Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
RAB3B	5865	broad.mit.edu	37	1	52446102	52446102	+	Intron	DEL	A	-	-	rs80211476		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52446102delA	uc001cth.2	-							NM_002867	NP_002858			RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62443869	62443872	+	Intron	DEL	CTTC	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62443869_62443872delCTTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145368208	145368213	+	Intron	DEL	TCTCTG	-	-	rs72354261		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145368208_145368213delTCTCTG	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792			hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	146227920	146227920	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146227920delA	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
DAP3	7818	broad.mit.edu	37	1	155697259	155697260	+	Intron	INS	-	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155697259_155697260insA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506			death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)																	---	---	---	---
CAMSAP1L1	23271	broad.mit.edu	37	1	200816520	200816521	+	Intron	DEL	TG	-	-	rs2172666		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200816520_200816521delTG	uc001gvl.2	+						CAMSAP1L1_uc001gvk.2_Intron|CAMSAP1L1_uc001gvm.2_Intron	NM_203459	NP_982284			calmodulin regulated spectrin-associated protein							cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4																		---	---	---	---
NENF	29937	broad.mit.edu	37	1	212617892	212617911	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTA	-	-	rs57220444		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212617892_212617911delTGTGTGTGTGTGTGTGTGTA	uc001hjd.2	+						NENF_uc010ptf.1_Intron	NM_013349	NP_037481			neuron derived neurotrophic factor precursor							extracellular space	heme binding				0				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)														---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236645415	236645415	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236645415delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11776864	11776869	+	Intron	DEL	GGGCAT	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11776864_11776869delGGGCAT	uc002rbk.1	+						GREB1_uc002rbp.1_Intron	NM_014668	NP_055483			growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11776918	11776923	+	Intron	DEL	GGGCAG	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11776918_11776923delGGGCAG	uc002rbk.1	+						GREB1_uc002rbp.1_Intron	NM_014668	NP_055483			growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
NTSR2	23620	broad.mit.edu	37	2	11802573	11802574	+	Intron	INS	-	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11802573_11802574insA	uc002rbq.3	-							NM_012344	NP_036476			neurotensin receptor 2						sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)													---	---	---	---
MATN3	4148	broad.mit.edu	37	2	20201952	20201953	+	Intron	INS	-	AGAG	AGAG	rs147407955	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20201952_20201953insAGAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372			matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
SAP130	79595	broad.mit.edu	37	2	128751055	128751055	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128751055delA	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron|SAP130_uc002tpq.1_Intron	NM_024545	NP_078821			Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	131590960	131590964	+	Intron	DEL	GAAAG	-	-	rs62162115		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131590960_131590964delGAAAG	uc002trx.1	-											Homo sapiens cDNA FLJ33681 fis, clone BRAWH2002549.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239667253	239667260	+	IGR	DEL	CTTCCTTC	-	-	rs71043164		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239667253_239667260delCTTCCTTC								ASB1 (306363 upstream) : TWIST2 (89413 downstream)																																			---	---	---	---
RAF1	5894	broad.mit.edu	37	3	12629337	12629337	+	Intron	DEL	T	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12629337delT	uc003bxf.3	-						RAF1_uc011aut.1_Intron|RAF1_uc011auu.1_Intron	NM_002880	NP_002871			v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				---	---	---	---
KPNA1	3836	broad.mit.edu	37	3	122171392	122171395	+	Intron	DEL	GGAG	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122171392_122171395delGGAG	uc003efd.1	-						KPNA1_uc003efb.1_Intron|KPNA1_uc003efc.1_Intron|KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255			karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)														---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183669933	183669934	+	Intron	DEL	TT	-	-	rs34905378		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183669933_183669934delTT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679			ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ST6GAL1	6480	broad.mit.edu	37	3	186704988	186704989	+	Intron	INS	-	AAGGA	AAGGA	rs144465329	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186704988_186704989insAAGGA	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323			ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	76010133	76010136	+	IGR	DEL	AGGG	-	-	rs9991977		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76010133_76010136delAGGG								PARM1 (34810 upstream) : RCHY1 (394219 downstream)																																			---	---	---	---
GAB1	2549	broad.mit.edu	37	4	144381841	144381841	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144381841delA	uc003ije.2	+						GAB1_uc003ijd.2_Intron|GAB1_uc011chq.1_Intron	NM_002039	NP_002030			GRB2-associated binding protein 1 isoform b						cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)																	---	---	---	---
TCERG1	10915	broad.mit.edu	37	5	145889882	145889882	+	Intron	DEL	A	-	-	rs67804115		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145889882delA	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697			transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	15710418	15710419	+	IGR	INS	-	TTCC	TTCC	rs148203937	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15710418_15710419insTTCC								DTNBP1 (47147 upstream) : MYLIP (418898 downstream)																																			---	---	---	---
TRAF3IP2	10758	broad.mit.edu	37	6	111884048	111884048	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111884048delA	uc011ebc.1	-						TRAF3IP2_uc011ebb.1_Intron|TRAF3IP2_uc003pvd.2_Intron|TRAF3IP2_uc003pvg.2_Intron|TRAF3IP2_uc003pvf.2_Intron	NM_147686	NP_679211			TRAF3 interacting protein 2 isoform 2						intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)														---	---	---	---
SCIN	85477	broad.mit.edu	37	7	12669023	12669024	+	Intron	INS	-	CA	CA	rs147409814	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12669023_12669024insCA	uc003ssn.3	+						SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Intron	NM_001112706	NP_001106177			scinderin isoform 1						actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)														---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90742138	90742139	+	Intron	DEL	GT	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90742138_90742139delGT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
ZNF394	84124	broad.mit.edu	37	7	99097022	99097022	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097022delA	uc003uqs.2	-						ZNF394_uc003uqt.2_Intron|ZNF394_uc003uqu.1_Intron	NM_032164	NP_115540			zinc finger protein 394						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)																	---	---	---	---
IFRD1	3475	broad.mit.edu	37	7	112113100	112113123	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTGTGTA	-	-	rs141635606	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112113100_112113123delTGTGTGTGTGTGTGTGTGTGTGTA	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron|IFRD1_uc003vgj.2_Intron|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Intron|IFRD1_uc003vgk.2_Intron	NM_001007245	NP_001007246			interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	144493134	144493136	+	IGR	DEL	GTC	-	-	rs62521862		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144493134_144493136delGTC								RHPN1 (26745 upstream) : MAFA (18379 downstream)																																			---	---	---	---
NCS1	23413	broad.mit.edu	37	9	132985262	132985262	+	Intron	DEL	C	-	-	rs34826568		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985262delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101			frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0																		---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136657133	136657134	+	Intron	INS	-	CA	CA			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136657133_136657134insCA	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_5'Flank	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
LHX3	8022	broad.mit.edu	37	9	139090465	139090466	+	Intron	INS	-	C	C	rs147905773	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139090465_139090466insC	uc004cha.2	-						LHX3_uc004cgz.2_Intron	NM_178138	NP_835258			LIM homeobox protein 3 isoform a						inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	37691031	37691032	+	IGR	INS	-	CCTT	CCTT			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37691031_37691032insCCTT								ANKRD30A (169536 upstream) : ZNF248 (399415 downstream)																																			---	---	---	---
LOC100133308	100133308	broad.mit.edu	37	10	45604736	45604737	+	5'Flank	INS	-	A	A	rs35266791		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45604736_45604737insA	uc001jby.2	-						LOC100133308_uc001jbz.2_Intron|LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0																		---	---	---	---
PIK3AP1	118788	broad.mit.edu	37	10	98357029	98357036	+	Intron	DEL	TTCCTTCC	-	-	rs140576354	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98357029_98357036delTTCCTTCC	uc001kmq.2	-						PIK3AP1_uc001kmo.2_Intron|PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522			phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)														---	---	---	---
C10orf137	26098	broad.mit.edu	37	10	127437816	127437817	+	Intron	INS	-	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127437816_127437817insA	uc001liq.1	+						C10orf137_uc001lio.1_Intron|C10orf137_uc001lip.1_Intron|C10orf137_uc001lis.1_Intron|C10orf137_uc001lit.1_5'Flank	NM_015608	NP_056423			erythroid differentiation-related factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	59066135	59066136	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs36130299		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066135_59066136insGGAAGGAA								MPEG1 (85641 upstream) : OR5AN1 (65796 downstream)																																			---	---	---	---
CTSC	1075	broad.mit.edu	37	11	88034008	88034011	+	Intron	DEL	TTTC	-	-	rs3832753		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88034008_88034011delTTTC	uc001pck.3	-						CTSC_uc001pcl.3_Intron	NM_001814	NP_001805			cathepsin C isoform a preproprotein						immune response	lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	115497786	115497786	+	IGR	DEL	T	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115497786delT								CADM1 (122545 upstream) : None (None downstream)																																			---	---	---	---
C12orf63	374467	broad.mit.edu	37	12	97073169	97073170	+	Intron	INS	-	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97073169_97073170insT	uc001tet.1	+							NM_198520	NP_940922			hypothetical protein LOC374467											skin(6)|ovary(1)	7																		---	---	---	---
COG6	57511	broad.mit.edu	37	13	40325365	40325365	+	3'UTR	DEL	T	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40325365delT	uc001uxh.2	+	19					COG6_uc001uxi.2_3'UTR|COG6_uc010acb.2_Intron	NM_020751	NP_065802			component of oligomeric golgi complex 6 isoform						protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)														---	---	---	---
RNASEH2B	79621	broad.mit.edu	37	13	51530586	51530587	+	Frame_Shift_Ins	INS	-	A	A	rs112937854		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51530586_51530587insA	uc001vfa.3	+	11	1236_1237	c.915_916insA	c.(913-918)AATAAAfs	p.N305fs	RNASEH2B_uc001vfb.3_Intron	NM_024570	NP_078846	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B isoform 1	305_306					RNA catabolic process	nucleus|ribonuclease H2 complex					0		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)														---	---	---	---
TDRD3	81550	broad.mit.edu	37	13	61141478	61141479	+	Intron	INS	-	TTTTC	TTTTC	rs141427579	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61141478_61141479insTTTTC	uc001via.2	+						TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421			tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21902060	21902061	+	Intron	INS	-	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21902060_21902061insA	uc002djs.3	-						uc010vbo.1_Intron|uc002dju.1_5'Flank					Homo sapiens cDNA FLJ45371 fis, clone BRHIP3017855, highly  similar to Homo sapiens nuclear pore complex interacting protein (NPIP).																														---	---	---	---
NLRC5	84166	broad.mit.edu	37	16	57073467	57073468	+	Intron	INS	-	T	T	rs148574042	by1000genomes	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57073467_57073468insT	uc002ekk.1	+						NLRC5_uc010ccq.1_Intron|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Intron|NLRC5_uc002ekm.2_Intron|NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_5'Flank|NLRC5_uc002ekp.1_5'Flank	NM_032206	NP_115582			nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	60214848	60214855	+	IGR	DEL	TTCCGTCT	-	-	rs71979129		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60214848_60214855delTTCCGTCT								None (None upstream) : None (None downstream)																																			---	---	---	---
PDPR	55066	broad.mit.edu	37	16	70176004	70176004	+	Intron	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70176004delA	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron	NM_017990	NP_060460			pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)														---	---	---	---
FAM18B2	201158	broad.mit.edu	37	17	15468766	15468766	+	5'Flank	DEL	A	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15468766delA	uc002goq.2	-						CDRT4_uc010vvw.1_5'Flank|FAM18B2_uc010vvx.1_5'Flank|FAM18B2_uc010cor.2_5'Flank	NM_145301	NP_660344			hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)														---	---	---	---
RAD51L3	5892	broad.mit.edu	37	17	33442946	33442947	+	Intron	INS	-	A	A	rs66668059		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33442946_33442947insA	uc002hir.2	-						RFFL_uc002hiq.2_Intron|RAD51L3_uc010wcd.1_Intron|RAD51L3_uc002his.2_Intron|RAD51L3_uc010ctk.2_Intron|RAD51L3_uc010wce.1_Intron|RAD51L3_uc002hit.2_Intron|RAD51L3_uc002hiu.2_Intron|RAD51L3_uc010wcf.1_Intron|RAD51L3_uc002hiw.1_Intron|RAD51L3_uc002hiv.1_Intron|RAD51L3_uc010ctl.1_Intron|RAD51L3_uc010ctm.1_Intron	NM_002878	NP_002869			RAD51-like 3 isoform 1						DNA repair|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)									Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501			ankyrin repeat domain 30B											ovary(1)|skin(1)	2																		---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67068606	67068606	+	Intron	DEL	G	-	-	rs34997416		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67068606delG	uc002lkl.2	+							NM_152721	NP_689934			docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	41157488	41157491	+	IGR	DEL	GGAA	-	-			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41157488_41157491delGGAA								LTBP4 (21763 upstream) : NUMBL (14323 downstream)																																			---	---	---	---
STAU1	6780	broad.mit.edu	37	20	47782357	47782358	+	Intron	DEL	CT	-	-	rs72593076		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47782357_47782358delCT	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347			staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	22	16915280	16915281	+	IGR	INS	-	TT	TT	rs148711386		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16915280_16915281insTT								OR11H1 (465476 upstream) : CCT8L2 (156367 downstream)																																			---	---	---	---
SFI1	9814	broad.mit.edu	37	22	31971048	31971049	+	Intron	INS	-	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31971048_31971049insA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468			spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13463955	13463956	+	IGR	INS	-	GCCA	GCCA			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13463955_13463956insGCCA								None (None upstream) : None (None downstream)																																			---	---	---	---
LRRC47	57470	broad.mit.edu	37	1	3701670	3701670	+	Missense_Mutation	SNP	C	T	T	rs139681433		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3701670C>T	uc001akx.1	-	3	1203	c.1175G>A	c.(1174-1176)CGG>CAG	p.R392Q		NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	392					translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)														---	---	---	---
MFN2	9927	broad.mit.edu	37	1	12062117	12062117	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12062117C>T	uc001atn.3	+	11	1570	c.1117C>T	c.(1117-1119)CGA>TGA	p.R373*	MFN2_uc009vni.2_Nonsense_Mutation_p.R373*	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2	373	Cytoplasmic (Potential).				blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	63128728	63128728	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63128728T>A	uc001daq.2	-	2	146	c.112A>T	c.(112-114)AAT>TAT	p.N38Y	DOCK7_uc001dap.2_Missense_Mutation_p.N38Y|DOCK7_uc009wah.1_Missense_Mutation_p.N38Y	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	38					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	63128729	63128729	+	Silent	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63128729A>C	uc001daq.2	-	2	145	c.111T>G	c.(109-111)CTT>CTG	p.L37L	DOCK7_uc001dap.2_Silent_p.L37L|DOCK7_uc009wah.1_Silent_p.L37L	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	37					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
CTBS	1486	broad.mit.edu	37	1	85020805	85020805	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85020805G>C	uc001dka.2	-	7	1100	c.1035C>G	c.(1033-1035)AAC>AAG	p.N345K	SPATA1_uc001djz.1_Intron|CTBS_uc001dkc.2_Missense_Mutation_p.N254K|CTBS_uc001dkd.2_Missense_Mutation_p.N139K|CTBS_uc001dkb.2_Missense_Mutation_p.N139K	NM_004388	NP_004379	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl- precursor	345						lysosome	cation binding				0				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)														---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98058818	98058818	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98058818C>T	uc001drv.2	-	10	1221	c.1084G>A	c.(1084-1086)GTC>ATC	p.V362I		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	362					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
AMPD2	271	broad.mit.edu	37	1	110171967	110171967	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110171967G>A	uc009wfh.1	+	15	2421	c.1879G>A	c.(1879-1881)GTG>ATG	p.V627M	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.V546M|AMPD2_uc001dyc.1_Missense_Mutation_p.V627M|AMPD2_uc010ovr.1_Missense_Mutation_p.V552M|AMPD2_uc001dyd.1_Missense_Mutation_p.V508M|AMPD2_uc001dye.1_Translation_Start_Site	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	627					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)														---	---	---	---
ST7L	54879	broad.mit.edu	37	1	113068734	113068734	+	Intron	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113068734C>T	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron	NM_017744	NP_060214			suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
ATP1A1	476	broad.mit.edu	37	1	116937768	116937768	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116937768C>A	uc001ege.2	+	13	2036	c.1697C>A	c.(1696-1698)CCT>CAT	p.P566H	ATP1A1_uc010owv.1_Missense_Mutation_p.P535H|ATP1A1_uc010oww.1_Missense_Mutation_p.P566H|ATP1A1_uc010owx.1_Missense_Mutation_p.P535H|C1orf203_uc009whb.2_Intron	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	566	Cytoplasmic (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)													---	---	---	---
MTMR11	10903	broad.mit.edu	37	1	149903217	149903217	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149903217G>A	uc001etl.3	-	13	1476	c.1225C>T	c.(1225-1227)CGA>TGA	p.R409*	SF3B4_uc001etk.1_5'Flank|MTMR11_uc001etm.1_Nonsense_Mutation_p.R337*|MTMR11_uc010pbm.1_Intron|MTMR11_uc010pbn.1_Missense_Mutation_p.A235V	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	409	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
INSRR	3645	broad.mit.edu	37	1	156819226	156819226	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156819226T>C	uc010pht.1	-	6	1510	c.1256A>G	c.(1255-1257)AAC>AGC	p.N419S	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	419					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)																	---	---	---	---
GORAB	92344	broad.mit.edu	37	1	170521254	170521254	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170521254C>G	uc001gha.2	+	5	863	c.836C>G	c.(835-837)ACG>AGG	p.T279R	GORAB_uc009wvx.2_Missense_Mutation_p.T99R|GORAB_uc001ghb.2_Missense_Mutation_p.T99R|GORAB_uc001ghc.2_Missense_Mutation_p.T99R|GORAB_uc001ghd.2_Missense_Mutation_p.T72R	NM_152281	NP_689494	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting isoform a	279	Necessary for interaction with RCHY1.|Potential.					Golgi apparatus|nucleus					0																		---	---	---	---
TNR	7143	broad.mit.edu	37	1	175372750	175372750	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175372750G>T	uc001gkp.1	-	2	583	c.502C>A	c.(502-504)CAA>AAA	p.Q168K	TNR_uc009wwu.1_Missense_Mutation_p.Q168K|TNR_uc010pmz.1_Missense_Mutation_p.Q168K	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	168	Cys-rich.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)																	---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190129876	190129876	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190129876G>A	uc001gse.1	-	7	1338	c.1106C>T	c.(1105-1107)GCG>GTG	p.A369V	FAM5C_uc010pot.1_Missense_Mutation_p.A267V	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	369						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197396612	197396612	+	Silent	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197396612T>C	uc001gtz.2	+	7	2292	c.2157T>C	c.(2155-2157)GAT>GAC	p.D719D	CRB1_uc010poz.1_Silent_p.D650D|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Silent_p.D607D|CRB1_uc010ppb.1_Intron|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Silent_p.D200D|CRB1_uc001gub.1_Silent_p.D368D	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	719	Extracellular (Potential).|Laminin G-like 2.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
KCTD3	51133	broad.mit.edu	37	1	215793886	215793886	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215793886C>T	uc001hks.2	+	18	2668	c.2374C>T	c.(2374-2376)CCA>TCA	p.P792S	KCTD3_uc001hkt.2_Missense_Mutation_p.P790S|KCTD3_uc010pub.1_Missense_Mutation_p.P690S|KCTD3_uc009xdn.2_Missense_Mutation_p.P516S	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	792						voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)														---	---	---	---
HEATR5B	54497	broad.mit.edu	37	2	37229454	37229454	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37229454G>A	uc002rpp.1	-	32	5408	c.5312C>T	c.(5311-5313)CCC>CTC	p.P1771L	HEATR5B_uc002rpo.1_Missense_Mutation_p.P84L|HEATR5B_uc010ezy.1_Intron	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1771							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)																---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51254932	51254932	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51254932C>T	uc010fbq.2	-	2	1957	c.480G>A	c.(478-480)CCG>CCA	p.P160P	NRXN1_uc002rxe.3_Silent_p.P160P|NRXN1_uc002rxd.1_Silent_p.P160P	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71886083	71886083	+	Missense_Mutation	SNP	G	A	A	rs143163327		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71886083G>A	uc002sie.2	+	43	5090	c.4714G>A	c.(4714-4716)GCC>ACC	p.A1572T	DYSF_uc010feg.2_Missense_Mutation_p.A1603T|DYSF_uc010feh.2_Missense_Mutation_p.A1579T|DYSF_uc002sig.3_Missense_Mutation_p.A1558T|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.A1593T|DYSF_uc010fef.2_Missense_Mutation_p.A1610T|DYSF_uc010fei.2_Missense_Mutation_p.A1589T|DYSF_uc010fek.2_Missense_Mutation_p.A1590T|DYSF_uc010fej.2_Missense_Mutation_p.A1580T|DYSF_uc010fel.2_Missense_Mutation_p.A1559T|DYSF_uc010feo.2_Missense_Mutation_p.A1604T|DYSF_uc010fem.2_Missense_Mutation_p.A1594T|DYSF_uc010fen.2_Missense_Mutation_p.A1611T|DYSF_uc002sif.2_Missense_Mutation_p.A1573T|DYSF_uc010yqy.1_Missense_Mutation_p.A453T|DYSF_uc010yqz.1_Missense_Mutation_p.A333T	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1572	Cytoplasmic (Potential).|C2 5.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
SPR	6697	broad.mit.edu	37	2	73115443	73115443	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73115443G>C	uc002sik.2	+	2	355	c.305G>C	c.(304-306)GGC>GCC	p.G102A		NM_003124	NP_003115	P35270	SPRE_HUMAN	sepiapterin reductase	102					nitric oxide biosynthetic process|tetrahydrobiopterin biosynthetic process	cytoplasm	aldo-keto reductase (NADP) activity|NADP binding|sepiapterin reductase activity			ovary(2)	2																OREG0014704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SEMA4F	10505	broad.mit.edu	37	2	74889902	74889902	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74889902G>A	uc002sna.1	+	5	611	c.500G>A	c.(499-501)CGG>CAG	p.R167Q	SEMA4F_uc010ysb.1_Intron|SEMA4F_uc010ffq.1_Missense_Mutation_p.R134Q|SEMA4F_uc010ffr.1_Intron|SEMA4F_uc002snb.1_Intron|SEMA4F_uc002snc.1_Intron	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	167	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
NCAPH	23397	broad.mit.edu	37	2	97020058	97020058	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97020058C>A	uc002svz.1	+	9	1224	c.1140C>A	c.(1138-1140)GAC>GAA	p.D380E	NCAPH_uc010fhu.1_Missense_Mutation_p.D356E|NCAPH_uc010fhv.1_Missense_Mutation_p.D369E|NCAPH_uc010yum.1_Missense_Mutation_p.D356E|NCAPH_uc010fhw.1_Missense_Mutation_p.D369E|NCAPH_uc010yun.1_Missense_Mutation_p.D244E|NCAPH_uc002swa.1_5'UTR	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	380					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)																---	---	---	---
ANAPC1	64682	broad.mit.edu	37	2	112625621	112625621	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112625621G>C	uc002thi.2	-	7	911	c.664C>G	c.(664-666)CCA>GCA	p.P222A		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	222					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2																		---	---	---	---
PSD4	23550	broad.mit.edu	37	2	113940797	113940797	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113940797C>A	uc002tjc.2	+	2	947	c.764C>A	c.(763-765)CCT>CAT	p.P255H	PSD4_uc002tjd.2_5'UTR|PSD4_uc002tje.2_Missense_Mutation_p.P254H|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	255					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
C2orf76	130355	broad.mit.edu	37	2	120078733	120078733	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120078733A>G	uc002tls.2	-	4	722	c.181T>C	c.(181-183)TAT>CAT	p.Y61H	C2orf76_uc010flf.1_Missense_Mutation_p.Y61H|C2orf76_uc010yyg.1_RNA|C2orf76_uc002tlt.2_Missense_Mutation_p.Y61H|C2orf76_uc002tlu.2_Missense_Mutation_p.Y61H	NM_001017927	NP_001017927	Q3KRA6	CB076_HUMAN	hypothetical protein LOC130355	61											0																		---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	137813980	137813980	+	Intron	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137813980C>A	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_5'Flank	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138373815	138373815	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138373815G>A	uc002tva.1	+	17	3407	c.3407G>A	c.(3406-3408)TGT>TAT	p.C1136Y	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141660534	141660534	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141660534C>G	uc002tvj.1	-	23	4693	c.3721G>C	c.(3721-3723)GAA>CAA	p.E1241Q	LRP1B_uc010fnl.1_Missense_Mutation_p.E423Q	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1241	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
UPP2	151531	broad.mit.edu	37	2	158980300	158980300	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158980300G>T	uc002tzp.2	+	6	898	c.704G>T	c.(703-705)AGA>ATA	p.R235I	UPP2_uc002tzo.2_Missense_Mutation_p.R292I	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a	235					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0																		---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166755241	166755241	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166755241C>T	uc002udk.2	-	22	3038	c.2905G>A	c.(2905-2907)GAA>AAA	p.E969K		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	969	TPR 15.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
SCN9A	6335	broad.mit.edu	37	2	167060651	167060651	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167060651C>T	uc010fpl.2	-	26	4896	c.4555G>A	c.(4555-4557)GTA>ATA	p.V1519I	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1530	IV.|Helical; Name=S1 of repeat IV; (Potential).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)													---	---	---	---
MAP1D	254042	broad.mit.edu	37	2	172930411	172930411	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172930411G>C	uc002uhk.2	+	4	501	c.428G>C	c.(427-429)GGC>GCC	p.G143A	MAP1D_uc010zdw.1_Missense_Mutation_p.G25A	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor	143					N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179395550	179395550	+	Silent	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395550T>C	uc010zfg.1	-	307	98312	c.98088A>G	c.(98086-98088)GTA>GTG	p.V32696V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.V26391V|TTN_uc010zfi.1_Silent_p.V26324V|TTN_uc010zfj.1_Silent_p.V26199V|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33623							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
NUP35	129401	broad.mit.edu	37	2	184023068	184023068	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184023068A>T	uc002upf.2	+	7	770	c.667A>T	c.(667-669)AAA>TAA	p.K223*	NUP35_uc010zfs.1_Nonsense_Mutation_p.K205*|NUP35_uc010zft.1_Nonsense_Mutation_p.K105*|NUP35_uc002upg.2_RNA	NM_138285	NP_612142	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa	223	RRM Nup35-type.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	intermediate filament cytoskeleton|nuclear membrane|nuclear pore|plasma membrane					0																		---	---	---	---
GLB1L	79411	broad.mit.edu	37	2	220102629	220102629	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220102629C>T	uc002vkm.2	-	15	1631	c.1392G>A	c.(1390-1392)ACG>ACA	p.T464T	GLB1L_uc002vkk.2_Silent_p.T221T|GLB1L_uc010zkx.1_Silent_p.T374T|GLB1L_uc002vkn.2_Silent_p.T464T	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor	464					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
STAC	6769	broad.mit.edu	37	3	36524518	36524518	+	Silent	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36524518C>A	uc003cgh.1	+	3	462	c.423C>A	c.(421-423)GCC>GCA	p.A141A	STAC_uc010hgd.1_RNA|STAC_uc011aya.1_Intron	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	141	Phorbol-ester/DAG-type.				intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
IMPDH2	3615	broad.mit.edu	37	3	49065727	49065727	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49065727T>C	uc003cvt.2	-	4	370	c.278A>G	c.(277-279)CAC>CGC	p.H93R		NM_000884	NP_000875	P12268	IMDH2_HUMAN	inosine monophosphate dehydrogenase 2	93					GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	IMP dehydrogenase activity|metal ion binding|nucleotide binding|protein binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)													---	---	---	---
SEMA3G	56920	broad.mit.edu	37	3	52472960	52472960	+	Silent	SNP	G	T	T	rs142516678	byFrequency	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52472960G>T	uc003dea.1	-	13	1485	c.1485C>A	c.(1483-1485)ACC>ACA	p.T495T		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	495	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)														---	---	---	---
FEZF2	55079	broad.mit.edu	37	3	62357828	62357828	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62357828G>C	uc003dlh.2	-	1	923	c.716C>G	c.(715-717)CCG>CGG	p.P239R	FEZF2_uc003dli.2_Missense_Mutation_p.P239R	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	239					transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)														---	---	---	---
OR5K3	403277	broad.mit.edu	37	3	98110101	98110101	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98110101G>C	uc011bgw.1	+	1	592	c.592G>C	c.(592-594)GTG>CTG	p.V198L		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
C3orf15	89876	broad.mit.edu	37	3	119469891	119469891	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119469891T>C	uc003ede.3	+	17	2328	c.2251T>C	c.(2251-2253)TCA>CCA	p.S751P	C3orf15_uc010hqz.2_Missense_Mutation_p.S689P|C3orf15_uc011bjd.1_Missense_Mutation_p.S625P|C3orf15_uc011bje.1_Missense_Mutation_p.S731P|C3orf15_uc003edg.3_RNA|C3orf15_uc003edh.3_RNA	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	587						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)														---	---	---	---
PLXND1	23129	broad.mit.edu	37	3	129286351	129286351	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129286351C>T	uc003emx.2	-	22	4170	c.4070G>A	c.(4069-4071)CGC>CAC	p.R1357H	PLXND1_uc011blb.1_Missense_Mutation_p.R25H	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1357	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1																		---	---	---	---
IGSF10	285313	broad.mit.edu	37	3	151155443	151155443	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151155443A>T	uc011bod.1	-	6	6906	c.6906T>A	c.(6904-6906)AAT>AAA	p.N2302K	IGSF10_uc011bob.1_Missense_Mutation_p.N329K|IGSF10_uc011boc.1_Missense_Mutation_p.N281K	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	2302	Ig-like C2-type 9.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
KLHL6	89857	broad.mit.edu	37	3	183211985	183211985	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183211985C>A	uc003flr.2	-	5	1290	c.1232G>T	c.(1231-1233)CGC>CTC	p.R411L	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_3'UTR|KLHL6_uc010hxk.1_RNA	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	411	Kelch 2.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)															---	---	---	---
WFS1	7466	broad.mit.edu	37	4	6302687	6302687	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6302687G>A	uc003giy.2	+	8	1331	c.1165G>A	c.(1165-1167)GAT>AAT	p.D389N	WFS1_uc003gix.2_Missense_Mutation_p.D389N|WFS1_uc003giz.2_Missense_Mutation_p.D207N	NM_001145853	NP_001139325	O76024	WFS1_HUMAN	wolframin	389					endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)														---	---	---	---
ATP10D	57205	broad.mit.edu	37	4	47548832	47548832	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47548832G>T	uc003gxk.1	+	10	1752	c.1588G>T	c.(1588-1590)GCC>TCC	p.A530S	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Missense_Mutation_p.A515S	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	530	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3																		---	---	---	---
AASDH	132949	broad.mit.edu	37	4	57204862	57204862	+	Silent	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57204862G>T	uc003hbn.2	-	15	3156	c.3003C>A	c.(3001-3003)ATC>ATA	p.I1001I	AASDH_uc010ihb.2_Silent_p.I516I|AASDH_uc011caa.1_3'UTR|AASDH_uc003hbo.2_Silent_p.I901I|AASDH_uc011cab.1_Silent_p.I516I|AASDH_uc010ihc.2_3'UTR	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1001					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)																---	---	---	---
LIN54	132660	broad.mit.edu	37	4	83858420	83858420	+	Silent	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83858420G>T	uc003hnx.3	-	9	1942	c.1564C>A	c.(1564-1566)CGA>AGA	p.R522R	LIN54_uc003hnz.3_Silent_p.R301R|LIN54_uc003hny.3_Silent_p.R121R|LIN54_uc010ijt.2_Silent_p.R433R|LIN54_uc010iju.2_Silent_p.R121R|LIN54_uc010ijv.2_Silent_p.R301R	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	522	CXC 1.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)																---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102751290	102751290	+	Silent	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102751290A>G	uc003hvy.3	+	2	670	c.396A>G	c.(394-396)CAA>CAG	p.Q132Q	BANK1_uc003hvx.3_Silent_p.Q117Q|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Silent_p.Q102Q	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	132	Interaction with ITPR2.				B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102984241	102984241	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102984241C>T	uc003hvy.3	+	13	2432	c.2158C>T	c.(2158-2160)CGA>TGA	p.R720*	BANK1_uc003hvx.3_Nonsense_Mutation_p.R705*|BANK1_uc010ill.2_Nonsense_Mutation_p.R587*|BANK1_uc003hvz.3_Nonsense_Mutation_p.R690*	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	720					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
AIMP1	9255	broad.mit.edu	37	4	107252898	107252898	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107252898G>A	uc011cfg.1	+	5	513	c.461G>A	c.(460-462)CGT>CAT	p.R154H	AIMP1_uc003hyg.2_Missense_Mutation_p.R154H|AIMP1_uc003hyh.2_Missense_Mutation_p.R178H	NM_001142415	NP_001135887	Q12904	AIMP1_HUMAN	small inducible cytokine subfamily E, member 1	154	tRNA-binding.|Interaction with HSP90B1 (By similarity).|Required for endothelial cell migration.				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126336957	126336957	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126336957T>G	uc003ifj.3	+	5	6839	c.6839T>G	c.(6838-6840)CTT>CGT	p.L2280R	FAT4_uc011cgp.1_Missense_Mutation_p.L578R	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2280	Extracellular (Potential).|Cadherin 22.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
ACCN5	51802	broad.mit.edu	37	4	156775288	156775288	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156775288A>G	uc003ipe.1	-	3	573	c.526T>C	c.(526-528)TAT>CAT	p.Y176H		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	176	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)														---	---	---	---
C5orf42	65250	broad.mit.edu	37	5	37184925	37184925	+	Silent	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37184925C>A	uc011cpa.1	-	25	4677	c.4446G>T	c.(4444-4446)TCG>TCT	p.S1482S	C5orf42_uc011coy.1_5'Flank|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Silent_p.S557S|C5orf42_uc011cpb.1_Silent_p.S363S	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1482										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)															---	---	---	---
FGF10	2255	broad.mit.edu	37	5	44388473	44388473	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44388473C>T	uc003jog.1	-	1	312	c.312G>A	c.(310-312)GAG>GAA	p.E104E		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	104					actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)																	---	---	---	---
HCN1	348980	broad.mit.edu	37	5	45353212	45353212	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353212G>A	uc003jok.2	-	5	1392	c.1367C>T	c.(1366-1368)CCT>CTT	p.P456L		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	456	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---
MAP1B	4131	broad.mit.edu	37	5	71495024	71495024	+	Missense_Mutation	SNP	C	T	T	rs151255965		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71495024C>T	uc003kbw.3	+	5	6083	c.5842C>T	c.(5842-5844)CGG>TGG	p.R1948W	MAP1B_uc010iyw.1_Missense_Mutation_p.R1965W|MAP1B_uc010iyx.1_Missense_Mutation_p.R1822W|MAP1B_uc010iyy.1_Missense_Mutation_p.R1822W	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1948	MAP1B 5.					microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)														---	---	---	---
THBS4	7060	broad.mit.edu	37	5	79378239	79378239	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79378239T>C	uc003kgh.2	+	22	3018	c.2695T>C	c.(2695-2697)TAT>CAT	p.Y899H	uc003kgi.3_RNA	NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor	899	TSP C-terminal.				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)														---	---	---	---
APC	324	broad.mit.edu	37	5	112174682	112174682	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112174682C>T	uc010jby.2	+	16	3771	c.3391C>T	c.(3391-3393)CAA>TAA	p.Q1131*	APC_uc011cvt.1_Nonsense_Mutation_p.Q1113*|APC_uc003kpz.3_Nonsense_Mutation_p.Q1131*|APC_uc003kpy.3_Nonsense_Mutation_p.Q1131*|APC_uc010jbz.2_Nonsense_Mutation_p.Q848*|APC_uc010jca.2_Nonsense_Mutation_p.Q431*	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1131	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.|Asp/Glu-rich (acidic).				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.Q1131*(2)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	T	T	rs121913332		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175639C>T	uc010jby.2	+	16	4728	c.4348C>T	c.(4348-4350)CGA>TGA	p.R1450*	APC_uc011cvt.1_Nonsense_Mutation_p.R1432*|APC_uc003kpz.3_Nonsense_Mutation_p.R1450*|APC_uc003kpy.3_Nonsense_Mutation_p.R1450*|APC_uc010jbz.2_Nonsense_Mutation_p.R1167*|APC_uc010jca.2_Nonsense_Mutation_p.R750*	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.R1450*(115)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		R1450*(SW837_LARGE_INTESTINE)|R1450*(LS123_LARGE_INTESTINE)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)	12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
PCDHB2	56133	broad.mit.edu	37	5	140476413	140476413	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476413C>T	uc003lil.2	+	1	2177	c.2039C>T	c.(2038-2040)CCG>CTG	p.P680L	PCDHB2_uc003lim.1_Missense_Mutation_p.P341L	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	680	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB3	56132	broad.mit.edu	37	5	140482266	140482266	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140482266C>T	uc003lio.2	+	1	2033	c.2033C>T	c.(2032-2034)CCG>CTG	p.P678L	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	678	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
HDAC3	8841	broad.mit.edu	37	5	141016342	141016342	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141016342C>T	uc003llf.2	-	1	82	c.16G>A	c.(16-18)GCC>ACC	p.A6T	HDAC3_uc003lle.1_5'Flank|HDAC3_uc010jgd.1_Missense_Mutation_p.A6T|HDAC3_uc010jge.1_RNA|RELL2_uc003lli.2_5'Flank|RELL2_uc003llh.2_5'Flank|RELL2_uc003llg.2_5'Flank|RELL2_uc010jgf.2_5'Flank	NM_003883	NP_003874	O15379	HDAC3_HUMAN	histone deacetylase 3	6	Histone deacetylase.				anti-apoptosis|cellular lipid metabolic process|negative regulation of cell cycle|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|spindle assembly|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|spindle microtubule|transcriptional repressor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription corepressor activity|transcription factor binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)													---	---	---	---
NR3C1	2908	broad.mit.edu	37	5	142661488	142661488	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142661488C>G	uc003lmz.2	-	9	2792	c.2300G>C	c.(2299-2301)GGA>GCA	p.G767A	NR3C1_uc003lmy.2_Missense_Mutation_p.G768A|NR3C1_uc003lna.2_Intron|NR3C1_uc003lnb.2_Missense_Mutation_p.G767A|NR3C1_uc011dbk.1_Missense_Mutation_p.G370A|NR3C1_uc003lnc.2_Missense_Mutation_p.G767A|NR3C1_uc003lnd.2_Missense_Mutation_p.G767A|NR3C1_uc003lne.2_Missense_Mutation_p.G767A|NR3C1_uc003lnf.2_Missense_Mutation_p.G768A	NM_000176	NP_000167	P04150	GCR_HUMAN	glucocorticoid receptor isoform alpha	767	Steroid-binding.				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)													---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3324180	3324180	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3324180C>T	uc003mvm.3	-	4	970	c.970G>A	c.(970-972)GTG>ATG	p.V324M	SLC22A23_uc003mvn.3_Missense_Mutation_p.V43M|SLC22A23_uc003mvo.3_Missense_Mutation_p.V43M|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.V324M|SLC22A23_uc010jno.2_Missense_Mutation_p.V324M	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a	324	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
HIST1H3H	8357	broad.mit.edu	37	6	27776046	27776046	+	5'Flank	SNP	C	A	A	rs143049396	byFrequency	TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27776046C>A	uc003njm.2	+						HIST1H2BL_uc003njl.2_5'Flank	NM_003536	NP_003527			histone cluster 1, H3h						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1																		---	---	---	---
HIST1H2AJ	8331	broad.mit.edu	37	6	27782460	27782460	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27782460G>T	uc003njn.1	-	1	59	c.59C>A	c.(58-60)TCT>TAT	p.S20Y	HIST1H2BM_uc003njo.2_5'Flank	NM_021066	NP_066544	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	20					nucleosome assembly	nucleosome|nucleus	DNA binding				0																		---	---	---	---
TCF19	6941	broad.mit.edu	37	6	31130473	31130473	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31130473C>T	uc003nss.2	+	4	1541	c.1017C>T	c.(1015-1017)TGC>TGT	p.C339C	TCF19_uc003nst.2_Silent_p.C339C	NM_001077511	NP_001070979	Q9Y242	TCF19_HUMAN	transcription factor 19	339	PHD-type.				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
BAT3	7917	broad.mit.edu	37	6	31606973	31606973	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31606973C>A	uc003nvg.3	-	25	3648	c.3334G>T	c.(3334-3336)GAA>TAA	p.E1112*	BAT3_uc003nvf.3_Nonsense_Mutation_p.E1106*|BAT3_uc003nvh.3_Nonsense_Mutation_p.E1106*|BAT3_uc003nvi.3_Nonsense_Mutation_p.E1106*|BAT3_uc011dnw.1_Nonsense_Mutation_p.E1057*|BAT3_uc011dnx.1_Nonsense_Mutation_p.E883*	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	1112					apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0																		---	---	---	---
PI16	221476	broad.mit.edu	37	6	36929321	36929321	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36929321G>T	uc003ona.2	+	3	816	c.488G>T	c.(487-489)TGC>TTC	p.C163F	PI16_uc003omz.1_Missense_Mutation_p.C163F|PI16_uc003onb.2_Missense_Mutation_p.C163F|PI16_uc011dts.1_5'UTR	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	163	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66204978	66204978	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66204978G>A	uc011dxu.1	-	4	864	c.326C>T	c.(325-327)ACA>ATA	p.T109I	EYS_uc003peq.2_Missense_Mutation_p.T109I|EYS_uc003per.1_Missense_Mutation_p.T109I|EYS_uc010kaj.1_RNA	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	109					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75861908	75861908	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75861908G>C	uc003phs.2	-	19	3940	c.3774C>G	c.(3772-3774)GAC>GAG	p.D1258E	COL12A1_uc003pht.2_Missense_Mutation_p.D94E	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1258	VWFA 3.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82925890	82925890	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82925890G>A	uc003pjl.1	-	11	2031	c.1504C>T	c.(1504-1506)CGA>TGA	p.R502*	IBTK_uc011dyv.1_Nonsense_Mutation_p.R502*|IBTK_uc011dyw.1_Nonsense_Mutation_p.R502*|IBTK_uc010kbi.1_Nonsense_Mutation_p.R196*|IBTK_uc003pjm.2_Nonsense_Mutation_p.R502*	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	502					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---
TBX18	9096	broad.mit.edu	37	6	85446858	85446858	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85446858A>T	uc003pkl.1	-	8	1369	c.1369T>A	c.(1369-1371)TAT>AAT	p.Y457N	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	457					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	4056825	4056825	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4056825G>A	uc003smx.2	+	17	2582	c.2443G>A	c.(2443-2445)GGA>AGA	p.G815R	SDK1_uc010kso.2_Missense_Mutation_p.G91R	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	815	Fibronectin type-III 2.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
FAM126A	84668	broad.mit.edu	37	7	23000007	23000007	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23000007G>A	uc003svm.3	-	10	1114	c.859C>T	c.(859-861)CCT>TCT	p.P287S	FAM126A_uc003svn.3_Missense_Mutation_p.P143S	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	287						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33397458	33397458	+	Intron	SNP	T	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33397458T>G	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Intron|BBS9_uc003tds.1_Intron|BBS9_uc011kao.1_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
BMPER	168667	broad.mit.edu	37	7	33946429	33946429	+	Splice_Site	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33946429G>A	uc011kap.1	+	2	248	c.134_splice	c.e2-1	p.G45_splice		NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56087384	56087384	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56087384G>C	uc003trg.2	-	4	547	c.184C>G	c.(184-186)CTC>GTC	p.L62V	PSPH_uc003trh.2_Missense_Mutation_p.L62V|PSPH_uc003tri.2_Missense_Mutation_p.L62V|PSPH_uc003trj.2_Missense_Mutation_p.L91V	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	62					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77755084	77755084	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77755084C>G	uc003ugx.2	-	20	3748	c.3494G>C	c.(3493-3495)AGG>ACG	p.R1165T	MAGI2_uc003ugy.2_Missense_Mutation_p.R1151T|MAGI2_uc010ldx.1_Missense_Mutation_p.R758T	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	1165	PDZ 6.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84671599	84671599	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84671599A>T	uc003uic.2	-	8	904	c.864T>A	c.(862-864)AAT>AAA	p.N288K	SEMA3D_uc010led.2_Missense_Mutation_p.N288K|SEMA3D_uc003uib.2_5'Flank	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	288	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
FSCN3	29999	broad.mit.edu	37	7	127238559	127238559	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127238559A>T	uc003vmd.1	+	4	1250	c.1031A>T	c.(1030-1032)AAC>ATC	p.N344I	FSCN3_uc011koh.1_Missense_Mutation_p.N210I|FSCN3_uc010llc.1_Missense_Mutation_p.N344I	NM_020369	NP_065102	Q9NQT6	FSCN3_HUMAN	fascin 3	344						actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging			ovary(1)	1																		---	---	---	---
PARP12	64761	broad.mit.edu	37	7	139737608	139737608	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139737608C>T	uc003vvl.1	-	7	2105	c.1231G>A	c.(1231-1233)GCC>ACC	p.A411T	PARP12_uc003vvk.1_Missense_Mutation_p.A197T|PARP12_uc010lnf.1_Intron	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	411	WWE 2.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)																	---	---	---	---
ZNF777	27153	broad.mit.edu	37	7	149148160	149148160	+	Silent	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149148160G>A	uc003wfv.2	-	4	1180	c.1017C>T	c.(1015-1017)CGC>CGT	p.R339R		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	339	Glu-rich.|KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)															---	---	---	---
LGI3	203190	broad.mit.edu	37	8	22012113	22012113	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22012113C>A	uc003xav.2	-	3	599	c.310G>T	c.(310-312)GGA>TGA	p.G104*	LGI3_uc010ltu.2_Nonsense_Mutation_p.G104*	NM_139278	NP_644807	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	104	LRR 1.				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome				ovary(1)	1				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)														---	---	---	---
KCNU1	157855	broad.mit.edu	37	8	36675180	36675180	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36675180C>T	uc010lvw.2	+	10	1095	c.1008C>T	c.(1006-1008)GTC>GTT	p.V336V	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	336	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)														---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48824975	48824975	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48824975C>T	uc003xqi.2	-	25	2986	c.2929G>A	c.(2929-2931)GAT>AAT	p.D977N	PRKDC_uc003xqj.2_Missense_Mutation_p.D977N|PRKDC_uc011ldh.1_Missense_Mutation_p.D977N	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	977					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
C8orf45	157777	broad.mit.edu	37	8	67786777	67786777	+	Missense_Mutation	SNP	G	T	T	rs146704201		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67786777G>T	uc003xwz.3	+	4	412	c.241G>T	c.(241-243)GTT>TTT	p.V81F	C8orf45_uc003xwv.2_Missense_Mutation_p.V81F|C8orf45_uc011lev.1_Missense_Mutation_p.V81F|C8orf45_uc011lew.1_Missense_Mutation_p.V12F|C8orf45_uc011lex.1_5'UTR|C8orf45_uc003xwy.3_Missense_Mutation_p.V81F	NM_173518	NP_775789	Q4G0Z9	CH045_HUMAN	minichromosome maintenance complex	81					DNA replication		ATP binding|DNA binding			ovary(1)	1	Breast(64;0.186)		Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
EYA1	2138	broad.mit.edu	37	8	72123457	72123457	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72123457C>A	uc003xys.3	-	16	1919	c.1632G>T	c.(1630-1632)AGG>AGT	p.R544S	EYA1_uc003xyr.3_Missense_Mutation_p.R509S|EYA1_uc003xyt.3_Missense_Mutation_p.R511S|EYA1_uc010lzf.2_Missense_Mutation_p.R471S|EYA1_uc003xyu.2_Missense_Mutation_p.R544S|EYA1_uc011lfe.1_Missense_Mutation_p.R538S|EYA1_uc003xyv.2_Missense_Mutation_p.R422S	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	544					double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77616929	77616929	+	Silent	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77616929G>C	uc003yav.2	+	2	993	c.606G>C	c.(604-606)GGG>GGC	p.G202G	ZFHX4_uc003yat.1_Silent_p.G202G|ZFHX4_uc003yau.1_Silent_p.G202G|ZFHX4_uc003yaw.1_Silent_p.G202G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	202						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88249348	88249348	+	Intron	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88249348A>G	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
INTS8	55656	broad.mit.edu	37	8	95862222	95862222	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95862222A>T	uc003yhb.2	+	12	1536	c.1410A>T	c.(1408-1410)AAA>AAT	p.K470N	INTS8_uc003yha.1_Missense_Mutation_p.K470N|INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.K297N	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8	470					snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)																	---	---	---	---
EBAG9	9166	broad.mit.edu	37	8	110576743	110576743	+	Silent	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110576743G>T	uc003ynf.2	+	7	832	c.597G>T	c.(595-597)CGG>CGT	p.R199R	EBAG9_uc003yng.2_Silent_p.R199R	NM_198120	NP_936056	O00559	RCAS1_HUMAN	estrogen receptor binding site associated	199	Cytoplasmic (Potential).|Potential.				apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity				0			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)															---	---	---	---
TLN1	7094	broad.mit.edu	37	9	35711653	35711653	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35711653C>T	uc003zxt.2	-	29	4172	c.3818G>A	c.(3817-3819)CGA>CAA	p.R1273Q		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	1273					axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29769635	29769635	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29769635A>T	uc001iut.1	-	29	5961	c.5208T>A	c.(5206-5208)TAT>TAA	p.Y1736*	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Nonsense_Mutation_p.Y650*|SVIL_uc001iuu.1_Nonsense_Mutation_p.Y1310*|SVIL_uc009xlc.2_Nonsense_Mutation_p.Y528*	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1736					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
GDF2	2658	broad.mit.edu	37	10	48414362	48414362	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48414362C>A	uc001jfa.1	-	2	669	c.506G>T	c.(505-507)AGC>ATC	p.S169I		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	169					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
SLC18A3	6572	broad.mit.edu	37	10	50819027	50819027	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50819027A>C	uc001jhw.2	+	1	681	c.241A>C	c.(241-243)ACC>CCC	p.T81P	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	81	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2																		---	---	---	---
USP54	159195	broad.mit.edu	37	10	75289589	75289589	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75289589G>A	uc001juo.2	-	13	1926	c.1909C>T	c.(1909-1911)CGC>TGC	p.R637C	USP54_uc001juk.2_5'UTR|USP54_uc001jul.2_5'UTR|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA|USP54_uc001jup.2_Missense_Mutation_p.R637C|USP54_uc010qkl.1_Missense_Mutation_p.R637C	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	637					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)															OREG0020266	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CNNM1	26507	broad.mit.edu	37	10	101124268	101124268	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101124268G>T	uc001kpp.3	+	5	2412	c.2123G>T	c.(2122-2124)TGC>TTC	p.C708F	CNNM1_uc009xwe.2_Missense_Mutation_p.C708F|CNNM1_uc010qpi.1_Missense_Mutation_p.C708F|CNNM1_uc009xwf.2_Missense_Mutation_p.C708F|CNNM1_uc009xwg.2_Missense_Mutation_p.C108F	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1	708					ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108338983	108338983	+	Intron	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108338983G>A	uc001kym.2	-						SORCS1_uc001kyl.2_Missense_Mutation_p.A1133V|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Missense_Mutation_p.A1133V|SORCS1_uc001kyo.2_3'UTR	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
NUP160	23279	broad.mit.edu	37	11	47814468	47814468	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47814468C>A	uc001ngm.2	-	28	3405	c.3320G>T	c.(3319-3321)CGG>CTG	p.R1107L	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	1107					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
MS4A14	84689	broad.mit.edu	37	11	60184013	60184013	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60184013C>T	uc001npj.2	+	5	2137	c.1572C>T	c.(1570-1572)GGC>GGT	p.G524G	MS4A14_uc001npi.2_Silent_p.G412G|MS4A14_uc001npn.2_Silent_p.G262G|MS4A14_uc001npk.2_Silent_p.G507G|MS4A14_uc001npl.2_Silent_p.G262G|MS4A14_uc001npm.2_Silent_p.G262G	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	524	Gln-rich.					integral to membrane	receptor activity			breast(1)	1																		---	---	---	---
SART1	9092	broad.mit.edu	37	11	65743976	65743976	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65743976C>T	uc001ogl.2	+	13	1775	c.1683C>T	c.(1681-1683)CGC>CGT	p.R561R		NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T	561					cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1																		---	---	---	---
PAK1	5058	broad.mit.edu	37	11	77066712	77066712	+	Splice_Site	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77066712C>T	uc001oyh.3	-	7	1305	c.772_splice	c.e7+1	p.R258_splice	PAK1_uc010rso.1_Splice_Site_p.R160_splice|PAK1_uc001oyg.3_Splice_Site_p.R258_splice|PAK1_uc001oyi.1_Splice_Site_p.R258_splice|PAK1_uc010rsn.1_Intron	NM_002576	NP_002567			p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)																	---	---	---	---
FZD4	8322	broad.mit.edu	37	11	86663042	86663042	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86663042C>T	uc001pce.2	-	2	1062	c.756G>A	c.(754-756)GAG>GAA	p.E252E	PRSS23_uc001pcc.1_RNA	NM_012193	NP_036325	Q9ULV1	FZD4_HUMAN	frizzled 4 precursor	252	Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|negative regulation of cell-substrate adhesion|neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|progesterone secretion|regulation of vascular endothelial growth factor receptor signaling pathway|substrate adhesion-dependent cell spreading|vasculogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cell projection|cell surface|cytoplasm	cytokine binding|G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			large_intestine(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
MED17	9440	broad.mit.edu	37	11	93543040	93543040	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93543040C>T	uc001pem.3	+	11	2017	c.1742C>T	c.(1741-1743)TCA>TTA	p.S581L		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	581					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
CEP57	9702	broad.mit.edu	37	11	95532563	95532563	+	Intron	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95532563C>A	uc001pfp.1	+						CEP57_uc001pfo.1_Intron|CEP57_uc010ruh.1_Intron|CEP57_uc010rui.1_Intron|CEP57_uc009ywn.1_Intron|CEP57_uc001pfq.1_Intron|CEP57_uc001pfr.1_Intron	NM_014679	NP_055494			translokin						fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)												Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132527089	132527089	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132527089T>C	uc001qgs.2	-	2	343	c.293A>G	c.(292-294)TAC>TGC	p.Y98C	OPCML_uc001qgu.2_Missense_Mutation_p.Y91C|OPCML_uc010sck.1_Missense_Mutation_p.Y98C|OPCML_uc001qgt.2_Missense_Mutation_p.Y98C|OPCML_uc010scl.1_Missense_Mutation_p.Y57C	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	98	Ig-like C2-type 1.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
CLEC6A	93978	broad.mit.edu	37	12	8610588	8610588	+	Intron	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8610588G>A	uc001qum.1	+							NM_001007033	NP_001007034			dectin-2						defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding			breast(1)	1	Lung SC(5;0.184)																	---	---	---	---
PHC1	1911	broad.mit.edu	37	12	9074320	9074320	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9074320C>T	uc001qvd.2	+	5	586	c.430C>T	c.(430-432)CAG>TAG	p.Q144*	PHC1_uc001qvc.1_Nonsense_Mutation_p.Q107*|PHC1_uc010sgn.1_Nonsense_Mutation_p.Q144*|PHC1_uc001qve.2_Nonsense_Mutation_p.Q144*	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	144					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	21995340	21995340	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21995340C>T	uc001rfi.1	-	27	3401	c.3381G>A	c.(3379-3381)ATG>ATA	p.M1127I	ABCC9_uc001rfh.2_Missense_Mutation_p.M1127I|ABCC9_uc001rfj.1_Missense_Mutation_p.M1091I	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1127	ABC transmembrane type-1 2.|Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
PDZRN4	29951	broad.mit.edu	37	12	41900359	41900359	+	Silent	SNP	T	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41900359T>A	uc010skn.1	+	4	416	c.348T>A	c.(346-348)CCT>CCA	p.P116P	PDZRN4_uc001rmq.3_Silent_p.P57P|PDZRN4_uc009zjz.2_Silent_p.P55P|PDZRN4_uc001rmr.2_5'Flank	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	315							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)																---	---	---	---
PRICKLE1	144165	broad.mit.edu	37	12	42858256	42858256	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42858256A>C	uc010skv.1	-	7	1867	c.1580T>G	c.(1579-1581)CTG>CGG	p.L527R	PRICKLE1_uc001rnl.2_Missense_Mutation_p.L527R|PRICKLE1_uc010skw.1_Missense_Mutation_p.L527R|PRICKLE1_uc001rnm.2_Missense_Mutation_p.L527R	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	527					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)														---	---	---	---
KRT78	196374	broad.mit.edu	37	12	53242671	53242671	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53242671C>T	uc001sbc.1	-	1	108	c.44G>A	c.(43-45)CGC>CAC	p.R15H		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	15	Head.|Gly-rich.					keratin filament	protein binding|structural molecule activity			ovary(2)	2																		---	---	---	---
HOXC4	3221	broad.mit.edu	37	12	54447931	54447931	+	Silent	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54447931C>A	uc001seu.2	+	3	905	c.225C>A	c.(223-225)CCC>CCA	p.P75P	HOXC4_uc001sex.2_Silent_p.P75P	NM_014620	NP_055435	P09017	HXC4_HUMAN	homeobox C4	75						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85449766	85449766	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85449766G>C	uc001tac.2	+	8	1306	c.1195G>C	c.(1195-1197)GCA>CCA	p.A399P	LRRIQ1_uc001tab.1_Missense_Mutation_p.A399P|LRRIQ1_uc001taa.1_Missense_Mutation_p.A374P	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	399										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
KERA	11081	broad.mit.edu	37	12	91445274	91445274	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91445274C>A	uc001tbl.2	-	3	1527	c.908G>T	c.(907-909)TGT>TTT	p.C303F		NM_007035	NP_008966	O60938	KERA_HUMAN	keratocan precursor	303	LRR 10.				response to stimulus|visual perception	proteinaceous extracellular matrix				skin(1)	1																		---	---	---	---
C12orf63	374467	broad.mit.edu	37	12	97073407	97073407	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97073407G>A	uc001tet.1	+	7	946	c.868G>A	c.(868-870)GTG>ATG	p.V290M		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	290										skin(6)|ovary(1)	7																		---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104118856	104118856	+	Missense_Mutation	SNP	G	A	A	rs140998727		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104118856G>A	uc001tjw.2	+	45	4973	c.4787G>A	c.(4786-4788)CGC>CAC	p.R1596H	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1596	Extracellular (Potential).|FAS1 5.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	p.R1596R(1)		ovary(9)|skin(5)	14																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112600915	112600915	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112600915C>G	uc009zwc.2	-	68	11803	c.11785G>C	c.(11785-11787)GAT>CAT	p.D3929H		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124315205	124315205	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315205G>C	uc001uft.3	+	25	4175	c.4150G>C	c.(4150-4152)GAG>CAG	p.E1384Q		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1384	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
TUBA3C	7278	broad.mit.edu	37	13	19751671	19751671	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751671G>C	uc009zzj.2	-	4	501	c.452C>G	c.(451-453)TCT>TGT	p.S151C		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	151					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36379850	36379850	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36379850G>T	uc001uvf.2	-	15	2163	c.1930C>A	c.(1930-1932)CAT>AAT	p.H644N	DCLK1_uc001uve.3_Missense_Mutation_p.H337N|DCLK1_uc010teh.1_Missense_Mutation_p.H337N|DCLK1_uc010abk.2_Missense_Mutation_p.H164N	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	644	Protein kinase.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37446989	37446989	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37446989T>C	uc001uvw.2	-	3	819	c.476A>G	c.(475-477)AAG>AGG	p.K159R	SMAD9_uc001uvx.2_Missense_Mutation_p.K159R|SMAD9_uc010tep.1_5'UTR	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	159					BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
LRCH1	23143	broad.mit.edu	37	13	47263329	47263329	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47263329G>A	uc001vbj.2	+	7	1248	c.1012G>A	c.(1012-1014)GAG>AAG	p.E338K	LRCH1_uc010acp.2_Missense_Mutation_p.E338K|LRCH1_uc001vbk.2_Missense_Mutation_p.E338K|LRCH1_uc001vbl.3_Missense_Mutation_p.E338K	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)	338										ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)														---	---	---	---
CAB39L	81617	broad.mit.edu	37	13	49924993	49924993	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49924993G>A	uc001vcw.2	-	5	949	c.451C>T	c.(451-453)CGA>TGA	p.R151*	CAB39L_uc001vcx.2_Nonsense_Mutation_p.R151*|CAB39L_uc010adf.2_Nonsense_Mutation_p.R148*	NM_030925	NP_112187	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	151					cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84454621	84454621	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454621C>G	uc001vlk.2	-	1	1908	c.1022G>C	c.(1021-1023)TGC>TCC	p.C341S		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	341	Extracellular (Potential).|LRRNT 2.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88329122	88329122	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329122C>T	uc001vln.2	+	2	1698	c.1479C>T	c.(1477-1479)ATC>ATT	p.I493I	SLITRK5_uc010tic.1_Silent_p.I252I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	493	Extracellular (Potential).|LRR 10.					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88330443	88330443	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88330443G>T	uc001vln.2	+	2	3019	c.2800G>T	c.(2800-2802)GAG>TAG	p.E934*	SLITRK5_uc010tic.1_Nonsense_Mutation_p.E693*	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	934	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	22386711	22386711	+	Intron	SNP	T	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22386711T>G	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aiy.2_RNA|uc001wch.2_Missense_Mutation_p.I41M					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
MIPOL1	145282	broad.mit.edu	37	14	37739664	37739664	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37739664A>C	uc001wuc.2	+	7	930	c.427A>C	c.(427-429)AAA>CAA	p.K143Q	MIPOL1_uc010amr.2_RNA|MIPOL1_uc001wub.3_Missense_Mutation_p.K112Q|MIPOL1_uc001wud.2_Missense_Mutation_p.K143Q|MIPOL1_uc010ams.2_Missense_Mutation_p.K143Q|MIPOL1_uc001wue.2_Missense_Mutation_p.K112Q|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	143	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)														---	---	---	---
MLH3	27030	broad.mit.edu	37	14	75506730	75506730	+	Intron	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75506730C>T	uc001xrd.1	-						MLH3_uc001xre.1_Intron|MLH3_uc010tuy.1_Intron	NM_001040108	NP_001035197			mutL homolog 3 isoform 1						mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)									MMR					---	---	---	---
PTPN21	11099	broad.mit.edu	37	14	88945666	88945666	+	Silent	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88945666G>A	uc001xwv.3	-	13	2440	c.2109C>T	c.(2107-2109)GAC>GAT	p.D703D	PTPN21_uc010twc.1_Silent_p.D499D	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	703						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4																		---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94120100	94120100	+	Silent	SNP	C	T	T	rs139115792		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94120100C>T	uc001ybv.1	+	35	5831	c.5748C>T	c.(5746-5748)CCC>CCT	p.P1916P	KIAA1409_uc001ybs.1_Silent_p.P1894P	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2071						integral to membrane		p.P1894P(1)		ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
ATG2B	55102	broad.mit.edu	37	14	96789038	96789038	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96789038A>T	uc001yfi.2	-	17	2940	c.2575T>A	c.(2575-2577)TCC>ACC	p.S859T		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	859										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)														---	---	---	---
C14orf79	122616	broad.mit.edu	37	14	105457964	105457964	+	Intron	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105457964G>T	uc001ypy.1	+						C14orf79_uc001ypz.1_Intron|C14orf79_uc010tym.1_Intron	NM_174891	NP_777551			hypothetical protein LOC122616												0		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00326)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0181)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	25425725	25425725	+	5'Flank	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25425725C>T	uc001yyy.1	+						uc001yza.1_5'Flank|uc001yys.1_Intron|SNORD115-7_uc001yyw.1_Intron|SNORD115-6_uc001yyx.1_RNA|SNORD115-7_uc001yyz.2_5'Flank					Homo sapiens clone Rt-7 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																														---	---	---	---
RTF1	23168	broad.mit.edu	37	15	41763442	41763442	+	Silent	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41763442G>A	uc001zny.2	+	8	1110	c.1098G>A	c.(1096-1098)CGG>CGA	p.R366R		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	366	Plus3.				histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)														---	---	---	---
ANKDD1A	348094	broad.mit.edu	37	15	65226358	65226358	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65226358A>G	uc002aoa.2	+	9	820	c.791A>G	c.(790-792)TAT>TGT	p.Y264C	ANKDD1A_uc002aoc.2_RNA|ANKDD1A_uc010bha.2_Missense_Mutation_p.Y173C	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	264	ANK 8.				signal transduction					ovary(1)	1																		---	---	---	---
IL16	3603	broad.mit.edu	37	15	81584977	81584977	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81584977C>G	uc002bgh.3	+	12	1877	c.1501C>G	c.(1501-1503)CGC>GGC	p.R501G	IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Missense_Mutation_p.R501G|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.R543G|IL16_uc002bgg.2_Missense_Mutation_p.R501G|IL16_uc002bgi.1_Translation_Start_Site|IL16_uc002bgj.2_Translation_Start_Site|IL16_uc002bgk.2_5'Flank	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	501					immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
FBXL16	146330	broad.mit.edu	37	16	747115	747115	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:747115C>T	uc002cjc.2	-	3	494	c.291G>A	c.(289-291)ACG>ACA	p.T97T	FBXL16_uc002cja.2_5'Flank|FBXL16_uc002cjb.2_5'Flank	NM_153350	NP_699181	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	97	F-box.										0		Hepatocellular(780;0.0218)																---	---	---	---
PKMYT1	9088	broad.mit.edu	37	16	3025332	3025332	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3025332G>T	uc002csn.2	-	4	1303	c.860C>A	c.(859-861)GCG>GAG	p.A287E	PKMYT1_uc010uwn.1_RNA|PKMYT1_uc002csm.2_Missense_Mutation_p.A287E|PKMYT1_uc002cso.2_Missense_Mutation_p.A218E|PKMYT1_uc002csp.2_Missense_Mutation_p.A278E|PKMYT1_uc002csq.2_Missense_Mutation_p.A278E|PKMYT1_uc010bsy.1_Missense_Mutation_p.A278E	NM_004203	NP_004194	Q99640	PMYT1_HUMAN	protein kinase Myt1 isoform 1	287	Protein kinase.				G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis	endoplasmic reticulum membrane|Golgi membrane|membrane fraction|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1																		---	---	---	---
BTBD12	84464	broad.mit.edu	37	16	3647972	3647972	+	Missense_Mutation	SNP	G	A	A	rs138799572		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3647972G>A	uc002cvp.2	-	6	1819	c.1192C>T	c.(1192-1194)CGG>TGG	p.R398W		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	398	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0													Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7383011	7383011	+	Intron	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7383011G>A	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Silent_p.A3A|A2BP1_uc002cyy.2_Silent_p.A3A|A2BP1_uc002cyx.2_Silent_p.A3A|A2BP1_uc010uyc.1_Silent_p.A3A	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
ERCC4	2072	broad.mit.edu	37	16	14041537	14041537	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14041537T>C	uc002dce.2	+	11	2093	c.2084T>C	c.(2083-2085)CTT>CCT	p.L695P	ERCC4_uc010uyz.1_Missense_Mutation_p.L245P	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	695	ERCC4.|Interaction with EME1 and ERCC1.				double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10								Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				---	---	---	---
NOMO1	23420	broad.mit.edu	37	16	14947462	14947462	+	Splice_Site	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14947462G>T	uc002dcv.2	+	8	939	c.873_splice	c.e8+1	p.V291_splice		NM_014287	NP_055102			nodal modulator 1 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1																		---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21033315	21033315	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21033315C>T	uc010vbe.1	-	40	5754	c.5754G>A	c.(5752-5754)ATG>ATA	p.M1918I		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1918					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
SLC5A11	115584	broad.mit.edu	37	16	24918379	24918379	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24918379C>T	uc002dmu.2	+	12	1380	c.1148C>T	c.(1147-1149)GCG>GTG	p.A383V	SLC5A11_uc002dms.2_Missense_Mutation_p.A319V|SLC5A11_uc010vcd.1_Missense_Mutation_p.A348V|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Missense_Mutation_p.A313V|SLC5A11_uc010bxt.2_Missense_Mutation_p.A319V|SLC5A11_uc002dmv.2_Missense_Mutation_p.A6V	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	383	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)														---	---	---	---
ITGAD	3681	broad.mit.edu	37	16	31427817	31427817	+	Intron	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31427817C>G	uc002ebv.1	+						ITGAD_uc010cap.1_Intron	NM_005353	NP_005344			integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1																		---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72828655	72828655	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72828655C>A	uc002fck.2	-	9	8599	c.7926G>T	c.(7924-7926)AAG>AAT	p.K2642N	ZFHX3_uc002fcl.2_Missense_Mutation_p.K1728N	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	2642	Homeobox 3.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
SLC13A5	284111	broad.mit.edu	37	17	6607272	6607272	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6607272G>T	uc002gdj.2	-	4	560	c.472C>A	c.(472-474)CAG>AAG	p.Q158K	SLC13A5_uc010vtf.1_Missense_Mutation_p.Q158K|SLC13A5_uc010clq.2_Missense_Mutation_p.Q115K|SLC13A5_uc002gdk.2_Missense_Mutation_p.Q141K|SLC13A5_uc002gdl.1_Missense_Mutation_p.Q140K	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a	158						integral to membrane	citrate transmembrane transporter activity				0																		---	---	---	---
MYH13	8735	broad.mit.edu	37	17	10216513	10216513	+	Silent	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10216513C>A	uc002gmk.1	-	30	4233	c.4143G>T	c.(4141-4143)ACG>ACT	p.T1381T		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1381	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6																		---	---	---	---
MYH13	8735	broad.mit.edu	37	17	10224947	10224947	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10224947C>G	uc002gmk.1	-	24	3103	c.3013G>C	c.(3013-3015)GAG>CAG	p.E1005Q	MYH13_uc010vve.1_Missense_Mutation_p.E103Q	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1005	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6																		---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21319751	21319751	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319751A>C	uc002gyv.1	+	3	1802	c.1097A>C	c.(1096-1098)AAG>ACG	p.K366T		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	366	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
MPP2	4355	broad.mit.edu	37	17	41959871	41959871	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41959871C>T	uc010wip.1	-	6	654	c.597G>A	c.(595-597)ACG>ACA	p.T199T	MPP2_uc002ien.1_Silent_p.T171T|MPP2_uc010wim.1_Silent_p.T143T|MPP2_uc002ieo.1_Silent_p.T154T|MPP2_uc010win.1_Silent_p.T15T|MPP2_uc010wio.1_Silent_p.T143T|MPP2_uc010czm.1_Silent_p.T137T	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2	178					signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)														---	---	---	---
SCPEP1	59342	broad.mit.edu	37	17	55058576	55058576	+	Silent	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55058576G>T	uc002iuv.3	+	2	263	c.210G>T	c.(208-210)CTG>CTT	p.L70L	SCPEP1_uc010dcl.2_RNA|SCPEP1_uc010wnk.1_Silent_p.L20L	NM_021626	NP_067639	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1 precursor	70					proteolysis	extracellular region	serine-type carboxypeptidase activity			skin(1)	1	Breast(9;2.86e-08)																	---	---	---	---
METTL4	64863	broad.mit.edu	37	18	2539062	2539062	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2539062C>T	uc002klh.3	-	9	2136	c.1356G>A	c.(1354-1356)TGG>TGA	p.W452*	METTL4_uc010dkj.2_3'UTR	NM_022840	NP_073751	Q8N3J2	METL4_HUMAN	methyltransferase like 4	452					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding			kidney(1)|skin(1)	2																		---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	6983112	6983112	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6983112T>A	uc002knm.2	-	40	5876	c.5782A>T	c.(5782-5784)ACT>TCT	p.T1928S	LAMA1_uc010wzj.1_Missense_Mutation_p.T1404S	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1928	Domain II and I.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
ADAMTS10	81794	broad.mit.edu	37	19	8670006	8670006	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8670006C>A	uc002mkj.1	-	4	600	c.326G>T	c.(325-327)CGG>CTG	p.R109L	ADAMTS10_uc002mkk.1_5'UTR	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	109					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	8994159	8994159	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8994159G>T	uc002mkp.2	-	65	41730	c.41526C>A	c.(41524-41526)TGC>TGA	p.C13842*	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Nonsense_Mutation_p.C659*|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13845	Extracellular (Potential).|SEA 12.			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
DOCK6	57572	broad.mit.edu	37	19	11313353	11313353	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11313353G>C	uc002mqs.3	-	42	5309	c.5268C>G	c.(5266-5268)TTC>TTG	p.F1756L	DOCK6_uc002mqr.3_Missense_Mutation_p.F156L|DOCK6_uc010xlq.1_Missense_Mutation_p.F1095L	NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1756	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
BEST2	54831	broad.mit.edu	37	19	12866462	12866462	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12866462G>A	uc002mux.2	+	6	748	c.748G>A	c.(748-750)GCT>ACT	p.A250T		NM_017682	NP_060152	Q8NFU1	BEST2_HUMAN	vitelliform macular dystrophy 2-like 1	250	Extracellular (Potential).				membrane depolarization|sensory perception of smell	chloride channel complex|cilium|plasma membrane	chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
PGLYRP2	114770	broad.mit.edu	37	19	15587424	15587424	+	Intron	SNP	A	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15587424A>C	uc002nbf.3	-						PGLYRP2_uc002nbg.3_Intron	NM_052890	NP_443122			peptidoglycan recognition protein 2 precursor						defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ZNF626	199777	broad.mit.edu	37	19	20807787	20807787	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807787G>A	uc002npb.1	-	4	1046	c.896C>T	c.(895-897)ACC>ATC	p.T299I	ZNF626_uc002npc.1_Missense_Mutation_p.T223I	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	299	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
ZNF626	199777	broad.mit.edu	37	19	20807796	20807796	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807796C>T	uc002npb.1	-	4	1037	c.887G>A	c.(886-888)CGG>CAG	p.R296Q	ZNF626_uc002npc.1_Missense_Mutation_p.R220Q	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	296	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45239108	45239108	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45239108C>A	uc002xsf.1	-	3	556	c.518G>T	c.(517-519)AGC>ATC	p.S173I	SLC13A3_uc010ghn.1_Missense_Mutation_p.S142I|SLC13A3_uc010zxw.1_Missense_Mutation_p.S173I|SLC13A3_uc002xsg.1_Missense_Mutation_p.S126I|SLC13A3_uc010gho.1_Missense_Mutation_p.S126I|SLC13A3_uc010zxx.1_Missense_Mutation_p.S75I|SLC13A3_uc002xsi.3_Missense_Mutation_p.S126I	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	173	Cytoplasmic (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32492849	32492849	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32492849C>T	uc002yow.1	-	29	5085	c.4613G>A	c.(4612-4614)AGA>AAA	p.R1538K	TIAM1_uc011adk.1_3'UTR|TIAM1_uc011adl.1_Missense_Mutation_p.R1478K	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1538					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
MX2	4600	broad.mit.edu	37	21	42770928	42770928	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42770928G>T	uc002yzf.1	+	9	1358	c.1254G>T	c.(1252-1254)AAG>AAT	p.K418N	MX2_uc011aer.1_RNA|MX2_uc002yzg.1_Missense_Mutation_p.K141N|MX2_uc010gop.1_5'UTR	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	418					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)																---	---	---	---
MCM3AP	8888	broad.mit.edu	37	21	47703695	47703695	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47703695A>G	uc002zir.1	-	2	1313	c.1277T>C	c.(1276-1278)CTT>CCT	p.L426P	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	426					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)																	---	---	---	---
CECR1	51816	broad.mit.edu	37	22	17670888	17670888	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17670888G>A	uc002zmk.1	-	5	1128	c.916C>T	c.(916-918)CGA>TGA	p.R306*	CECR1_uc010gqu.1_Nonsense_Mutation_p.R306*|CECR1_uc011agi.1_Nonsense_Mutation_p.R264*|CECR1_uc011agj.1_3'UTR|CECR1_uc002zmj.1_Nonsense_Mutation_p.R65*	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	306					adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)																---	---	---	---
PPM1F	9647	broad.mit.edu	37	22	22287943	22287943	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22287943C>T	uc002zvp.1	-	5	681	c.567G>A	c.(565-567)GTG>GTA	p.V189V	PPM1F_uc011aik.1_Silent_p.V85V|PPM1F_uc002zvq.2_Silent_p.V189V	NM_014634	NP_055449	P49593	PPM1F_HUMAN	protein phosphatase 1F	189					apoptosis|protein dephosphorylation	protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(2)|large_intestine(1)|breast(1)|kidney(1)	5	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)														---	---	---	---
TFIP11	24144	broad.mit.edu	37	22	26906070	26906070	+	Silent	SNP	G	T	T	rs140252083		TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26906070G>T	uc003acr.2	-	3	543	c.169C>A	c.(169-171)CGA>AGA	p.R57R	TFIP11_uc003acs.2_Silent_p.R57R|TFIP11_uc003act.2_Silent_p.R57R	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	57					biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
SMCR7L	54471	broad.mit.edu	37	22	39909957	39909957	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39909957C>A	uc003axx.2	+	6	1519	c.1021C>A	c.(1021-1023)CTG>ATG	p.L341M	SMCR7L_uc003axw.2_Missense_Mutation_p.L341M|SMCR7L_uc010gxz.1_Missense_Mutation_p.L163M|SMCR7L_uc003axy.2_Missense_Mutation_p.L163M	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN	hypothetical protein LOC54471	341						integral to membrane|mitochondrion				central_nervous_system(1)	1	Melanoma(58;0.04)															OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SLC25A6	293	broad.mit.edu	37	X	1508415	1508415	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1508415T>C	uc004cpt.2	-	2	413	c.317A>G	c.(316-318)CAC>CGC	p.H106R	SLC25A6_uc004cpu.2_RNA	NM_001636	NP_001627	P12236	ADT3_HUMAN	adenine nucleotide translocator 3	106				KHTQ -> RHA (in Ref. 5; AAA36750).	active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)													---	---	---	---
GPR173	54328	broad.mit.edu	37	X	53106025	53106025	+	Silent	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53106025C>T	uc004dru.2	+	2	480	c.222C>T	c.(220-222)GTC>GTT	p.V74V		NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	74	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
PCDH11X	27328	broad.mit.edu	37	X	91133209	91133209	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133209C>A	uc004efk.1	+	2	2815	c.1970C>A	c.(1969-1971)GCC>GAC	p.A657D	PCDH11X_uc004efl.1_Missense_Mutation_p.A657D|PCDH11X_uc004efo.1_Missense_Mutation_p.A657D|PCDH11X_uc010nmv.1_Missense_Mutation_p.A657D|PCDH11X_uc004efm.1_Missense_Mutation_p.A657D|PCDH11X_uc004efn.1_Missense_Mutation_p.A657D|PCDH11X_uc004efh.1_Missense_Mutation_p.A657D|PCDH11X_uc004efj.1_Missense_Mutation_p.A657D	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	657	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2																		---	---	---	---
CAPN6	827	broad.mit.edu	37	X	110496246	110496246	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110496246C>T	uc004epc.1	-	4	664	c.496G>A	c.(496-498)GCT>ACT	p.A166T	CAPN6_uc011msu.1_5'UTR	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	166	Calpain catalytic.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
ODZ1	10178	broad.mit.edu	37	X	124028133	124028133	+	Intron	SNP	G	T	T			TCGA-CG-4476-01	TCGA-CG-4476-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124028133G>T	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068			odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23																		---	---	---	---
