T	uc010pyy.1	+	1	418	c.418C>T	c.(418-420)CAT>TAT	p.H140Y		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	140	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)															---	---	---	---
OR2L2	26246	broad.mit.edu	37	1	248201578	248201578	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248201578T>G	uc001idw.2	+	1	105	c.9T>G	c.(7-9)AAT>AAG	p.N3K	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	3	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)															---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1271161	1271161	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1271161T>G	uc002qwq.2	+	14	1230	c.1102T>G	c.(1102-1104)TTG>GTG	p.L368V	SNTG2_uc010ewi.2_Missense_Mutation_p.L241V	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	368	PH.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
ADAM17	6868	broad.mit.edu	37	2	9676896	9676896	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9676896C>G	uc002qzu.2	-	3	475	c.292G>C	c.(292-294)GTG>CTG	p.V98L	ADAM17_uc010ewy.2_Missense_Mutation_p.V98L|ADAM17_uc010ewz.2_Intron|ADAM17_uc010exb.1_Missense_Mutation_p.V98L|ADAM17_uc002qzv.2_Missense_Mutation_p.V98L	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17	98	Poly-Val.				B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)														---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15415596	15415596	+	Intron	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15415596C>A	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
ALK	238	broad.mit.edu	37	2	29473982	29473982	+	Silent	SNP	G	A	A	rs56017149		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29473982G>A	uc002rmy.2	-	12	3100	c.2193C>T	c.(2191-2193)ACC>ACT	p.T731T		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	731	Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
ALK	238	broad.mit.edu	37	2	29754946	29754946	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29754946T>C	uc002rmy.2	-	4	1896	c.989A>G	c.(988-990)AAG>AGG	p.K330R		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	330	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
ZNF514	84874	broad.mit.edu	37	2	95815386	95815386	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95815386G>A	uc002sue.1	-	5	1218	c.844C>T	c.(844-846)CAC>TAC	p.H282Y	ZNF514_uc002sud.1_Missense_Mutation_p.H355Y	NM_032788	NP_116177	Q96K75	ZN514_HUMAN	zinc finger protein 514	282	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100917224	100917224	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100917224G>C	uc002tal.3	-	4	1587	c.947C>G	c.(946-948)GCT>GGT	p.A316G	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	316					proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
C2orf29	55571	broad.mit.edu	37	2	101885796	101885796	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101885796G>A	uc002taw.3	+	7	1536	c.1454G>A	c.(1453-1455)CGA>CAA	p.R485Q		NM_017546	NP_060016	Q9UKZ1	CB029_HUMAN	hypothetical protein LOC55571	485					cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
SLC9A4	389015	broad.mit.edu	37	2	103095555	103095555	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103095555G>T	uc002tbz.3	+	2	971	c.514G>T	c.(514-516)GGC>TGC	p.G172C		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	172	Helical; Name=E/M5; (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3																		---	---	---	---
IMP4	92856	broad.mit.edu	37	2	131103621	131103621	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131103621G>A	uc002tra.1	+	7	642	c.625G>A	c.(625-627)GTG>ATG	p.V209M		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	209	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)																	---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141110649	141110649	+	Intron	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141110649A>T	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625248	141625248	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625248T>G	uc002tvj.1	-	27	5462	c.4490A>C	c.(4489-4491)AAG>ACG	p.K1497T	LRP1B_uc010fnl.1_Missense_Mutation_p.K679T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1497	Extracellular (Potential).|LDL-receptor class B 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141641574	141641574	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141641574T>A	uc002tvj.1	-	25	4953	c.3981A>T	c.(3979-3981)GAA>GAT	p.E1327D	LRP1B_uc010fnl.1_Missense_Mutation_p.E509D	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1327	Extracellular (Potential).|LDL-receptor class B 9.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144276860	144276860	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144276860C>G	uc002tvm.3	+	10	1003	c.852C>G	c.(850-852)CAC>CAG	p.H284Q	ARHGAP15_uc002tvn.2_Missense_Mutation_p.H50Q	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	284	Rho-GAP.				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
SCN9A	6335	broad.mit.edu	37	2	167060511	167060511	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167060511T>C	uc010fpl.2	-	26	5036	c.4695A>G	c.(4693-4695)GTA>GTG	p.V1565V	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1576	Helical; Name=S3 of repeat IV; (Potential).|IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)													---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168099123	168099123	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168099123G>A	uc002udx.2	+	8	1239	c.1221G>A	c.(1219-1221)GTG>GTA	p.V407V	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.V232V|XIRP2_uc010fpq.2_Silent_p.V185V|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	232					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179489281	179489281	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179489281A>G	uc010zfg.1	-	191	37246	c.37022T>C	c.(37021-37023)CTT>CCT	p.L12341P	TTN_uc010zfh.1_Missense_Mutation_p.L6036P|TTN_uc010zfi.1_Missense_Mutation_p.L5969P|TTN_uc010zfj.1_Missense_Mutation_p.L5844P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13268							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179498346	179498346	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179498346T>G	uc010zfg.1	-	181	35260	c.35036A>C	c.(35035-35037)GAG>GCG	p.E11679A	TTN_uc010zfh.1_Missense_Mutation_p.E5374A|TTN_uc010zfi.1_Missense_Mutation_p.E5307A|TTN_uc010zfj.1_Missense_Mutation_p.E5182A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12606							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179594182	179594182	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179594182T>G	uc010zfg.1	-	61	15193	c.14969A>C	c.(14968-14970)AAG>ACG	p.K4990T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.K1651T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5917							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CCDC141	285025	broad.mit.edu	37	2	179720163	179720163	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179720163G>T	uc002unf.1	-	9	1303	c.1246C>A	c.(1246-1248)CAA>AAA	p.Q416K		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	416							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
CCDC141	285025	broad.mit.edu	37	2	179736260	179736260	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179736260A>C	uc002unf.1	-	4	431	c.374T>G	c.(373-375)CTT>CGT	p.L125R		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	125	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210557509	210557509	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557509A>C	uc002vde.1	+	7	863	c.615A>C	c.(613-615)AAA>AAC	p.K205N	MAP2_uc002vdc.1_Missense_Mutation_p.K205N|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.K201N	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	205					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210557512	210557512	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557512T>G	uc002vde.1	+	7	866	c.618T>G	c.(616-618)ACT>ACG	p.T206T	MAP2_uc002vdc.1_Silent_p.T206T|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.T202T	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	206					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212589824	212589824	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212589824C>T	uc002veg.1	-	6	816	c.718G>A	c.(718-720)GGA>AGA	p.G240R	ERBB4_uc002veh.1_Missense_Mutation_p.G240R|ERBB4_uc010zji.1_Missense_Mutation_p.G240R|ERBB4_uc010zjj.1_Missense_Mutation_p.G240R|ERBB4_uc010fut.1_Missense_Mutation_p.G240R	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	240	Cys-rich.|Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
OBSL1	23363	broad.mit.edu	37	2	220435229	220435229	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220435229C>T	uc010fwk.2	-	1	783	c.726G>A	c.(724-726)GCG>GCA	p.A242A	OBSL1_uc010fwl.1_5'Flank|OBSL1_uc002vmi.2_Silent_p.A242A|OBSL1_uc002vmj.2_Intron|INHA_uc002vmk.1_5'Flank	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	242					cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	447213	447213	+	Missense_Mutation	SNP	G	A	A	rs139892128		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:447213G>A	uc003bou.2	+	27	3717	c.3446G>A	c.(3445-3447)CGG>CAG	p.R1149Q	CHL1_uc003bot.2_Missense_Mutation_p.R1165Q|CHL1_uc011asi.1_Missense_Mutation_p.R1112Q	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	1149	Cytoplasmic (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28562499	28562499	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28562499A>C	uc003ceh.2	+	9	969	c.801A>C	c.(799-801)GAA>GAC	p.E267D	ZCWPW2_uc003cei.2_Missense_Mutation_p.E267D|ZCWPW2_uc010hfo.2_Missense_Mutation_p.E72D	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	267							zinc ion binding			ovary(2)	2																		---	---	---	---
TRANK1	9881	broad.mit.edu	37	3	36898370	36898370	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36898370T>A	uc003cgj.2	-	3	1363	c.1061A>T	c.(1060-1062)CAC>CTC	p.H354L		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	904					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SLC25A38	54977	broad.mit.edu	37	3	39437883	39437883	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39437883C>T	uc003cjo.2	+							NM_017875	NP_060345			solute carrier family 25, member 38						erythrocyte differentiation|heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)														---	---	---	---
CCDC13	152206	broad.mit.edu	37	3	42793433	42793433	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42793433C>A	uc003cly.3	-	5	682	c.598G>T	c.(598-600)GCA>TCA	p.A200S	CCDC13_uc003clz.2_Missense_Mutation_p.A200S|CCDC13_uc011azq.1_Missense_Mutation_p.A200S	NM_144719	NP_653320	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	200	Potential.									ovary(1)	1																		---	---	---	---
LAMB2	3913	broad.mit.edu	37	3	49160671	49160671	+	Missense_Mutation	SNP	T	C	C	rs112933248		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49160671T>C	uc003cwe.2	-	26	4417	c.4118A>G	c.(4117-4119)GAT>GGT	p.D1373G	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1373	Domain II.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52404576	52404576	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52404576C>T	uc011bef.1	+	40	6603	c.6342C>T	c.(6340-6342)AGC>AGT	p.S2114S		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2114					ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62216974	62216974	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62216974G>C	uc003dlb.2	+	14	3083	c.2364G>C	c.(2362-2364)GAG>GAC	p.E788D	PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	788	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62535631	62535631	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62535631A>C	uc003dll.2	-	11	2273	c.1913T>G	c.(1912-1914)CTC>CGC	p.L638R	CADPS_uc003dlk.1_Missense_Mutation_p.L142R|CADPS_uc003dlm.2_Missense_Mutation_p.L638R|CADPS_uc003dln.2_Missense_Mutation_p.L638R	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	638					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	75986752	75986752	+	IGR	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75986752A>G								ZNF717 (152082 upstream) : None (None downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77693847	77693847	+	Intron	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77693847T>G	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
OR5H14	403273	broad.mit.edu	37	3	97869148	97869148	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97869148A>T	uc003dsg.1	+	1	919	c.919A>T	c.(919-921)AGA>TGA	p.R307*		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121258317	121258317	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121258317G>A	uc003eee.3	-	4	723	c.594C>T	c.(592-594)ATC>ATT	p.I198I		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	198	Helicase ATP-binding.				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
GOLGB1	2804	broad.mit.edu	37	3	121415806	121415806	+	Silent	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121415806G>C	uc003eei.3	-	13	3675	c.3549C>G	c.(3547-3549)GCC>GCG	p.A1183A	GOLGB1_uc010hrc.2_Silent_p.A1188A|GOLGB1_uc003eej.3_Silent_p.A1149A|GOLGB1_uc011bjm.1_Silent_p.A1069A|GOLGB1_uc010hrd.1_Silent_p.A1147A	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1183	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)														---	---	---	---
FAIM	55179	broad.mit.edu	37	3	138340238	138340238	+	Intron	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138340238T>C	uc003esr.2	+						FAIM_uc003eso.1_Intron|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Intron|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204			Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0																		---	---	---	---
ZIC4	84107	broad.mit.edu	37	3	147114142	147114142	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147114142A>G	uc003ewd.1	-	3	458	c.185T>C	c.(184-186)CTC>CCC	p.L62P	ZIC4_uc003ewc.1_5'UTR|ZIC4_uc011bno.1_Missense_Mutation_p.L112P	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	62						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2																		---	---	---	---
MED12L	116931	broad.mit.edu	37	3	151129179	151129179	+	Silent	SNP	G	A	A	rs143048351		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151129179G>A	uc003eyp.2	+	39	5957	c.5919G>A	c.(5917-5919)CCG>CCA	p.P1973P	MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1973	Gln-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
IGSF10	285313	broad.mit.edu	37	3	151161049	151161049	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151161049A>C	uc011bod.1	-	5	5686	c.5686T>G	c.(5686-5688)TTA>GTA	p.L1896V	IGSF10_uc011bob.1_5'Flank|IGSF10_uc011boc.1_5'Flank	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1896	Ig-like C2-type 5.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
WDR49	151790	broad.mit.edu	37	3	167245795	167245795	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167245795A>C	uc003fev.1	-	11	1667	c.1361T>G	c.(1360-1362)CTT>CGT	p.L454R	WDR49_uc003feu.1_Missense_Mutation_p.L279R|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	454	WD 7.									large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174814756	174814756	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174814756C>G	uc003fit.2	+	2	307	c.220C>G	c.(220-222)CTA>GTA	p.L74V	NAALADL2_uc003fiu.1_Missense_Mutation_p.L67V	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	74	Cytoplasmic (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
USP13	8975	broad.mit.edu	37	3	179424791	179424791	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179424791G>A	uc003fkh.2	+	5	628	c.547G>A	c.(547-549)GAA>AAA	p.E183K	USP13_uc003fkf.2_Missense_Mutation_p.E183K	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	183					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
HGFAC	3083	broad.mit.edu	37	4	3446111	3446111	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3446111C>T	uc003ghc.2	+	6	675	c.672C>T	c.(670-672)CAC>CAT	p.H224H	HGFAC_uc010icw.2_Silent_p.H224H	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	224	Fibronectin type-I.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)														---	---	---	---
C4orf50	389197	broad.mit.edu	37	4	5975440	5975440	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5975440G>A	uc003git.1	-	4	444	c.354C>T	c.(352-354)AAC>AAT	p.N118N		NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197	118										pancreas(2)|breast(1)	3																		---	---	---	---
BEND4	389206	broad.mit.edu	37	4	42122308	42122308	+	Missense_Mutation	SNP	T	G	G	rs147406283	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42122308T>G	uc003gwn.2	-	5	1730	c.1150A>C	c.(1150-1152)AGC>CGC	p.S384R	BEND4_uc003gwm.2_Missense_Mutation_p.S384R|BEND4_uc011byy.1_Missense_Mutation_p.S384R	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	384											0																		---	---	---	---
GUF1	60558	broad.mit.edu	37	4	44682845	44682845	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44682845C>T	uc003gww.3	+	3	619	c.412C>T	c.(412-414)CTC>TTC	p.L138F	GUF1_uc010ifz.1_RNA	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog	138					translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
TMPRSS11F	389208	broad.mit.edu	37	4	68939662	68939662	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68939662T>G	uc003hdt.1	-	4	397	c.348A>C	c.(346-348)TTA>TTC	p.L116F	LOC550112_uc003hdl.3_Intron	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	116	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
PROL1	58503	broad.mit.edu	37	4	71275771	71275771	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71275771A>C	uc003hfi.2	+	3	900	c.726A>C	c.(724-726)AAA>AAC	p.K242N		NM_021225	NP_067048	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	242					regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity			large_intestine(1)	1		all_hematologic(202;0.196)																---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79186217	79186217	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79186217G>A	uc003hlb.2	+	7	1082	c.642G>A	c.(640-642)CCG>CCA	p.P214P	FRAS1_uc003hkw.2_Silent_p.P214P|FRAS1_uc003hky.1_5'UTR|FRAS1_uc003hkz.2_5'UTR	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	214	VWFC 3.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96171665	96171665	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96171665T>C	uc003htp.1	-	5	902	c.748A>G	c.(748-750)AGT>GGT	p.S250G	UNC5C_uc010ilc.1_Missense_Mutation_p.S250G|UNC5C_uc003htq.2_Missense_Mutation_p.S250G	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	250	Extracellular (Potential).|Ig-like C2-type.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)														---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126237930	126237930	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126237930C>T	uc003ifj.3	+	1	364	c.364C>T	c.(364-366)CGA>TGA	p.R122*		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	122	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126336095	126336095	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126336095A>C	uc003ifj.3	+	5	5977	c.5977A>C	c.(5977-5979)ACT>CCT	p.T1993P	FAT4_uc011cgp.1_Missense_Mutation_p.T291P	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1993	Cadherin 19.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372808	126372808	+	Missense_Mutation	SNP	A	C	C	rs79726583		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372808A>C	uc003ifj.3	+	9	10637	c.10637A>C	c.(10636-10638)TAT>TCT	p.Y3546S	FAT4_uc011cgp.1_Missense_Mutation_p.Y1844S|FAT4_uc003ifi.1_Missense_Mutation_p.Y1024S	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3546	Cadherin 34.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126411765	126411765	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126411765T>C	uc003ifj.3	+	17	13788	c.13788T>C	c.(13786-13788)ACT>ACC	p.T4596T	FAT4_uc011cgp.1_Silent_p.T2837T|FAT4_uc003ifi.1_Silent_p.T2073T	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4596	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
NR3C2	4306	broad.mit.edu	37	4	149035392	149035392	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149035392T>C	uc003ilj.3	-	8	2996	c.2662A>G	c.(2662-2664)AGC>GGC	p.S888G	NR3C2_uc003ilk.3_Missense_Mutation_p.S771G|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	888	Steroid-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)													---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155252779	155252779	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155252779A>T	uc003inw.2	-	10	2321	c.2321T>A	c.(2320-2322)CTT>CAT	p.L774H	DCHS2_uc003inx.2_Intron	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	774	Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
GRIA2	2891	broad.mit.edu	37	4	158282799	158282799	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158282799A>C	uc003ipm.3	+						GRIA2_uc011cit.1_Missense_Mutation_p.S754R|GRIA2_uc003ipl.3_Missense_Mutation_p.S801R|GRIA2_uc003ipk.3_Missense_Mutation_p.S754R|GRIA2_uc010iqh.1_RNA|GRIA2_uc011ciu.1_3'UTR|GRIA2_uc011civ.1_RNA|GRIA2_uc011ciw.1_Intron|GRIA2_uc011cix.1_Intron|GRIA2_uc011ciy.1_Missense_Mutation_p.S111R|GRIA2_uc011ciz.1_RNA	NM_001083619	NP_001077088			glutamate receptor, ionotropic, AMPA 2 isoform 2						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)													---	---	---	---
ADAM29	11086	broad.mit.edu	37	4	175898835	175898835	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175898835A>C	uc003iuc.2	+	5	2829	c.2159A>C	c.(2158-2160)AAA>ACA	p.K720T	ADAM29_uc003iud.2_Missense_Mutation_p.K720T|ADAM29_uc010irr.2_Missense_Mutation_p.K720T|ADAM29_uc011cki.1_Missense_Mutation_p.K720T	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	720	Cytoplasmic (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)														---	---	---	---
KIAA0947	23379	broad.mit.edu	37	5	5462906	5462906	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5462906G>A	uc003jdm.3	+	13	3681	c.3459G>A	c.(3457-3459)ACG>ACA	p.T1153T		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1153										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	10973668	10973668	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10973668T>G	uc003jfa.1	-	22	3720	c.3575A>C	c.(3574-3576)AAG>ACG	p.K1192T	CTNND2_uc010itt.2_Missense_Mutation_p.K1101T|CTNND2_uc011cmy.1_Missense_Mutation_p.K855T|CTNND2_uc011cmz.1_Missense_Mutation_p.K759T|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.K784T	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1192					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21765081	21765081	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21765081A>C	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron|uc003jgj.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
HTR1A	3350	broad.mit.edu	37	5	63257083	63257083	+	Missense_Mutation	SNP	G	A	A	rs145641566	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257083G>A	uc011cqt.1	-	1	464	c.464C>T	c.(463-465)GCG>GTG	p.A155V		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	155	Helical; Name=4; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)													---	---	---	---
BDP1	55814	broad.mit.edu	37	5	70860616	70860616	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70860616T>C	uc003kbp.1	+	39	8042	c.7779T>C	c.(7777-7779)TAT>TAC	p.Y2593Y	BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2593					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)														---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79030171	79030171	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79030171G>T	uc003kgc.2	+	2	5655	c.5583G>T	c.(5581-5583)TTG>TTT	p.L1861F		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1861						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79034232	79034232	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79034232A>G	uc003kgc.2	+	2	9716	c.9644A>G	c.(9643-9645)GAC>GGC	p.D3215G		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3215						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79095378	79095378	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79095378A>G	uc003kgc.2	+	13	12221	c.12149A>G	c.(12148-12150)AAA>AGA	p.K4050R		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	4050	B30.2/SPRY.			K -> E (in Ref. 2; CAD38607).		perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
MSH3	4437	broad.mit.edu	37	5	79966138	79966138	+	Intron	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79966138C>G	uc003kgz.2	+							NM_002439	NP_002430			mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)									MMR					---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82817020	82817020	+	Silent	SNP	T	G	G	rs141161041		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82817020T>G	uc003kii.3	+	7	3251	c.2895T>G	c.(2893-2895)ACT>ACG	p.T965T	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Silent_p.T965T|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	965	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82817101	82817101	+	Silent	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82817101A>C	uc003kii.3	+	7	3332	c.2976A>C	c.(2974-2976)TCA>TCC	p.S992S	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Silent_p.S992S|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	992	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
SLCO6A1	133482	broad.mit.edu	37	5	101735362	101735362	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101735362A>G	uc003knn.2	-	10	1883	c.1711T>C	c.(1711-1713)TGT>CGT	p.C571R	SLCO6A1_uc003kno.2_Missense_Mutation_p.C318R|SLCO6A1_uc003knp.2_Missense_Mutation_p.C571R|SLCO6A1_uc003knq.2_Missense_Mutation_p.C509R	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	571	Extracellular (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)														---	---	---	---
APC	324	broad.mit.edu	37	5	112175553	112175553	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175553G>A	uc010jby.2	+	16	4642	c.4262G>A	c.(4261-4263)AGT>AAT	p.S1421N	APC_uc011cvt.1_Missense_Mutation_p.S1403N|APC_uc003kpz.3_Missense_Mutation_p.S1421N|APC_uc003kpy.3_Missense_Mutation_p.S1421N|APC_uc010jbz.2_Missense_Mutation_p.S1138N|APC_uc010jca.2_Missense_Mutation_p.S721N	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1421	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.S1421fs*52(7)|p.D1422fs*2(2)|p.Y1376fs*41(1)|p.S1421fs*53(1)|p.?(1)|p.S1421fs*1(1)|p.S1411fs*41(1)|p.K1192fs*3(1)|p.S1421S(1)|p.D1422fs*1(1)|p.S1421fs*2(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
KCNN2	3781	broad.mit.edu	37	5	113698592	113698592	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113698592C>T	uc003kqo.2	+	1	577	c.120C>T	c.(118-120)GTC>GTT	p.V40V		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	40						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)														---	---	---	---
KDM3B	51780	broad.mit.edu	37	5	137713489	137713489	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137713489A>G	uc003lcy.1	+	4	755	c.555A>G	c.(553-555)CAA>CAG	p.Q185Q	KDM3B_uc010jew.1_5'UTR	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	185					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11																		---	---	---	---
PCDHA11	56138	broad.mit.edu	37	5	140250915	140250915	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250915G>A	uc003lia.2	+	1	3085	c.2227G>A	c.(2227-2229)GCG>ACG	p.A743T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.A743T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	743	Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA13	56136	broad.mit.edu	37	5	140262769	140262769	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140262769G>C	uc003lif.2	+	1	916	c.916G>C	c.(916-918)GGC>CGC	p.G306R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.G306R|PCDHA13_uc003lid.2_Missense_Mutation_p.G306R	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	306	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB2	56133	broad.mit.edu	37	5	140476258	140476258	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476258C>T	uc003lil.2	+	1	2022	c.1884C>T	c.(1882-1884)ACC>ACT	p.T628T	PCDHB2_uc003lim.1_Silent_p.T289T	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	628	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB11	56125	broad.mit.edu	37	5	140580728	140580728	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140580728C>T	uc003liy.2	+	1	1381	c.1381C>T	c.(1381-1383)CGC>TGC	p.R461C	PCDHB11_uc011daj.1_Missense_Mutation_p.R96C	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	461	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHGA8	9708	broad.mit.edu	37	5	140773889	140773889	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140773889G>A	uc003lkd.1	+	1	2407	c.1509G>A	c.(1507-1509)TCG>TCA	p.S503S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Silent_p.S503S	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	503	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SLC26A2	1836	broad.mit.edu	37	5	149361167	149361167	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149361167C>T	uc003lrh.2	+	3	2279	c.2011C>T	c.(2011-2013)CGC>TGC	p.R671C		NM_000112	NP_000103	P50443	S26A2_HUMAN	solute carrier family 26 member 2	671	Cytoplasmic (Potential).|STAS.					integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
ZNF300	91975	broad.mit.edu	37	5	150278009	150278009	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150278009G>A	uc003lsy.1	-	4	390	c.123C>T	c.(121-123)TAC>TAT	p.Y41Y	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	41	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
NKX2-5	1482	broad.mit.edu	37	5	172659803	172659803	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172659803G>A	uc003mcm.1	-	2	920	c.744C>T	c.(742-744)TAC>TAT	p.Y248Y		NM_004387	NP_004378	P52952	NKX25_HUMAN	NK2 transcription factor related, locus 5	248	Ala/Pro-rich.		Y -> H (in ASD-AVCD; somatic mutation).		adult heart development|atrial cardiac muscle cell development|atrial septum morphogenesis|heart looping|hemopoiesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell apoptosis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|outflow tract septum morphogenesis|pharyngeal system development|positive regulation of calcium ion transport via voltage-gated calcium channel activity|positive regulation of cardioblast differentiation|positive regulation of cell proliferation|positive regulation of heart contraction|positive regulation of neuron differentiation|positive regulation of sodium ion transport|positive regulation of survival gene product expression|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of cardiac muscle contraction|right ventricular cardiac muscle tissue morphogenesis|septum secundum development|spleen development|thyroid gland development|vasculogenesis|ventricular septum morphogenesis		chromatin binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
PDLIM7	9260	broad.mit.edu	37	5	176919639	176919639	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176919639C>T	uc003mhc.1	-	3	221	c.136G>A	c.(136-138)GTG>ATG	p.V46M	PDLIM7_uc003mha.1_5'Flank|PDLIM7_uc003mhb.1_Missense_Mutation_p.V46M|PDLIM7_uc003mhd.1_Translation_Start_Site|PDLIM7_uc003mhe.1_RNA|PDLIM7_uc003mhf.2_Missense_Mutation_p.V46M|PDLIM7_uc003mhg.1_Missense_Mutation_p.V46M	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1	46	PDZ.				cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
ZNF454	285676	broad.mit.edu	37	5	178392727	178392727	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178392727C>G	uc003mjo.1	+	5	1593	c.1322C>G	c.(1321-1323)ACA>AGA	p.T441R	ZNF454_uc010jkz.1_Missense_Mutation_p.T441R	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	441	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)														---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11190446	11190446	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11190446G>A	uc003mzv.2	-	5	1823	c.1656C>T	c.(1654-1656)AAC>AAT	p.N552N	NEDD9_uc010joz.2_Silent_p.N552N|NEDD9_uc003mzw.3_Silent_p.N406N	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	552					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
GFOD1	54438	broad.mit.edu	37	6	13486905	13486905	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13486905G>A	uc003nat.1	-	1	883	c.218C>T	c.(217-219)CCG>CTG	p.P73L	GFOD1_uc003nas.1_5'Flank|C6orf114_uc003nav.2_5'Flank	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	73						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)															---	---	---	---
ZNF192	7745	broad.mit.edu	37	6	28121369	28121369	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28121369T>G	uc003nkn.1	+	6	1495	c.1311T>G	c.(1309-1311)AAT>AAG	p.N437K	ZNF192_uc010jqx.1_Missense_Mutation_p.N437K|ZNF192_uc010jqy.1_Missense_Mutation_p.N250K|ZNF192_uc011dkz.1_Missense_Mutation_p.N250K	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192	437	C2H2-type 5.				viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
GABBR1	2550	broad.mit.edu	37	6	29581206	29581206	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29581206C>A	uc003nmt.3	-	12	1716	c.1380G>T	c.(1378-1380)GAG>GAT	p.E460D	GABBR1_uc003nmp.3_Missense_Mutation_p.E343D|GABBR1_uc003nms.3_Missense_Mutation_p.E343D|GABBR1_uc003nmu.3_Missense_Mutation_p.E398D|GABBR1_uc011dlr.1_Missense_Mutation_p.E283D|GABBR1_uc011dls.1_Missense_Mutation_p.E460D	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	460	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)													---	---	---	---
BAT3	7917	broad.mit.edu	37	6	31612290	31612290	+	Intron	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31612290C>G	uc003nvg.3	-						BAT3_uc003nvf.3_Intron|BAT3_uc003nvh.3_Intron|BAT3_uc003nvi.3_Intron|BAT3_uc011dnw.1_Intron|BAT3_uc011dnx.1_Intron|BAT3_uc003nvj.1_Intron	NM_004639	NP_004630			HLA-B associated transcript-3 isoform a						apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0																		---	---	---	---
KIFC1	3833	broad.mit.edu	37	6	33366122	33366122	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33366122C>G	uc003oef.3	+	3	658	c.208C>G	c.(208-210)CCA>GCA	p.P70A	KIFC1_uc011drf.1_Missense_Mutation_p.P70A|uc011drg.1_5'Flank	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	70					blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0																		---	---	---	---
MOCS1	4337	broad.mit.edu	37	6	39893473	39893473	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39893473G>A	uc003opb.2	-	2	505	c.367C>T	c.(367-369)CGG>TGG	p.R123W	MOCS1_uc003opa.2_Missense_Mutation_p.R123W|MOCS1_uc003opc.2_Missense_Mutation_p.R123W|MOCS1_uc003opd.2_Missense_Mutation_p.R123W|MOCS1_uc003ope.2_Missense_Mutation_p.R36W	NM_005942	NP_005933	Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis-step 1 protein	123	Molybdenum cofactor biosynthesis protein A.	GTP (By similarity).	R -> W (in MOCOD type A).		Mo-molybdopterin cofactor biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex|nucleus	4 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|catalytic activity|GTP binding|metal ion binding			ovary(1)|liver(1)|central_nervous_system(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
TFAP2D	83741	broad.mit.edu	37	6	50682950	50682950	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50682950A>C	uc003paf.2	+	2	673	c.161A>C	c.(160-162)GAG>GCG	p.E54A	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	54							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)																	---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51612590	51612590	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51612590A>G	uc003pah.1	-	58	10100	c.9824T>C	c.(9823-9825)CTT>CCT	p.L3275P	PKHD1_uc010jzn.1_Missense_Mutation_p.L1258P|PKHD1_uc003pai.2_Missense_Mutation_p.L3275P	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3275	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
BAI3	577	broad.mit.edu	37	6	69349123	69349123	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69349123A>G	uc003pev.3	+	3	1004	c.556A>G	c.(556-558)ACA>GCA	p.T186A	BAI3_uc010kak.2_Missense_Mutation_p.T186A	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	186	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
BAI3	577	broad.mit.edu	37	6	69772932	69772932	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69772932A>C	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	72806819	72806819	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72806819A>C	uc003pga.2	+	3	490	c.413A>C	c.(412-414)AAG>ACG	p.K138T		NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	138	RabBD.|FYVE-type.				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
SPACA1	81833	broad.mit.edu	37	6	88767403	88767403	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88767403A>C	uc003pmn.2	+	3	456	c.339A>C	c.(337-339)GAA>GAC	p.E113D		NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1 precursor	113	Extracellular (Potential).					integral to membrane					0		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)														---	---	---	---
SPACA1	81833	broad.mit.edu	37	6	88767404	88767404	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88767404G>T	uc003pmn.2	+	3	457	c.340G>T	c.(340-342)GAA>TAA	p.E114*		NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1 precursor	114	Extracellular (Potential).					integral to membrane					0		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)														---	---	---	---
FHL5	9457	broad.mit.edu	37	6	97058456	97058456	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97058456T>G	uc003pos.1	+	6	918	c.513T>G	c.(511-513)ACT>ACG	p.T171T	FHL5_uc003pot.1_Silent_p.T171T	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	171	LIM zinc-binding 3.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)														---	---	---	---
GPRC6A	222545	broad.mit.edu	37	6	117127831	117127831	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117127831A>C	uc003pxj.1	-	3	1059	c.1037T>G	c.(1036-1038)CTT>CGT	p.L346R	GPRC6A_uc003pxk.1_Intron|GPRC6A_uc003pxl.1_Missense_Mutation_p.L346R	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	346	Extracellular (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)														---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117724426	117724426	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117724426C>T	uc003pxp.1	-	6	652	c.453G>A	c.(451-453)CCG>CCA	p.P151P	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	151	Fibronectin type-III 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
C6orf204	387119	broad.mit.edu	37	6	118813011	118813011	+	Silent	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118813011A>C	uc003pxz.1	-	6	1863	c.1275T>G	c.(1273-1275)ACT>ACG	p.T425T	C6orf204_uc003pya.1_Silent_p.T428T|C6orf204_uc003pyb.2_Silent_p.T425T|C6orf204_uc011ebj.1_Silent_p.T323T|C6orf204_uc003pyc.2_Silent_p.T428T	NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a	425						centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124979358	124979358	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124979358T>A	uc003pzo.2	+	4	577	c.300T>A	c.(298-300)AAT>AAA	p.N100K	NKAIN2_uc003pzn.1_Missense_Mutation_p.N100K|NKAIN2_uc003pzp.2_Missense_Mutation_p.N99K|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Missense_Mutation_p.N10K	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1	100						integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
MOXD1	26002	broad.mit.edu	37	6	132722354	132722354	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132722354G>A	uc003qdf.2	-	1	311	c.212C>T	c.(211-213)GCG>GTG	p.A71V		NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	71	Lumenal (Potential).|DOMON.				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)														---	---	---	---
TAAR9	134860	broad.mit.edu	37	6	132859575	132859575	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132859575A>G	uc011eci.1	+	1	149	c.147A>G	c.(145-147)GGA>GGG	p.G49G		NM_175057	NP_778227	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9	49	Helical; Name=1; (Potential).					plasma membrane	G-protein coupled receptor activity				0	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)														---	---	---	---
MYCT1	80177	broad.mit.edu	37	6	153019200	153019200	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153019200A>C	uc003qpd.3	+	1	171	c.163A>C	c.(163-165)AGT>CGT	p.S55R	MYCT1_uc010kjc.1_Missense_Mutation_p.S55R|MYCT1_uc003qpc.3_Missense_Mutation_p.S55R	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	55						nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)														---	---	---	---
FRMD1	79981	broad.mit.edu	37	6	168465674	168465674	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168465674G>A	uc003qwo.3	-	5	590	c.525C>T	c.(523-525)TGC>TGT	p.C175C	FRMD1_uc003qwm.3_5'UTR|FRMD1_uc011egs.1_5'UTR|FRMD1_uc011egt.1_Silent_p.C87C|FRMD1_uc003qwn.3_Silent_p.C107C	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN	FERM domain containing 1 isoform 1	175	FERM.					cytoskeleton	binding			ovary(1)	1		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)														---	---	---	---
TNRC18	84629	broad.mit.edu	37	7	5427483	5427483	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5427483G>T	uc003soi.3	-	5	2321	c.1972C>A	c.(1972-1974)CCC>ACC	p.P658T	TNRC18_uc010ksx.1_Missense_Mutation_p.P584T	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	658							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)														---	---	---	---
ZDHHC4	55146	broad.mit.edu	37	7	6620230	6620230	+	Missense_Mutation	SNP	C	T	T	rs145005587		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6620230C>T	uc003sqi.2	+	4	396	c.38C>T	c.(37-39)TCG>TTG	p.S13L	ZDHHC4_uc003sqg.2_Missense_Mutation_p.S13L|ZDHHC4_uc003sql.2_Missense_Mutation_p.S13L|ZDHHC4_uc003sqh.2_Missense_Mutation_p.S13L|ZDHHC4_uc003sqj.2_Missense_Mutation_p.S13L|ZDHHC4_uc003sqk.2_Missense_Mutation_p.S13L|ZDHHC4_uc003sqm.2_Missense_Mutation_p.S13L	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	13	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)														---	---	---	---
ZDHHC4	55146	broad.mit.edu	37	7	6621869	6621869	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6621869T>A	uc003sqi.2	+	6	715	c.357T>A	c.(355-357)TGT>TGA	p.C119*	ZDHHC4_uc003sqg.2_Nonsense_Mutation_p.C119*|ZDHHC4_uc003sql.2_Nonsense_Mutation_p.C119*|ZDHHC4_uc003sqh.2_Nonsense_Mutation_p.C119*|ZDHHC4_uc003sqj.2_Nonsense_Mutation_p.C119*|ZDHHC4_uc003sqk.2_Nonsense_Mutation_p.C119*|ZDHHC4_uc003sqm.2_Nonsense_Mutation_p.C119*	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	119	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)														---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21599414	21599414	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21599414A>C	uc003svc.2	+							NM_003777	NP_003768			dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21788356	21788356	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21788356T>G	uc003svc.2	+	53	8721	c.8690T>G	c.(8689-8691)CTT>CGT	p.L2897R		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2897	AAA 4 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37252941	37252941	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37252941T>C	uc003tfk.1	-	12	1260	c.953A>G	c.(952-954)CAG>CGG	p.Q318R	ELMO1_uc011kbc.1_Missense_Mutation_p.Q222R|ELMO1_uc010kxg.1_Missense_Mutation_p.Q318R	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	318					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
LIMK1	3984	broad.mit.edu	37	7	73530167	73530167	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73530167G>A	uc003uaa.1	+	13	1611	c.1446G>A	c.(1444-1446)GCG>GCA	p.A482A	RFC2_uc011kfa.1_Intron|LIMK1_uc010lbl.1_RNA|LIMK1_uc003uab.2_Silent_p.A448A	NM_002314	NP_002305	P53667	LIMK1_HUMAN	LIM domain kinase 1	482	Protein kinase.				actin cytoskeleton organization|axon guidance|negative regulation of ubiquitin-protein ligase activity|positive regulation of actin filament bundle assembly|positive regulation of axon extension|Rho protein signal transduction	cytosol|growth cone|nucleus	ATP binding|heat shock protein binding|protein serine/threonine kinase activity|zinc ion binding			stomach(2)|ovary(1)	3		Lung NSC(55;0.137)																---	---	---	---
HGF	3082	broad.mit.edu	37	7	81388112	81388112	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81388112A>C	uc003uhl.2	-	3	428	c.263T>G	c.(262-264)GTT>GGT	p.V88G	HGF_uc003uhm.2_Missense_Mutation_p.V88G|HGF_uc003uhn.1_Missense_Mutation_p.V88G|HGF_uc003uho.1_Missense_Mutation_p.V88G|HGF_uc003uhp.2_Missense_Mutation_p.V88G	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	88	PAN.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82764520	82764520	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764520T>G	uc003uhx.2	-	3	2635	c.2346A>C	c.(2344-2346)AAA>AAC	p.K782N	PCLO_uc003uhv.2_Missense_Mutation_p.K782N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	728	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82784942	82784942	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784942T>G	uc003uhx.2	-	2	1304	c.1015A>C	c.(1015-1017)ACA>CCA	p.T339P	PCLO_uc003uhv.2_Missense_Mutation_p.T339P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
ABCB4	5244	broad.mit.edu	37	7	87069058	87069058	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87069058C>G	uc003uiv.1	-	14	1732	c.1656G>C	c.(1654-1656)AAG>AAC	p.K552N	ABCB4_uc003uiw.1_Missense_Mutation_p.K552N|ABCB4_uc003uix.1_Missense_Mutation_p.K552N	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	552	ABC transporter 1.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)																	---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88963642	88963642	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963642A>C	uc011khi.1	+	4	1884	c.1346A>C	c.(1345-1347)AAG>ACG	p.K449T		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	449						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
AGFG2	3268	broad.mit.edu	37	7	100160308	100160308	+	Intron	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100160308G>A	uc003uvf.2	+						AGFG2_uc010lgy.2_Intron	NM_006076	NP_006067			ArfGAP with FG repeats 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
SH2B2	10603	broad.mit.edu	37	7	101943868	101943868	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101943868G>A	uc011kko.1	+	2	208	c.163G>A	c.(163-165)GCC>ACC	p.A55T		NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2	12					blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0																		---	---	---	---
NRCAM	4897	broad.mit.edu	37	7	107820828	107820828	+	Missense_Mutation	SNP	C	T	T	rs151029926	byFrequency	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107820828C>T	uc003vfb.2	-	25	3161	c.2690G>A	c.(2689-2691)CGT>CAT	p.R897H	NRCAM_uc003vfc.2_Missense_Mutation_p.R881H|NRCAM_uc011kmk.1_Missense_Mutation_p.R892H|NRCAM_uc003vfd.2_Missense_Mutation_p.R873H|NRCAM_uc003vfe.2_Missense_Mutation_p.R873H	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	897	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5																		---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111368562	111368562	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111368562T>C	uc003vfx.2	-	52	5938	c.5669A>G	c.(5668-5670)GAG>GGG	p.E1890G	DOCK4_uc011kml.1_Missense_Mutation_p.E771G|DOCK4_uc011kmm.1_Missense_Mutation_p.E759G|DOCK4_uc003vfw.2_Missense_Mutation_p.E1302G|DOCK4_uc003vfy.2_Missense_Mutation_p.E1935G|DOCK4_uc003vfv.2_Missense_Mutation_p.E203G	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1890	Pro-rich.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
PTPRZ1	5803	broad.mit.edu	37	7	121679542	121679542	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121679542G>T	uc003vjy.2	+	20	5932	c.5537G>T	c.(5536-5538)AGT>ATT	p.S1846I	PTPRZ1_uc003vjz.2_Missense_Mutation_p.S979I|PTPRZ1_uc011knt.1_Missense_Mutation_p.S436I	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1846	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9																		---	---	---	---
NUP205	23165	broad.mit.edu	37	7	135333310	135333310	+	3'UTR	SNP	C	G	G	rs114786864	by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135333310C>G	uc003vsw.2	+	43					NUP205_uc003vsx.2_RNA	NM_015135	NP_055950			nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
PTN	5764	broad.mit.edu	37	7	136935973	136935973	+	Intron	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136935973T>G	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
PRSS1	5644	broad.mit.edu	37	7	142458458	142458458	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458458G>T	uc003wak.2	+	2	110	c.93G>T	c.(91-93)GAG>GAT	p.E31D	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Intron|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	31	Peptidase S1.				digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)											Hereditary_Pancreatitis				---	---	---	---
OR2F2	135948	broad.mit.edu	37	7	143632690	143632690	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632690G>A	uc011ktv.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)																	---	---	---	---
ZNF398	57541	broad.mit.edu	37	7	148876789	148876789	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148876789G>T	uc003wfl.2	+	6	2100	c.1825G>T	c.(1825-1827)GGT>TGT	p.G609C	ZNF398_uc011kul.1_Missense_Mutation_p.G438C|ZNF398_uc011kum.1_Missense_Mutation_p.G614C	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a	609					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)															---	---	---	---
KCNH2	3757	broad.mit.edu	37	7	150648916	150648916	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150648916C>T	uc003wic.2	-	7	1578	c.1565G>A	c.(1564-1566)GGG>GAG	p.G522E	KCNH2_uc003wib.2_Missense_Mutation_p.G182E|KCNH2_uc011kux.1_Missense_Mutation_p.G426E|KCNH2_uc003wid.2_Missense_Mutation_p.G182E|KCNH2_uc003wie.2_Missense_Mutation_p.G522E	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	522	Helical; Voltage-sensor; Name=Segment S4; (Potential).				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)													---	---	---	---
GALNT11	63917	broad.mit.edu	37	7	151810363	151810363	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151810363C>T	uc010lqg.1	+	8	1343	c.1113C>T	c.(1111-1113)ATC>ATT	p.I371I	GALNT11_uc011kvm.1_Silent_p.I290I|GALNT11_uc003wku.2_Silent_p.I371I|GALNT11_uc003wkw.1_Silent_p.I119I	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11	371	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151970786	151970786	+	Intron	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151970786T>G	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
ZNF596	169270	broad.mit.edu	37	8	192905	192905	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:192905G>A	uc003wot.2	+	3	319	c.31G>A	c.(31-33)GAT>AAT	p.D11N	ZNF596_uc003wou.2_5'UTR|ZNF596_uc003wov.2_Missense_Mutation_p.D11N|ZNF596_uc003wow.2_Missense_Mutation_p.D11N	NM_173539	NP_775810	Q8TC21	ZN596_HUMAN	zinc finger protein 596	11	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2796225	2796225	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2796225T>A	uc011kwk.1	-	70	10970	c.10580A>T	c.(10579-10581)GAA>GTA	p.E3527V	CSMD1_uc011kwj.1_Missense_Mutation_p.E2841V|CSMD1_uc010lrg.2_Missense_Mutation_p.E1418V	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	3527	Cytoplasmic (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2832075	2832075	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2832075C>T	uc011kwk.1	-	56	9031	c.8641G>A	c.(8641-8643)GTC>ATC	p.V2881I	CSMD1_uc011kwj.1_Missense_Mutation_p.V2210I|CSMD1_uc010lrg.2_Missense_Mutation_p.V891I	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2881	Sushi 21.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2944709	2944709	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2944709C>G	uc011kwk.1	-	49	7777	c.7387G>C	c.(7387-7389)GGA>CGA	p.G2463R	CSMD1_uc011kwj.1_Missense_Mutation_p.G1792R|CSMD1_uc010lrg.2_Missense_Mutation_p.G531R	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2463	Sushi 14.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3038632	3038632	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3038632T>G	uc011kwk.1	-	37	6118	c.5728A>C	c.(5728-5730)ACT>CCT	p.T1910P	CSMD1_uc011kwj.1_Missense_Mutation_p.T1302P|CSMD1_uc003wqe.2_Missense_Mutation_p.T1066P|CSMD1_uc010lrg.2_5'UTR	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1910	Extracellular (Potential).|CUB 11.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3253782	3253782	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3253782A>C	uc011kwk.1	-	17	2920	c.2530T>G	c.(2530-2532)TTC>GTC	p.F844V	CSMD1_uc011kwj.1_Missense_Mutation_p.F236V|CSMD1_uc003wqe.2_5'UTR	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	844	Extracellular (Potential).|CUB 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3855488	3855488	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3855488T>G	uc011kwk.1	-	5	1145	c.755A>C	c.(754-756)GAC>GCC	p.D252A		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	252	Extracellular (Potential).|CUB 2.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
SLC25A37	51312	broad.mit.edu	37	8	23429191	23429191	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23429191G>A	uc003xdo.2	+	4	993	c.840G>A	c.(838-840)TCG>TCA	p.S280S	SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_RNA|uc003xds.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	280	Solcar 3.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)														---	---	---	---
SLC25A37	51312	broad.mit.edu	37	8	23429192	23429192	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23429192G>T	uc003xdo.2	+	4	994	c.841G>T	c.(841-843)GGT>TGT	p.G281C	SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_RNA|uc003xds.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	281	Solcar 3.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)														---	---	---	---
EFCAB1	79645	broad.mit.edu	37	8	49644049	49644049	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49644049T>G	uc003xqo.2	-	2	232	c.72A>C	c.(70-72)GAA>GAC	p.E24D	EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Intron|EFCAB1_uc010lxx.2_Intron|EFCAB1_uc011ldk.1_Intron	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a	24							calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)																---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72938301	72938301	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72938301A>C	uc003xza.2	-	25	3120	c.2945T>G	c.(2944-2946)CTT>CGT	p.L982R	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	982	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73480233	73480233	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480233C>A	uc003xzb.2	+	2	852	c.264C>A	c.(262-264)TTC>TTA	p.F88L		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	88	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
TERF1	7013	broad.mit.edu	37	8	73921176	73921176	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73921176A>G	uc003xzd.2	+	1	80	c.55A>G	c.(55-57)AGG>GGG	p.R19G	TERF1_uc003xzc.2_RNA|TERF1_uc003xze.2_Missense_Mutation_p.R19G	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1	19	Asp/Glu-rich (acidic).				age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding			ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104898096	104898096	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898096T>G	uc003yls.2	+	2	844	c.603T>G	c.(601-603)TCT>TCG	p.S201S	RIMS2_uc003ylp.2_Silent_p.S423S|RIMS2_uc003ylw.2_Silent_p.S231S|RIMS2_uc003ylq.2_Silent_p.S231S|RIMS2_uc003ylr.2_Silent_p.S231S	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	p.S231S(1)		ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
LRP12	29967	broad.mit.edu	37	8	105503141	105503141	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105503141A>G	uc003yma.2	-	7	2435	c.2340T>C	c.(2338-2340)TCT>TCC	p.S780S	LRP12_uc003ymb.2_Silent_p.S761S|LRP12_uc003ylz.2_Silent_p.S186S	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	780	Cytoplasmic (Potential).				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113301723	113301723	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113301723A>G	uc003ynu.2	-	57	9178	c.9019T>C	c.(9019-9021)TCT>CCT	p.S3007P	CSMD3_uc003yns.2_Missense_Mutation_p.S2209P|CSMD3_uc003ynt.2_Missense_Mutation_p.S2967P|CSMD3_uc011lhx.1_Missense_Mutation_p.S2838P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3007	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113678505	113678505	+	Splice_Site	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113678505C>A	uc003ynu.2	-	17	2975	c.2816_splice	c.e17+1	p.R939_splice	CSMD3_uc003yns.2_Splice_Site_p.R211_splice|CSMD3_uc003ynt.2_Splice_Site_p.R899_splice|CSMD3_uc011lhx.1_Splice_Site_p.R835_splice	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113812478	113812478	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113812478A>C	uc003ynu.2	-	13	2044	c.1885T>G	c.(1885-1887)TTG>GTG	p.L629V	CSMD3_uc003ynt.2_Missense_Mutation_p.L589V|CSMD3_uc011lhx.1_Missense_Mutation_p.L525V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	629	Extracellular (Potential).|CUB 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
WISP1	8840	broad.mit.edu	37	8	134232985	134232985	+	Missense_Mutation	SNP	C	T	T	rs140971140		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134232985C>T	uc003yub.2	+	3	587	c.511C>T	c.(511-513)CGG>TGG	p.R171W	WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	171	VWFC.				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136657345	136657345	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136657345A>G	uc003yuv.2	+	8	1328	c.934A>G	c.(934-936)ACT>GCT	p.T312A	KHDRBS3_uc003yuw.2_3'UTR|KHDRBS3_uc010mek.2_RNA	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal	312	Tyr-rich.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
GLDC	2731	broad.mit.edu	37	9	6595131	6595131	+	Intron	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6595131G>C	uc003zkc.2	-							NM_000170	NP_000161			glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8331578	8331578	+	Intron	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331578T>G	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
SH3GL2	6456	broad.mit.edu	37	9	17786533	17786533	+	Intron	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17786533C>G	uc003zna.2	+						SH3GL2_uc011lmx.1_Intron|SH3GL2_uc011lmy.1_Intron	NM_003026	NP_003017			SH3-domain GRB2-like 2						axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)														---	---	---	---
SH3GL2	6456	broad.mit.edu	37	9	17789403	17789403	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17789403A>C	uc003zna.2	+	6	767	c.479A>C	c.(478-480)AAG>ACG	p.K160T	SH3GL2_uc011lmx.1_Missense_Mutation_p.K125T|SH3GL2_uc011lmy.1_Missense_Mutation_p.K113T	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	160	BAR.				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)														---	---	---	---
UBAP2	55833	broad.mit.edu	37	9	33922786	33922786	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33922786C>G	uc003ztq.1	-	28	3276	c.3163G>C	c.(3163-3165)GCG>CCG	p.A1055P	UBAP2_uc011loc.1_Missense_Mutation_p.A964P|UBAP2_uc011lod.1_Missense_Mutation_p.A788P|UBAP2_uc011loe.1_Missense_Mutation_p.A810P|UBAP2_uc003ztn.1_Missense_Mutation_p.A294P|UBAP2_uc003zto.1_Missense_Mutation_p.A294P|UBAP2_uc003ztp.1_Missense_Mutation_p.A294P	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2	1055										ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)														---	---	---	---
FBXO10	26267	broad.mit.edu	37	9	37541762	37541762	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37541762C>T	uc004aab.2	-	2	53	c.4G>A	c.(4-6)GAG>AAG	p.E2K	FBXO10_uc004aac.2_Missense_Mutation_p.E18K|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	2	F-box.					ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)														---	---	---	---
RORB	6096	broad.mit.edu	37	9	77282711	77282711	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77282711T>C	uc004aji.2	+	8	1087	c.1038T>C	c.(1036-1038)TCT>TCC	p.S346S	RORB_uc004ajh.2_Silent_p.S335S	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	346	Ligand-binding (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94493274	94493274	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94493274G>T	uc004arj.1	-	7	1300	c.1101C>A	c.(1099-1101)AAC>AAA	p.N367K	ROR2_uc004ari.1_Missense_Mutation_p.N227K|ROR2_uc004ark.2_Missense_Mutation_p.N367K	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	367	Extracellular (Potential).|Kringle.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
KIAA1529	57653	broad.mit.edu	37	9	100085179	100085179	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100085179C>T	uc011lut.1	+	24	2546	c.1773C>T	c.(1771-1773)TGC>TGT	p.C591C	KIAA1529_uc004axe.1_Silent_p.C591C|KIAA1529_uc004axg.1_Silent_p.C452C|KIAA1529_uc011lus.1_Silent_p.C409C|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Silent_p.C452C|KIAA1529_uc011luv.1_Silent_p.C449C	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)																---	---	---	---
XPA	7507	broad.mit.edu	37	9	100456040	100456040	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100456040G>A	uc004axr.3	-	2	291	c.174C>T	c.(172-174)GGC>GGT	p.G58G	XPA_uc004axs.3_RNA	NM_000380	NP_000371	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A	58	Interaction with CEP164 and required for UV resistance.				nucleotide-excision repair, DNA damage removal	nucleoplasm	damaged DNA binding|metal ion binding|nucleotide binding|protein domain specific binding|protein homodimerization activity			breast(1)	1		Acute lymphoblastic leukemia(62;0.158)						Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				---	---	---	---
PALM2-AKAP2	445815	broad.mit.edu	37	9	112705446	112705446	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112705446C>T	uc004bei.2	+	7	1169	c.977C>T	c.(976-978)ACG>ATG	p.T326M	PALM2_uc004bef.2_Missense_Mutation_p.T328M|PALM2_uc004beg.2_Missense_Mutation_p.T294M|PALM2_uc004beh.3_Missense_Mutation_p.T326M|PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	Error:Variant_position_missing_in_Q9Y2D5_after_alignment							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119203072	119203072	+	Splice_Site	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119203072C>A	uc004bjs.1	-	22	3700	c.3599_splice	c.e22-1	p.E1200_splice	ASTN2_uc004bjr.1_Splice_Site_p.E1196_splice|ASTN2_uc004bjt.1_Splice_Site_p.E1149_splice|ASTN2_uc004bjp.1_Splice_Site_p.E293_splice|ASTN2_uc004bjq.1_Splice_Site_p.E252_splice|ASTN2_uc011lxr.1_Splice_Site_p.E252_splice|ASTN2_uc011lxs.1_Splice_Site_p.E252_splice|ASTN2_uc011lxt.1_Splice_Site_p.E252_splice|ASTN2_uc004bjo.1_Splice_Site	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120475788	120475788	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475788T>G	uc004bjz.2	+	3	1673	c.1382T>G	c.(1381-1383)GTT>GGT	p.V461G	TLR4_uc004bka.2_Missense_Mutation_p.V421G|TLR4_uc004bkb.2_Missense_Mutation_p.V261G	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	461	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
ANAPC2	29882	broad.mit.edu	37	9	140079432	140079432	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140079432G>A	uc004clr.1	-	4	1054	c.981C>T	c.(979-981)CAC>CAT	p.H327H	ANAPC2_uc004clq.1_Silent_p.H186H	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	327					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)														---	---	---	---
GATA3	2625	broad.mit.edu	37	10	8115807	8115807	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8115807T>G	uc001ika.2	+	6	1710	c.1153T>G	c.(1153-1155)TTC>GTC	p.F385V	GATA3_uc001ijz.2_Missense_Mutation_p.F386V	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	385					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22								F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37431029	37431029	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431029A>G	uc001iza.1	+	7	1135	c.1036A>G	c.(1036-1038)ACA>GCA	p.T346A		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	402						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37505290	37505290	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37505290A>C	uc001iza.1	+	32	2982	c.2883A>C	c.(2881-2883)AAA>AAC	p.K961N		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1017	Potential.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---
ZNF32	7580	broad.mit.edu	37	10	44140004	44140004	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44140004C>G	uc001jbb.2	-	3	505	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	uc001jba.2_Intron|ZNF32_uc001jbc.2_Missense_Mutation_p.E106Q	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32	106	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)														---	---	---	---
MAPK8	5599	broad.mit.edu	37	10	49634068	49634068	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49634068C>T	uc009xnz.2	+	8	1050	c.826C>T	c.(826-828)CCT>TCT	p.P276S	MAPK8_uc001jgl.2_Missense_Mutation_p.P276S|MAPK8_uc001jgm.2_Missense_Mutation_p.P276S|MAPK8_uc001jgo.2_Missense_Mutation_p.P276S|MAPK8_uc009xoa.2_Intron|MAPK8_uc001jgn.2_Missense_Mutation_p.P276S|MAPK8_uc010qgk.1_Missense_Mutation_p.P276S|MAPK8_uc001jgp.2_Missense_Mutation_p.P276S|MAPK8_uc001jgq.2_Missense_Mutation_p.P276S	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	276	Protein kinase.				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	54048563	54048563	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54048563A>G	uc001jjm.2	+	15	1936	c.1742A>G	c.(1741-1743)AAG>AGG	p.K581R	PRKG1_uc001jjo.2_Missense_Mutation_p.K596R|PRKG1_uc009xow.1_Missense_Mutation_p.K299R|uc001jjq.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	581	Protein kinase.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
STAMBPL1	57559	broad.mit.edu	37	10	90733079	90733079	+	3'UTR	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90733079A>T	uc010qmx.1	+	11					ACTA2_uc001kfq.2_Intron|FAS_uc010qna.1_RNA	NM_020799	NP_065850			STAM binding protein-like 1								metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)														---	---	---	---
PCGF5	84333	broad.mit.edu	37	10	93011167	93011167	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93011167T>A	uc001khh.2	+	6	691	c.444T>A	c.(442-444)AAT>AAA	p.N148K	PCGF5_uc010qnk.1_Missense_Mutation_p.N148K|PCGF5_uc001khi.2_Missense_Mutation_p.N148K	NM_032373	NP_115749	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	148					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1																		---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116198978	116198978	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116198978C>A	uc010qsg.1	-	20	2198	c.2099G>T	c.(2098-2100)AGA>ATA	p.R700I	ABLIM1_uc010qsh.1_Missense_Mutation_p.R668I|ABLIM1_uc010qsi.1_Missense_Mutation_p.R640I|ABLIM1_uc010qsf.1_Missense_Mutation_p.R377I	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a	700					axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117059546	117059546	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117059546A>C	uc001lcg.2	+	16	2804	c.2418A>C	c.(2416-2418)AAA>AAC	p.K806N	ATRNL1_uc010qsm.1_5'UTR|ATRNL1_uc010qsn.1_5'Flank	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	806	C-type lectin.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117853305	117853305	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117853305C>A	uc001lcj.2	-	8	1621	c.923G>T	c.(922-924)AGT>ATT	p.S308I	GFRA1_uc001lci.2_Missense_Mutation_p.S303I|GFRA1_uc009xyr.2_Missense_Mutation_p.S303I	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a	308	3.				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117884933	117884933	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117884933C>T	uc001lcj.2	-	6	1267	c.569G>A	c.(568-570)CGC>CAC	p.R190H	GFRA1_uc001lci.2_Missense_Mutation_p.R185H|GFRA1_uc009xyr.2_Missense_Mutation_p.R185H	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a	190	2.				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
MMP21	118856	broad.mit.edu	37	10	127461299	127461299	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127461299G>A	uc001liu.2	-	3	718	c.718C>T	c.(718-720)CGG>TGG	p.R240W		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	240					proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
TNNI2	7136	broad.mit.edu	37	11	1862752	1862752	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1862752C>T	uc010qxe.1	+	6	542	c.520C>T	c.(520-522)CGG>TGG	p.R174W	TNNI2_uc010qxc.1_Missense_Mutation_p.R172W|TNNI2_uc010qxd.1_Missense_Mutation_p.R172W	NM_001145841	NP_001139313	P48788	TNNI2_HUMAN	fast-twitch skeletal muscle troponin I isoform	174			R -> Q (in DA2B).		muscle filament sliding|positive regulation of transcription, DNA-dependent|skeletal muscle contraction	cytosol|nucleus|troponin complex	actin binding|troponin T binding				0		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
MRGPRE	116534	broad.mit.edu	37	11	3249330	3249330	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3249330C>T	uc001lxq.3	-	2	1007	c.697G>A	c.(697-699)GGC>AGC	p.G233S		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	233	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
HBE1	3046	broad.mit.edu	37	11	5290789	5290789	+	Silent	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5290789A>C	uc001mal.1	-	2	463	c.210T>G	c.(208-210)ACT>ACG	p.T70T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Silent_p.T70T	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	70					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR51B4	79339	broad.mit.edu	37	11	5323134	5323134	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5323134A>G	uc010qza.1	-	1	43	c.43T>C	c.(43-45)TTC>CTC	p.F15L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)												OREG0003718	type=REGULATORY REGION|Gene=OR51B4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
OR52L1	338751	broad.mit.edu	37	11	6007684	6007684	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6007684T>C	uc001mcd.2	-	1	532	c.477A>G	c.(475-477)ATA>ATG	p.I159M		NM_001005173	NP_001005173	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L,	159	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
CRY2	1408	broad.mit.edu	37	11	45869154	45869154	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45869154C>T	uc010rgn.1	+	1	198	c.176C>T	c.(175-177)CCG>CTG	p.P59L	CRY2_uc009ykw.2_Intron	NM_021117	NP_066940	Q49AN0	CRY2_HUMAN	cryptochrome 2 (photolyase-like) isoform 1	38	DNA photolyase.				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1																		---	---	---	---
OR4C12	283093	broad.mit.edu	37	11	50003778	50003778	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003778T>G	uc010ria.1	-	1	260	c.260A>C	c.(259-261)AAG>ACG	p.K87T		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	87	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3																		---	---	---	---
OR4C16	219428	broad.mit.edu	37	11	55340243	55340243	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55340243T>G	uc010rih.1	+	1	640	c.640T>G	c.(640-642)TTC>GTC	p.F214V		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	214	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)																---	---	---	---
OR5L2	26338	broad.mit.edu	37	11	55595359	55595359	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595359T>C	uc001nhy.1	+	1	665	c.665T>C	c.(664-666)CTC>CCC	p.L222P		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)													HNSCC(27;0.073)			---	---	---	---
OR8H3	390152	broad.mit.edu	37	11	55890015	55890015	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890015T>G	uc001nii.1	+	1	167	c.167T>G	c.(166-168)CTT>CGT	p.L56R		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	56	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)																	---	---	---	---
OR5T2	219464	broad.mit.edu	37	11	55999981	55999981	+	Silent	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999981A>C	uc010rjc.1	-	1	681	c.681T>G	c.(679-681)TCT>TCG	p.S227S		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	227	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
OR8K3	219473	broad.mit.edu	37	11	56086621	56086621	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56086621T>G	uc010rjf.1	+	1	839	c.839T>G	c.(838-840)GTT>GGT	p.V280G		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)																	---	---	---	---
OR5M11	219487	broad.mit.edu	37	11	56310202	56310202	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56310202A>G	uc010rjl.1	-	1	532	c.532T>C	c.(532-534)TGT>CGT	p.C178R		NM_001005245	NP_001005245	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
CNTF	1270	broad.mit.edu	37	11	58391663	58391663	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58391663T>C	uc001nna.3	+	2	351	c.271T>C	c.(271-273)TTA>CTA	p.L91L	ZFP91-CNTF_uc010rkm.1_RNA	NM_000614	NP_000605	P26441	CNTF_HUMAN	ciliary neurotrophic factor	91					ciliary neurotrophic factor-mediated signaling pathway|growth|negative regulation of neuron apoptosis|positive regulation of tyrosine phosphorylation of Stat3 protein		ciliary neurotrophic factor receptor binding|growth factor activity|interleukin-6 receptor binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)																---	---	---	---
OR4D11	219986	broad.mit.edu	37	11	59271453	59271453	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59271453C>T	uc001noa.1	+	1	405	c.405C>T	c.(403-405)ATC>ATT	p.I135I		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
GPR44	11251	broad.mit.edu	37	11	60620847	60620847	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60620847C>G	uc001nqc.2	-	2	461	c.349G>C	c.(349-351)GCC>CCC	p.A117P		NM_004778	NP_004769	Q9Y5Y4	GPR44_HUMAN	G protein-coupled receptor 44	117	Helical; Name=3; (Potential).				immune response	integral to plasma membrane	N-formyl peptide receptor activity			ovary(1)	1																		---	---	---	---
NPAS4	266743	broad.mit.edu	37	11	66192584	66192584	+	Silent	SNP	G	A	A	rs151135507		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66192584G>A	uc001ohx.1	+	7	2399	c.2223G>A	c.(2221-2223)TCG>TCA	p.S741S	NPAS4_uc010rpc.1_Silent_p.S531S	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	741					transcription, DNA-dependent		DNA binding|signal transducer activity				0																		---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89133448	89133448	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89133448T>G	uc001pct.2	-	10	1185	c.946A>C	c.(946-948)AGT>CGT	p.S316R	NOX4_uc009yvr.2_Missense_Mutation_p.S291R|NOX4_uc001pcu.2_Missense_Mutation_p.S242R|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.S316R|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Missense_Mutation_p.S150R|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Missense_Mutation_p.S292R|NOX4_uc009yvq.2_Missense_Mutation_p.S292R	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	316	FAD-binding FR-type.|Extracellular (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115102154	115102154	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115102154C>T	uc001ppi.3	-	4	610	c.481G>A	c.(481-483)GAG>AAG	p.E161K	CADM1_uc001ppf.3_Missense_Mutation_p.E161K|CADM1_uc001ppk.3_Missense_Mutation_p.E161K|CADM1_uc001ppj.3_Missense_Mutation_p.E161K|CADM1_uc001ppl.2_Missense_Mutation_p.E161K	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	161	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
TMPRSS13	84000	broad.mit.edu	37	11	117787939	117787939	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117787939G>A	uc001prs.1	-	3	595	c.502C>T	c.(502-504)CTC>TTC	p.L168F	TMPRSS13_uc009yzr.1_Intron|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.L168F	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	163	Helical; Signal-anchor for type II membrane protein; (Potential).				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)														---	---	---	---
OAF	220323	broad.mit.edu	37	11	120097661	120097661	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120097661C>T	uc001pxb.2	+	3	744	c.503C>T	c.(502-504)GCC>GTC	p.A168V		NM_178507	NP_848602	Q86UD1	OAF_HUMAN	OAF homolog precursor	168											0		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120833306	120833306	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120833306G>A	uc001pxn.2	+	18	2469	c.2182G>A	c.(2182-2184)GAG>AAG	p.E728K	GRIK4_uc009zav.1_Missense_Mutation_p.E728K|GRIK4_uc009zaw.1_Missense_Mutation_p.E728K|GRIK4_uc009zax.1_Missense_Mutation_p.E728K	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	728	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
ASAM	79827	broad.mit.edu	37	11	122953807	122953807	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122953807C>G	uc001pyt.2	-	5	1024	c.665G>C	c.(664-666)CGA>CCA	p.R222P		NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor	222	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124134859	124134859	+	IGR	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124134859A>C								OR8G2 (38549 upstream) : OR8D1 (44878 downstream)																																			---	---	---	---
OR8D1	283159	broad.mit.edu	37	11	124180410	124180410	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124180410A>G	uc010sag.1	-	1	253	c.253T>C	c.(253-255)TTC>CTC	p.F85L		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)														---	---	---	---
OR8D2	283160	broad.mit.edu	37	11	124189189	124189189	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189189T>G	uc010sah.1	-	1	905	c.905A>C	c.(904-906)AAG>ACG	p.K302T		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)														---	---	---	---
TBRG1	84897	broad.mit.edu	37	11	124501985	124501985	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124501985C>T	uc001qak.3	+						TBRG1_uc001qaj.3_Intron|TBRG1_uc001qal.3_Intron|TBRG1_uc001qam.3_Intron|TBRG1_uc009zbf.2_Intron|TBRG1_uc009zbg.2_Intron|TBRG1_uc009zbh.2_Intron	NM_032811	NP_116200			transforming growth factor beta regulator 1						cell cycle arrest|DNA replication|negative regulation of cell proliferation|nucleolus to nucleoplasm transport|protein stabilization	nucleus	DNA binding|protein binding				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)														---	---	---	---
KCNA1	3736	broad.mit.edu	37	12	5021847	5021847	+	Missense_Mutation	SNP	T	G	G	rs139518461		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5021847T>G	uc001qnh.2	+	2	2408	c.1303T>G	c.(1303-1305)TTA>GTA	p.L435V		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	435					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
GPR162	27239	broad.mit.edu	37	12	6933903	6933903	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6933903A>G	uc001qqw.1	+	2	1374	c.839A>G	c.(838-840)TAT>TGT	p.Y280C	LEPREL2_uc001qqz.1_5'Flank|GPR162_uc010sfn.1_Missense_Mutation_p.Y280C|GPR162_uc001qqx.1_Intron|GPR162_uc009zfd.1_Intron|GPR162_uc001qqy.1_Intron	NM_019858	NP_062832	Q16538	GP162_HUMAN	G protein-coupled receptor 162 isoform 2	280	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
SLCO1C1	53919	broad.mit.edu	37	12	20874854	20874854	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20874854A>G	uc001rej.3	+	9	1247	c.892A>G	c.(892-894)AGT>GGT	p.S298G	SLCO1C1_uc010sii.1_Missense_Mutation_p.S298G|SLCO1C1_uc010sij.1_Missense_Mutation_p.S249G|SLCO1C1_uc009zip.2_Missense_Mutation_p.S132G|SLCO1C1_uc001rei.2_Missense_Mutation_p.S298G|SLCO1C1_uc010sik.1_Missense_Mutation_p.S180G	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	298	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)																	---	---	---	---
SLCO1C1	53919	broad.mit.edu	37	12	20905343	20905343	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20905343A>C	uc001rej.3	+	16	2375	c.2020A>C	c.(2020-2022)AGT>CGT	p.S674R	SLCO1C1_uc010sii.1_Missense_Mutation_p.K708T|SLCO1C1_uc010sij.1_Missense_Mutation_p.S625R|SLCO1C1_uc009zip.2_Missense_Mutation_p.K542T|SLCO1C1_uc001rei.2_Missense_Mutation_p.S674R|SLCO1C1_uc010sik.1_Missense_Mutation_p.K590T	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	674	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)																	---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23908618	23908618	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23908618T>C	uc001rfw.2	-	4	624	c.522A>G	c.(520-522)AAA>AAG	p.K174K	SOX5_uc001rfx.2_Silent_p.K161K|SOX5_uc001rfy.2_Silent_p.K161K|SOX5_uc010siv.1_Silent_p.K161K|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Silent_p.K126K	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	174					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
PRICKLE1	144165	broad.mit.edu	37	12	42858713	42858713	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42858713A>G	uc010skv.1	-	7	1410	c.1123T>C	c.(1123-1125)TTG>CTG	p.L375L	PRICKLE1_uc001rnl.2_Silent_p.L375L|PRICKLE1_uc010skw.1_Silent_p.L375L|PRICKLE1_uc001rnm.2_Silent_p.L375L	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	375					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)														---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45173623	45173623	+	Intron	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45173623T>C	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580			NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
DGKA	1606	broad.mit.edu	37	12	56335328	56335328	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56335328C>T	uc001sij.2	+	15	1474	c.1210C>T	c.(1210-1212)CGA>TGA	p.R404*	DGKA_uc001sih.1_Nonsense_Mutation_p.R292*|DGKA_uc001sii.1_Nonsense_Mutation_p.R262*|DGKA_uc009zod.1_Nonsense_Mutation_p.R323*|DGKA_uc001sik.2_Nonsense_Mutation_p.R404*|DGKA_uc001sil.2_Nonsense_Mutation_p.R404*|DGKA_uc001sim.2_Nonsense_Mutation_p.R404*|DGKA_uc001sin.2_Nonsense_Mutation_p.R404*|DGKA_uc009zof.2_Nonsense_Mutation_p.R50*|DGKA_uc001sio.2_Nonsense_Mutation_p.R146*	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	404	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)													---	---	---	---
NACA	4666	broad.mit.edu	37	12	57113824	57113824	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57113824A>C	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Missense_Mutation_p.V497G|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Missense_Mutation_p.V497G|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672			nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1								T	BCL6	NHL								---	---	---	---
DPY19L2	283417	broad.mit.edu	37	12	63954283	63954283	+	3'UTR	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63954283G>T	uc001srp.1	-	22					DPY19L2_uc010sso.1_3'UTR	NM_173812	NP_776173			dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)														---	---	---	---
TBC1D15	64786	broad.mit.edu	37	12	72291645	72291645	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72291645G>A	uc001swu.2	+	11	1233	c.1224G>A	c.(1222-1224)ATG>ATA	p.M408I	TBC1D15_uc009zrv.2_Missense_Mutation_p.M270I|TBC1D15_uc010stt.1_Missense_Mutation_p.M377I|TBC1D15_uc001swv.2_Missense_Mutation_p.M391I|TBC1D15_uc001sww.2_Missense_Mutation_p.M140I	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	386	Rab-GAP TBC.						protein binding|Rab GTPase activator activity				0																		---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	73046203	73046203	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73046203C>G	uc001sxa.2	+	16	2672	c.2642C>G	c.(2641-2643)GCA>GGA	p.A881G		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	881	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	73046210	73046210	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73046210T>C	uc001sxa.2	+	16	2679	c.2649T>C	c.(2647-2649)TCT>TCC	p.S883S		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	883	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85460688	85460688	+	Intron	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85460688G>T	uc001tac.2	+						LRRIQ1_uc001tab.1_Intron	NM_001079910	NP_001073379			leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
TMTC3	160418	broad.mit.edu	37	12	88542204	88542204	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88542204G>C	uc001tau.2	+	2	332	c.112G>C	c.(112-114)GAT>CAT	p.D38H	TMTC3_uc009zsm.2_RNA	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	38						integral to membrane	binding			skin(1)	1																		---	---	---	---
NUAK1	9891	broad.mit.edu	37	12	106461101	106461101	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106461101C>A	uc001tlj.1	-	7	2845	c.1465G>T	c.(1465-1467)GAG>TAG	p.E489*		NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5	489							ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ASCL4	121549	broad.mit.edu	37	12	108169333	108169333	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108169333C>T	uc001tmr.2	+	1	1172	c.341C>T	c.(340-342)ACG>ATG	p.T114M		NM_203436	NP_982260	Q6XD76	ASCL4_HUMAN	achaete-scute complex-like 4	113	Helix-loop-helix motif.				regulation of transcription from RNA polymerase II promoter|skin development|transcription, DNA-dependent	nucleus	DNA binding			central_nervous_system(1)	1																		---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111779618	111779618	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111779618C>T	uc001tsa.1	+	21	3573	c.3420C>T	c.(3418-3420)ACC>ACT	p.T1140T		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1140						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
TBX3	6926	broad.mit.edu	37	12	115112506	115112506	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115112506C>T	uc001tvt.1	-	7	2198	c.1234G>A	c.(1234-1236)GTC>ATC	p.V412I	TBX3_uc001tvu.1_Missense_Mutation_p.V392I	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	412					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)														---	---	---	---
DHX37	57647	broad.mit.edu	37	12	125453092	125453092	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125453092T>A	uc001ugy.2	-	10	1495	c.1396A>T	c.(1396-1398)ATG>TTG	p.M466L		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	466	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129559097	129559097	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129559097T>C	uc009zyl.1	-	9	2951	c.2623A>G	c.(2623-2625)AAC>GAC	p.N875D	TMEM132D_uc001uia.2_Missense_Mutation_p.N413D	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	875	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
SACS	26278	broad.mit.edu	37	13	23914825	23914825	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914825G>A	uc001uon.2	-	10	3779	c.3190C>T	c.(3190-3192)CTC>TTC	p.L1064F	SACS_uc001uoo.2_Missense_Mutation_p.L917F|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1064					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35883675	35883675	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35883675A>C	uc001uvb.2	+	36	6055	c.5849A>C	c.(5848-5850)AAC>ACC	p.N1950T	NBEA_uc010abi.2_Missense_Mutation_p.N606T	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1950						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
MAB21L1	4081	broad.mit.edu	37	13	36049356	36049356	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049356A>C	uc001uvc.2	-	1	1477	c.920T>G	c.(919-921)CTT>CGT	p.L307R	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	307					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)														---	---	---	---
TRPC4	7223	broad.mit.edu	37	13	38357117	38357117	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357117G>T	uc001uws.2	-	2	589	c.354C>A	c.(352-354)CAC>CAA	p.H118Q	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.H118Q|TRPC4_uc010tey.1_Missense_Mutation_p.H118Q|TRPC4_uc010abw.2_Missense_Mutation_p.H118Q|TRPC4_uc010abx.2_Missense_Mutation_p.H118Q|TRPC4_uc010aby.2_Missense_Mutation_p.H118Q	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	118	ANK 3.|Cytoplasmic (Potential).|Multimerization domain (By similarity).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)														---	---	---	---
KCNRG	283518	broad.mit.edu	37	13	50589942	50589942	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50589942C>A	uc001vdu.2	+	1	553	c.313C>A	c.(313-315)CCA>ACA	p.P105T	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_Missense_Mutation_p.P105T|TRIM13_uc001vdp.1_3'UTR|TRIM13_uc001vdq.1_3'UTR|TRIM13_uc001vdr.1_3'UTR|TRIM13_uc001vds.1_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	105	BTB.					voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84453564	84453564	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84453564C>T	uc001vlk.2	-	1	2965	c.2079G>A	c.(2077-2079)TCG>TCA	p.S693S		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	693	Cytoplasmic (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84454971	84454971	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454971T>C	uc001vlk.2	-	1	1558	c.672A>G	c.(670-672)AAA>AAG	p.K224K		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	224	Extracellular (Potential).|LRRCT 1.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88329633	88329633	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329633T>C	uc001vln.2	+	2	2209	c.1990T>C	c.(1990-1992)TCT>CCT	p.S664P	SLITRK5_uc010tic.1_Missense_Mutation_p.S423P	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	664	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94679974	94679974	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94679974A>C	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
CLDN10	9071	broad.mit.edu	37	13	96230169	96230169	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96230169G>A	uc001vmh.2	+	5	649	c.588G>A	c.(586-588)GGG>GGA	p.G196G	CLDN10_uc001vmg.2_Silent_p.G194G|CLDN10_uc010tii.1_Silent_p.G175G|DZIP1_uc010afn.2_Intron	NM_006984	NP_008915	P78369	CLD10_HUMAN	claudin 10 isoform b	196	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)															---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110862540	110862540	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110862540A>C	uc001vqw.3	-	9	610	c.488T>G	c.(487-489)CTT>CGT	p.L163R	COL4A1_uc010agl.2_Missense_Mutation_p.L163R	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	163					angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
RNASE2	6036	broad.mit.edu	37	14	21424360	21424360	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21424360C>T	uc010aif.2	+	2	499	c.430C>T	c.(430-432)CGA>TGA	p.R144*	RNASE2_uc001vyl.1_Nonsense_Mutation_p.R144*	NM_002934	NP_002925	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver,	144					chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)														---	---	---	---
SUPT16H	11198	broad.mit.edu	37	14	21840058	21840058	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21840058G>A	uc001wao.2	-	3	644	c.305C>T	c.(304-306)GCC>GTC	p.A102V		NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	102					DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22974109	22974109	+	Intron	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22974109A>T	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wex.2_5'Flank|uc001wez.2_RNA|uc001wfa.2_5'Flank|uc010ajx.1_5'Flank|uc001wfb.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
COCH	1690	broad.mit.edu	37	14	31353795	31353795	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31353795T>C	uc001wqr.2	+	9	746	c.666T>C	c.(664-666)TTT>TTC	p.F222F	COCH_uc001wqp.2_Silent_p.F222F|COCH_uc001wqq.3_Silent_p.F222F|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.F29F	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	222	VWFA 1.				sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33292964	33292964	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292964A>C	uc001wrq.2	+	13	6115	c.5945A>C	c.(5944-5946)AAG>ACG	p.K1982T		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1982					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47600949	47600949	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47600949T>G	uc001wwj.3	-	5	882	c.686A>C	c.(685-687)AAG>ACG	p.K229T	MDGA2_uc001wwi.3_5'UTR|MDGA2_uc010ani.2_5'UTR	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	229	Ig-like 2.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
DAAM1	23002	broad.mit.edu	37	14	59806819	59806819	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59806819C>A	uc001xdz.1	+	17	2151	c.2026C>A	c.(2026-2028)CTG>ATG	p.L676M	DAAM1_uc001xea.1_Missense_Mutation_p.L666M	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	676	FH2.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)														---	---	---	---
ACTN1	87	broad.mit.edu	37	14	69347560	69347560	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69347560G>A	uc001xkl.2	-	17	2410	c.2100C>T	c.(2098-2100)ATC>ATT	p.I700I	ACTN1_uc001xkk.2_Silent_p.I296I|ACTN1_uc010ttb.1_Silent_p.I635I|ACTN1_uc001xkm.2_Silent_p.I700I|ACTN1_uc001xkn.2_Silent_p.I700I|ACTN1_uc010ttc.1_Silent_p.I285I	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	700	Spectrin 4.|Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79117610	79117610	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79117610A>T	uc001xun.2	+	3	534	c.43A>T	c.(43-45)AGT>TGT	p.S15C	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.S149C	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	388	Laminin G-like 2.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
FLRT2	23768	broad.mit.edu	37	14	86089542	86089542	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86089542T>G	uc001xvr.2	+	2	2451	c.1684T>G	c.(1684-1686)TTT>GTT	p.F562V	FLRT2_uc010atd.2_Missense_Mutation_p.F562V	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	562	Helical; (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)														---	---	---	---
SNRPN	6638	broad.mit.edu	37	15	25222131	25222131	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25222131T>G	uc001ywp.1	+	10	1265	c.375T>G	c.(373-375)GCT>GCG	p.A125A	SNRPN_uc001ywq.1_Silent_p.A125A|SNRPN_uc001ywr.1_Silent_p.A125A|SNRPN_uc001yws.1_Silent_p.A125A|SNRPN_uc001ywt.1_Silent_p.A125A|SNRPN_uc001ywv.1_Silent_p.A128A|SNRPN_uc001yww.1_Silent_p.A125A|SNRPN_uc001ywx.1_Silent_p.A125A|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	125					RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)										Prader-Willi_syndrome				---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27573949	27573949	+	Intron	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27573949G>T	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
LCMT2	9836	broad.mit.edu	37	15	43622516	43622516	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43622516C>T	uc001zrg.2	-	1	376	c.172G>A	c.(172-174)GTC>ATC	p.V58I	LCMT2_uc010udn.1_Intron|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	58					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)													---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45456025	45456025	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45456025G>A	uc001zus.1	+	34	4788	c.4442G>A	c.(4441-4443)CGG>CAG	p.R1481Q	DUOX1_uc001zut.1_Missense_Mutation_p.R1481Q|DUOX1_uc010bee.1_Missense_Mutation_p.R861Q	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor	1481	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)												OREG0023103	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48063668	48063668	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48063668C>A	uc010bek.2	+	19	3268	c.2908C>A	c.(2908-2910)CAG>AAG	p.Q970K	SEMA6D_uc001zvw.2_Missense_Mutation_p.Q908K|SEMA6D_uc001zvy.2_Missense_Mutation_p.Q970K|SEMA6D_uc001zvz.2_Missense_Mutation_p.Q914K|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.Q908K|SEMA6D_uc001zwc.2_Missense_Mutation_p.Q895K	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	970	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
SPPL2A	84888	broad.mit.edu	37	15	51017499	51017499	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51017499G>C	uc001zyv.2	-	12	1348	c.1168C>G	c.(1168-1170)CCA>GCA	p.P390A		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	390						integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54308071	54308071	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54308071A>C	uc002ack.2	+	1	2971	c.2971A>C	c.(2971-2973)ATC>CTC	p.I991L		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	991	Potential.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54919041	54919041	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54919041A>G	uc002ack.2	+	31	6375	c.6375A>G	c.(6373-6375)GAA>GAG	p.E2125E	UNC13C_uc002acm.2_Silent_p.E46E	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	2125	C2 2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
UACA	55075	broad.mit.edu	37	15	70959121	70959121	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70959121G>T	uc002asr.2	-	16	4006	c.3902C>A	c.(3901-3903)ACA>AAA	p.T1301K	UACA_uc010uke.1_Missense_Mutation_p.T1192K|UACA_uc002asq.2_Missense_Mutation_p.T1288K|UACA_uc010bin.1_Missense_Mutation_p.T1276K	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1301	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
TM6SF1	53346	broad.mit.edu	37	15	83790730	83790730	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83790730T>G	uc002bjp.2	+	5	565	c.456T>G	c.(454-456)GTT>GTG	p.V152V	TM6SF1_uc010bmq.2_Silent_p.V152V|TM6SF1_uc002bjq.2_Silent_p.V152V|TM6SF1_uc010bmr.2_Intron|TM6SF1_uc002bjr.2_Silent_p.V4V	NM_023003	NP_075379	Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1 isoform 1	152	Helical; (Potential).					integral to membrane				ovary(1)	1																		---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84324519	84324519	+	Silent	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84324519T>G	uc002bjz.3	+	2	230	c.6T>G	c.(4-6)GCT>GCG	p.A2A	ADAMTSL3_uc002bjy.1_Silent_p.A2A|ADAMTSL3_uc010bmt.1_Silent_p.A2A|ADAMTSL3_uc010bmu.1_Silent_p.A2A	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	2						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
C15orf32	145858	broad.mit.edu	37	15	93015606	93015606	+	Silent	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93015606A>G	uc002brc.1	+	1	700	c.228A>G	c.(226-228)CAA>CAG	p.Q76Q	C15orf32_uc010bod.1_RNA	NM_153040	NP_694585	Q32M92	CO032_HUMAN	hypothetical protein LOC145858	76										ovary(1)	1	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)															---	---	---	---
FAM169B	283777	broad.mit.edu	37	15	99023856	99023856	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99023856C>A	uc002buk.1	-	4	407	c.157G>T	c.(157-159)GTT>TTT	p.V53F		NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777	53											0																		---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99500432	99500432	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99500432G>A	uc002bul.2	+	21	3915	c.3865G>A	c.(3865-3867)GAG>AAG	p.E1289K	IGF1R_uc010bon.2_Missense_Mutation_p.E1288K	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	1289	Cytoplasmic (Potential).				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
MAPK8IP3	23162	broad.mit.edu	37	16	1797222	1797222	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1797222G>A	uc002cmk.2	+	6	1057	c.937G>A	c.(937-939)GAC>AAC	p.D313N	MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Missense_Mutation_p.D313N|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.D314N	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	313					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
ABCC6	368	broad.mit.edu	37	16	16263498	16263498	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16263498C>T	uc002den.3	-						ABCC6_uc010bvo.2_Intron	NM_001171	NP_001162			ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)														---	---	---	---
SMG1	23049	broad.mit.edu	37	16	18883676	18883676	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18883676C>T	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907			PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	26147518	26147518	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147518C>A	uc002dof.2	+	2	1712	c.1320C>A	c.(1318-1320)TAC>TAA	p.Y440*		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	440	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	26147533	26147533	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147533A>C	uc002dof.2	+	2	1727	c.1335A>C	c.(1333-1335)CAA>CAC	p.Q445H		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	445	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
SRCAP	10847	broad.mit.edu	37	16	30750720	30750720	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30750720C>T	uc002dze.1	+	34	9744	c.9359C>T	c.(9358-9360)ACC>ATC	p.T3120I	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.T2915I	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	3120					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)															---	---	---	---
GNAO1	2775	broad.mit.edu	37	16	56362638	56362638	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56362638C>T	uc002eit.3	+	4	1296	c.399C>T	c.(397-399)GGC>GGT	p.G133G	GNAO1_uc002eiu.3_Silent_p.G133G	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha	133					dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)																---	---	---	---
CCDC135	84229	broad.mit.edu	37	16	57735855	57735855	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57735855A>G	uc002emi.2	+	5	601	c.512A>G	c.(511-513)CAC>CGC	p.H171R	CCDC135_uc002emj.2_Missense_Mutation_p.H171R|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	171						cytoplasm				central_nervous_system(1)	1																		---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70698105	70698105	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70698105G>A	uc002ezj.2	-	15	1979	c.1719C>T	c.(1717-1719)ACC>ACT	p.T573T		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	573					filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76513436	76513436	+	Splice_Site	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76513436G>A	uc002feu.1	+	14	2267	c.1882_splice	c.e14+1	p.E628_splice	CNTNAP4_uc002fev.1_Splice_Site_p.E492_splice|CNTNAP4_uc010chb.1_Splice_Site_p.E555_splice|CNTNAP4_uc002fex.1_Splice_Site_p.E631_splice|CNTNAP4_uc002few.2_Splice_Site_p.E603_splice	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
CDYL2	124359	broad.mit.edu	37	16	80718652	80718652	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80718652C>A	uc002ffs.2	-	2	504	c.399G>T	c.(397-399)AAG>AAT	p.K133N		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	133						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
ZZEF1	23140	broad.mit.edu	37	17	3974169	3974169	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3974169G>A	uc002fxe.2	-	26	3948	c.3884C>T	c.(3883-3885)GCC>GTC	p.A1295V	ZZEF1_uc002fxj.1_5'UTR	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	1295							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578212G>A	uc002gim.2	-	6	831	c.637C>T	c.(637-639)CGA>TGA	p.R213*	TP53_uc002gig.1_Nonsense_Mutation_p.R213*|TP53_uc002gih.2_Nonsense_Mutation_p.R213*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R81*|TP53_uc010cng.1_Nonsense_Mutation_p.R81*|TP53_uc002gii.1_Nonsense_Mutation_p.R81*|TP53_uc010cnh.1_Nonsense_Mutation_p.R213*|TP53_uc010cni.1_Nonsense_Mutation_p.R213*|TP53_uc002gij.2_Nonsense_Mutation_p.R213*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R120*|TP53_uc002gio.2_Nonsense_Mutation_p.R81*|TP53_uc010vug.1_Nonsense_Mutation_p.R174*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R81*(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11726122	11726122	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11726122C>T	uc002gne.2	+	48	9085	c.9017C>T	c.(9016-9018)ACA>ATA	p.T3006I	DNAH9_uc010coo.2_Missense_Mutation_p.T2300I	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3006	AAA 4 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11775107	11775107	+	Intron	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11775107C>T	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21319086	21319086	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319086C>T	uc002gyv.1	+	3	1137	c.432C>T	c.(430-432)ATC>ATT	p.I144I		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	144	Selectivity filter (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
SLFN5	162394	broad.mit.edu	37	17	33592742	33592742	+	Silent	SNP	C	T	T	rs148974561		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33592742C>T	uc002hjf.3	+	5	2628	c.2511C>T	c.(2509-2511)ACC>ACT	p.T837T	SLFN5_uc010wcg.1_3'UTR	NM_144975	NP_659412	Q08AF3	SLFN5_HUMAN	schlafen family member 5	837					cell differentiation		ATP binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)														---	---	---	---
SRCIN1	80725	broad.mit.edu	37	17	36707421	36707421	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36707421G>A	uc002hqd.2	-	15	3157	c.2932C>T	c.(2932-2934)CGA>TGA	p.R978*	SRCIN1_uc002hqf.1_Nonsense_Mutation_p.R850*|SRCIN1_uc002hqe.2_Nonsense_Mutation_p.R832*	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	850	Pro-rich.			R -> K (in Ref. 6; AA sequence).	exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0																		---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37879658	37879658	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37879658G>A	uc002hso.2	+	17	2271	c.2033G>A	c.(2032-2034)CGG>CAG	p.R678Q	ERBB2_uc002hsm.2_Missense_Mutation_p.R648Q|ERBB2_uc010cwa.2_Missense_Mutation_p.R663Q|ERBB2_uc002hsp.2_Missense_Mutation_p.R481Q|ERBB2_uc010cwb.2_Missense_Mutation_p.R678Q|ERBB2_uc010wek.1_Missense_Mutation_p.R402Q	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	678	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			---	---	---	---
KRTAP9-9	81870	broad.mit.edu	37	17	39388788	39388788	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39388788C>A	uc010wfq.1	+	1	37	c.35C>A	c.(34-36)ACC>AAC	p.T12N		NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9	12						keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
KRT33A	3883	broad.mit.edu	37	17	39502714	39502714	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39502714C>G	uc002hwk.1	-	6	1120	c.1083G>C	c.(1081-1083)GAG>GAC	p.E361D		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	361	Coil 2.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
C17orf104	284071	broad.mit.edu	37	17	42744389	42744389	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42744389G>A	uc010czv.2	+	5	1110	c.1110G>A	c.(1108-1110)AAG>AAA	p.K370K	C17orf104_uc002igy.1_Silent_p.K204K|C17orf104_uc002igz.3_Silent_p.K204K|C17orf104_uc010wja.1_RNA|C17orf104_uc002iha.2_Silent_p.K204K	NM_001145080	NP_001138552	A2RUB1	CQ104_HUMAN	hypothetical protein LOC284071	370										central_nervous_system(1)	1																		---	---	---	---
STXBP4	252983	broad.mit.edu	37	17	53237236	53237236	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53237236G>T	uc002iuf.1	+	18	1833	c.1626G>T	c.(1624-1626)GAG>GAT	p.E542D	STXBP4_uc010dcd.1_Missense_Mutation_p.E520D	NM_178509	NP_848604	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	542						cytoplasm	calcium ion binding			ovary(1)	1																		---	---	---	---
COIL	8161	broad.mit.edu	37	17	55016467	55016467	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55016467A>T	uc002iuu.2	-	7	1727	c.1696T>A	c.(1696-1698)TCT>ACT	p.S566T		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	566						Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)																	---	---	---	---
RNF43	54894	broad.mit.edu	37	17	56438164	56438164	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56438164C>A	uc002iwf.2	-	6	2785	c.829G>T	c.(829-831)GAG>TAG	p.E277*	RNF43_uc010wnv.1_Nonsense_Mutation_p.E236*|RNF43_uc002iwh.3_Nonsense_Mutation_p.E277*|RNF43_uc002iwg.3_Nonsense_Mutation_p.E277*|RNF43_uc010dcw.2_Nonsense_Mutation_p.E150*	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	277	RING-type; atypical.|Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65683203	65683203	+	Intron	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65683203G>T	uc002jgc.2	+						PITPNC1_uc002jgb.2_Missense_Mutation_p.R235L	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
NOTUM	147111	broad.mit.edu	37	17	79914768	79914768	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79914768C>T	uc010wvg.1	-	7	1150	c.878G>A	c.(877-879)CGT>CAT	p.R293H		NM_178493	NP_848588	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog precursor	293						extracellular region	hydrolase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)															---	---	---	---
EPB41L3	23136	broad.mit.edu	37	18	5433533	5433533	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5433533C>A	uc002kmt.1	-	8	933	c.847G>T	c.(847-849)GAG>TAG	p.E283*	EPB41L3_uc010wzh.1_Nonsense_Mutation_p.E283*|EPB41L3_uc002kmu.1_Nonsense_Mutation_p.E283*|EPB41L3_uc010dkq.1_Nonsense_Mutation_p.E174*|EPB41L3_uc010dks.1_Nonsense_Mutation_p.E305*	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	283	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5																		---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	6977733	6977733	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6977733G>A	uc002knm.2	-	44	6432	c.6338C>T	c.(6337-6339)GCA>GTA	p.A2113V	LAMA1_uc010wzj.1_Missense_Mutation_p.A1589V	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2113	Domain II and I.|Potential.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PSMG2	56984	broad.mit.edu	37	18	12724536	12724536	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12724536T>G	uc002krk.2	+	6	663	c.620T>G	c.(619-621)TTT>TGT	p.F207C	PSMG2_uc002krg.2_Missense_Mutation_p.F176C|PSMG2_uc002krj.1_Missense_Mutation_p.F207C	NM_020232	NP_064617	Q969U7	PSMG2_HUMAN	proteasome (prosome, macropain) assembly	207					proteasome assembly	nucleus	protein binding				0																		---	---	---	---
C18orf8	29919	broad.mit.edu	37	18	21096377	21096377	+	Missense_Mutation	SNP	A	G	G	rs148477145		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21096377A>G	uc010xax.1	+	7	764	c.643A>G	c.(643-645)ATG>GTG	p.M215V	C18orf8_uc010xau.1_Missense_Mutation_p.M58V|C18orf8_uc010xav.1_Missense_Mutation_p.M167V|C18orf8_uc010xaw.1_Missense_Mutation_p.M58V|C18orf8_uc002kul.2_RNA	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1	215										ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)															OREG0024894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ST8SIA5	29906	broad.mit.edu	37	18	44266172	44266172	+	Silent	SNP	G	A	A	rs143784819		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44266172G>A	uc002lcj.1	-	5	1102	c.534C>T	c.(532-534)TGC>TGT	p.C178C	ST8SIA5_uc002lci.1_Silent_p.C25C|ST8SIA5_uc010xcy.1_Silent_p.C214C|ST8SIA5_uc010xcz.1_Silent_p.C147C	NM_013305	NP_037437	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide	178	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3																		---	---	---	---
SMAD4	4089	broad.mit.edu	37	18	48573594	48573594	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48573594G>C	uc010xdp.1	+	2	716	c.178G>C	c.(178-180)GCT>CCT	p.A60P	SMAD4_uc010xdo.1_RNA	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	60	MH1.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(5)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)										Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				---	---	---	---
MC4R	4160	broad.mit.edu	37	18	58039324	58039324	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58039324C>G	uc002lie.1	-	1	678	c.259G>C	c.(259-261)GCT>CCT	p.A87P		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	87	Helical; Name=2; (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)																---	---	---	---
CDH20	28316	broad.mit.edu	37	18	59221915	59221915	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59221915C>T	uc010dps.1	+	11	2405	c.2393C>T	c.(2392-2394)GCG>GTG	p.A798V	CDH20_uc002lif.2_Missense_Mutation_p.A792V	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	798	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)																---	---	---	---
CDH7	1005	broad.mit.edu	37	18	63489412	63489412	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63489412G>T	uc002ljz.2	+	5	1046	c.721G>T	c.(721-723)GGA>TGA	p.G241*	CDH7_uc002lka.2_Nonsense_Mutation_p.G241*|CDH7_uc002lkb.2_Nonsense_Mutation_p.G241*	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	241	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)																---	---	---	---
POLRMT	5442	broad.mit.edu	37	19	629604	629604	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:629604C>T	uc002lpf.1	-	3	814	c.758G>A	c.(757-759)CGG>CAG	p.R253Q		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	253					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GIPC3	126326	broad.mit.edu	37	19	3589487	3589487	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3589487G>A	uc002lyd.3	+	4	666	c.639G>A	c.(637-639)GCG>GCA	p.A213A		NM_133261	NP_573568	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	213										breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8162226	8162226	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8162226C>T	uc002mjf.2	-	41	5255	c.5234G>A	c.(5233-5235)CGC>CAC	p.R1745H		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1745	EGF-like 26; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11																		---	---	---	---
ANGPTL4	51129	broad.mit.edu	37	19	8430901	8430901	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8430901C>T	uc002mjq.1	+	2	577	c.382C>T	c.(382-384)CGG>TGG	p.R128W	ANGPTL4_uc002mjr.1_Missense_Mutation_p.R128W|ANGPTL4_uc010xkc.1_5'UTR	NM_139314	NP_647475	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4 protein isoform a precursor	128	Potential.				angiogenesis|cell differentiation|cellular lipid metabolic process|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|positive regulation of angiogenesis|response to hypoxia|signal transduction|triglyceride homeostasis	extracellular space|proteinaceous extracellular matrix	enzyme inhibitor activity|receptor binding			ovary(1)	1																		---	---	---	---
ZNF69	7620	broad.mit.edu	37	19	12014521	12014521	+	Intron	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12014521A>C	uc002mst.3	+							NM_021915	NP_068734			zinc finger protein 69							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				Lung(535;0.011)														---	---	---	---
ZNF93	81931	broad.mit.edu	37	19	20044880	20044880	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20044880A>C	uc002non.2	+	4	1227	c.1116A>C	c.(1114-1116)GAA>GAC	p.E372D		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	372	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1																		---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22156673	22156673	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156673T>C	uc002nqp.2	-	4	1312	c.1163A>G	c.(1162-1164)AAG>AGG	p.K388R	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22157209	22157209	+	Silent	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157209A>C	uc002nqp.2	-	4	776	c.627T>G	c.(625-627)GCT>GCG	p.A209A	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF492	57615	broad.mit.edu	37	19	22836737	22836737	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22836737A>C	uc002nqw.3	+	3	294	c.50A>C	c.(49-51)AAG>ACG	p.K17T		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)																---	---	---	---
ZNF302	55900	broad.mit.edu	37	19	35174131	35174131	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35174131A>T	uc002nvr.1	+	5	597	c.334A>T	c.(334-336)AAA>TAA	p.K112*	ZNF302_uc010xrz.1_Nonsense_Mutation_p.K69*|ZNF302_uc002nvp.1_Nonsense_Mutation_p.K68*|ZNF302_uc002nvq.1_Nonsense_Mutation_p.K68*|ZNF302_uc002nvs.1_Nonsense_Mutation_p.K68*	NM_018443	NP_060913	Q9NR11	ZN302_HUMAN	zinc finger protein 302	Error:Variant_position_missing_in_Q9NR11_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)															---	---	---	---
ZNF568	374900	broad.mit.edu	37	19	37413699	37413699	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37413699C>A	uc002ofc.2	+	3	542	c.27C>A	c.(25-27)AGC>AGA	p.S9R	ZNF568_uc010efg.2_5'UTR|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Intron|ZNF568_uc010efe.2_Intron|ZNF568_uc010eff.1_5'UTR	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	9					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38980888	38980888	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38980888G>A	uc002oit.2	+	36	6117	c.5987G>A	c.(5986-5988)CGC>CAC	p.R1996H	RYR1_uc002oiu.2_Missense_Mutation_p.R1996H	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1996	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
CD33	945	broad.mit.edu	37	19	51742916	51742916	+	Silent	SNP	C	T	T	rs61736476	byFrequency;by1000genomes	TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51742916C>T	uc002pwa.2	+	7	1108	c.1068C>T	c.(1066-1068)ACC>ACT	p.T356T	CD33_uc010eos.1_3'UTR|CD33_uc010eot.1_Silent_p.T229T|CD33_uc010eou.1_RNA	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	356	ITIM motif 2.|Cytoplasmic (Potential).				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)													---	---	---	---
ZNF83	55769	broad.mit.edu	37	19	53116874	53116874	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53116874T>G	uc002pzu.3	-	2	2188	c.944A>C	c.(943-945)AAA>ACA	p.K315T	ZNF83_uc002pzv.3_Missense_Mutation_p.K315T|ZNF83_uc010eps.2_Missense_Mutation_p.K287T|ZNF83_uc010ept.2_Missense_Mutation_p.K315T|ZNF83_uc010epu.2_Missense_Mutation_p.K315T|ZNF83_uc010epv.2_Missense_Mutation_p.K315T|ZNF83_uc010epw.2_Missense_Mutation_p.K315T|ZNF83_uc010epx.2_Missense_Mutation_p.K287T|ZNF83_uc010epy.2_Missense_Mutation_p.K315T|ZNF83_uc010epz.2_Missense_Mutation_p.K287T	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	315						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)														---	---	---	---
ZNF611	81856	broad.mit.edu	37	19	53208189	53208189	+	3'UTR	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53208189T>C	uc002pzz.2	-	7					ZNF611_uc010eqc.2_3'UTR|ZNF611_uc010ydo.1_3'UTR|ZNF611_uc010ydr.1_3'UTR|ZNF611_uc010ydp.1_3'UTR|ZNF611_uc010ydq.1_3'UTR|ZNF611_uc002qaa.3_3'UTR	NM_030972	NP_112234			zinc finger protein 611 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)														---	---	---	---
LILRB3	11025	broad.mit.edu	37	19	54746095	54746095	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54746095C>T	uc010erh.1	-	3	286	c.162G>A	c.(160-162)GAG>GAA	p.E54E	LILRA6_uc002qew.1_Silent_p.E54E|LILRB3_uc002qeh.1_Silent_p.E54E|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Silent_p.E54E|LILRA6_uc002qek.1_Silent_p.E54E|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Silent_p.E54E|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Silent_p.E54E|LILRB3_uc002qep.1_Silent_p.E54E|LILRB3_uc002qeq.1_Silent_p.E54E|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Silent_p.E54E|LILRA6_uc010yep.1_Silent_p.E54E|LILRA6_uc010yeq.1_Silent_p.E54E|LILRA6_uc002qet.3_RNA|LILRA6_uc002qeu.1_Silent_p.E54E|LILRA6_uc002qev.1_5'Flank	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	54	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
LILRB4	11006	broad.mit.edu	37	19	55175267	55175267	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55175267G>A	uc002qgp.2	+	3	488	c.126G>A	c.(124-126)GGG>GGA	p.G42G	LILRB4_uc002qgo.1_Silent_p.G83G|LILRB4_uc002qgq.2_Silent_p.G42G|LILRB4_uc010ers.1_5'UTR|LILRB4_uc002qgr.2_Silent_p.G83G|LILRB4_uc010ert.2_Silent_p.G83G|LILRB4_uc010eru.2_Silent_p.G71G	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	42	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)														---	---	---	---
NLRP9	338321	broad.mit.edu	37	19	56244335	56244335	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56244335G>A	uc002qly.2	-	2	890	c.862C>T	c.(862-864)CGG>TGG	p.R288W		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	288	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)														---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57328918	57328918	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328918A>T	uc002qnu.2	-	7	1243	c.892T>A	c.(892-894)TCA>ACA	p.S298T	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.S269T|PEG3_uc002qnv.2_Missense_Mutation_p.S298T|PEG3_uc002qnw.2_Missense_Mutation_p.S174T|PEG3_uc002qnx.2_Missense_Mutation_p.S172T|PEG3_uc010etr.2_Missense_Mutation_p.S298T	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	298					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57335020	57335020	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57335020T>G	uc002qnu.2	-	2	773	c.422A>C	c.(421-423)GAC>GCC	p.D141A	ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnr.2_Missense_Mutation_p.D15A|ZIM2_uc002qnq.2_Missense_Mutation_p.D15A|ZIM2_uc010etp.2_Missense_Mutation_p.D15A|ZIM2_uc010ygs.1_Missense_Mutation_p.D15A|PEG3_uc002qnt.2_Missense_Mutation_p.D141A|PEG3_uc002qnv.2_Missense_Mutation_p.D141A|PEG3_uc002qnw.2_Missense_Mutation_p.D15A|PEG3_uc002qnx.2_Missense_Mutation_p.D15A|PEG3_uc010etr.2_Missense_Mutation_p.D141A	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	141					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
ZNF551	90233	broad.mit.edu	37	19	58198842	58198842	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58198842T>G	uc002qpw.3	+	3	1374	c.1151T>G	c.(1150-1152)TTT>TGT	p.F384C	ZNF551_uc002qpv.3_Missense_Mutation_p.F327C|ZNF776_uc002qpx.2_Intron	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN	zinc finger protein 551	400	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
SSTR4	6754	broad.mit.edu	37	20	23016664	23016664	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23016664G>A	uc002wsr.2	+	1	608	c.544G>A	c.(544-546)GCC>ACC	p.A182T		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	182	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)																	---	---	---	---
SUN5	140732	broad.mit.edu	37	20	31577434	31577434	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31577434T>G	uc002wyi.2	-	9	698	c.605A>C	c.(604-606)AAG>ACG	p.K202T		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	202					spermatogenesis					skin(1)	1																		---	---	---	---
CEP250	11190	broad.mit.edu	37	20	34090802	34090802	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34090802C>A	uc002xcm.2	+	31	5276	c.4605C>A	c.(4603-4605)GAC>GAA	p.D1535E	CEP250_uc010zve.1_Missense_Mutation_p.D903E	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	1535	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)															---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11098719	11098719	+	5'UTR	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098719T>G	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22782648	22782648	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22782648C>T	uc002yld.1	+	10	1499	c.1250C>T	c.(1249-1251)CCT>CTT	p.P417L	NCAM2_uc011acb.1_Missense_Mutation_p.P275L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	417	Ig-like C2-type 5.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
APP	351	broad.mit.edu	37	21	27347535	27347535	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27347535G>A	uc002ylz.2	-	11	1506	c.1306C>T	c.(1306-1308)CAG>TAG	p.Q436*	APP_uc010glk.2_Nonsense_Mutation_p.Q412*|APP_uc002yma.2_Nonsense_Mutation_p.Q417*|APP_uc011ach.1_Nonsense_Mutation_p.Q380*|APP_uc002ymb.2_Nonsense_Mutation_p.Q361*|APP_uc010glj.2_Nonsense_Mutation_p.Q305*|APP_uc011aci.1_Nonsense_Mutation_p.Q326*	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor	436	Extracellular (Potential).				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)																---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32526634	32526634	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32526634T>G	uc002yow.1	-	18	3574	c.3102A>C	c.(3100-3102)CAA>CAC	p.Q1034H	TIAM1_uc011adk.1_Missense_Mutation_p.Q1034H|TIAM1_uc011adl.1_Missense_Mutation_p.Q974H	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1034					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47754527	47754527	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47754527A>G	uc002zji.3	+	3	591	c.484A>G	c.(484-486)AGT>GGT	p.S162G	PCNT_uc002zjj.2_Missense_Mutation_p.S44G|PCNT_uc010gqk.1_RNA	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	162					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
CECR5	27440	broad.mit.edu	37	22	17622071	17622071	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17622071G>A	uc002zmf.2	-	6	652	c.624C>T	c.(622-624)ATC>ATT	p.I208I	CECR5_uc002zmd.2_Silent_p.I19I|CECR5_uc002zme.2_5'UTR|CECR5_uc002zmg.2_Silent_p.I71I|CECR5_uc002zmh.2_Silent_p.I178I	NM_033070	NP_149061	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	208							hydrolase activity				0		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)																---	---	---	---
AIFM3	150209	broad.mit.edu	37	22	21327698	21327698	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21327698C>T	uc002ztj.2	+	3	352	c.134C>T	c.(133-135)ACG>ATG	p.T45M	AIFM3_uc002ztk.2_Missense_Mutation_p.T45M|AIFM3_uc002ztl.2_Missense_Mutation_p.T51M|AIFM3_uc011ahx.1_Missense_Mutation_p.R70W|AIFM3_uc002ztm.1_5'Flank	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	45					activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)															---	---	---	---
SUSD2	56241	broad.mit.edu	37	22	24581668	24581668	+	Silent	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24581668G>A	uc002zzn.1	+	8	1154	c.1110G>A	c.(1108-1110)GCG>GCA	p.A370A		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	370	AMOP.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
CRYBB2	1415	broad.mit.edu	37	22	25627692	25627692	+	Missense_Mutation	SNP	C	T	T	rs148209404		TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25627692C>T	uc003abp.1	+	6	619	c.571C>T	c.(571-573)CGC>TGC	p.R191C		NM_000496	NP_000487	P43320	CRBB2_HUMAN	crystallin, beta B2	191	Beta/gamma crystallin 'Greek key' 4.				response to stimulus|visual perception		structural constituent of eye lens				0																		---	---	---	---
CCDC157	550631	broad.mit.edu	37	22	30766792	30766792	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30766792G>T	uc011aku.1	+	5	1558	c.898G>T	c.(898-900)GCT>TCT	p.A300S	CCDC157_uc011akv.1_Missense_Mutation_p.A300S	NM_001017437	NP_001017437	Q569K6	CC157_HUMAN	coiled-coil domain containing 157	300	Potential.									central_nervous_system(1)	1																		---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	40055011	40055011	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40055011A>C	uc003ayc.2	+	12	2220	c.2220A>C	c.(2218-2220)AAA>AAC	p.K740N	CACNA1I_uc003ayd.2_Missense_Mutation_p.K705N|CACNA1I_uc003aye.2_Missense_Mutation_p.K655N|CACNA1I_uc003ayf.2_Missense_Mutation_p.K620N	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	740	Helical; Name=S4 of repeat II; (Potential).|II.				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
FAM48B1	100130302	broad.mit.edu	37	X	24382955	24382955	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24382955C>G	uc011mjx.1	+	1	2078	c.2078C>G	c.(2077-2079)TCG>TGG	p.S693W		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1																		---	---	---	---
MAGEB18	286514	broad.mit.edu	37	X	26157683	26157683	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26157683T>A	uc004dbq.1	+	2	768	c.581T>A	c.(580-582)ATT>AAT	p.I194N		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	194	MAGE.						protein binding			central_nervous_system(1)	1																		---	---	---	---
FOXR2	139628	broad.mit.edu	37	X	55650731	55650731	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55650731A>C	uc004duo.2	+	1	899	c.587A>C	c.(586-588)AAT>ACT	p.N196T		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	196	Fork-head.				embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3																		---	---	---	---
FAAH2	158584	broad.mit.edu	37	X	57367776	57367776	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57367776G>C	uc004dvc.2	+	5	844	c.695G>C	c.(694-696)CGA>CCA	p.R232P		NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	232						integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3															HNSCC(52;0.14)			---	---	---	---
ZCCHC5	203430	broad.mit.edu	37	X	77913151	77913151	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77913151A>C	uc004edc.1	-	2	1063	c.767T>G	c.(766-768)GTT>GGT	p.V256G		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	256							nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZCCHC5	203430	broad.mit.edu	37	X	77913452	77913452	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77913452A>C	uc004edc.1	-	2	762	c.466T>G	c.(466-468)TCA>GCA	p.S156A		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	156	Pro-rich.						nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DACH2	117154	broad.mit.edu	37	X	86087115	86087115	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86087115A>C	uc004eew.2	+	12	1927	c.1757A>C	c.(1756-1758)AAC>ACC	p.N586T	DACH2_uc004eex.2_3'UTR|DACH2_uc010nmq.2_Missense_Mutation_p.N452T|DACH2_uc011mra.1_Missense_Mutation_p.N419T|DACH2_uc010nmr.2_Missense_Mutation_p.N367T	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	586					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5																		---	---	---	---
CSTF2	1478	broad.mit.edu	37	X	100078953	100078953	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100078953G>C	uc004egh.2	+	5	581	c.523G>C	c.(523-525)GCA>CCA	p.A175P	CSTF2_uc010nnd.2_Missense_Mutation_p.A175P|CSTF2_uc004egi.2_Missense_Mutation_p.A175P	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	175	Interactions with CSTF3 and SYMPK.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding			skin(1)	1																		---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	104512217	104512217	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104512217A>C	uc004elz.1	+	5	1446	c.690A>C	c.(688-690)AAA>AAC	p.K230N		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	230	Ig-like C2-type 2.|Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
NRK	203447	broad.mit.edu	37	X	105153087	105153087	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153087T>G	uc004emd.2	+	13	1757	c.1454T>G	c.(1453-1455)GTT>GGT	p.V485G	NRK_uc010npc.1_Missense_Mutation_p.V153G	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	485	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14															HNSCC(51;0.14)			---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130412103	130412103	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130412103G>A	uc004ewd.2	-	13	2285	c.2047C>T	c.(2047-2049)CTC>TTC	p.L683F	IGSF1_uc004ewe.3_Missense_Mutation_p.L677F|IGSF1_uc004ewf.2_Missense_Mutation_p.L663F	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	683	Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135427962	135427962	+	Silent	SNP	T	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135427962T>C	uc004ezu.1	+	6	2388	c.2097T>C	c.(2095-2097)ACT>ACC	p.T699T	GPR112_uc010nsb.1_Silent_p.T494T|GPR112_uc010nsc.1_Silent_p.T466T	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	699	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
SPANXN1	494118	broad.mit.edu	37	X	144337215	144337215	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337215T>G	uc004fcb.2	+	2	100	c.100T>G	c.(100-102)TTA>GTA	p.L34V		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	34											0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
SLITRK2	84631	broad.mit.edu	37	X	144905446	144905446	+	Silent	SNP	G	C	C			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144905446G>C	uc004fcd.2	+	5	2493	c.1503G>C	c.(1501-1503)CTG>CTC	p.L501L	SLITRK2_uc010nsp.2_Silent_p.L501L|SLITRK2_uc010nso.2_Silent_p.L501L|SLITRK2_uc011mwq.1_Silent_p.L501L|SLITRK2_uc011mwr.1_Silent_p.L501L|SLITRK2_uc011mws.1_Silent_p.L501L|SLITRK2_uc004fcg.2_Silent_p.L501L|SLITRK2_uc011mwt.1_Silent_p.L501L	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	501	Extracellular (Potential).|LRR 12.					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
AFF2	2334	broad.mit.edu	37	X	147967480	147967480	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147967480T>G	uc004fcp.2	+	8	1803	c.1324T>G	c.(1324-1326)TTG>GTG	p.L442V	AFF2_uc004fco.2_Missense_Mutation_p.L403V|AFF2_uc004fcq.2_Missense_Mutation_p.L432V|AFF2_uc004fcr.2_Missense_Mutation_p.L403V|AFF2_uc011mxb.1_Missense_Mutation_p.L407V|AFF2_uc004fcs.2_Missense_Mutation_p.L409V|AFF2_uc011mxc.1_Missense_Mutation_p.L83V	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	442					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
ATP2B3	492	broad.mit.edu	37	X	152807854	152807854	+	Silent	SNP	C	T	T			TCGA-CG-4469-01	TCGA-CG-4469-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152807854C>T	uc004fht.1	+	4	864	c.738C>T	c.(736-738)GGC>GGT	p.G246G	ATP2B3_uc004fhs.1_Silent_p.G246G	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	246	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
