Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRKCZ	5590	broad.mit.edu	37	1	1986737	1986737	+	Intron	DEL	A	-	-	rs35052584		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1986737delA	uc001aiq.2	+							NM_002744	NP_002735			protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
TUFT1	7286	broad.mit.edu	37	1	151530466	151530466	+	Intron	DEL	A	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151530466delA	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512			tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
CD55	1604	broad.mit.edu	37	1	207504820	207504821	+	Intron	DEL	AC	-	-	rs67713531		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207504820_207504821delAC	uc001hfq.3	+						CD55_uc001hfp.3_Intron|CD55_uc001hfr.3_Intron|CD55_uc010psf.1_Intron|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Intron|CD55_uc009xcg.2_Intron	NM_000574	NP_000565			decay accelerating factor for complement isoform						complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)													---	---	---	---
USH2A	7399	broad.mit.edu	37	1	215814186	215814186	+	Intron	DEL	C	-	-	rs78797010		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215814186delC	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	64603416	64603417	+	IGR	INS	-	CACCACCAT	CACCACCAT	rs141783487	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603416_64603417insCACCACCAT								PELI1 (231811 upstream) : HSPC159 (77910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
IQCG	84223	broad.mit.edu	37	3	197665189	197665189	+	Intron	DEL	A	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197665189delA	uc003fyo.2	-						IQCG_uc003fyn.2_Intron|IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907			IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)														---	---	---	---
QDPR	5860	broad.mit.edu	37	4	17513499	17513499	+	Intron	DEL	C	-	-	rs112530867		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17513499delC	uc003gpd.2	-						QDPR_uc003gpe.2_Intron|QDPR_uc003gpf.2_Intron	NM_000320	NP_000311			quinoid dihydropteridine reductase						dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity			ovary(1)	1					NADH(DB00157)													---	---	---	---
KDR	3791	broad.mit.edu	37	4	55981760	55981761	+	Intron	DEL	TG	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55981760_55981761delTG	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244			kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---
EGF	1950	broad.mit.edu	37	4	110925371	110925372	+	Intron	INS	-	AC	AC	rs35428416		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925371_110925372insAC	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954			epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)													---	---	---	---
TRIML1	339976	broad.mit.edu	37	4	189063287	189063287	+	Intron	DEL	G	-	-	rs28719886		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189063287delG	uc003izm.1	+						TRIML1_uc003izn.1_5'Flank	NM_178556	NP_848651			tripartite motif family-like 1						multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687			hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
UBE2D2	7322	broad.mit.edu	37	5	138991547	138991547	+	Intron	DEL	T	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138991547delT	uc003ler.2	+						UBE2D2_uc003leq.2_Intron	NM_003339	NP_003330			ubiquitin-conjugating enzyme E2D 2 isoform 1						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
DCTN4	51164	broad.mit.edu	37	5	150136201	150136202	+	Intron	INS	-	T	T	rs76622369		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150136201_150136202insT	uc003lsv.2	-						DCTN4_uc003lsu.2_Intron|DCTN4_uc010jhi.2_Intron|DCTN4_uc010jhj.2_Intron|DCTN4_uc011dck.1_Intron	NM_016221	NP_057305			dynactin 4 (p62) isoform b							centrosome|nucleus	protein N-terminus binding			central_nervous_system(1)	1		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SFXN1	94081	broad.mit.edu	37	5	174938744	174938745	+	Intron	DEL	TG	-	-	rs3834721		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174938744_174938745delTG	uc003mda.2	+						SFXN1_uc003mdb.1_Intron	NM_022754	NP_073591			sideroflexin 1						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity|protein binding			ovary(1)	1	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
BAT3	7917	broad.mit.edu	37	6	31615793	31615794	+	Intron	INS	-	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31615793_31615794insT	uc003nvg.3	-						BAT3_uc003nvf.3_Intron|BAT3_uc003nvh.3_Intron|BAT3_uc003nvi.3_Intron|BAT3_uc011dnw.1_Intron|BAT3_uc011dnx.1_Intron|BAT3_uc003nvj.1_Intron	NM_004639	NP_004630			HLA-B associated transcript-3 isoform a						apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0																		---	---	---	---
FAM71F2	346653	broad.mit.edu	37	7	128312704	128312704	+	Intron	DEL	G	-	-	rs10265601		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128312704delG	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457			hypothetical protein LOC346653 isoform a												0																OREG0018296	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130288599	130288599	+	Intron	DEL	A	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130288599delA	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
TMEM176A	55365	broad.mit.edu	37	7	150499164	150499165	+	Intron	INS	-	TTCTC	TTCTC	rs137988135		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150499164_150499165insTTCTC	uc003whx.1	+						TMEM176B_uc003whu.3_5'Flank|TMEM176B_uc003whv.3_5'Flank|TMEM176B_uc003whw.3_5'Flank	NM_018487	NP_060957			hepatocellular carcinoma-associated antigen 112							integral to membrane				ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
SLC25A32	81034	broad.mit.edu	37	8	104416833	104416834	+	Intron	INS	-	C	C	rs1865855	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104416833_104416834insC	uc003yll.2	-						SLC25A32_uc011lhr.1_Intron	NM_030780	NP_110407			solute carrier family 25, member 32						folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)													---	---	---	---
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195			mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)													---	---	---	---
NET1	10276	broad.mit.edu	37	10	5499147	5499147	+	3'UTR	DEL	T	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5499147delT	uc001iia.2	+	12					NET1_uc010qar.1_3'UTR|NET1_uc001iib.2_3'UTR|NET1_uc010qas.1_3'UTR	NM_001047160	NP_001040625			neuroepithelial cell transforming gene 1 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	42672528	42672528	+	IGR	DEL	C	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42672528delC								None (None upstream) : LOC441666 (154787 downstream)																																			---	---	---	---
KRTAP5-5	439915	broad.mit.edu	37	11	1651199	1651228	+	In_Frame_Del	DEL	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	rs144216147	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651199_1651228delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	uc001lty.2	+	1	167_196	c.129_158delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	c.(127-159)GGAGGCTGTGGGGGCTGTGGCTCCGGCTGTGCG>GGG	p.GCGGCGSGCA44del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44_53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10653738	10653738	+	Intron	DEL	T	-	-	rs72349102		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10653738delT	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637			JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
SF3B2	10992	broad.mit.edu	37	11	65825443	65825444	+	Intron	INS	-	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825443_65825444insA	uc001ogy.1	+							NM_006842	NP_006833			splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3																		---	---	---	---
UCP2	7351	broad.mit.edu	37	11	73686860	73686862	+	Intron	DEL	CTT	-	-	rs141148353		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73686860_73686862delCTT	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346			uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)																	---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73796187	73796188	+	Intron	INS	-	T	T	rs74787473		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73796187_73796188insT	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346			C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
VSIG10	54621	broad.mit.edu	37	12	118519822	118519823	+	Intron	INS	-	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118519822_118519823insA	uc001tws.2	-							NM_019086	NP_061959			V-set and immunoglobulin domain containing 10							integral to membrane					0																		---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109859345	109859354	+	3'UTR	DEL	TGTGTGTGTT	-	-	rs71670580		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109859345_109859354delTGTGTGTGTT	uc001vqt.1	+	35					MYO16_uc010agk.1_3'UTR	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
ATP5S	27109	broad.mit.edu	37	14	50789101	50789102	+	Intron	INS	-	ATAC	ATAC	rs148370941	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50789101_50789102insATAC	uc001wxw.1	+						ATP5S_uc001wxv.2_Intron|ATP5S_uc001wxx.1_Intron|ATP5S_uc010ant.1_Intron	NM_001003803	NP_001003803			ATP synthase, H+ transporting, mitochondrial F0						ATP biosynthetic process	mitochondrial inner membrane|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity			ovary(1)|skin(1)	2	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	56010632	56010632	+	IGR	DEL	T	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56010632delT								TBPL2 (103369 upstream) : C14orf33 (14058 downstream)																																			---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64685821	64685822	+	Intron	DEL	TG	-	-	rs59649607		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64685821_64685822delTG	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron|SYNE2_uc001xgr.2_Intron|SYNE2_uc010tsi.1_Intron|SYNE2_uc001xgs.2_Intron|SYNE2_uc001xgt.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	93814196	93814196	+	Intron	DEL	A	-	-	rs112422740		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93814196delA	uc001ybs.1	+						COX8C_uc001ybt.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
ARHGAP11B	89839	broad.mit.edu	37	15	30919319	30919320	+	Intron	INS	-	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30919319_30919320insT	uc001zet.1	+						ARHGAP11B_uc010azv.1_Intron|ARHGAP11B_uc001zeu.2_Intron	NM_001039841	NP_001034930			Rho GTPase activating protein 11B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)														---	---	---	---
ZSCAN29	146050	broad.mit.edu	37	15	43661548	43661549	+	Intron	INS	-	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43661548_43661549insA	uc001zrk.1	-						ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc010bdf.1_Intron|ZSCAN29_uc001zrl.1_Intron|ZSCAN29_uc010bdg.1_Intron|ZSCAN29_uc001zrm.2_Intron|TUBGCP4_uc001zrn.2_5'Flank|TUBGCP4_uc001zro.2_5'Flank	NM_152455	NP_689668			zinc finger protein 690						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)														---	---	---	---
NEO1	4756	broad.mit.edu	37	15	73552409	73552409	+	Intron	DEL	T	-	-	rs34823408		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73552409delT	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490			neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1																		---	---	---	---
POLG	5428	broad.mit.edu	37	15	89860990	89860991	+	Intron	INS	-	T	T	rs34171931		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89860990_89860991insT	uc002bns.3	-						POLG_uc002bnr.3_Intron	NM_002693	NP_002684			DNA-directed DNA polymerase gamma						base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)										DNA_polymerases_(catalytic_subunits)					---	---	---	---
CACNG3	10368	broad.mit.edu	37	16	24357903	24357903	+	Intron	DEL	A	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24357903delA	uc002dmf.2	+							NM_006539	NP_006530			voltage-dependent calcium channel gamma-3						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)														---	---	---	---
LOC595101	595101	broad.mit.edu	37	16	30347982	30347983	+	5'Flank	INS	-	T	T	rs148333845		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30347982_30347983insT	uc002dxp.1	-							NR_002453				Homo sapiens cDNA FLJ39663 fis, clone SMINT2007187.												0																		---	---	---	---
VPS35	55737	broad.mit.edu	37	16	46714944	46714945	+	Intron	INS	-	AC	AC	rs148688318	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46714944_46714945insAC	uc002eef.3	-						VPS35_uc002eed.2_5'Flank|VPS35_uc002eee.2_Intron	NM_018206	NP_060676			vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)																---	---	---	---
LRRC50	123872	broad.mit.edu	37	16	84193579	84193579	+	Intron	DEL	T	-	-	rs11292642		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84193579delT	uc002fhl.3	+						LRRC50_uc010vnw.1_Intron	NM_178452	NP_848547			leucine rich repeat containing 50						axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0														Kartagener_syndrome				---	---	---	---
ELAC2	60528	broad.mit.edu	37	17	12908601	12908606	+	Intron	DEL	GTAACT	-	-	rs10532461		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12908601_12908606delGTAACT	uc002gnz.3	-						ELAC2_uc002gnv.3_5'Flank|ELAC2_uc002gnw.3_5'Flank|ELAC2_uc002gnx.3_Intron|ELAC2_uc010vvo.1_Intron|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597			elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0														Hereditary_Prostate_Cancer				---	---	---	---
BAHCC1	57597	broad.mit.edu	37	17	79418983	79418984	+	Intron	INS	-	C	C	rs147840370	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79418983_79418984insC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988			BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74583446	74583447	+	Intron	INS	-	T	T	rs139479077	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74583446_74583447insT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron|ZNF236_uc002lmk.1_Intron	NM_007345	NP_031371			zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	3776194	3776195	+	IGR	INS	-	AAGTG	AAGTG	rs148480350	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3776194_3776195insAAGTG								RAX2 (3975 upstream) : MATK (1773 downstream)																																			---	---	---	---
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958			scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)														---	---	---	---
EPOR	2057	broad.mit.edu	37	19	11488454	11488455	+	3'UTR	DEL	TA	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11488454_11488455delTA	uc002mrh.2	-	2										SubName: Full=Erythropoietin receptor; Flags: Fragment;							extracellular region|integral to plasma membrane	erythropoietin receptor activity|identical protein binding			ovary(1)	1					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
HIF3A	64344	broad.mit.edu	37	19	46811257	46811260	+	Intron	DEL	AGAT	-	-	rs59642371	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46811257_46811260delAGAT	uc002peh.2	+						HIF3A_uc002pef.1_Intron|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008			hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)														---	---	---	---
BRSK1	84446	broad.mit.edu	37	19	55813840	55813840	+	Intron	DEL	G	-	-	rs5828617		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55813840delG	uc002qkg.2	+						BRSK1_uc002qkf.2_Intron|BRSK1_uc002qkh.2_Intron	NM_032430	NP_115806			BR serine/threonine kinase 1						establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)												OREG0025680	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	20	17169112	17169113	+	IGR	INS	-	T	T	rs142333729	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17169112_17169113insT								OTOR (436304 upstream) : PCSK2 (37639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9590549	9590550	+	IGR	INS	-	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9590549_9590550insA								None (None upstream) : None (None downstream)																																			---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
SLC37A1	54020	broad.mit.edu	37	21	43995178	43995179	+	Intron	INS	-	TC	TC	rs143404028	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43995178_43995179insTC	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837			solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0																OREG0026239	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47864968	47864969	+	Intron	INS	-	T	T	rs147675714	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47864968_47864969insT	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022			pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
PIWIL3	440822	broad.mit.edu	37	22	25153627	25153628	+	Intron	DEL	AC	-	-	rs62232189		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25153627_25153628delAC	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496			piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	70183298	70183302	+	IGR	DEL	AGGGA	-	-			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70183298_70183302delAGGGA								SLC7A3 (32339 upstream) : SNX12 (26062 downstream)																																			---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34182100	34182100	+	Silent	SNP	A	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34182100A>C	uc001bxn.1	-	20	2912	c.2883T>G	c.(2881-2883)GGT>GGG	p.G961G	CSMD2_uc001bxm.1_Silent_p.G1001G	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	961	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
C8A	731	broad.mit.edu	37	1	57349320	57349320	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57349320C>A	uc001cyo.2	+	6	953	c.821C>A	c.(820-822)TCA>TAA	p.S274*		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	274	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
HHLA3	11147	broad.mit.edu	37	1	70832118	70832118	+	Intron	SNP	C	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70832118C>A	uc001dfa.2	+						HHLA3_uc010oqp.1_Intron|HHLA3_uc001dfb.2_Intron|HHLA3_uc001dfc.2_Intron	NM_001036645	NP_001031722			HERV-H LTR-associating 3 isoform 2								protein binding				0																		---	---	---	---
NCSTN	23385	broad.mit.edu	37	1	160327004	160327004	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160327004C>T	uc001fvx.2	+	16	2092	c.1968C>T	c.(1966-1968)ATC>ATT	p.I656I	NCSTN_uc001fvy.2_Silent_p.I636I|NCSTN_uc010pjf.1_Silent_p.I518I|NCSTN_uc001fvz.2_Silent_p.I436I|NCSTN_uc010pjg.1_Silent_p.I398I	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	656	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164761842	164761842	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164761842C>T	uc001gct.2	+	3	635	c.377C>T	c.(376-378)TCG>TTG	p.S126L	PBX1_uc010pku.1_Missense_Mutation_p.S126L|PBX1_uc010pkv.1_Missense_Mutation_p.S43L|PBX1_uc001gcs.2_Missense_Mutation_p.S126L|PBX1_uc010pkw.1_Missense_Mutation_p.S16L	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	126					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
SLC9A11	284525	broad.mit.edu	37	1	173552664	173552664	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173552664G>A	uc001giz.2	-	6	1044	c.621C>T	c.(619-621)ATC>ATT	p.I207I	SLC9A11_uc010pmq.1_RNA	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	207					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2																		---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196274444	196274444	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196274444G>A	uc001gtd.1	-	22	2575	c.2515C>T	c.(2515-2517)CTA>TTA	p.L839L	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.L765L|KCNT2_uc001gtf.1_Silent_p.L815L|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Silent_p.L815L|KCNT2_uc001gth.1_Silent_p.L336L	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	839	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216741435	216741435	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216741435G>T	uc001hkw.1	-	4	761	c.595C>A	c.(595-597)CGT>AGT	p.R199S	ESRRG_uc001hky.1_Missense_Mutation_p.R176S|ESRRG_uc009xdp.1_Missense_Mutation_p.R176S|ESRRG_uc001hkz.1_Missense_Mutation_p.R137S|ESRRG_uc010puc.1_Missense_Mutation_p.R176S|ESRRG_uc001hla.1_Missense_Mutation_p.R176S|ESRRG_uc001hlb.1_Missense_Mutation_p.R176S|ESRRG_uc010pud.1_Missense_Mutation_p.R7S|ESRRG_uc001hlc.1_Missense_Mutation_p.R176S|ESRRG_uc001hld.1_Missense_Mutation_p.R176S|ESRRG_uc001hkx.1_Missense_Mutation_p.R204S|ESRRG_uc009xdo.1_Missense_Mutation_p.R176S|ESRRG_uc001hle.1_Missense_Mutation_p.R176S	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	199	Nuclear receptor.				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237796936	237796936	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237796936G>A	uc001hyl.1	+	43	6734	c.6614G>A	c.(6613-6615)CGT>CAT	p.R2205H		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2205	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240256750	240256750	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240256750G>A	uc010pyd.1	+	1	1566	c.1341G>A	c.(1339-1341)CCG>CCA	p.P447P	FMN2_uc010pye.1_Silent_p.P447P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	447					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
CCDC93	54520	broad.mit.edu	37	2	118703100	118703100	+	Intron	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118703100C>T	uc002tlj.2	-						CCDC93_uc010fld.1_Intron	NM_019044	NP_061917			coiled-coil domain containing 93											large_intestine(1)|ovary(1)	2																		---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7494338	7494338	+	Nonsense_Mutation	SNP	A	T	T	rs144288627		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7494338A>T	uc003bqm.2	+	6	1493	c.1219A>T	c.(1219-1221)AAA>TAA	p.K407*	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Nonsense_Mutation_p.K407*|GRM7_uc003bql.2_Nonsense_Mutation_p.K407*|GRM7_uc003bqn.1_5'UTR|GRM7_uc010hch.1_5'UTR	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	407	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52403955	52403955	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52403955G>A	uc011bef.1	+	38	6319	c.6058G>A	c.(6058-6060)GAG>AAG	p.E2020K		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2020	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96706450	96706450	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706450G>A	uc010how.1	+	3	770	c.727G>A	c.(727-729)GAC>AAC	p.D243N	EPHA6_uc003drp.1_Missense_Mutation_p.D243N	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	148	Ephrin-binding.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
CEP63	80254	broad.mit.edu	37	3	134256003	134256003	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134256003C>T	uc003eqo.1	+	7	897	c.448C>T	c.(448-450)CGT>TGT	p.R150C	CEP63_uc003eql.1_Missense_Mutation_p.R150C|CEP63_uc003eqm.2_Missense_Mutation_p.R150C|CEP63_uc003eqn.1_Missense_Mutation_p.R150C	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a	150	Potential.				cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1																		---	---	---	---
IGSF10	285313	broad.mit.edu	37	3	151171512	151171512	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151171512A>T	uc011bod.1	-	3	375	c.375T>A	c.(373-375)TTT>TTA	p.F125L		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	125	LRR 3.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
P2RY1	5028	broad.mit.edu	37	3	152554282	152554282	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152554282C>T	uc003ezq.2	+	1	1547	c.711C>T	c.(709-711)TAC>TAT	p.Y237Y		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	237	Helical; Name=5; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)															---	---	---	---
MASP1	5648	broad.mit.edu	37	3	186953885	186953885	+	Intron	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186953885C>T	uc003frh.1	-						MASP1_uc003fri.2_Missense_Mutation_p.G592S|MASP1_uc003frj.2_Missense_Mutation_p.G561S	NM_001879	NP_001870			mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)														---	---	---	---
RBM47	54502	broad.mit.edu	37	4	40438457	40438457	+	Splice_Site	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40438457C>T	uc003gvc.2	-	5	2040	c.1330_splice	c.e5+1	p.V444_splice	RBM47_uc003gvd.2_Intron|RBM47_uc003gve.2_Splice_Site|RBM47_uc011bys.1_Splice_Site_p.V406_splice	NM_001098634	NP_001092104			RNA binding motif protein 47 isoform a							nucleus	nucleotide binding|RNA binding			breast(3)	3																		---	---	---	---
RASSF6	166824	broad.mit.edu	37	4	74447534	74447534	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74447534C>T	uc003hhd.1	-	8	940	c.817G>A	c.(817-819)GAA>AAA	p.E273K	RASSF6_uc003hhc.1_Missense_Mutation_p.E241K|RASSF6_uc010iik.1_Missense_Mutation_p.E207K|RASSF6_uc010iil.1_Missense_Mutation_p.E229K	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	273	Ras-associating.				apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)															---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77677626	77677626	+	Silent	SNP	A	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77677626A>T	uc011cbx.1	+	8	5687	c.4734A>T	c.(4732-4734)ACA>ACT	p.T1578T	SHROOM3_uc003hkg.2_Silent_p.T1356T	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	1578					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94436497	94436497	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94436497C>T	uc011cdt.1	+	13	2386	c.2128C>T	c.(2128-2130)CGG>TGG	p.R710W	GRID2_uc011cdu.1_Missense_Mutation_p.R615W	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	710	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162459360	162459360	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162459360C>G	uc003iqh.2	-	10	1706	c.1270G>C	c.(1270-1272)GAC>CAC	p.D424H	FSTL5_uc003iqi.2_Missense_Mutation_p.D423H|FSTL5_uc010iqv.2_Missense_Mutation_p.D423H	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	424	Ig-like 2.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13769728	13769728	+	Intron	SNP	G	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13769728G>T	uc003jfd.2	-						DNAH5_uc003jfc.2_5'Flank	NM_001369	NP_001360			dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288672	65288672	+	Silent	SNP	T	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288672T>C	uc003juk.1	+	3	434	c.126T>C	c.(124-126)TTT>TTC	p.F42F	ERBB2IP_uc003juh.1_Silent_p.F42F|ERBB2IP_uc003jui.1_Silent_p.F42F|ERBB2IP_uc003juj.1_Silent_p.F42F|ERBB2IP_uc011cqx.1_Silent_p.F42F|ERBB2IP_uc011cqy.1_Silent_p.F42F|ERBB2IP_uc011cqz.1_Silent_p.F42F|ERBB2IP_uc010iwx.1_Silent_p.F42F|ERBB2IP_uc003jul.1_Silent_p.F42F	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	42	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65342364	65342364	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65342364G>C	uc003juk.1	+	18	2094	c.1786G>C	c.(1786-1788)GAG>CAG	p.E596Q	ERBB2IP_uc003juh.1_Missense_Mutation_p.E592Q|ERBB2IP_uc003jui.1_Missense_Mutation_p.E596Q|ERBB2IP_uc003juj.1_Missense_Mutation_p.E596Q|ERBB2IP_uc011cqx.1_Missense_Mutation_p.E596Q|ERBB2IP_uc011cqy.1_Missense_Mutation_p.E596Q|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Missense_Mutation_p.E592Q|ERBB2IP_uc003jul.1_Missense_Mutation_p.E592Q	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	596					basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3287186	3287186	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3287186C>T	uc003mvm.3	-	7	1453	c.1453G>A	c.(1453-1455)GTG>ATG	p.V485M	uc003mvi.1_RNA|SLC22A23_uc003mvn.3_Missense_Mutation_p.V204M|SLC22A23_uc003mvo.3_Missense_Mutation_p.V204M|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.V485M|SLC22A23_uc003mvq.1_RNA	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a	485	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
KIAA0319	9856	broad.mit.edu	37	6	24596282	24596282	+	Missense_Mutation	SNP	G	A	A	rs141114963		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24596282G>A	uc011djo.1	-	3	857	c.620C>T	c.(619-621)GCG>GTG	p.A207V	KIAA0319_uc011djp.1_Missense_Mutation_p.A162V|KIAA0319_uc003neh.1_Missense_Mutation_p.A207V|KIAA0319_uc011djq.1_Missense_Mutation_p.A198V|KIAA0319_uc011djr.1_Missense_Mutation_p.A207V	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	207	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2																		---	---	---	---
TREML4	285852	broad.mit.edu	37	6	41196676	41196676	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41196676G>A	uc003oqc.2	+	2	392	c.288G>A	c.(286-288)ATG>ATA	p.M96I	TREML4_uc003oqd.2_RNA	NM_198153	NP_937796	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid	96	Ig-like V-type.					extracellular region				breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)																	---	---	---	---
LMBRD1	55788	broad.mit.edu	37	6	70459254	70459254	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70459254C>A	uc003pfa.2	-	5	567	c.452G>T	c.(451-453)TGT>TTT	p.C151F	LMBRD1_uc003pez.2_Missense_Mutation_p.C78F|LMBRD1_uc010kal.2_Missense_Mutation_p.C78F|LMBRD1_uc003pfb.2_Intron	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	151	Helical; Name=4; (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1																		---	---	---	---
ME1	4199	broad.mit.edu	37	6	83937127	83937127	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83937127G>T	uc003pjy.2	-	11	1308	c.1202C>A	c.(1201-1203)CCT>CAT	p.P401H	ME1_uc011dzb.1_Missense_Mutation_p.P326H|ME1_uc011dzc.1_Missense_Mutation_p.P235H	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	401					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)													---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166883325	166883325	+	Intron	SNP	T	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166883325T>G	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
ITGB8	3696	broad.mit.edu	37	7	20421359	20421359	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20421359G>C	uc003suu.2	+	6	1516	c.811G>C	c.(811-813)GGA>CGA	p.G271R	ITGB8_uc011jyh.1_Missense_Mutation_p.G136R|ITGB8_uc003sut.2_Missense_Mutation_p.G271R	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	271	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3																		---	---	---	---
GRM3	2913	broad.mit.edu	37	7	86416011	86416011	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86416011C>T	uc003uid.2	+	3	2002	c.903C>T	c.(901-903)GAC>GAT	p.D301D	GRM3_uc010lef.2_Silent_p.D299D|GRM3_uc010leg.2_Silent_p.D173D|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	301	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)													---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100701312	100701312	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100701312C>T	uc003uxp.1	+	13	13522	c.13469C>T	c.(13468-13470)ACG>ATG	p.T4490M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4490	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
LRRC4	64101	broad.mit.edu	37	7	127670603	127670603	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127670603G>C	uc003vmk.2	-	2	228	c.91C>G	c.(91-93)CTG>GTG	p.L31V	SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4 precursor	31						cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4				Lung(243;0.124)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151927301	151927301	+	Intron	SNP	A	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927301A>G	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
NR5A1	2516	broad.mit.edu	37	9	127265456	127265456	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127265456C>T	uc004boo.1	-	3	333	c.146G>A	c.(145-147)TGC>TAC	p.C49Y		NM_004959	NP_004950	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	49	NR C4-type.|Nuclear receptor.				cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0																		---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7618701	7618701	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7618701C>T	uc001ijq.2	-	10	1772	c.1693G>A	c.(1693-1695)GAT>AAT	p.D565N	ITIH5_uc001ijp.2_Missense_Mutation_p.D351N|ITIH5_uc001ijr.1_Missense_Mutation_p.D565N	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	565					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55755492	55755492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55755492G>A	uc001jju.1	-	21	3180	c.2785C>T	c.(2785-2787)CGA>TGA	p.R929*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.R934*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.R941*|PCDH15_uc010qht.1_Nonsense_Mutation_p.R936*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.R929*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.R892*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.R858*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.R934*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qia.1_Nonsense_Mutation_p.R907*|PCDH15_uc010qib.1_Nonsense_Mutation_p.R907*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.R929*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	929	Extracellular (Potential).|Cadherin 9.				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72285718	72285718	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72285718C>T	uc001jrd.3	+	2	292	c.11C>T	c.(10-12)ACG>ATG	p.T4M		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	4										ovary(2)|central_nervous_system(1)	3																		---	---	---	---
GBF1	8729	broad.mit.edu	37	10	104135332	104135332	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104135332C>T	uc001kux.1	+	30	4114	c.3874C>T	c.(3874-3876)CCT>TCT	p.P1292S	GBF1_uc001kuy.1_Missense_Mutation_p.P1292S|GBF1_uc001kuz.1_Missense_Mutation_p.P1293S	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1292					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)														---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106927067	106927067	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106927067G>A	uc001kyi.1	+	13	2088	c.1861G>A	c.(1861-1863)GTG>ATG	p.V621M		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	621	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
C10orf90	118611	broad.mit.edu	37	10	128193340	128193340	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128193340C>T	uc001ljq.2	-	3	550	c.429G>A	c.(427-429)ACG>ACA	p.T143T	C10orf90_uc001ljp.2_Silent_p.T96T|C10orf90_uc010qum.1_Silent_p.T240T|C10orf90_uc009yao.2_Silent_p.T240T|C10orf90_uc001ljs.1_Silent_p.T96T	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	143										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)												OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1275540	1275540	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1275540G>A	uc009ycr.1	+	56	16573	c.16447G>A	c.(16447-16449)GTC>ATC	p.V5483I	MUC5B_uc001ltb.2_Missense_Mutation_p.V5149I	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5146	VWFD 4.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
COPB1	1315	broad.mit.edu	37	11	14481849	14481849	+	Intron	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14481849G>C	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535			coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ATG2A	23130	broad.mit.edu	37	11	64673986	64673986	+	Silent	SNP	C	T	T	rs75814919	by1000genomes	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64673986C>T	uc001obx.2	-	21	3118	c.3003G>A	c.(3001-3003)CCG>CCA	p.P1001P		NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1001							protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
GAL3ST3	89792	broad.mit.edu	37	11	65810465	65810465	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65810465C>T	uc001ogv.2	-	2	969	c.809G>A	c.(808-810)CGC>CAC	p.R270H	GAL3ST3_uc001ogw.2_Missense_Mutation_p.R270H	NM_033036	NP_149025	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	270	Lumenal (Potential).				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(1)	1																		---	---	---	---
RPS6KB2	6199	broad.mit.edu	37	11	67201943	67201943	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67201943C>T	uc001old.2	+	13	1225	c.1143C>T	c.(1141-1143)AAC>AAT	p.N381N	RPS6KB2_uc001olf.2_Silent_p.N181N|RPS6KB2_uc001olg.2_Silent_p.N381N|RPS6KB2_uc009yrq.2_Silent_p.N181N|RPS6KB2_uc001ole.2_RNA|RPS6KB2_uc001olh.2_RNA|RPS6KB2_uc009yrr.2_Silent_p.N212N	NM_003952	NP_003943	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide	381	AGC-kinase C-terminal.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of translational initiation|translation	nucleoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|stomach(1)|lung(1)|salivary_gland(1)	7			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)															---	---	---	---
CABP4	57010	broad.mit.edu	37	11	67223662	67223662	+	Missense_Mutation	SNP	C	T	T	rs121917828	byFrequency	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67223662C>T	uc001olo.2	+	2	447	c.370C>T	c.(370-372)CGC>TGC	p.R124C	CABP4_uc001oln.2_Missense_Mutation_p.R19C	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	124			R -> C (in CSNB2B).		visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)															---	---	---	---
GAL	51083	broad.mit.edu	37	11	68456365	68456365	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68456365T>C	uc001oob.2	+	5	490	c.272T>C	c.(271-273)ATT>ACT	p.I91T		NM_015973	NP_057057	P22466	GALA_HUMAN	galanin preproprotein	91					growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)														---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	498207	498207	+	Silent	SNP	T	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:498207T>C	uc001qif.1	-	1	414	c.51A>G	c.(49-51)CCA>CCG	p.P17P	KDM5A_uc001qie.1_Silent_p.P17P|CCDC77_uc009zdk.2_5'Flank|CCDC77_uc010sdp.1_5'Flank|KDM5A_uc010sdn.1_Silent_p.P17P|KDM5A_uc010sdo.1_Silent_p.P17P	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	17					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3								T 	NUP98	AML								---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7551181	7551181	+	Splice_Site	SNP	C	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7551181C>G	uc001qsy.2	-	7	1435	c.1409_splice	c.e7-1	p.D470_splice	CD163L1_uc010sge.1_Splice_Site_p.D480_splice	NM_174941	NP_777601			scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	G	G	rs17851045		TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25380275T>G	uc001rgp.1	-	3	364	c.183A>C	c.(181-183)CAA>CAC	p.Q61H	KRAS_uc001rgq.1_Missense_Mutation_p.Q61H	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	61	GTP.		Q -> R (in a colorectal cancer sample; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.Q61H(140)|p.Q61L(51)|p.Q61R(44)|p.Q61K(24)|p.Q61P(11)|p.Q61E(10)|p.Q61D(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			Q61H(T3M4_PANCREAS)|Q61H(HS766T_PANCREAS)|Q61H(NCIH460_LUNG)|Q61H(NCIH1155_LUNG)|Q61H(CL11_LARGE_INTESTINE)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
OS9	10956	broad.mit.edu	37	12	58087953	58087953	+	Silent	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58087953G>C	uc001spj.2	+	1	68	c.9G>C	c.(7-9)GCG>GCC	p.A3A	OS9_uc010srx.1_Silent_p.A3A|OS9_uc001spk.2_Silent_p.A3A|OS9_uc001spl.2_Silent_p.A3A|OS9_uc001spm.2_Silent_p.A3A|OS9_uc001spn.2_Silent_p.A3A|OS9_uc010sry.1_Silent_p.A3A|OS9_uc010srz.1_Silent_p.A3A	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum	3					ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
VEZT	55591	broad.mit.edu	37	12	95660360	95660360	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95660360C>T	uc001tdz.2	+	5	767	c.662C>T	c.(661-663)GCT>GTT	p.A221V	VEZT_uc009zsy.1_Missense_Mutation_p.A63V|VEZT_uc001tdr.2_Missense_Mutation_p.A63V|VEZT_uc001tds.2_Missense_Mutation_p.A173V|VEZT_uc001tdt.2_Missense_Mutation_p.A173V|VEZT_uc009zsz.1_Missense_Mutation_p.A221V|VEZT_uc001tdv.2_Missense_Mutation_p.A190V|VEZT_uc001tdw.1_Missense_Mutation_p.A173V|VEZT_uc009zta.1_Missense_Mutation_p.A173V	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	221						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1																		---	---	---	---
HCFC2	29915	broad.mit.edu	37	12	104492124	104492124	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104492124G>A	uc001tkj.3	+	13	1847	c.1744G>A	c.(1744-1746)GAG>AAG	p.E582K	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	582	Fibronectin type-III 2.				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
CRY1	1407	broad.mit.edu	37	12	107386583	107386583	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107386583C>T	uc001tmi.3	-	12	2602	c.1743G>A	c.(1741-1743)CAG>CAA	p.Q581Q		NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)	581					DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3																		---	---	---	---
SACS	26278	broad.mit.edu	37	13	23928673	23928673	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23928673G>A	uc001uon.2	-	8	2667	c.2078C>T	c.(2077-2079)TCA>TTA	p.S693L	SACS_uc001uoo.2_Missense_Mutation_p.S546L|SACS_uc001uop.1_Missense_Mutation_p.S480L|SACS_uc001uoq.1_Missense_Mutation_p.S546L	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	693					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---
SLC22A17	51310	broad.mit.edu	37	14	23817454	23817454	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23817454C>T	uc001wjl.2	-	5	810	c.754G>A	c.(754-756)GCT>ACT	p.A252T	SLC22A17_uc010akk.2_Missense_Mutation_p.A34T|SLC22A17_uc001wjn.2_RNA|SLC22A17_uc001wjm.2_Missense_Mutation_p.A252T	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	252					siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)														---	---	---	---
REC8	9985	broad.mit.edu	37	14	24648871	24648871	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24648871A>T	uc001wmr.2	+	19	1817	c.1390A>T	c.(1390-1392)ATG>TTG	p.M464L	REC8_uc001wms.2_Missense_Mutation_p.M464L	NM_005132	NP_005123	O95072	REC8_HUMAN	REC8 homolog	464	Glu-rich.				mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm					0				GBM - Glioblastoma multiforme(265;0.00839)														---	---	---	---
PRKD1	5587	broad.mit.edu	37	14	30105555	30105555	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30105555G>A	uc001wqh.2	-	7	1312	c.1131C>T	c.(1129-1131)AAC>AAT	p.N377N		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	377					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)														---	---	---	---
LRFN5	145581	broad.mit.edu	37	14	42360992	42360992	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360992A>G	uc001wvm.2	+	4	3123	c.1925A>G	c.(1924-1926)AAG>AGG	p.K642R	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	642	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)											HNSCC(30;0.082)			---	---	---	---
MNAT1	4331	broad.mit.edu	37	14	61275157	61275157	+	Intron	SNP	A	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61275157A>C	uc001xfd.2	+						MNAT1_uc010apq.1_Nonstop_Mutation_p.*144S|MNAT1_uc001xfe.2_Intron	NM_002431	NP_002422			menage a trois 1 (CAK assembly factor)						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein complex assembly|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cytoplasm|holo TFIIH complex	protein N-terminus binding|zinc ion binding			ovary(1)|lung(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.0174)									Direct_reversal_of_damage|NER					---	---	---	---
ZFYVE26	23503	broad.mit.edu	37	14	68220880	68220880	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68220880G>A	uc001xka.2	-	38	7175	c.7036C>T	c.(7036-7038)CGG>TGG	p.R2346W	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_Missense_Mutation_p.R192W	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2346					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)														---	---	---	---
GOLGA5	9950	broad.mit.edu	37	14	93273162	93273162	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93273162C>G	uc001yaz.1	+	3	808	c.626C>G	c.(625-627)CCT>CGT	p.P209R		NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5	209	Cytoplasmic (Potential).				Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)				T	RET	papillary thyroid								---	---	---	---
UBR1	197131	broad.mit.edu	37	15	43330361	43330361	+	Intron	SNP	T	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43330361T>A	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576			ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)														---	---	---	---
IGDCC4	57722	broad.mit.edu	37	15	65687476	65687476	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65687476G>C	uc002aou.1	-	8	1742	c.1532C>G	c.(1531-1533)GCC>GGC	p.A511G	IGDCC4_uc002aot.1_Missense_Mutation_p.A99G	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member	511	Extracellular (Potential).|Fibronectin type-III 1.					integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
UACA	55075	broad.mit.edu	37	15	70980090	70980090	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70980090A>G	uc002asr.2	-	6	598	c.494T>C	c.(493-495)GTA>GCA	p.V165A	UACA_uc010uke.1_Missense_Mutation_p.V165A|UACA_uc002asq.2_Missense_Mutation_p.V152A|UACA_uc010bin.1_Missense_Mutation_p.V151A	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	165						cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
CHRNB4	1143	broad.mit.edu	37	15	78917483	78917483	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78917483G>A	uc002bed.1	-	6	1601	c.1489C>T	c.(1489-1491)CGT>TGT	p.R497C	CHRNB4_uc002bee.1_Silent_p.S170S|uc002bef.1_5'Flank	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	497	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0																		---	---	---	---
GPRC5B	51704	broad.mit.edu	37	16	19883643	19883643	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19883643G>A	uc002dgt.2	-	2	633	c.525C>T	c.(523-525)ATC>ATT	p.I175I	GPRC5B_uc010vav.1_Silent_p.I201I	NM_016235	NP_057319	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, family C, group 5,	175	Helical; Name=4; (Potential).									lung(1)|breast(1)|skin(1)	3																		---	---	---	---
PMFBP1	83449	broad.mit.edu	37	16	72158753	72158753	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72158753C>G	uc002fcc.3	-	17	2689	c.2517G>C	c.(2515-2517)AAG>AAC	p.K839N	PMFBP1_uc002fcd.2_Missense_Mutation_p.K834N|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.K689N|PMFBP1_uc010cgo.1_Missense_Mutation_p.K130N	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	839	Potential.									ovary(2)	2		Ovarian(137;0.179)														OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MYH8	4626	broad.mit.edu	37	17	10301947	10301947	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10301947G>A	uc002gmm.2	-	30	4087	c.3992C>T	c.(3991-3993)GCC>GTC	p.A1331V	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1331	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11														Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54428147	54428147	+	Missense_Mutation	SNP	C	T	T	rs141896298	byFrequency	TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428147C>T	uc002iun.1	+	4	253	c.218C>T	c.(217-219)ACG>ATG	p.T73M		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	73										large_intestine(1)|ovary(1)	2																		---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8113650	8113650	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113650C>T	uc002knn.3	+	12	2526	c.2023C>T	c.(2023-2025)CCT>TCT	p.P675S	PTPRM_uc010dkv.2_Missense_Mutation_p.P675S|PTPRM_uc010wzl.1_Missense_Mutation_p.P462S	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	675	Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
RALBP1	10928	broad.mit.edu	37	18	9517304	9517304	+	Intron	SNP	A	G	G			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9517304A>G	uc002kob.2	+						RALBP1_uc002koc.2_Intron	NM_006788	NP_006779			ralA binding protein 1						chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1																		---	---	---	---
SMAD4	4089	broad.mit.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48591919G>A	uc010xdp.1	+	9	1620	c.1082G>A	c.(1081-1083)CGC>CAC	p.R361H	SMAD4_uc002lfb.3_Missense_Mutation_p.R206H	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	361	MH2.		R -> H (in a colorectal cancer sample; somatic mutation).|R -> C (in JPS).		BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.R361C(6)|p.R361H(3)|p.?(2)|p.R361S(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)										Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				---	---	---	---
NARS	4677	broad.mit.edu	37	18	55283214	55283214	+	Intron	SNP	T	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55283214T>C	uc002lgs.2	-						NARS_uc002lgt.2_Intron|NARS_uc010xea.1_Intron|NARS_uc010xeb.1_Intron|NARS_uc010xec.1_Intron|NARS_uc010xed.1_Intron	NM_004539	NP_004530			asparaginyl-tRNA synthetase						asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)													---	---	---	---
ZNF358	140467	broad.mit.edu	37	19	7584405	7584405	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7584405G>A	uc002mgn.2	+	2	447	c.277G>A	c.(277-279)GAC>AAC	p.D93N		NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	93					embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	8959694	8959694	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8959694G>A	uc002mkp.2	-	84	43642	c.43438C>T	c.(43438-43440)CGG>TGG	p.R14480W	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.R1280W|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	22125	Cytoplasmic (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9089844	9089844	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089844C>T	uc002mkp.2	-	1	2175	c.1971G>A	c.(1969-1971)AAG>AAA	p.K657K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	657	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
RAB3A	5864	broad.mit.edu	37	19	18311172	18311172	+	Silent	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18311172G>A	uc002nie.2	-	3	481	c.312C>T	c.(310-312)ATC>ATT	p.I104I		NM_002866	NP_002857	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	104					glutamate secretion|protein transport|small GTPase mediated signal transduction	clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|plasma membrane|synaptic vesicle	GTP binding|GTPase activity				0																		---	---	---	---
HAPLN4	404037	broad.mit.edu	37	19	19369476	19369476	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19369476G>A	uc002nmb.2	-	4	728	c.673C>T	c.(673-675)CGG>TGG	p.R225W	HAPLN4_uc002nmc.2_Missense_Mutation_p.R225W	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	225	Link 1.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)															---	---	---	---
CILP2	148113	broad.mit.edu	37	19	19656451	19656451	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19656451C>T	uc002nmv.3	+	8	3182	c.3097C>T	c.(3097-3099)CGG>TGG	p.R1033W	CILP2_uc002nmw.3_Missense_Mutation_p.R1039W	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	1033						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1																		---	---	---	---
WDR62	284403	broad.mit.edu	37	19	36558857	36558857	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36558857G>C	uc002odc.2	+	7	918	c.827G>C	c.(826-828)GGC>GCC	p.G276A	WDR62_uc002odd.2_Missense_Mutation_p.G276A|WDR62_uc002odb.2_Missense_Mutation_p.G276A	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	276					cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)															---	---	---	---
CYP2A13	1553	broad.mit.edu	37	19	41600209	41600209	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41600209G>A	uc002opt.2	+	7	1042	c.1033G>A	c.(1033-1035)GAC>AAC	p.D345N		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	345					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)													---	---	---	---
NLRP4	147945	broad.mit.edu	37	19	56369621	56369621	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56369621C>T	uc002qmd.3	+	3	1284	c.862C>T	c.(862-864)CGG>TGG	p.R288W	NLRP4_uc002qmf.2_Missense_Mutation_p.R213W|NLRP4_uc010etf.2_Missense_Mutation_p.R119W	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	288	NACHT.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)														---	---	---	---
MZF1	7593	broad.mit.edu	37	19	59080632	59080632	+	Intron	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59080632C>T	uc002qto.2	-						LOC100131691_uc002qtm.2_Intron|MZF1_uc002qtn.2_Intron|MZF1_uc010euu.1_3'UTR	NM_198055	NP_932172			zinc finger protein 42 isoform 2						viral reproduction	nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)														---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2597930	2597930	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2597930C>T	uc002wgf.1	+	16	2168	c.2153C>T	c.(2152-2154)CCA>CTA	p.P718L	TMC2_uc002wgg.1_Missense_Mutation_p.P702L	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	718	Extracellular (Potential).					integral to membrane				ovary(3)	3																		---	---	---	---
C20orf29	55317	broad.mit.edu	37	20	3804851	3804851	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3804851C>T	uc002wjs.1	+	3	688	c.510C>T	c.(508-510)CTC>CTT	p.L170L	C20orf29_uc002wjt.2_Silent_p.L94L|C20orf29_uc002wju.1_Silent_p.L170L	NM_018347	NP_060817	Q9NUS5	CT029_HUMAN	hypothetical protein LOC55317	170					double-strand break repair via homologous recombination		protein binding			skin(1)	1																		---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10951401	10951401	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10951401A>T	uc002yip.1	-	10	679	c.311T>A	c.(310-312)CTG>CAG	p.L104Q	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.L86Q|TPTE_uc002yir.1_Missense_Mutation_p.L66Q|TPTE_uc010gkv.1_5'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	104	Helical; (Potential).				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47786730	47786730	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47786730C>T	uc002zji.3	+	15	2948	c.2841C>T	c.(2839-2841)GCC>GCT	p.A947A	PCNT_uc002zjj.2_Silent_p.A829A	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	947					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
TNMD	64102	broad.mit.edu	37	X	99854068	99854068	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99854068C>T	uc004efy.3	+	6	859	c.633C>T	c.(631-633)AAC>AAT	p.N211N	TNMD_uc004efz.2_3'UTR	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN	tenomodulin	211	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1																		---	---	---	---
ZIC3	7547	broad.mit.edu	37	X	136651179	136651179	+	Silent	SNP	C	T	T			TCGA-CG-5719-01	TCGA-CG-5719-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136651179C>T	uc004fak.2	+	2	1684	c.1179C>T	c.(1177-1179)TGC>TGT	p.C393C		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	393	C2H2-type 5.				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
