Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
ILDR2	387597	broad.mit.edu	37	1	166944274	166944277	+	Intron	DEL	CACA	-	-	rs67253020		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166944274_166944277delCACA	uc001gdx.1	-							NM_199351	NP_955383			immunoglobulin-like domain containing receptor							integral to membrane				ovary(1)	1																		---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171519129	171519129	+	Intron	DEL	T	-	-	rs67131565		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171519129delT	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																																			---	---	---	---
FBXW12	285231	broad.mit.edu	37	3	48420122	48420122	+	Intron	DEL	G	-	-	rs9311422	by1000genomes	TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48420122delG	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985			F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247			immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)															---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29926345	29926346	+	Intron	INS	-	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29926345_29926346insG	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930			coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)																---	---	---	---
TEK	7010	broad.mit.edu	37	9	27204692	27204692	+	Intron	DEL	T	-	-	rs72428264		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27204692delT	uc003zqi.3	+						TEK_uc011lno.1_Intron|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Intron	NM_000459	NP_000450			TEK tyrosine kinase, endothelial precursor						angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)														---	---	---	---
NCS1	23413	broad.mit.edu	37	9	132985262	132985262	+	Intron	DEL	C	-	-	rs34826568		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985262delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101			frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0																		---	---	---	---
EXD3	54932	broad.mit.edu	37	9	140267711	140267729	+	Intron	DEL	GAGGGTGAAGCCACGGGCT	-	-	rs59889670		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140267711_140267729delGAGGGTGAAGCCACGGGCT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290			exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0																		---	---	---	---
KIF11	3832	broad.mit.edu	37	10	94388745	94388745	+	Intron	DEL	T	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94388745delT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514			kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1																		---	---	---	---
PSD	5662	broad.mit.edu	37	10	104166908	104166909	+	Intron	DEL	CT	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104166908_104166909delCT	uc001kvg.1	-						PSD_uc001kve.1_5'Flank|PSD_uc001kvf.1_Intron|PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Intron	NM_002779	NP_002770			pleckstrin and Sec7 domain containing						regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)														---	---	---	---
VWA2	340706	broad.mit.edu	37	10	116014988	116014989	+	Intron	INS	-	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116014988_116014989insT	uc001lbl.1	+						VWA2_uc001lbk.1_Intron|VWA2_uc009xyf.1_Intron	NM_198496	NP_940898			von Willebrand factor A domain containing 2							extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	135455791	135455792	+	IGR	DEL	TG	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135455791_135455792delTG								FRG2B (15492 upstream) : LOC653544 (34487 downstream)																																			---	---	---	---
P4HA3	283208	broad.mit.edu	37	11	73999993	73999994	+	Intron	INS	-	A	A	rs36086552		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73999993_73999994insA	uc001ouz.2	-						P4HA3_uc001ouy.3_Intron|P4HA3_uc010rrj.1_Intron	NM_182904	NP_878907			prolyl 4-hydroxylase, alpha III subunit							endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)																	---	---	---	---
SIDT2	51092	broad.mit.edu	37	11	117054354	117054355	+	Intron	INS	-	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117054354_117054355insA	uc001pqh.1	+						SIDT2_uc010rxe.1_Intron|SIDT2_uc001pqg.2_Intron|SIDT2_uc001pqi.1_Intron	NM_001040455	NP_001035545			SID1 transmembrane family, member 2 precursor							integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)														---	---	---	---
TEAD4	7004	broad.mit.edu	37	12	3129551	3129551	+	Intron	DEL	G	-	-	rs3837514		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3129551delG	uc010sej.1	+						TEAD4_uc010sek.1_Intron|TEAD4_uc001qln.2_Intron	NM_003213	NP_003204			TEA domain family member 4 isoform 1						hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
DDX11	1663	broad.mit.edu	37	12	31250614	31250614	+	Intron	DEL	A	-	-	rs35761927		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31250614delA	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)														Multiple Myeloma(12;0.14)			---	---	---	---
TMBIM6	7009	broad.mit.edu	37	12	50151816	50151817	+	Intron	INS	-	A	A	rs80171037		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50151816_50151817insA	uc001rux.2	+						TMBIM6_uc010sml.1_Intron|TMBIM6_uc001ruy.2_Intron|TMBIM6_uc001ruz.2_Intron	NM_003217	NP_003208			testis enhanced gene transcript (BAX inhibitor						apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus					0																		---	---	---	---
SLC11A2	4891	broad.mit.edu	37	12	51404296	51404297	+	Intron	INS	-	A	A	rs72071625		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51404296_51404297insA	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc010smx.1_5'Flank|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608			solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1																		---	---	---	---
HAUS4	54930	broad.mit.edu	37	14	23419353	23419353	+	Intron	DEL	C	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23419353delC	uc001whp.2	-						HAUS4_uc001who.2_Intron|HAUS4_uc001whq.2_Intron|HAUS4_uc001whr.2_Intron|HAUS4_uc001whs.2_Intron|HAUS4_uc001wht.2_Intron|HAUS4_uc001whu.2_Intron|HAUS4_uc001whv.2_Intron|HAUS4_uc001whw.2_Intron|HAUS4_uc001whx.2_Intron	NM_017815	NP_060285			HAUS augmin-like complex, subunit 4						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32437251	32437252	+	IGR	INS	-	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32437251_32437252insC								HERC2P4 (273377 upstream) : TP53TG3B (247589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86559921	86559921	+	IGR	DEL	A	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86559921delA								FOXF1 (11852 upstream) : MTHFSD (3862 downstream)																																			---	---	---	---
C17orf53	78995	broad.mit.edu	37	17	42229795	42229796	+	Intron	INS	-	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42229795_42229796insA	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	NM_024032	NP_076937			hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843			tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2																		---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6887429	6887430	+	Intron	INS	-	T	T	rs10651246		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6887429_6887430insT	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron					SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
C19orf20	91978	broad.mit.edu	37	19	507444	507445	+	5'Flank	INS	-	GG	GG	rs76411702		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:507444_507445insGG	uc002lou.2	+							NM_033513	NP_277048			tubulin polyglutamylase complex subunit 1						multicellular organismal development	axon|centrosome|cilium axoneme|dendrite|flagellar axoneme|microtubule|microtubule basal body				pancreas(1)	1		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
PIP5K1C	23396	broad.mit.edu	37	19	3648501	3648528	+	Intron	DEL	GGCGCCCACCTGTGGGGCTGCAGACCCG	-	-	rs9676740		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3648501_3648528delGGCGCCCACCTGTGGGGCTGCAGACCCG	uc002lyj.1	-						PIP5K1C_uc010xhq.1_Intron|PIP5K1C_uc010xhr.1_Intron	NM_012398	NP_036530			phosphatidylinositol-4-phosphate 5-kinase, type						axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)														---	---	---	---
C3	718	broad.mit.edu	37	19	6708145	6708148	+	Intron	DEL	CTCT	-	-	rs149392655		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6708145_6708148delCTCT	uc002mfm.2	-							NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
LIG1	3978	broad.mit.edu	37	19	48636047	48636048	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48636047_48636048insAAAAAAAAAAA	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron	NM_000234	NP_000225			DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)								NER					---	---	---	---
C20orf112	140688	broad.mit.edu	37	20	31035206	31035207	+	3'UTR	INS	-	AAAAA	AAAAA	rs149650216		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31035206_31035207insAAAAA	uc002wxu.3	-	8					C20orf112_uc010gec.2_3'UTR	NM_080616	NP_542183			hypothetical protein LOC140688												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	20229947	20229948	+	IGR	INS	-	T	T	rs140136910	by1000genomes;by1000genomes	TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229947_20229948insT								TMPRSS15 (453977 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																																			---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26761678	26761678	+	Intron	DEL	A	-	-	rs675083		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26761678delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40502242	40502242	+	Intron	DEL	T	-	-			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40502242delT	uc003aym.2	+							NM_001024843	NP_001020014			trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
ATXN10	25814	broad.mit.edu	37	22	46136634	46136635	+	Intron	INS	-	TG	TG	rs144019432	by1000genomes	TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136634_46136635insTG	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368			ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)														---	---	---	---
SYTL4	94121	broad.mit.edu	37	X	99930886	99930891	+	3'UTR	DEL	TACACA	-	-	rs138484614		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99930886_99930891delTACACA	uc004egd.3	-	19					SYTL4_uc004egc.2_3'UTR|SYTL4_uc010nnb.2_3'UTR|SYTL4_uc010nnc.2_3'UTR|SYTL4_uc004ege.3_3'UTR|SYTL4_uc004egf.3_3'UTR	NM_080737	NP_542775			synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
EPHA8	2046	broad.mit.edu	37	1	22927491	22927491	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22927491C>T	uc001bfx.1	+	15	2764	c.2639C>T	c.(2638-2640)GCG>GTG	p.A880V		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	880	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70478648	70478648	+	Intron	SNP	T	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70478648T>G	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
CD53	963	broad.mit.edu	37	1	111441780	111441780	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111441780G>T	uc001dzw.2	+	9	794	c.623G>T	c.(622-624)TGC>TTC	p.C208F	CD53_uc001dzx.2_Missense_Mutation_p.C208F|CD53_uc010owa.1_Missense_Mutation_p.C149F|CD53_uc001dzy.2_Missense_Mutation_p.C153F	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	208	Cytoplasmic (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)														---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	114225853	114225853	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114225853G>A	uc001edk.2	+	21	3844	c.3663G>A	c.(3661-3663)TCG>TCA	p.S1221S	MAGI3_uc001edi.3_3'UTR|MAGI3_uc010owm.1_3'UTR|MAGI3_uc001edj.2_3'UTR|MAGI3_uc009wgo.2_RNA	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	1246					apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144917576	144917576	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144917576G>A	uc001elw.3	-	12	1819	c.1528C>T	c.(1528-1530)CGT>TGT	p.R510C	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.R576C|PDE4DIP_uc001emc.1_Missense_Mutation_p.R510C|PDE4DIP_uc001emd.1_Missense_Mutation_p.R510C|PDE4DIP_uc001emb.1_Missense_Mutation_p.R673C|PDE4DIP_uc001eme.1_Missense_Mutation_p.R39C|PDE4DIP_uc001emf.1_Missense_Mutation_p.R297C	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	510	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
OR6K3	391114	broad.mit.edu	37	1	158687142	158687142	+	Missense_Mutation	SNP	G	A	A	rs79482939	by1000genomes	TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687142G>A	uc010pip.1	-	1	812	c.812C>T	c.(811-813)TCA>TTA	p.S271L		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	271	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)																	---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225142780	225142780	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225142780T>C	uc001how.2	+	3	412	c.197T>C	c.(196-198)TTG>TCG	p.L66S	DNAH14_uc001hou.3_Missense_Mutation_p.L66S|DNAH14_uc001hot.3_Missense_Mutation_p.L66S|DNAH14_uc001hov.3_Missense_Mutation_p.L66S	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform	243					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232650895	232650895	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650895G>A	uc001hvg.2	-	1	349	c.191C>T	c.(190-192)CCG>CTG	p.P64L		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	64					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)																---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457935	248457935	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457935C>A	uc010pzj.1	-	1	946	c.946G>T	c.(946-948)GCC>TCC	p.A316S		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	316	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
TRIB2	28951	broad.mit.edu	37	2	12880931	12880931	+	3'UTR	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12880931C>T	uc002rbv.3	+	3					TRIB2_uc010yjp.1_3'UTR	NM_021643	NP_067675			tribbles homolog 2						negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
NFE2L2	4780	broad.mit.edu	37	2	178096690	178096690	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178096690G>T	uc002ulh.3	-	5	1196	c.641C>A	c.(640-642)CCA>CAA	p.P214Q	NFE2L2_uc002ulg.3_Missense_Mutation_p.P198Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.P191Q|NFE2L2_uc002uli.3_Missense_Mutation_p.P198Q	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	214					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---
TTN	7273	broad.mit.edu	37	2	179426117	179426117	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179426117G>C	uc010zfg.1	-	275	77262	c.77038C>G	c.(77038-77040)CCT>GCT	p.P25680A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P19375A|TTN_uc010zfi.1_Missense_Mutation_p.P19308A|TTN_uc010zfj.1_Missense_Mutation_p.P19183A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26607							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179581972	179581972	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179581972G>A	uc010zfg.1	-	85	21981	c.21757C>T	c.(21757-21759)CGC>TGC	p.R7253C	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R3914C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8180							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205990415	205990415	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205990415C>T	uc002var.1	+	10	1595	c.1388C>T	c.(1387-1389)TCG>TTG	p.S463L	PARD3B_uc010fub.1_Missense_Mutation_p.S463L|PARD3B_uc002vao.1_Missense_Mutation_p.S463L|PARD3B_uc002vap.1_Missense_Mutation_p.S463L|PARD3B_uc002vaq.1_Missense_Mutation_p.S463L	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	463	PDZ 2.				cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
SLC16A14	151473	broad.mit.edu	37	2	230910835	230910835	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230910835T>C	uc002vqd.1	-	4	1370	c.1007A>G	c.(1006-1008)CAC>CGC	p.H336R	FBXO36_uc010fxi.1_Intron|SLC16A14_uc002vqe.2_Missense_Mutation_p.H336R|SLC16A14_uc002vqf.2_Missense_Mutation_p.H336R	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid	336	Cytoplasmic (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)														---	---	---	---
TRANK1	9881	broad.mit.edu	37	3	36896947	36896947	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36896947C>T	uc003cgj.2	-	3	2786	c.2484G>A	c.(2482-2484)TCG>TCA	p.S828S		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	1378					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
KALRN	8997	broad.mit.edu	37	3	124436117	124436117	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124436117A>T	uc003ehg.2	+	59	8427	c.8300A>T	c.(8299-8301)GAC>GTC	p.D2767V	KALRN_uc003ehk.2_Missense_Mutation_p.D1070V	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2766	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
VEPH1	79674	broad.mit.edu	37	3	157188240	157188240	+	Missense_Mutation	SNP	C	T	T	rs141413130		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157188240C>T	uc003fbj.1	-	3	534	c.217G>A	c.(217-219)GAG>AAG	p.E73K	VEPH1_uc003fbk.1_Missense_Mutation_p.E73K|VEPH1_uc010hvu.1_Missense_Mutation_p.E73K|VEPH1_uc003fbm.2_Missense_Mutation_p.E73K|VEPH1_uc003fbn.2_Missense_Mutation_p.E73K	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	73						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)															---	---	---	---
SAMD7	344658	broad.mit.edu	37	3	169644391	169644391	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169644391T>A	uc003fgd.2	+	6	608	c.341T>A	c.(340-342)ATT>AAT	p.I114N	SAMD7_uc003fge.2_Missense_Mutation_p.I114N|SAMD7_uc011bpo.1_Missense_Mutation_p.I15N	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	114										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
DNAJB11	51726	broad.mit.edu	37	3	186299790	186299790	+	Silent	SNP	G	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299790G>C	uc003fqi.2	+	6	826	c.606G>C	c.(604-606)GTG>GTC	p.V202V		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	202					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)														---	---	---	---
MXD4	10608	broad.mit.edu	37	4	2259700	2259700	+	Intron	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2259700G>T	uc003geu.1	-							NM_006454	NP_006445			MAD4						negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|transcription corepressor activity				0																		---	---	---	---
WDR19	57728	broad.mit.edu	37	4	39271702	39271702	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39271702C>A	uc003gtv.2	+	31	3619	c.3465C>A	c.(3463-3465)CAC>CAA	p.H1155Q	WDR19_uc011byi.1_Missense_Mutation_p.H995Q|WDR19_uc003gtw.1_Missense_Mutation_p.H752Q	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1155					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1																		---	---	---	---
HNRNPD	3184	broad.mit.edu	37	4	83278030	83278030	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83278030T>C	uc003hmm.1	-	6	1090	c.772A>G	c.(772-774)ATG>GTG	p.M258V	HNRNPD_uc003hml.1_RNA|HNRNPD_uc003hmn.1_Missense_Mutation_p.M239V|HNRNPD_uc003hmo.1_Missense_Mutation_p.M258V|HNRNPD_uc003hmp.1_Missense_Mutation_p.M239V|HNRNPD_uc010ijr.1_Missense_Mutation_p.M239V|HNRNPD_uc011cci.1_Missense_Mutation_p.M104V	NM_031370	NP_112738	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D	258	RRM 2.				nuclear mRNA splicing, via spliceosome|positive regulation of transcription, DNA-dependent|RNA catabolic process|transcription, DNA-dependent	cytosol|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|telomeric DNA binding				0																		---	---	---	---
CDS1	1040	broad.mit.edu	37	4	85553014	85553014	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85553014G>A	uc011ccv.1	+	6	1121	c.623G>A	c.(622-624)CGT>CAT	p.R208H	CDS1_uc010ike.1_Missense_Mutation_p.R12H	NM_001263	NP_001254	Q92903	CDS1_HUMAN	CDP-diacylglycerol synthase 1	208					signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity			large_intestine(2)|ovary(1)|breast(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)														---	---	---	---
TLL1	7092	broad.mit.edu	37	4	167012436	167012436	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167012436C>T	uc003irh.1	+	19	3246	c.2599C>T	c.(2599-2601)CGG>TGG	p.R867W	TLL1_uc011cjn.1_Missense_Mutation_p.R890W|TLL1_uc011cjo.1_Missense_Mutation_p.R691W	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	867	CUB 4.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)														---	---	---	---
PCDHA1	56147	broad.mit.edu	37	5	140166324	140166324	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166324C>T	uc003lhb.2	+	1	449	c.449C>T	c.(448-450)TCG>TTG	p.S150L	PCDHA1_uc003lha.2_Missense_Mutation_p.S150L|PCDHA1_uc003lgz.2_Missense_Mutation_p.S150L	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	150	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA6	56142	broad.mit.edu	37	5	140208285	140208285	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208285G>T	uc003lho.2	+	1	636	c.609G>T	c.(607-609)GAG>GAT	p.E203D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.E203D|PCDHA6_uc011dab.1_Missense_Mutation_p.E203D	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	203	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA8	56140	broad.mit.edu	37	5	140222835	140222835	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140222835G>A	uc003lhs.2	+	1	1929	c.1929G>A	c.(1927-1929)CCG>CCA	p.P643P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.P643P	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	643	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGB2	56103	broad.mit.edu	37	5	140741004	140741004	+	Silent	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741004C>A	uc003ljs.1	+	1	1302	c.1302C>A	c.(1300-1302)TCC>TCA	p.S434S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Silent_p.S434S|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	434	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
NR3C1	2908	broad.mit.edu	37	5	142779330	142779330	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142779330C>T	uc003lmz.2	-	2	1567	c.1075G>A	c.(1075-1077)GTT>ATT	p.V359I	NR3C1_uc003lmy.2_Missense_Mutation_p.V359I|NR3C1_uc003lna.2_Missense_Mutation_p.V359I|NR3C1_uc003lnb.2_Missense_Mutation_p.V359I|NR3C1_uc011dbk.1_Intron|NR3C1_uc003lnc.2_Missense_Mutation_p.V359I|NR3C1_uc003lnd.2_Missense_Mutation_p.V359I|NR3C1_uc003lne.2_Missense_Mutation_p.V359I|NR3C1_uc003lnf.2_Missense_Mutation_p.V359I|NR3C1_uc003lng.2_Missense_Mutation_p.V359I|NR3C1_uc003lnh.2_Missense_Mutation_p.V359I|NR3C1_uc003lni.2_Missense_Mutation_p.V359I	NM_000176	NP_000167	P04150	GCR_HUMAN	glucocorticoid receptor isoform alpha	359	Modulating.				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)													---	---	---	---
POLH	5429	broad.mit.edu	37	6	43581728	43581728	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43581728A>G	uc003ovq.3	+	11	1880	c.1576A>G	c.(1576-1578)ACA>GCA	p.T526A	POLH_uc010jyu.2_Missense_Mutation_p.T402A|POLH_uc011dvl.1_RNA|POLH_uc003ovr.3_Missense_Mutation_p.T427A	NM_006502	NP_006493	Q9Y253	POLH_HUMAN	DNA-directed DNA polymerase eta	526					DNA replication|DNA synthesis involved in DNA repair|regulation of DNA repair|response to UV-C	cytoplasm|nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			breast(2)	2	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)										DNA_polymerases_(catalytic_subunits)	Xeroderma_Pigmentosum				---	---	---	---
MUT	4594	broad.mit.edu	37	6	49415470	49415470	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49415470C>T	uc003ozg.3	-	8	1728	c.1473G>A	c.(1471-1473)AAG>AAA	p.K491K		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	491					fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73904416	73904416	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73904416C>T	uc003pgk.2	+	14	2425	c.2078C>T	c.(2077-2079)ACG>ATG	p.T693M	KCNQ5_uc011dyh.1_Missense_Mutation_p.T712M|KCNQ5_uc011dyi.1_Missense_Mutation_p.T703M|KCNQ5_uc010kat.2_Missense_Mutation_p.T684M|KCNQ5_uc011dyj.1_Missense_Mutation_p.T583M|KCNQ5_uc011dyk.1_Missense_Mutation_p.T443M	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	693					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75838110	75838110	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75838110A>G	uc003phs.2	-	38	6408	c.6242T>C	c.(6241-6243)ATA>ACA	p.I2081T	COL12A1_uc003pht.2_Missense_Mutation_p.I917T	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2081	Fibronectin type-III 16.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152673313	152673313	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152673313G>A	uc010kiw.2	-	70	12031	c.11429C>T	c.(11428-11430)ACG>ATG	p.T3810M	SYNE1_uc003qot.3_Missense_Mutation_p.T3795M|SYNE1_uc003qou.3_Missense_Mutation_p.T3810M|SYNE1_uc010kja.1_Missense_Mutation_p.T515M	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3810	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20198241	20198241	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20198241G>A	uc003sus.3	-	5	2052	c.1743C>T	c.(1741-1743)CTC>CTT	p.L581L	MACC1_uc010kug.2_Silent_p.L581L	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	581	SH3.				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
HOXA11	3207	broad.mit.edu	37	7	27224468	27224468	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27224468G>A	uc003syx.2	-	1	368	c.296C>T	c.(295-297)GCG>GTG	p.A99V	HOXA11_uc003syy.2_RNA|HOXA11AS_uc003syz.1_5'Flank	NM_005523	NP_005514	P31270	HXA11_HUMAN	homeobox A11	99					branching involved in ureteric bud morphogenesis|cartilage development involved in endochondral bone morphogenesis|developmental growth|dorsal/ventral pattern formation|mesodermal cell fate specification|positive regulation of cell development|positive regulation of chondrocyte differentiation	protein-DNA complex|transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)	2								T	NUP98	CML								---	---	---	---
Unknown	0	broad.mit.edu	37	7	38393355	38393355	+	Intron	SNP	T	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38393355T>G	uc003tgp.1	+											Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																														---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39500263	39500263	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39500263A>G	uc003thb.1	+	9	1562	c.1520A>G	c.(1519-1521)CAG>CGG	p.Q507R		NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1	507	POU-specific.				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1																		---	---	---	---
RAMP3	10268	broad.mit.edu	37	7	45222946	45222946	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45222946G>A	uc003tnb.2	+	3	443	c.382G>A	c.(382-384)GTT>ATT	p.V128I	RAMP3_uc003tnc.2_Missense_Mutation_p.V96I	NM_005856	NP_005847	O60896	RAMP3_HUMAN	receptor activity modifying protein 3 precursor	128	Helical; (Potential).				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane|lysosome	protein transporter activity				0					Pramlintide(DB01278)													---	---	---	---
TMEM130	222865	broad.mit.edu	37	7	98460898	98460898	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98460898G>A	uc003upo.2	-	2	400	c.211C>T	c.(211-213)CGC>TGC	p.R71C	TMEM130_uc011kiq.1_Missense_Mutation_p.R52C|TMEM130_uc011kir.1_Missense_Mutation_p.R71C|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a	71	Extracellular (Potential).					Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
ADAM18	8749	broad.mit.edu	37	8	39587447	39587447	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39587447C>T	uc003xni.2	+	20	2208	c.2208C>T	c.(2206-2208)GAC>GAT	p.D736D	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.D712D	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	736	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104898187	104898187	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898187C>T	uc003yls.2	+	2	935	c.694C>T	c.(694-696)CTA>TTA	p.L232L	RIMS2_uc003ylp.2_Silent_p.L454L|RIMS2_uc003ylw.2_Silent_p.L262L|RIMS2_uc003ylq.2_Silent_p.L262L|RIMS2_uc003ylr.2_Silent_p.L262L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	485					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RNF139	11236	broad.mit.edu	37	8	125499249	125499249	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125499249C>T	uc003yrc.2	+	2	1702	c.1359C>T	c.(1357-1359)CTC>CTT	p.L453L		NM_007218	NP_009149	Q8WU17	RN139_HUMAN	ring finger protein 139	453					negative regulation of cell proliferation|regulation of protein ubiquitination	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			kidney(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)											Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
KIAA1432	57589	broad.mit.edu	37	9	5772699	5772699	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5772699A>G	uc003zji.2	+	23	3608	c.3515A>G	c.(3514-3516)GAG>GGG	p.E1172G	KIAA1432_uc003zjl.3_Missense_Mutation_p.E1135G|ERMP1_uc011lme.1_Intron	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	1251						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)														---	---	---	---
ZNF658	26149	broad.mit.edu	37	9	40784149	40784149	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40784149G>C	uc004abs.2	-	4	348	c.196C>G	c.(196-198)CCA>GCA	p.P66A	ZNF658_uc010mmm.1_Missense_Mutation_p.P66A|ZNF658_uc010mmn.1_Missense_Mutation_p.P66A	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	66	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)														---	---	---	---
C9orf103	414328	broad.mit.edu	37	9	86258434	86258434	+	Silent	SNP	A	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86258434A>C	uc004amu.1	+	5	317	c.303A>C	c.(301-303)GTA>GTC	p.V101V	C9orf103_uc004amt.1_Silent_p.V55V|C9orf103_uc010mpv.1_Silent_p.V55V	NM_001001551	NP_001001551	Q5T6J7	GNTK_HUMAN	gluconokinase-like protein	101					carbohydrate metabolic process	cytoplasm	ATP binding|gluconokinase activity|shikimate kinase activity				0																		---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113148171	113148171	+	Intron	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113148171G>T	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197			polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
FAM78A	286336	broad.mit.edu	37	9	134151258	134151258	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134151258G>A	uc004cak.2	-	1	649	c.309C>T	c.(307-309)TAC>TAT	p.Y103Y		NM_033387	NP_203745	Q5JUQ0	FA78A_HUMAN	hypothetical protein LOC286336	103										ovary(1)	1	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)														---	---	---	---
GJD4	219770	broad.mit.edu	37	10	35896709	35896709	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35896709G>A	uc001iyy.1	+	2	426	c.268G>A	c.(268-270)GCC>ACC	p.A90T		NM_153368	NP_699199	Q96KN9	CXD4_HUMAN	connexin40.1	90	Helical; (Potential).				cell communication	connexon complex|integral to membrane				large_intestine(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
OR51T1	401665	broad.mit.edu	37	11	4904053	4904053	+	Silent	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4904053G>T	uc010qyp.1	+	1	1005	c.1005G>T	c.(1003-1005)CTG>CTT	p.L335L		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR4D10	390197	broad.mit.edu	37	11	59245145	59245145	+	Silent	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245145T>C	uc001nnz.1	+	1	243	c.243T>C	c.(241-243)GTT>GTC	p.V81V		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3																		---	---	---	---
OVOL1	5017	broad.mit.edu	37	11	65561652	65561652	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65561652C>T	uc001ofp.2	+	2	567	c.251C>T	c.(250-252)TCT>TTT	p.S84F	OVOL1_uc001ofq.2_Missense_Mutation_p.S22F	NM_004561	NP_004552	O14753	OVOL1_HUMAN	OVO-like 1 binding protein	84					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.17)														---	---	---	---
AKAP3	10566	broad.mit.edu	37	12	4736611	4736611	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4736611C>T	uc001qnb.3	-	4	1686	c.1457G>A	c.(1456-1458)CGT>CAT	p.R486H		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	486					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6																		---	---	---	---
APOBEC1	339	broad.mit.edu	37	12	7805130	7805130	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7805130C>T	uc001qtb.2	-	3	380	c.346G>A	c.(346-348)GTA>ATA	p.V116I	APOBEC1_uc001qtc.2_Missense_Mutation_p.V71I|APOBEC1_uc010sgf.1_Missense_Mutation_p.V116I	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	116					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0																		---	---	---	---
BAZ2A	11176	broad.mit.edu	37	12	57005736	57005736	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57005736G>T	uc001slq.1	-	6	1630	c.1436C>A	c.(1435-1437)GCA>GAA	p.A479E	BAZ2A_uc001slp.1_Missense_Mutation_p.A477E|BAZ2A_uc009zow.1_Missense_Mutation_p.A447E	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	479					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0																		---	---	---	---
RASSF3	283349	broad.mit.edu	37	12	65085273	65085273	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65085273C>T	uc001ssd.2	+	4	601	c.481C>T	c.(481-483)CGG>TGG	p.R161W	RASSF3_uc009zqn.2_RNA|RASSF3_uc001sse.2_Missense_Mutation_p.R91W	NM_178169	NP_835463	Q86WH2	RASF3_HUMAN	Ras association (RalGDS/AF-6) domain family	161	Ras-associating.				signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)														---	---	---	---
FRY	10129	broad.mit.edu	37	13	32776675	32776675	+	Intron	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32776675A>G	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36046612	36046612	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36046612C>T	uc001uvb.2	+	41	6730	c.6524C>T	c.(6523-6525)ACG>ATG	p.T2175M	NBEA_uc010abi.2_Missense_Mutation_p.T831M|NBEA_uc010tee.1_Translation_Start_Site	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2175						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64449413	64449413	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64449413C>G	uc001xgm.2	+	17	2132	c.1902C>G	c.(1900-1902)TTC>TTG	p.F634L	SYNE2_uc001xgl.2_Missense_Mutation_p.F634L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	634	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72139105	72139105	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72139105G>A	uc001xms.2	+	9	3218	c.2870G>A	c.(2869-2871)CGA>CAA	p.R957Q	SIPA1L1_uc001xmt.2_Missense_Mutation_p.R957Q|SIPA1L1_uc001xmu.2_Missense_Mutation_p.R957Q|SIPA1L1_uc001xmv.2_Missense_Mutation_p.R957Q|SIPA1L1_uc010ttm.1_Missense_Mutation_p.R432Q	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	957					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
SLC12A6	9990	broad.mit.edu	37	15	34528245	34528245	+	Silent	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34528245T>C	uc001zhw.2	-	23	3362	c.3198A>G	c.(3196-3198)GAA>GAG	p.E1066E	SLC12A6_uc001zhv.2_Silent_p.E1015E|SLC12A6_uc001zhx.2_Silent_p.E1051E|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Silent_p.E1007E|SLC12A6_uc001zib.2_Silent_p.E1057E|SLC12A6_uc001zic.2_Silent_p.E1066E|SLC12A6_uc010bau.2_Silent_p.E1066E|SLC12A6_uc001zid.2_Silent_p.E1007E|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Silent_p.E878E	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	1066	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)													---	---	---	---
GJD2	57369	broad.mit.edu	37	15	35045227	35045227	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35045227G>A	uc001zis.1	-	2	418	c.418C>T	c.(418-420)CGA>TGA	p.R140*	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	140	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)														---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72227776	72227776	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72227776T>A	uc002atl.3	-	17	2901	c.2428A>T	c.(2428-2430)AGA>TGA	p.R810*	MYO9A_uc010biq.2_Nonsense_Mutation_p.R430*|MYO9A_uc002atn.1_Nonsense_Mutation_p.R791*	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	810					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84690187	84690187	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84690187G>A	uc002bjz.3	+	26	4523	c.4299G>A	c.(4297-4299)TGG>TGA	p.W1433*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.W1433*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.W1433*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1433	TSP type-1 8.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
CHTF18	63922	broad.mit.edu	37	16	844151	844151	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:844151C>T	uc002cke.3	+	15	1963	c.1900C>T	c.(1900-1902)CGT>TGT	p.R634C	CHTF18_uc002ckf.3_Missense_Mutation_p.R662C|CHTF18_uc010brf.2_Missense_Mutation_p.R216C|CHTF18_uc002ckg.3_Missense_Mutation_p.R152C	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor	634					cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)																---	---	---	---
FLYWCH2	114984	broad.mit.edu	37	16	2946611	2946611	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2946611T>G	uc002csa.2	+	3	532	c.161T>G	c.(160-162)GTG>GGG	p.V54G	FLYWCH2_uc010uwj.1_Missense_Mutation_p.V54G|FLYWCH2_uc010uwk.1_Missense_Mutation_p.V54G	NM_138439	NP_612448	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	54											0																		---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10274134	10274134	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10274134G>A	uc002czo.3	-	2	683	c.135C>T	c.(133-135)GAC>GAT	p.D45D	GRIN2A_uc010uym.1_Silent_p.D45D|GRIN2A_uc002czr.3_Silent_p.D45D|GRIN2A_uc010buk.2_Silent_p.D45D	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	45	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
MYLK3	91807	broad.mit.edu	37	16	46764495	46764495	+	Intron	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46764495G>T	uc002eei.3	-						MYLK3_uc010vge.1_Intron|MYLK3_uc002eej.1_Intron	NM_182493	NP_872299			myosin light chain kinase 3						cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)																---	---	---	---
NOD2	64127	broad.mit.edu	37	16	50750497	50750497	+	Splice_Site	SNP	G	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50750497G>C	uc002egm.1	+	5	2568	c.2463_splice	c.e5-1	p.Y821_splice	NOD2_uc010cbl.1_Splice_Site_p.Y599_splice|NOD2_uc010cbm.1_Splice_Site_p.Y599_splice|NOD2_uc010cbn.1_Intron|NOD2_uc010cbo.1_Intron|NOD2_uc010cbp.1_Intron|NOD2_uc010cbq.1_Splice_Site|NOD2_uc010cbr.1_Intron	NM_022162	NP_071445			nucleotide-binding oligomerization domain						activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)																---	---	---	---
IRX5	10265	broad.mit.edu	37	16	54967637	54967637	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54967637C>T	uc002ehv.2	+	3	1304	c.1304C>T	c.(1303-1305)CCG>CTG	p.P435L	IRX5_uc002ehw.2_Missense_Mutation_p.P369L	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	435					response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding				0																		---	---	---	---
CAMTA2	23125	broad.mit.edu	37	17	4875783	4875783	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4875783G>A	uc002gah.1	-	16	2660	c.2552C>T	c.(2551-2553)TCC>TTC	p.S851F	CAMTA2_uc010cku.1_Missense_Mutation_p.S874F|CAMTA2_uc002gag.1_Missense_Mutation_p.S850F|CAMTA2_uc002gai.1_Missense_Mutation_p.S853F|CAMTA2_uc010ckv.1_Missense_Mutation_p.S498F	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	851					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1																		---	---	---	---
DLG4	1742	broad.mit.edu	37	17	7106879	7106879	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7106879C>T	uc002get.3	-	8	1699	c.498G>A	c.(496-498)GTG>GTA	p.V166V	DLG4_uc010vtm.1_RNA|DLG4_uc010vtn.1_Silent_p.V63V|DLG4_uc010cly.2_Silent_p.V120V|DLG4_uc010vto.1_Silent_p.V163V|DLG4_uc002geu.2_Silent_p.V120V	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	123	PDZ 1.				axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8216418	8216418	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8216418C>T	uc002glc.2	+	3	901	c.780C>T	c.(778-780)GCC>GCT	p.A260A	ARHGEF15_uc002glb.1_3'UTR|ARHGEF15_uc002gld.2_Silent_p.A260A|ARHGEF15_uc010vuw.1_Intron	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	260					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8219149	8219149	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8219149G>A	uc002glc.2	+	8	1619	c.1498G>A	c.(1498-1500)GCT>ACT	p.A500T	ARHGEF15_uc002gld.2_Missense_Mutation_p.A500T|ARHGEF15_uc010vuw.1_Missense_Mutation_p.A389T	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	500	DH.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
MYH10	4628	broad.mit.edu	37	17	8380351	8380351	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8380351C>T	uc002gll.2	-	40	5725	c.5629G>A	c.(5629-5631)GCT>ACT	p.A1877T	MYH10_uc002glm.2_Missense_Mutation_p.A1908T|MYH10_uc010cnx.2_Missense_Mutation_p.A1886T	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	1877	Potential.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2																		---	---	---	---
ALKBH5	54890	broad.mit.edu	37	17	18110185	18110185	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18110185C>T	uc010cpw.2	+	3	1599	c.908C>T	c.(907-909)CCA>CTA	p.P303L	ALKBH5_uc010cpx.2_RNA	NM_017758	NP_060228	Q6P6C2	ALKB5_HUMAN	alkB, alkylation repair homolog 5	303						integral to membrane	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_neural(463;0.228)																	---	---	---	---
PIGS	94005	broad.mit.edu	37	17	26890883	26890883	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26890883C>T	uc002hbo.2	-	4	702	c.329G>A	c.(328-330)AGG>AAG	p.R110K	PIGS_uc002hbn.2_Missense_Mutation_p.R102K|PIGS_uc010wap.1_Missense_Mutation_p.R49K	NM_033198	NP_149975	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	110	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			breast(2)|urinary_tract(1)|kidney(1)	4	Lung NSC(42;0.00431)																	---	---	---	---
LRRC37B	114659	broad.mit.edu	37	17	30349784	30349784	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30349784A>G	uc002hgu.2	+	1	1630	c.1619A>G	c.(1618-1620)CAG>CGG	p.Q540R	LRRC37B_uc010wbx.1_Missense_Mutation_p.Q458R|LRRC37B_uc010csu.2_Missense_Mutation_p.Q540R	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor	540	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)																---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31350876	31350876	+	Intron	SNP	T	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31350876T>A	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACE	1636	broad.mit.edu	37	17	61568741	61568741	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61568741C>T	uc002jau.1	+	19	2933	c.2911C>T	c.(2911-2913)CGG>TGG	p.R971W	ACE_uc002jav.1_Missense_Mutation_p.R397W|ACE_uc010ddv.1_Missense_Mutation_p.R198W|ACE_uc010wpj.1_Missense_Mutation_p.R397W|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Missense_Mutation_p.R217W	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	971	Extracellular (Potential).|Peptidase M2 2.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)													---	---	---	---
ZFP161	7541	broad.mit.edu	37	18	5291265	5291265	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5291265G>A	uc002kmq.2	-	4	1103	c.942C>T	c.(940-942)TTC>TTT	p.F314F	ZFP161_uc002kmr.2_Silent_p.F314F|ZFP161_uc010dkp.2_Silent_p.F314F	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog	314	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
NFATC1	4772	broad.mit.edu	37	18	77246792	77246792	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77246792G>A	uc010xfg.1	+	9	3090	c.2637G>A	c.(2635-2637)CCG>CCA	p.P879P	NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfj.1_Silent_p.P407P|NFATC1_uc002lnf.2_Silent_p.P866P|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	879	Trans-activation domain B (TAD-B).				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)														---	---	---	---
C19orf26	255057	broad.mit.edu	37	19	1235496	1235496	+	Intron	SNP	T	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1235496T>C	uc002lrm.2	-							NM_152769	NP_689982			downstream of Stk11							integral to membrane					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)											HNSCC(14;0.022)			---	---	---	---
FEM1A	55527	broad.mit.edu	37	19	4793005	4793005	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4793005G>A	uc002mbf.2	+	1	1278	c.1139G>A	c.(1138-1140)CGC>CAC	p.R380H	uc002mbg.1_RNA	NM_018708	NP_061178	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a	380					regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)														---	---	---	---
ZNRF4	148066	broad.mit.edu	37	19	5456204	5456204	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5456204G>A	uc002mca.3	+	1	779	c.702G>A	c.(700-702)GCG>GCA	p.A234A		NM_181710	NP_859061	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4 precursor	234	Extracellular (Potential).					integral to membrane	zinc ion binding			large_intestine(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)														---	---	---	---
PRAM1	84106	broad.mit.edu	37	19	8564247	8564247	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8564247C>T	uc002mkd.2	-	2	465	c.445G>A	c.(445-447)GGT>AGT	p.G149S	PRAM1_uc002mkc.2_Missense_Mutation_p.G149S	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	197	Pro-rich.						lipid binding|protein binding				0																		---	---	---	---
ZNF177	7730	broad.mit.edu	37	19	9492250	9492250	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9492250A>G	uc002mli.2	+	12	1426	c.763A>G	c.(763-765)AAG>GAG	p.K255E	ZNF177_uc002mlj.2_Missense_Mutation_p.K205E|ZNF177_uc002mlk.2_Missense_Mutation_p.K255E	NM_003451	NP_003442	Q13360	ZN177_HUMAN	zinc finger protein 177	255	C2H2-type 5.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31769496	31769496	+	Silent	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769496G>A	uc002nsy.3	-	2	1268	c.1203C>T	c.(1201-1203)CTC>CTT	p.L401L		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	401	C2H2-type 3; atypical.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
ZNF529	57711	broad.mit.edu	37	19	37039085	37039085	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37039085G>T	uc002oeh.3	-	5	577	c.375C>A	c.(373-375)AGC>AGA	p.S125R	ZNF529_uc010xth.1_Missense_Mutation_p.S125R|ZNF529_uc010xti.1_Missense_Mutation_p.S107R|ZNF529_uc002oeg.3_Missense_Mutation_p.S20R	NM_020951	NP_066002	Q6P280	ZN529_HUMAN	zinc finger protein 529 isoform a	92					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	Esophageal squamous(110;0.198)																	---	---	---	---
ZNF229	7772	broad.mit.edu	37	19	44933774	44933774	+	Silent	SNP	G	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44933774G>C	uc002oze.1	-	6	1616	c.1182C>G	c.(1180-1182)GTC>GTG	p.V394V	ZNF229_uc010ejk.1_Silent_p.V48V|ZNF229_uc010ejl.1_Silent_p.V388V	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	394	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)																---	---	---	---
KLK1	3816	broad.mit.edu	37	19	51322566	51322566	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51322566G>A	uc002ptk.1	-	5	712	c.673C>T	c.(673-675)CAA>TAA	p.Q225*	KLK1_uc010ycg.1_RNA	NM_002257	NP_002248	P06870	KLK1_HUMAN	kallikrein 1 preproprotein	225	Peptidase S1.				proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
C19orf18	147685	broad.mit.edu	37	19	58472857	58472857	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58472857G>A	uc002qqv.2	-	5	538	c.434C>T	c.(433-435)CCG>CTG	p.P145L		NM_152474	NP_689687	Q8NEA5	CS018_HUMAN	hypothetical protein LOC147685 precursor	145	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)														---	---	---	---
TOMM34	10953	broad.mit.edu	37	20	43572151	43572151	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43572151C>T	uc002xmy.2	-	6	908	c.768G>A	c.(766-768)CTG>CTA	p.L256L	PABPC1L_uc002xmx.2_Intron|TOMM34_uc002xmz.2_RNA	NM_006809	NP_006800	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	256	TPR 5.				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	heat shock protein binding|signal sequence binding				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	31045467	31045467	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31045467C>G	uc002yno.1	-	4	1026	c.562G>C	c.(562-564)GAG>CAG	p.E188Q	GRIK1_uc002ynn.2_Missense_Mutation_p.E188Q|GRIK1_uc011acs.1_Missense_Mutation_p.E188Q|GRIK1_uc011act.1_Missense_Mutation_p.E132Q|GRIK1_uc010glq.1_Missense_Mutation_p.E46Q|GRIK1_uc002ynr.2_Missense_Mutation_p.E188Q	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	188	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
PLXNB2	23654	broad.mit.edu	37	22	50715103	50715103	+	Silent	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50715103C>T	uc003bkv.3	-	35	5398	c.5292G>A	c.(5290-5292)CAG>CAA	p.Q1764Q	PLXNB2_uc003bkt.1_Silent_p.Q556Q|PLXNB2_uc003bku.1_Silent_p.Q749Q	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1764	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
CXorf23	256643	broad.mit.edu	37	X	19973635	19973635	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19973635C>T	uc004czp.2	-	4	1324	c.1324G>A	c.(1324-1326)GCT>ACT	p.A442T	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Missense_Mutation_p.A7T|CXorf23_uc004czo.2_Missense_Mutation_p.A392T	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	442						mitochondrion				lung(1)|skin(1)	2																		---	---	---	---
FAM47B	170062	broad.mit.edu	37	X	34961131	34961131	+	Silent	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34961131C>A	uc004ddi.1	+	1	201	c.183C>A	c.(181-183)GCC>GCA	p.A61A		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	61										ovary(3)|breast(1)	4																		---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53655786	53655786	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53655786C>A	uc004dsp.2	-	14	1433	c.1031G>T	c.(1030-1032)AGC>ATC	p.S344I		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	344					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
KIAA2022	340533	broad.mit.edu	37	X	73962731	73962731	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962731A>C	uc004eby.2	-	3	2278	c.1661T>G	c.(1660-1662)ATG>AGG	p.M554R		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	554					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15																		---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100417865	100417865	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100417865G>A	uc004egx.2	+	21	2450	c.2180G>A	c.(2179-2181)GGG>GAG	p.G727E	CENPI_uc011mrg.1_Missense_Mutation_p.G713E	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	727					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
ZMAT1	84460	broad.mit.edu	37	X	101139539	101139539	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101139539G>A	uc004eim.2	-	2	3845	c.347C>T	c.(346-348)TCA>TTA	p.S116L	ZMAT1_uc011mrl.1_Missense_Mutation_p.S287L|ZMAT1_uc004ein.2_Missense_Mutation_p.S116L|ZMAT1_uc011mrm.1_Missense_Mutation_p.S116L	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin type 1 isoform 3	116						nucleus	zinc ion binding			ovary(1)	1																		---	---	---	---
TCEAL5	340543	broad.mit.edu	37	X	102529130	102529130	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102529130T>G	uc004ejz.1	-	3	657	c.362A>C	c.(361-363)GAC>GCC	p.D121A		NM_001012979	NP_001012997	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(1)|breast(1)	2																		---	---	---	---
NRK	203447	broad.mit.edu	37	X	105179181	105179181	+	Silent	SNP	A	G	G			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105179181A>G	uc004emd.2	+	21	3822	c.3519A>G	c.(3517-3519)GAA>GAG	p.E1173E	NRK_uc010npc.1_Silent_p.E841E	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1173							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14															HNSCC(51;0.14)			---	---	---	---
ACTRT1	139741	broad.mit.edu	37	X	127185408	127185408	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-5722-01	TCGA-CG-5722-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185408C>A	uc004eum.2	-	1	975	c.778G>T	c.(778-780)GAG>TAG	p.E260*		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	260						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5																		---	---	---	---
