Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
RBP7	116362	broad.mit.edu	37	1	10068501	10068502	+	Intron	INS	-	T	T	rs112928878		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068501_10068502insT	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192			retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)													---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50610037	50610038	+	Intron	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50610037_50610038insA	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
AK5	26289	broad.mit.edu	37	1	77948989	77948990	+	Intron	INS	-	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77948989_77948990insT	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283			adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1																		---	---	---	---
GPR161	23432	broad.mit.edu	37	1	168056573	168056574	+	Intron	DEL	GT	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168056573_168056574delGT	uc001gfc.2	-						GPR161_uc001gfb.2_Intron|GPR161_uc010pll.1_Intron|GPR161_uc010plm.1_Intron|GPR161_uc009wvo.2_Intron|GPR161_uc001gfd.2_Intron|GPR161_uc010pln.1_Intron	NM_153832	NP_722561			G protein-coupled receptor 161 isoform 2						multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108519282	108519283	+	IGR	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108519282_108519283insA								RGPD4 (10283 upstream) : SLC5A7 (83712 downstream)																																			---	---	---	---
ALS2CR11	151254	broad.mit.edu	37	2	202439790	202439791	+	Intron	INS	-	GAG	GAG	rs138295994	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202439790_202439791insGAG	uc002uye.2	-						ALS2CR11_uc002uyf.2_Intron|ALS2CR11_uc010fti.2_Intron	NM_152525	NP_689738			amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
PRR21	643905	broad.mit.edu	37	2	240982117	240982144	+	Frame_Shift_Del	DEL	GTGGGTGAAGAGGCATGGATGAAGGACT	-	-	rs147066740	byFrequency;by1000genomes;byFrequency;byFrequency;by1000genomes;byFrequency;by1000genomes;byFrequency;by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240982117_240982144delGTGGGTGAAGAGGCATGGATGAAGGACT	uc010zod.1	-	1	256_283	c.256_283delAGTCCTTCATCCATGCCTCTTCACCCAC	c.(256-285)AGTCCTTCATCCATGCCTCTTCACCCACGGfs	p.S86fs		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	86_95	Pro-rich.									ovary(1)|skin(1)	2																		---	---	---	---
MTMR14	64419	broad.mit.edu	37	3	9691543	9691544	+	Intron	DEL	GA	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9691543_9691544delGA	uc003brz.2	+						MTMR14_uc003bsa.2_Intron|MTMR14_uc003bsb.2_Intron|MTMR14_uc011ath.1_Intron|MTMR14_uc010hcl.2_Intron	NM_001077525	NP_001070993			jumpy isoform 2							perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(99;0.227)																	---	---	---	---
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257			CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
TMEM207	131920	broad.mit.edu	37	3	190147703	190147704	+	Intron	DEL	GA	-	-	rs78875004		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147703_190147704delGA	uc003fsj.2	-							NM_207316	NP_997199			transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)														---	---	---	---
C4orf50	389197	broad.mit.edu	37	4	5981739	5981740	+	Intron	INS	-	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5981739_5981740insT	uc003git.1	-							NM_207405	NP_997288			hypothetical protein LOC389197											pancreas(2)|breast(1)	3																		---	---	---	---
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475			NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
MAK	4117	broad.mit.edu	37	6	10814203	10814203	+	Intron	DEL	T	-	-	rs112931281		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10814203delT	uc003mzl.2	-						SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jos.1_Intron|MAK_uc010jot.2_Intron|MAK_uc010jou.2_Intron|MAK_uc003mzm.2_Intron|MAK_uc010jov.1_Intron	NM_005906	NP_005897			male germ cell-associated kinase						cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|cyclin-dependent protein kinase activity			breast(2)|skin(1)	3	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)																---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32521539	32521540	+	Intron	INS	-	GAAA	GAAA	rs71843515		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521539_32521540insGAAA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
SYNCRIP	10492	broad.mit.edu	37	6	86350405	86350406	+	Intron	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86350405_86350406insA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363			synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)														---	---	---	---
NUS1	116150	broad.mit.edu	37	6	118028340	118028347	+	3'UTR	DEL	GTGTGTGC	-	-	rs1052261		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118028340_118028347delGTGTGTGC	uc003pxw.2	+	5						NM_138459	NP_612468			nuclear undecaprenyl pyrophosphate synthase 1						angiogenesis|cell differentiation	integral to membrane	receptor activity|transferase activity, transferring alkyl or aryl (other than methyl) groups			central_nervous_system(1)	1		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)														---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151330671	151330671	+	Intron	DEL	A	-	-	rs71780971		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151330671delA	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882			acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	57642327	57642327	+	IGR	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57642327delT								ZNF716 (109062 upstream) : None (None downstream)																																			---	---	---	---
PMS2L3	5387	broad.mit.edu	37	7	75142142	75142142	+	Intron	DEL	A	-	-	rs71519365		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75142142delA	uc003udp.2	-						PMS2L3_uc003udn.2_Intron|PMS2L3_uc003udq.2_Intron	NM_005395	NP_005386			SubName: Full=Postmeiotic segregation increased 2-like 3; SubName: Full=Postmeiotic segregation increased 2-like 3, isoform CRA_b;												0													Direct_reversal_of_damage|MMR					---	---	---	---
LOC100132832	100132832	broad.mit.edu	37	7	76669648	76669649	+	Intron	INS	-	ATCTC	ATCTC			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669648_76669649insATCTC	uc003ufy.2	+						PMS2L11_uc011kgn.1_Intron	NR_028058				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133184645	133184646	+	Intron	DEL	AC	-	-	rs138308682		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184645_133184646delAC	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
HAUS6	54801	broad.mit.edu	37	9	19063968	19063969	+	Intron	INS	-	T	T	rs72452802		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19063968_19063969insT	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron|SCARNA8_uc003znn.1_5'Flank	NM_017645	NP_060115			HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																																			---	---	---	---
FXN	2395	broad.mit.edu	37	9	71668387	71668388	+	Intron	INS	-	GATGGATG	GATGGATG	rs73647061	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668387_71668388insGATGGATG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135			frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0																		---	---	---	---
SEC61B	10952	broad.mit.edu	37	9	101990074	101990075	+	Intron	INS	-	T	T	rs111986989		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990074_101990075insT	uc004azh.2	+							NM_006808	NP_006799			Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
OR13C5	138799	broad.mit.edu	37	9	107361899	107361902	+	5'Flank	DEL	GAAT	-	-	rs10541505		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107361899_107361902delGAAT	uc011lvp.1	-							NM_001004482	NP_001004482			olfactory receptor, family 13, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
OR1L4	254973	broad.mit.edu	37	9	125486451	125486452	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125486451_125486452insT	uc004bmu.1	+	1	183_184	c.183_184insT	c.(181-186)TACTTTfs	p.Y61fs		NM_001005235	NP_001005235	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L,	61_62	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	91738926	91738927	+	IGR	DEL	AA	-	-	rs76395084		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91738926_91738927delAA								KIF20B (204226 upstream) : HTR7 (761651 downstream)																																			---	---	---	---
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960			insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
PDLIM1	9124	broad.mit.edu	37	10	96998112	96998112	+	Intron	DEL	T	-	-	rs45543839		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96998112delT	uc001kkh.2	-						PDLIM1_uc001kki.2_Intron|PDLIM1_uc009xuv.2_Intron|PDLIM1_uc001kkj.1_3'UTR	NM_020992	NP_066272			PDZ and LIM domain 1						response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108432894	108432895	+	Intron	INS	-	T	T	rs72369490		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108432894_108432895insT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
E2F8	79733	broad.mit.edu	37	11	19255692	19255693	+	Intron	INS	-	A	A	rs76020624		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19255692_19255693insA	uc001mpm.2	-						E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Intron	NM_024680	NP_078956			E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
EIF3M	10480	broad.mit.edu	37	11	32617734	32617735	+	Intron	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32617734_32617735insA	uc001mtu.2	+						EIF3M_uc010ref.1_Intron	NM_006360	NP_006351			eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)																	---	---	---	---
SPRYD5	84767	broad.mit.edu	37	11	55653609	55653610	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55653609_55653610insA	uc010rip.1	+	3	514_515	c.422_423insA	c.(421-423)CTAfs	p.L141fs	SPRYD5_uc010riq.1_5'UTR	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	141						intracellular	zinc ion binding				0		all_epithelial(135;0.226)																---	---	---	---
PELI3	246330	broad.mit.edu	37	11	66241318	66241318	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66241318delT	uc001oic.3	+	7	926	c.762delT	c.(760-762)GGTfs	p.G254fs	PELI3_uc001oib.2_Frame_Shift_Del_p.G254fs|PELI3_uc001oid.3_Frame_Shift_Del_p.G230fs|PELI3_uc001oie.3_Frame_Shift_Del_p.G105fs|PELI3_uc010rpd.1_Frame_Shift_Del_p.G95fs	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1	254						cytosol	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7338794	7338794	+	IGR	DEL	G	-	-	rs113717305		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7338794delG								CLSTN3 (27266 upstream) : PEX5 (2965 downstream)																																			---	---	---	---
KLRB1	3820	broad.mit.edu	37	12	9750903	9750904	+	Intron	DEL	TA	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9750903_9750904delTA	uc010sgt.1	-							NM_002258	NP_002249			killer cell lectin-like receptor subfamily B,						cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0																		---	---	---	---
LRP6	4040	broad.mit.edu	37	12	12317854	12317873	+	Intron	DEL	AAAAAAAAAAAAAAAAAAAA	-	-	rs72426759		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317854_12317873delAAAAAAAAAAAAAAAAAAAA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327			low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)																---	---	---	---
SLCO1B1	10599	broad.mit.edu	37	12	21331408	21331408	+	Intron	DEL	A	-	-	rs76212902		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21331408delA	uc001req.3	+							NM_006446	NP_006437			solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)													---	---	---	---
BICD1	636	broad.mit.edu	37	12	32520417	32520417	+	Intron	DEL	A	-	-	rs63514564		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520417delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
LARP4	113251	broad.mit.edu	37	12	50823109	50823109	+	Intron	DEL	A	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50823109delA	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc001rwm.2_Intron|LARP4_uc001rwn.2_Intron	NM_052879	NP_443111			c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
FERMT2	10979	broad.mit.edu	37	14	53340667	53340667	+	Intron	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53340667delT	uc001xad.2	-						FERMT2_uc001xac.2_Intron|FERMT2_uc001xae.2_Intron|FERMT2_uc001xaf.2_Intron	NM_006832	NP_006823			fermitin family homolog 2 isoform 1						actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding				0	Breast(41;0.0342)																	---	---	---	---
SOLH	6650	broad.mit.edu	37	16	601220	601221	+	Intron	INS	-	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601220_601221insC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623			small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)																---	---	---	---
NUBP2	10101	broad.mit.edu	37	16	1837654	1837662	+	Intron	DEL	GCCCCGTCT	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1837654_1837662delGCCCCGTCT	uc002cmw.3	+						NUBP2_uc002cmx.3_Intron|NUBP2_uc010brx.2_Intron	NM_012225	NP_036357			nucleotide binding protein 2 (MinD homolog, E.							microtubule organizing center|nucleus	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|protein binding				0																		---	---	---	---
FLYWCH1	84256	broad.mit.edu	37	16	2988609	2988609	+	Intron	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2988609delT	uc002csd.2	+						FLYWCH1_uc002csb.2_Intron|FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672			FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0																		---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68684841	68684841	+	Intron	DEL	A	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68684841delA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding			ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74526722	74526722	+	Intron	DEL	A	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74526722delA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
CCDC144A	9720	broad.mit.edu	37	17	16623497	16623498	+	Intron	INS	-	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16623497_16623498insT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510			coiled-coil domain containing 144A												0																		---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30773823	30773823	+	Intron	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30773823delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30800601	30800601	+	Intron	DEL	T	-	-	rs112811195		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30800601delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
NSF	4905	broad.mit.edu	37	17	44795386	44795387	+	Intron	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44795386_44795387insA	uc002iku.2	+						NSF_uc010wke.1_Intron|NSF_uc010wkf.1_Intron|NSF_uc010wkg.1_Intron	NM_006178	NP_006169			vesicle-fusing ATPase						protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)														---	---	---	---
ABCA7	10347	broad.mit.edu	37	19	1046580	1046580	+	Intron	DEL	G	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1046580delG	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985			ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018			adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)														---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25848056	25848056	+	Intron	DEL	A	-	-	rs78077707		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25848056delA	uc002wvd.1	-											Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
GDF5	8200	broad.mit.edu	37	20	33935201	33935201	+	Intron	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33935201delT	uc010gfc.1	-						UQCC_uc010zuy.1_Intron|UQCC_uc002xcd.2_Intron|UQCC_uc010zuz.1_Intron|UQCC_uc010zva.1_Intron|UQCC_uc002xce.2_Intron|UQCC_uc002xcg.2_Intron|UQCC_uc010gfb.2_Intron|UQCC_uc010zvb.1_Intron|UQCC_uc002xcf.2_Intron|UQCC_uc002xci.1_Intron|UQCC_uc010gfd.1_Intron	NM_000557	NP_000548			growth differentiation factor 5 preproprotein						cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)															---	---	---	---
PLCG1	5335	broad.mit.edu	37	20	39790875	39790875	+	Intron	DEL	G	-	-	rs148867612		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39790875delG	uc002xjp.1	+						PLCG1_uc002xjo.1_Intron|PLCG1_uc010zwe.1_5'Flank	NM_182811	NP_877963			phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)																---	---	---	---
TCFL5	10732	broad.mit.edu	37	20	61491072	61491076	+	Intron	DEL	TTTTT	-	-	rs68160695		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61491072_61491076delTTTTT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|TCFL5_uc002ydq.2_Intron	NM_006602	NP_006593			transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)																	---	---	---	---
BPIL2	254240	broad.mit.edu	37	22	32853547	32853558	+	5'Flank	DEL	TCCATCCATCCA	-	-	rs71320927	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32853547_32853558delTCCATCCATCCA	uc003amn.2	-						BPIL2_uc010gwo.2_5'Flank|BPIL2_uc011amb.1_Intron|BPIL2_uc003amo.3_Intron	NM_174932	NP_777592			bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2																OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10109659	10109659	+	3'UTR	DEL	A	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10109659delA	uc004csx.3	+	23					WWC3_uc010nds.2_3'UTR|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506			WWC family member 3											ovary(4)	4																		---	---	---	---
NR0B1	190	broad.mit.edu	37	X	30324046	30324047	+	Intron	INS	-	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30324046_30324047insA	uc004dcf.3	-							NM_000475	NP_000466			nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)													---	---	---	---
TAF1	6872	broad.mit.edu	37	X	70626767	70626767	+	Intron	DEL	T	-	-			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70626767delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278			TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---
NXF2B	728343	broad.mit.edu	37	X	101622534	101622535	+	Intron	INS	-	GA	GA			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101622534_101622535insGA	uc004ejb.3	-						NXF2B_uc004eiz.3_Intron|NXF2B_uc004eja.3_Intron|NXF2_uc004eiy.3_Intron	NM_001099686	NP_001093156			nuclear RNA export factor 2B						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17272075	17272075	+	Missense_Mutation	SNP	G	A	A	rs2781608	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17272075G>A	uc001azt.2	+	15	2179	c.2110G>A	c.(2110-2112)GCC>ACC	p.A704T	CROCC_uc009voz.1_Missense_Mutation_p.A467T|CROCC_uc001azu.2_Missense_Mutation_p.A7T	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	704	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34066453	34066453	+	Intron	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34066453T>G	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxo.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
SLC6A9	6536	broad.mit.edu	37	1	44467189	44467189	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44467189C>T	uc001cll.2	-	9	1484	c.1292G>A	c.(1291-1293)CGT>CAT	p.R431H	SLC6A9_uc009vxe.2_Missense_Mutation_p.R287H|SLC6A9_uc010okm.1_Missense_Mutation_p.R358H|SLC6A9_uc001clm.2_Missense_Mutation_p.R377H|SLC6A9_uc009vxd.2_RNA|SLC6A9_uc010okn.1_Missense_Mutation_p.R362H|SLC6A9_uc001cln.2_Missense_Mutation_p.R358H|SLC6A9_uc010oko.1_Missense_Mutation_p.R247H|SLC6A9_uc010okp.1_RNA	NM_201649	NP_964012	P48067	SC6A9_HUMAN	solute carrier family 6 member 9 isoform 2	431						integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity				0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)													---	---	---	---
NRD1	4898	broad.mit.edu	37	1	52260202	52260202	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52260202C>T	uc001ctc.3	-	26	3243	c.2921G>A	c.(2920-2922)TGC>TAC	p.C974Y	NRD1_uc009vzb.2_Missense_Mutation_p.C669Y|NRD1_uc001ctd.3_Missense_Mutation_p.C906Y|NRD1_uc001cte.2_Missense_Mutation_p.C842Y|NRD1_uc001ctf.2_Missense_Mutation_p.C906Y|NRD1_uc010ong.1_RNA	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	905					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0																		---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	114201842	114201842	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114201842A>G	uc001edk.2	+	16	2951	c.2770A>G	c.(2770-2772)AAA>GAA	p.K924E	MAGI3_uc001edh.3_Missense_Mutation_p.K949E|MAGI3_uc001edi.3_Missense_Mutation_p.K924E|MAGI3_uc010owm.1_Missense_Mutation_p.K949E|MAGI3_uc001edj.2_Missense_Mutation_p.K645E	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	949	Interaction with LPAR2 and GRIN2B.|PDZ 5.				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150936523	150936523	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150936523A>G	uc001evu.2	+	21	3912	c.3722A>G	c.(3721-3723)GAT>GGT	p.D1241G	SETDB1_uc001evv.2_Missense_Mutation_p.D1241G	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1241	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
ASTN1	460	broad.mit.edu	37	1	176983923	176983923	+	Intron	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176983923T>G	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron|ASTN1_uc001gle.3_Intron	NM_004319	NP_004310			astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
ASPM	259266	broad.mit.edu	37	1	197059184	197059184	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197059184C>T	uc001gtu.2	-	25	10117	c.9860G>A	c.(9859-9861)TGT>TAT	p.C3287Y	ASPM_uc001gtv.2_Missense_Mutation_p.C1702Y|ASPM_uc001gtw.3_Missense_Mutation_p.C1135Y	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3287					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---
PFKFB2	5208	broad.mit.edu	37	1	207243623	207243623	+	Splice_Site	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207243623A>C	uc001hfg.2	+	12	1202	c.1093_splice	c.e12-2	p.S365_splice	PFKFB2_uc010psc.1_Splice_Site_p.S267_splice|PFKFB2_uc001hfh.2_Splice_Site_p.S365_splice|PFKFB2_uc009xcc.2_Splice_Site_p.S323_splice|PFKFB2_uc010psd.1_Splice_Site_p.S179_splice	NM_006212	NP_006203			6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			ovary(1)	1	Prostate(682;0.19)																	---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213415558	213415558	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415558G>A	uc010ptr.1	+	11	2898	c.2739G>A	c.(2737-2739)ATG>ATA	p.M913I	RPS6KC1_uc001hkd.2_Missense_Mutation_p.M901I|RPS6KC1_uc010pts.1_Missense_Mutation_p.M701I|RPS6KC1_uc010ptt.1_Missense_Mutation_p.M701I|RPS6KC1_uc010ptu.1_Missense_Mutation_p.M732I|RPS6KC1_uc010ptv.1_Missense_Mutation_p.M448I|RPS6KC1_uc001hke.2_Missense_Mutation_p.M732I	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	913	Protein kinase 2.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---
TRIM58	25893	broad.mit.edu	37	1	248024021	248024021	+	Intron	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248024021C>T	uc001ido.2	+							NM_015431	NP_056246			tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)															---	---	---	---
TPO	7173	broad.mit.edu	37	2	1488506	1488506	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1488506G>A	uc002qww.2	+	9	1568	c.1477G>A	c.(1477-1479)GGC>AGC	p.G493S	TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.G493S|TPO_uc002qwr.2_Missense_Mutation_p.G493S|TPO_uc002qwx.2_Missense_Mutation_p.G493S|TPO_uc010yio.1_Missense_Mutation_p.G320S|TPO_uc010yip.1_Missense_Mutation_p.G493S|TPO_uc002qwy.1_5'UTR|TPO_uc002qwz.2_RNA	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	493	Extracellular (Potential).		G -> S (in TDH2A).		cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)													---	---	---	---
APOB	338	broad.mit.edu	37	2	21229171	21229171	+	Silent	SNP	G	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21229171G>C	uc002red.2	-	26	10697	c.10569C>G	c.(10567-10569)TCC>TCG	p.S3523S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3523					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---
ADD2	119	broad.mit.edu	37	2	70933534	70933534	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70933534C>T	uc002sgz.2	-	3	472	c.7G>A	c.(7-9)GAA>AAA	p.E3K	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Missense_Mutation_p.E3K|ADD2_uc002sha.2_Missense_Mutation_p.E3K|ADD2_uc002sgx.2_Missense_Mutation_p.E3K|ADD2_uc010fdt.1_Missense_Mutation_p.E3K|ADD2_uc002shc.1_Missense_Mutation_p.E3K|ADD2_uc002shd.1_Missense_Mutation_p.E3K|ADD2_uc010fdu.1_Missense_Mutation_p.E19K	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	3					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3																		---	---	---	---
C2orf65	130951	broad.mit.edu	37	2	74867167	74867167	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74867167A>G	uc002smy.2	-	2	353	c.236T>C	c.(235-237)TTT>TCT	p.F79S	C2orf65_uc010ysa.1_Missense_Mutation_p.F79S|C2orf65_uc002smz.2_Missense_Mutation_p.F79S	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	79					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625236	141625236	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625236T>G	uc002tvj.1	-	27	5474	c.4502A>C	c.(4501-4503)CAG>CCG	p.Q1501P	LRP1B_uc010fnl.1_Missense_Mutation_p.Q683P	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1501	Extracellular (Potential).|LDL-receptor class B 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ACVR2A	92	broad.mit.edu	37	2	148657140	148657140	+	Intron	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148657140A>C	uc002twg.2	+						ACVR2A_uc010zbn.1_Intron|ACVR2A_uc002twh.2_Intron	NM_001616	NP_001607			activin A receptor, type IIA precursor						activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)														---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160176909	160176909	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160176909A>G	uc002uao.2	-	37	6726	c.6374T>C	c.(6373-6375)TTT>TCT	p.F2125S	BAZ2B_uc002uap.2_Missense_Mutation_p.F2089S	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	2125	Bromo.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
CALCRL	10203	broad.mit.edu	37	2	188210976	188210976	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188210976A>C	uc002upv.3	-	15	1869	c.1321T>G	c.(1321-1323)TTA>GTA	p.L441V	CALCRL_uc010frt.2_Missense_Mutation_p.L441V	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor	441	Cytoplasmic (Potential).					integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)															---	---	---	---
IQCA1	79781	broad.mit.edu	37	2	237405873	237405873	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237405873A>T	uc002vvz.1	-	2	451	c.269T>A	c.(268-270)ATG>AAG	p.M90K	IQCA1_uc002vwb.2_Missense_Mutation_p.M97K|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Missense_Mutation_p.M90K	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	90							ATP binding			ovary(1)	1																		---	---	---	---
MLPH	79083	broad.mit.edu	37	2	238449573	238449573	+	Silent	SNP	C	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238449573C>G	uc002vwt.2	+	11	1646	c.1419C>G	c.(1417-1419)GCC>GCG	p.A473A	MLPH_uc002vws.2_Silent_p.A330A|MLPH_uc010fyt.1_Silent_p.A445A|MLPH_uc002vwu.2_Silent_p.A445A|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron|MLPH_uc002vwx.2_Silent_p.A329A|MLPH_uc010fyu.2_Silent_p.A225A	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1	473	Potential.						metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	384718	384718	+	Intron	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:384718A>C	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		p.?(1)		skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
HACL1	26061	broad.mit.edu	37	3	15613246	15613246	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15613246G>A	uc003caf.2	-	12	1184	c.1024C>T	c.(1024-1026)CAG>TAG	p.Q342*	HACL1_uc011avr.1_RNA|HACL1_uc011avs.1_Nonsense_Mutation_p.Q315*|HACL1_uc011avt.1_Intron|HACL1_uc003cag.2_5'UTR|HACL1_uc011avu.1_Nonsense_Mutation_p.Q260*|HACL1_uc010hep.2_Nonsense_Mutation_p.Q101*	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase	342					fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0																		---	---	---	---
NEK10	152110	broad.mit.edu	37	3	27216205	27216205	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27216205G>A	uc010hfk.2	-	6	790	c.561C>T	c.(559-561)GAC>GAT	p.D187D	NEK10_uc003cds.1_Silent_p.D272D|NEK10_uc010hfj.2_Silent_p.D187D			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;	875							ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13																		---	---	---	---
CMTM6	54918	broad.mit.edu	37	3	32525444	32525444	+	3'UTR	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32525444C>A	uc003cfa.1	-	4						NM_017801	NP_060271			CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0																		---	---	---	---
KBTBD5	131377	broad.mit.edu	37	3	42733380	42733380	+	Silent	SNP	C	T	T	rs142843476	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42733380C>T	uc003clv.1	+	6	1861	c.1761C>T	c.(1759-1761)AAC>AAT	p.N587N		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	587	Kelch 5.									ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
DRD3	1814	broad.mit.edu	37	3	113890790	113890790	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113890790G>A	uc003ebd.2	-	3	473	c.50C>T	c.(49-51)GCA>GTA	p.A17V	DRD3_uc010hqn.1_Missense_Mutation_p.A17V|DRD3_uc003ebb.1_Missense_Mutation_p.A17V|DRD3_uc003ebc.1_Missense_Mutation_p.A17V	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	17	Extracellular (Probable).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133099271	133099271	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133099271C>T	uc003eph.2	+	4	990	c.716C>T	c.(715-717)ACC>ATC	p.T239I	TMEM108_uc003epi.2_Missense_Mutation_p.T239I|TMEM108_uc003epj.1_Missense_Mutation_p.T239I|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Missense_Mutation_p.T190I	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	239	Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
P2RY12	64805	broad.mit.edu	37	3	151056447	151056447	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151056447G>A	uc003eyw.1	-	2	403	c.187C>T	c.(187-189)CTT>TTT	p.L63F	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY12_uc011boa.1_Missense_Mutation_p.L63F|P2RY12_uc003eyx.1_Missense_Mutation_p.L63F	NM_176876	NP_795345	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y12	63	Helical; Name=2; (Potential).				platelet activation	integral to membrane|plasma membrane	guanyl-nucleotide exchange factor activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Ticlopidine(DB00208)|Treprostinil(DB00374)													---	---	---	---
MIR720	100302198	broad.mit.edu	37	3	164059124	164059124	+	5'Flank	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164059124C>T	hsa-mir-720|MI0006654	+																							0																		---	---	---	---
ZMAT3	64393	broad.mit.edu	37	3	178785396	178785396	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178785396C>T	uc003fjg.2	-	2	404	c.145G>A	c.(145-147)GGG>AGG	p.G49R	ZMAT3_uc010hxa.2_Missense_Mutation_p.G49R|ZMAT3_uc003fji.2_Missense_Mutation_p.G49R	NM_022470	NP_071915	Q9HA38	ZMAT3_HUMAN	p53 target zinc finger protein isoform 1	49					apoptosis|protein transport|regulation of growth|response to DNA damage stimulus|transmembrane transport	nucleolus	RNA binding|zinc ion binding			ovary(2)	2	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)															---	---	---	---
CCDC96	257236	broad.mit.edu	37	4	7043264	7043264	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7043264C>T	uc003gjv.2	-	1	1465	c.1402G>A	c.(1402-1404)GAG>AAG	p.E468K	TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	NM_153376	NP_699207	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	468											0																		---	---	---	---
AFAP1	60312	broad.mit.edu	37	4	7795508	7795508	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7795508C>T	uc003gkg.1	-	11	1585	c.1312G>A	c.(1312-1314)GCA>ACA	p.A438T	AFAP1_uc011bwk.1_Missense_Mutation_p.A438T	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1	438	PH 2.					actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0																		---	---	---	---
TMPRSS11F	389208	broad.mit.edu	37	4	68964625	68964625	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68964625A>C	uc003hdt.1	-	2	192	c.143T>G	c.(142-144)GTT>GGT	p.V48G		NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	48	Helical; Signal-anchor for type II membrane protein; (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
YTHDC1	91746	broad.mit.edu	37	4	69197837	69197837	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69197837G>C	uc003hdx.2	-	7	1459	c.1106C>G	c.(1105-1107)TCT>TGT	p.S369C	YTHDC1_uc003hdy.2_Missense_Mutation_p.S351C	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	369	YTH.									upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
DDIT4L	115265	broad.mit.edu	37	4	101109017	101109017	+	Silent	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101109017A>C	uc003hvq.2	-	3	602	c.399T>G	c.(397-399)ACT>ACG	p.T133T		NM_145244	NP_660287	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like	133					negative regulation of signal transduction	cytoplasm				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)														---	---	---	---
TRPC3	7222	broad.mit.edu	37	4	122853995	122853995	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122853995C>T	uc003ieg.2	-	2	492	c.418G>A	c.(418-420)GTC>ATC	p.V140I	TRPC3_uc010inr.2_Missense_Mutation_p.V67I|TRPC3_uc003ief.2_Missense_Mutation_p.V67I|TRPC3_uc011cgl.1_5'UTR	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN	transient receptor potential cation channel,	55	Cytoplasmic (Potential).|ANK 1.				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2																		---	---	---	---
PCDH10	57575	broad.mit.edu	37	4	134073930	134073930	+	Intron	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073930A>G	uc003iha.2	+						PCDH10_uc003igz.2_Missense_Mutation_p.R879G	NM_032961	NP_116586			protocadherin 10 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)														---	---	---	---
VEGFC	7424	broad.mit.edu	37	4	177608362	177608362	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177608362T>C	uc003ius.1	-	6	1554	c.1124A>G	c.(1123-1125)AAG>AGG	p.K375R		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	375					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)														---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7698445	7698445	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7698445A>G	uc003jdz.1	+	7	1134	c.1067A>G	c.(1066-1068)AAG>AGG	p.K356R	ADCY2_uc011cmo.1_Missense_Mutation_p.K176R	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	356	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
PRDM9	56979	broad.mit.edu	37	5	23522998	23522998	+	Intron	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522998A>G	uc003jgo.2	+							NM_020227	NP_064612			PR domain containing 9						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---
CDH10	1008	broad.mit.edu	37	5	24537713	24537713	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24537713A>G	uc003jgr.1	-	3	634	c.302T>C	c.(301-303)CTT>CCT	p.L101P	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	101	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)											HNSCC(23;0.051)			---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31409443	31409443	+	Intron	SNP	G	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31409443G>T	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33549454	33549454	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33549454C>T	uc003jia.1	-	21	4323	c.4160G>A	c.(4159-4161)CGC>CAC	p.R1387H	ADAMTS12_uc010iuq.1_Missense_Mutation_p.R1302H	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1387	TSP type-1 6.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	36953867	36953867	+	Intron	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36953867G>A	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677			delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90012394	90012394	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90012394G>A	uc003kju.2	+	43	9391	c.9295G>A	c.(9295-9297)GCA>ACA	p.A3099T	GPR98_uc003kjt.2_Missense_Mutation_p.A805T|GPR98_uc003kjv.2_Missense_Mutation_p.A699T	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3099	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
PCDHA6	56142	broad.mit.edu	37	5	140209731	140209731	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209731C>T	uc003lho.2	+	1	2082	c.2055C>T	c.(2053-2055)GGC>GGT	p.G685G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.G685G	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	685	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA4	56111	broad.mit.edu	37	5	140735929	140735929	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140735929G>A	uc003ljq.1	+	1	1162	c.1162G>A	c.(1162-1164)GAT>AAT	p.D388N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.D388N	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	388	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA6	56109	broad.mit.edu	37	5	140755518	140755518	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755518C>T	uc003ljy.1	+	1	1868	c.1868C>T	c.(1867-1869)ACG>ATG	p.T623M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.T623M	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	623	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	564037	564037	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:564037C>T	uc003mtd.2	-	16	1919	c.1785G>A	c.(1783-1785)GCG>GCA	p.A595A	EXOC2_uc003mte.2_Silent_p.A595A|EXOC2_uc011dho.1_Silent_p.A190A	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	595					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)														---	---	---	---
MDC1	9656	broad.mit.edu	37	6	30675783	30675783	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30675783T>C	uc003nrg.3	-	8	3013	c.2573A>G	c.(2572-2574)GAC>GGC	p.D858G	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	858				Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4													Other_conserved_DNA_damage_response_genes					---	---	---	---
ATF6B	1388	broad.mit.edu	37	6	32095981	32095981	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32095981C>T	uc003nzn.2	-	1	37	c.4G>A	c.(4-6)GCG>ACG	p.A2T	ATF6B_uc003nzo.2_Missense_Mutation_p.A2T|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_Missense_Mutation_p.A2T	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	2	Cytoplasmic (Potential).|Transcription activation.				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
SLC29A1	2030	broad.mit.edu	37	6	44197722	44197722	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44197722G>A	uc003owu.1	+	5	722	c.393G>A	c.(391-393)AAG>AAA	p.K131K	SLC29A1_uc011dvp.1_Silent_p.K150K|SLC29A1_uc003owv.1_Silent_p.K131K|SLC29A1_uc003oww.1_Silent_p.K210K|SLC29A1_uc011dvq.1_Silent_p.K173K|SLC29A1_uc003owx.1_Silent_p.K131K|SLC29A1_uc003owy.1_Silent_p.K131K|SLC29A1_uc003owz.1_Silent_p.K131K	NM_004955	NP_004946	Q99808	S29A1_HUMAN	equilibrative nucleoside transporter 1	131	Extracellular (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|basolateral plasma membrane|integral to plasma membrane|membrane fraction	nucleoside transmembrane transporter activity|protein binding			large_intestine(2)|skin(1)	3	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Troglitazone(DB00197)													---	---	---	---
CD2AP	23607	broad.mit.edu	37	6	47547178	47547178	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47547178C>T	uc003oyw.2	+	9	1417	c.961C>T	c.(961-963)CCA>TCA	p.P321S		NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	321	SH3 3.				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)															---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51637574	51637574	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51637574T>G	uc003pah.1	-	55	8844	c.8568A>C	c.(8566-8568)AAA>AAC	p.K2856N	PKHD1_uc010jzn.1_Missense_Mutation_p.K839N|PKHD1_uc003pai.2_Missense_Mutation_p.K2856N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2856	G8 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
C6orf142	90523	broad.mit.edu	37	6	53989433	53989433	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53989433G>C	uc003pcg.3	+	3	495	c.382G>C	c.(382-384)GAA>CAA	p.E128Q	C6orf142_uc003pcf.2_Missense_Mutation_p.E128Q|C6orf142_uc003pch.3_Missense_Mutation_p.E66Q|C6orf142_uc011dwz.1_Missense_Mutation_p.E87Q|C6orf142_uc011dxa.1_Missense_Mutation_p.E139Q	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	128						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---
SNX14	57231	broad.mit.edu	37	6	86238069	86238069	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86238069C>T	uc003pkr.2	-	20	2099	c.1906G>A	c.(1906-1908)GAT>AAT	p.D636N	SNX14_uc003pkp.2_Missense_Mutation_p.D499N|SNX14_uc003pkq.2_Missense_Mutation_p.D242N|SNX14_uc011dzg.1_Missense_Mutation_p.D584N|SNX14_uc003pks.2_Missense_Mutation_p.D583N|SNX14_uc003pkt.2_Missense_Mutation_p.D627N	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	636	PX.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)														---	---	---	---
TAAR2	9287	broad.mit.edu	37	6	132938378	132938378	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132938378G>A	uc003qdl.1	-	2	967	c.967C>T	c.(967-969)CGC>TGC	p.R323C	TAAR2_uc010kfr.1_Missense_Mutation_p.R278C	NM_001033080	NP_001028252	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	323	Cytoplasmic (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152485429	152485429	+	Missense_Mutation	SNP	C	T	T	rs143842011	byFrequency	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152485429C>T	uc010kiw.2	-	131	24261	c.23659G>A	c.(23659-23661)GTG>ATG	p.V7887M	SYNE1_uc010kiv.2_Missense_Mutation_p.V2411M|SYNE1_uc003qos.3_Missense_Mutation_p.V2411M|SYNE1_uc003qot.3_Missense_Mutation_p.V7816M|SYNE1_uc003qou.3_Missense_Mutation_p.V7887M|SYNE1_uc003qop.3_Missense_Mutation_p.V49M|SYNE1_uc011eez.1_Missense_Mutation_p.V89M|SYNE1_uc003qoq.3_Missense_Mutation_p.V89M|SYNE1_uc003qor.3_Missense_Mutation_p.V787M	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7887	Spectrin 28.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152711423	152711423	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152711423G>A	uc010kiw.2	-	53	8771	c.8169C>T	c.(8167-8169)CAC>CAT	p.H2723H	SYNE1_uc003qot.3_Silent_p.H2730H|SYNE1_uc003qou.3_Silent_p.H2723H|SYNE1_uc010kjb.1_Silent_p.H2706H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2723	Cytoplasmic (Potential).|HAT 5.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
AMPH	273	broad.mit.edu	37	7	38466550	38466550	+	Intron	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38466550T>C	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron|AMPH_uc003tgw.1_Intron|AMPH_uc010kxl.1_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88965033	88965033	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965033T>G	uc011khi.1	+	4	3275	c.2737T>G	c.(2737-2739)TCA>GCA	p.S913A		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	913						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94057073	94057073	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94057073A>C	uc003ung.1	+	49	3873	c.3402A>C	c.(3400-3402)GAA>GAC	p.E1134D	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1134	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
PDAP1	11333	broad.mit.edu	37	7	98994334	98994334	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994334G>C	uc003uqe.2	-	6	638	c.517C>G	c.(517-519)CGA>GGA	p.R173G		NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1	173					cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)													---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129999462	129999462	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129999462G>A	uc010lmd.1	+	7	986	c.366G>A	c.(364-366)GCG>GCA	p.A122A	CPA5_uc003vps.2_Silent_p.A122A|CPA5_uc003vpt.2_Silent_p.A122A|CPA5_uc010lme.1_Silent_p.A122A|CPA5_uc003vpu.1_Silent_p.A122A	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1	122					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2820151	2820151	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2820151G>A	uc011kwk.1	-	61	9858	c.9468C>T	c.(9466-9468)TGC>TGT	p.C3156C	CSMD1_uc011kwj.1_Silent_p.C2485C|CSMD1_uc010lrg.2_Silent_p.C1047C	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	3156	Extracellular (Potential).|Sushi 26.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3245020	3245020	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3245020G>A	uc011kwk.1	-	18	3171	c.2781C>T	c.(2779-2781)TGC>TGT	p.C927C	CSMD1_uc011kwj.1_Silent_p.C319C|CSMD1_uc003wqe.2_Silent_p.C83C	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	927	Extracellular (Potential).|Sushi 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3253803	3253803	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3253803A>C	uc011kwk.1	-	17	2899	c.2509T>G	c.(2509-2511)TTC>GTC	p.F837V	CSMD1_uc011kwj.1_Missense_Mutation_p.F229V|CSMD1_uc003wqe.2_5'UTR	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	837	Extracellular (Potential).|CUB 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
SOX7	83595	broad.mit.edu	37	8	10583429	10583429	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10583429C>T	uc003wtf.2	-	2	1065	c.986G>A	c.(985-987)CGC>CAC	p.R329H	SOX7_uc011kwz.1_Missense_Mutation_p.R381H	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	329	Sox C-terminal.				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)														---	---	---	---
SH2D4A	63898	broad.mit.edu	37	8	19192367	19192367	+	Missense_Mutation	SNP	G	A	A	rs75590099	by1000genomes	TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19192367G>A	uc003wzb.2	+	4	848	c.512G>A	c.(511-513)CGA>CAA	p.R171Q	SH2D4A_uc011kym.1_Missense_Mutation_p.R126Q|SH2D4A_uc003wzc.2_Missense_Mutation_p.R171Q	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	171						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)														---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68165687	68165687	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68165687C>A	uc003xxo.1	-	18	3087	c.2697G>T	c.(2695-2697)CAG>CAT	p.Q899H	ARFGEF1_uc003xxl.1_Missense_Mutation_p.Q353H	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	899					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69104587	69104587	+	Silent	SNP	C	T	T	rs137974526		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69104587C>T	uc003xxv.1	+	37	4458	c.4431C>T	c.(4429-4431)AAC>AAT	p.N1477N		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1477					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77765163	77765163	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765163G>A	uc003yav.2	+	10	6258	c.5871G>A	c.(5869-5871)ACG>ACA	p.T1957T	ZFHX4_uc003yau.1_Silent_p.T2002T|ZFHX4_uc003yaw.1_Silent_p.T1957T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1957	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97620628	97620628	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97620628C>T	uc003yhv.1	+	4	990	c.372C>T	c.(370-372)GCC>GCT	p.A124A	SDC2_uc011lgu.1_Silent_p.A95A	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	124	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
COL14A1	7373	broad.mit.edu	37	8	121219265	121219265	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121219265C>A	uc003yox.2	+	10	1388	c.1123C>A	c.(1123-1125)CAT>AAT	p.H375N	COL14A1_uc003yoy.2_Missense_Mutation_p.H53N|COL14A1_uc010mde.1_Missense_Mutation_p.H53N	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	375	Fibronectin type-III 2.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
TG	7038	broad.mit.edu	37	8	134042185	134042185	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134042185C>T	uc003ytw.2	+	41	7197	c.7156C>T	c.(7156-7158)CGT>TGT	p.R2386C	TG_uc010mdw.2_Missense_Mutation_p.R1145C|TG_uc011ljb.1_Missense_Mutation_p.R755C|TG_uc011ljc.1_Missense_Mutation_p.R519C	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2386					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
TSTA3	7264	broad.mit.edu	37	8	144696357	144696357	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144696357G>A	uc003yza.2	-	7	676	c.640C>T	c.(640-642)CGG>TGG	p.R214W	TSTA3_uc003yzb.2_Missense_Mutation_p.R214W	NM_003313	NP_003304	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	214					'de novo' GDP-L-fucose biosynthetic process|leukocyte cell-cell adhesion		coenzyme binding|electron carrier activity|GDP-4-dehydro-D-rhamnose reductase activity|GDP-L-fucose synthase activity|isomerase activity			pancreas(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		NADH(DB00157)													---	---	---	---
UHRF2	115426	broad.mit.edu	37	9	6460623	6460623	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6460623G>A	uc003zjy.2	+	4	1035	c.695G>A	c.(694-696)CGA>CAA	p.R232Q	UHRF2_uc003zjz.2_RNA|UHRF2_uc003zka.1_Missense_Mutation_p.R9Q	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains	232	Interaction with PCNP.				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)														---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	7046858	7046858	+	Intron	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7046858C>T	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16437105	16437105	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16437105A>T	uc003zml.2	-	6	1227	c.1087T>A	c.(1087-1089)TAT>AAT	p.Y363N	BNC2_uc011lmw.1_Missense_Mutation_p.Y268N|BNC2_uc003zmm.2_Missense_Mutation_p.Y321N|BNC2_uc003zmq.1_Missense_Mutation_p.Y377N|BNC2_uc003zmr.1_Missense_Mutation_p.Y400N|BNC2_uc003zmp.1_Missense_Mutation_p.Y391N|BNC2_uc010mij.1_Missense_Mutation_p.Y285N|BNC2_uc011lmv.1_Missense_Mutation_p.Y189N|BNC2_uc003zmo.1_Missense_Mutation_p.Y285N|BNC2_uc003zmj.2_Missense_Mutation_p.Y128N|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.Y128N|BNC2_uc003zmn.1_Missense_Mutation_p.Y128N	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	363					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
DENND4C	55667	broad.mit.edu	37	9	19331981	19331981	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19331981A>G	uc003znq.2	+	13	1584	c.1551A>G	c.(1549-1551)ATA>ATG	p.I517M	DENND4C_uc011lnc.1_Intron	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	517						integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
MAMDC2	256691	broad.mit.edu	37	9	72746492	72746492	+	Missense_Mutation	SNP	A	G	G	rs139503678		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72746492A>G	uc004ahm.2	+	7	1575	c.958A>G	c.(958-960)ATT>GTT	p.I320V	MAMDC2_uc004ahn.2_RNA	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN	MAM domain containing 2 precursor	320	MAM 2.					endoplasmic reticulum|membrane				central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
GALNT12	79695	broad.mit.edu	37	9	101589068	101589068	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101589068G>A	uc004ayz.2	+	3	576	c.576G>A	c.(574-576)TCG>TCA	p.S192S		NM_024642	NP_078918	Q8IXK2	GLT12_HUMAN	N-acetylgalactosaminyltransferase 12	192	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
ALDOB	229	broad.mit.edu	37	9	104187255	104187255	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104187255C>A	uc004bbk.2	-	8	951	c.869G>T	c.(868-870)TGC>TTC	p.C290F		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	290					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
HSDL2	84263	broad.mit.edu	37	9	115216406	115216406	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115216406A>G	uc004bga.1	+	9	1072	c.979A>G	c.(979-981)AAA>GAA	p.K327E	HSDL2_uc011lwv.1_Missense_Mutation_p.K206E|HSDL2_uc004bgb.1_Missense_Mutation_p.K161E|HSDL2_uc004bgc.1_Missense_Mutation_p.K254E|HSDL2_uc011lww.1_Missense_Mutation_p.K122E	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	327	SCP2.					peroxisome	oxidoreductase activity|sterol binding				0																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120475218	120475218	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475218A>C	uc004bjz.2	+	3	1103	c.812A>C	c.(811-813)AAG>ACG	p.K271T	TLR4_uc004bka.2_Missense_Mutation_p.K231T|TLR4_uc004bkb.2_Missense_Mutation_p.K71T	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	271	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
C10orf47	254427	broad.mit.edu	37	10	11894067	11894067	+	5'UTR	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11894067C>T	uc001ikx.2	+	2					uc001iky.1_Intron	NM_153256	NP_694988			hypothetical protein LOC254427											central_nervous_system(1)	1																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68686670	68686670	+	Intron	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68686670T>G	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmz.1_Intron|LRRTM3_uc001jmy.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126172767	126172767	+	Missense_Mutation	SNP	C	A	A	rs138019469		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126172767C>A	uc001lhs.1	+	2	205	c.185C>A	c.(184-186)GCA>GAA	p.A62E	LHPP_uc001lht.1_Missense_Mutation_p.A62E|LHPP_uc009yai.1_Missense_Mutation_p.A62E	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic	62					protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
SBF2	81846	broad.mit.edu	37	11	9810669	9810669	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9810669G>A	uc001mib.2	-	35	5057	c.4919C>T	c.(4918-4920)ACC>ATC	p.T1640I	uc001mhz.1_Intron|SBF2_uc001mid.2_Missense_Mutation_p.T284I|SBF2_uc001mic.2_5'Flank|uc001mie.3_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1640	Interaction with MTMR2.				myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---
C11orf84	144097	broad.mit.edu	37	11	63594451	63594451	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63594451G>A	uc001nxt.2	+	6	1222	c.986G>A	c.(985-987)CGG>CAG	p.R329Q	C11orf84_uc001nxu.1_RNA	NM_138471	NP_612480	Q9BUA3	CK084_HUMAN	hypothetical protein LOC144097	329											0																		---	---	---	---
FOLH1B	219595	broad.mit.edu	37	11	89431668	89431668	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89431668A>C	uc001pda.2	+	14	1756	c.1230A>C	c.(1228-1230)AAA>AAC	p.K410N		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	410					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92086454	92086454	+	Silent	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92086454T>C	uc001pdj.3	+	1	1193	c.1176T>C	c.(1174-1176)GGT>GGC	p.G392G		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	392	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
KDM4D	55693	broad.mit.edu	37	11	94731169	94731169	+	Silent	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731169T>C	uc001pfe.2	+	3	1465	c.633T>C	c.(631-633)ACT>ACC	p.T211T		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	211	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
EFCAB4B	84766	broad.mit.edu	37	12	3768726	3768726	+	Intron	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3768726T>C	uc001qmj.2	-						EFCAB4B_uc010sen.1_Intron|EFCAB4B_uc010seo.1_Intron|EFCAB4B_uc001qmi.1_Intron	NM_032680	NP_116069			EF-hand calcium binding domain 4B isoform c						activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)															---	---	---	---
KLRF1	51348	broad.mit.edu	37	12	9986055	9986055	+	Intron	SNP	C	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9986055C>G	uc010sgw.1	+						KLRF1_uc009zgw.2_Intron|KLRF1_uc009zgx.2_Intron|KLRF1_uc001qwm.2_Intron|KLRF1_uc009zgy.2_Intron|KLRF1_uc009zgz.2_Intron|KLRF1_uc009zha.2_Intron	NM_016523	NP_057607			killer cell lectin-like receptor subfamily F,						cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1																		---	---	---	---
ST8SIA1	6489	broad.mit.edu	37	12	22440074	22440074	+	Intron	SNP	T	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22440074T>A	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025			alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3																		---	---	---	---
PRICKLE1	144165	broad.mit.edu	37	12	42858814	42858814	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42858814C>T	uc010skv.1	-	7	1309	c.1022G>A	c.(1021-1023)CGG>CAG	p.R341Q	PRICKLE1_uc001rnl.2_Missense_Mutation_p.R341Q|PRICKLE1_uc010skw.1_Missense_Mutation_p.R341Q|PRICKLE1_uc001rnm.2_Missense_Mutation_p.R341Q	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	341					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)														---	---	---	---
PUS7L	83448	broad.mit.edu	37	12	44148392	44148392	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44148392A>T	uc001rnq.3	-	2	1146	c.657T>A	c.(655-657)TTT>TTA	p.F219L	PUS7L_uc001rnr.3_Missense_Mutation_p.F219L|PUS7L_uc001rns.3_Missense_Mutation_p.F219L|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	219					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)														---	---	---	---
LARP4	113251	broad.mit.edu	37	12	50821557	50821557	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50821557A>G	uc001rwp.1	+	2	175	c.31A>G	c.(31-33)AAA>GAA	p.K11E	LARP4_uc001rwo.1_Missense_Mutation_p.K11E|LARP4_uc001rwq.1_Missense_Mutation_p.K11E|LARP4_uc001rwr.1_Missense_Mutation_p.K11E|LARP4_uc001rws.1_Missense_Mutation_p.K10E|LARP4_uc001rwm.2_Missense_Mutation_p.K11E|LARP4_uc001rwn.2_5'UTR	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a	11							nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
KRT74	121391	broad.mit.edu	37	12	52964594	52964594	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52964594G>A	uc001sap.1	-	5	915	c.867C>T	c.(865-867)CAC>CAT	p.H289H		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	289	Rod.|Linker 12.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)														---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86373791	86373791	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373791T>G	uc001tai.3	-	8	1963	c.713A>C	c.(712-714)AAG>ACG	p.K238T	MGAT4C_uc001tal.3_Missense_Mutation_p.K238T|MGAT4C_uc001taj.3_Missense_Mutation_p.K238T|MGAT4C_uc001tak.3_Missense_Mutation_p.K238T|MGAT4C_uc010sum.1_Missense_Mutation_p.K262T|MGAT4C_uc001tah.3_Missense_Mutation_p.K238T	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	238	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86383296	86383296	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86383296A>C	uc001tai.3	-	6	1279	c.29T>G	c.(28-30)ATT>AGT	p.I10S	MGAT4C_uc001tal.3_Missense_Mutation_p.I10S|MGAT4C_uc001taj.3_Missense_Mutation_p.I10S|MGAT4C_uc001tak.3_Missense_Mutation_p.I10S|MGAT4C_uc010sum.1_Missense_Mutation_p.I34S|MGAT4C_uc001tah.3_Missense_Mutation_p.I10S	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	10	Cytoplasmic (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112685929	112685929	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112685929G>A	uc009zwc.2	-	20	2942	c.2924C>T	c.(2923-2925)GCC>GTC	p.A975V		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
MORN3	283385	broad.mit.edu	37	12	122091042	122091042	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122091042C>A	uc001uax.2	-	4	758	c.587G>T	c.(586-588)GGG>GTG	p.G196V	MORN3_uc001uay.2_Intron	NM_173855	NP_776254	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	196	MORN 7.										0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36006397	36006397	+	Intron	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36006397T>C	uc001uvb.2	+						NBEA_uc010abi.2_Intron	NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
EDNRB	1910	broad.mit.edu	37	13	78492471	78492471	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492471A>G	uc001vko.2	-	1	496	c.238T>C	c.(238-240)TCT>CCT	p.S80P	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Missense_Mutation_p.S80P|EDNRB_uc010aez.1_Missense_Mutation_p.S80P|EDNRB_uc001vkp.1_Missense_Mutation_p.S163P|EDNRB_uc010afa.1_Missense_Mutation_p.S80P	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	80	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)													---	---	---	---
OR4M1	441670	broad.mit.edu	37	14	20248768	20248768	+	Missense_Mutation	SNP	G	C	C	rs62619918		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248768G>C	uc010tku.1	+	1	287	c.287G>C	c.(286-288)GGA>GCA	p.G96A		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
DLGAP5	9787	broad.mit.edu	37	14	55655676	55655676	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55655676C>T	uc001xbs.2	-	2	439	c.222G>A	c.(220-222)AAG>AAA	p.K74K	DLGAP5_uc001xbt.2_Silent_p.K74K	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	74					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89878584	89878584	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89878584C>T	uc001xxo.3	-	2	374	c.237G>A	c.(235-237)TCG>TCA	p.S79S	FOXN3_uc001xxn.3_Silent_p.S79S|FOXN3_uc010atk.2_Silent_p.S79S|FOXN3_uc001xxp.2_Silent_p.S79S	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1	79					DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	p.S79L(1)		skin(2)|ovary(1)	3																		---	---	---	---
LGMN	5641	broad.mit.edu	37	14	93176169	93176169	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93176169C>T	uc001yav.2	-	12	1194	c.868G>A	c.(868-870)GCC>ACC	p.A290T	LGMN_uc001yat.2_Missense_Mutation_p.A290T|LGMN_uc001yau.2_Missense_Mutation_p.A290T|LGMN_uc001yaw.2_Missense_Mutation_p.A290T|LGMN_uc010aul.2_Missense_Mutation_p.A171T|LGMN_uc001yax.2_Missense_Mutation_p.A290T|LGMN_uc001yay.2_Missense_Mutation_p.A290T	NM_001008530	NP_001008530	Q99538	LGMN_HUMAN	legumain preproprotein	290					hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity			skin(1)	1		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94088466	94088466	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088466C>T	uc001ybv.1	+	28	4505	c.4422C>T	c.(4420-4422)AGC>AGT	p.S1474S	KIAA1409_uc001ybs.1_Silent_p.S1452S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1629						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106234219	106234219	+	Intron	SNP	C	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234219C>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
CSPG4	1464	broad.mit.edu	37	15	75974714	75974714	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75974714G>A	uc002baw.2	-	8	4963	c.4870C>T	c.(4870-4872)CGG>TGG	p.R1624W		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	1624	Extracellular (Potential).|Cysteine-containing.|Neurite growth inhibition (By similarity).|CSPG 11.				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3																		---	---	---	---
ZNF710	374655	broad.mit.edu	37	15	90617399	90617399	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617399C>T	uc002bov.1	+	4	1825	c.1702C>T	c.(1702-1704)CTG>TTG	p.L568L		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	568	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)															---	---	---	---
C15orf51	196968	broad.mit.edu	37	15	100340420	100340420	+	RNA	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100340420G>A	uc010urx.1	-	4		c.507C>T			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|C15orf51_uc010bow.2_RNA|uc002bvt.1_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0																		---	---	---	---
ALDH1A3	220	broad.mit.edu	37	15	101445802	101445802	+	Silent	SNP	C	T	T	rs113661159		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101445802C>T	uc002bwn.3	+	10	1247	c.1143C>T	c.(1141-1143)TGC>TGT	p.C381C	ALDH1A3_uc010bpb.2_Silent_p.C274C|uc002bwo.1_Intron	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3	381					retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)													---	---	---	---
USP31	57478	broad.mit.edu	37	16	23098403	23098403	+	Intron	SNP	T	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23098403T>A	uc002dll.2	-						USP31_uc010bxm.2_5'Flank	NM_020718	NP_065769			ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)														---	---	---	---
KIAA0556	23247	broad.mit.edu	37	16	27761639	27761639	+	Intron	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27761639C>T	uc002dow.2	+							NM_015202	NP_056017			hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8																		---	---	---	---
ZNF768	79724	broad.mit.edu	37	16	30536081	30536081	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30536081G>A	uc002dyk.3	-	2	1556	c.1380C>T	c.(1378-1380)CCC>CCT	p.P460P	ZNF768_uc010vex.1_Silent_p.P429P|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Silent_p.P429P	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	460	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding				0																		---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65016134	65016134	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016134T>G	uc002eoi.2	-	8	1504	c.1070A>C	c.(1069-1071)AAG>ACG	p.K357T	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Missense_Mutation_p.K357T|CDH11_uc010vin.1_Missense_Mutation_p.K231T|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	357	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
PSKH1	5681	broad.mit.edu	37	16	67961298	67961298	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67961298G>C	uc002euv.2	+	3	1198	c.1028G>C	c.(1027-1029)CGT>CCT	p.R343P		NM_006742	NP_006733	P11801	KPSH1_HUMAN	protein serine kinase H1	343	Protein kinase.					endoplasmic reticulum membrane|Golgi apparatus|microtubule organizing center|nuclear speck|plasma membrane	ATP binding|protein serine/threonine kinase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)														---	---	---	---
SLC7A6	9057	broad.mit.edu	37	16	68325560	68325560	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68325560T>G	uc002evt.1	+	8	1327	c.1018T>G	c.(1018-1020)TCA>GCA	p.S340A	SLC7A6_uc010cfb.1_RNA|SLC7A6_uc002evu.1_Missense_Mutation_p.S340A|SLC7A6_uc002evv.1_RNA|SLC7A6_uc010cfc.1_RNA	NM_001076785	NP_001070253	Q92536	YLAT2_HUMAN	solute carrier family 7 (cationic amino acid	340	Cytoplasmic (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|antiporter activity			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)														---	---	---	---
KIAA0664	23277	broad.mit.edu	37	17	2604521	2604521	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2604521G>T	uc002fuy.1	-	7	910	c.824C>A	c.(823-825)CCC>CAC	p.P275H	KIAA0664_uc002fux.1_Missense_Mutation_p.P207H	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	275							binding			breast(2)	2																		---	---	---	---
TMEM95	339168	broad.mit.edu	37	17	7258584	7258584	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7258584C>T	uc002ggh.1	+	1	88	c.61C>T	c.(61-63)CGC>TGC	p.R21C	TMEM95_uc002ggf.1_Missense_Mutation_p.R21C|TMEM95_uc002ggg.1_Missense_Mutation_p.R21C	NM_198154	NP_937797	Q3KNT9	TMM95_HUMAN	transmembrane protein 95	21	Extracellular (Potential).					integral to membrane					0		Prostate(122;0.173)																---	---	---	---
CDK12	51755	broad.mit.edu	37	17	37650864	37650864	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37650864G>A	uc010cvv.2	+	5	2922	c.2336G>A	c.(2335-2337)CGT>CAT	p.R779H	CDK12_uc010wef.1_Missense_Mutation_p.R778H|CDK12_uc002hrw.3_Missense_Mutation_p.R779H	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	779	Protein kinase.				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19															TCGA Ovarian(9;0.13)			---	---	---	---
PGAP3	93210	broad.mit.edu	37	17	37829375	37829375	+	Silent	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37829375C>T	uc002hsj.2	-	7	871	c.828G>A	c.(826-828)CCG>CCA	p.P276P	PGAP3_uc010cvy.2_RNA|PGAP3_uc010wej.1_Silent_p.P255P|PGAP3_uc002hsk.2_Silent_p.P225P|PGAP3_uc010cvz.2_Intron	NM_033419	NP_219487	Q96FM1	PGAP3_HUMAN	per1-like domain containing 1 precursor	276	Helical; (Potential).				GPI anchor biosynthetic process	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	hydrolase activity, acting on ester bonds			upper_aerodigestive_tract(1)	1																		---	---	---	---
LRRC59	55379	broad.mit.edu	37	17	48462540	48462540	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48462540G>A	uc002iqt.2	-	6	769	c.615C>T	c.(613-615)GCC>GCT	p.A205A		NM_018509	NP_060979	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	205	Potential.|Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial nucleoid	protein binding			central_nervous_system(1)	1	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)															---	---	---	---
EXOC7	23265	broad.mit.edu	37	17	74081411	74081411	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74081411G>A	uc002jqs.2	-	16	1944	c.1849C>T	c.(1849-1851)CAG>TAG	p.Q617*	EXOC7_uc002jqp.1_5'Flank|EXOC7_uc010dgv.1_Nonsense_Mutation_p.Q491*|EXOC7_uc002jqq.2_Nonsense_Mutation_p.Q566*|EXOC7_uc010wsw.1_Nonsense_Mutation_p.Q589*|EXOC7_uc010wsx.1_Nonsense_Mutation_p.Q558*|EXOC7_uc002jqr.2_Nonsense_Mutation_p.Q535*|EXOC7_uc010wsv.1_Nonsense_Mutation_p.Q538*	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4	617					exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)															---	---	---	---
SEC14L1	6397	broad.mit.edu	37	17	75196749	75196749	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75196749G>A	uc002jto.2	+	9	1270	c.1003G>A	c.(1003-1005)GAC>AAC	p.D335N	SEC14L1_uc010dhc.2_Missense_Mutation_p.D335N|SEC14L1_uc010wth.1_Missense_Mutation_p.D335N|SEC14L1_uc002jtm.2_Missense_Mutation_p.D335N|SEC14L1_uc010wti.1_Missense_Mutation_p.D301N	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	335	CRAL-TRIO.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2																		---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8113545	8113545	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113545T>G	uc002knn.3	+	12	2421	c.1918T>G	c.(1918-1920)TTA>GTA	p.L640V	PTPRM_uc010dkv.2_Missense_Mutation_p.L640V|PTPRM_uc010wzl.1_Missense_Mutation_p.L427V	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	640	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
KLHL14	57565	broad.mit.edu	37	18	30260165	30260165	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30260165G>A	uc002kxm.1	-	7	1943	c.1555C>T	c.(1555-1557)CGC>TGC	p.R519C	KLHL14_uc010dmd.1_Missense_Mutation_p.R68C	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	519						cytosol|endoplasmic reticulum membrane				ovary(1)	1																		---	---	---	---
C18orf34	374864	broad.mit.edu	37	18	30847015	30847015	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30847015T>G	uc002kxn.2	-	13	1416	c.1274A>C	c.(1273-1275)AAA>ACA	p.K425T	C18orf34_uc010dme.1_5'UTR|C18orf34_uc010xbr.1_Missense_Mutation_p.K425T|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.K425T|C18orf34_uc002kxp.2_Missense_Mutation_p.K425T	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	425										ovary(1)	1																		---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31538236	31538236	+	Silent	SNP	G	A	A	rs141277558		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31538236G>A	uc010dmi.2	-	7	1432	c.1203C>T	c.(1201-1203)GAC>GAT	p.D401D	NOL4_uc010xbs.1_Silent_p.D116D|NOL4_uc002kxr.3_Silent_p.D237D|NOL4_uc010xbt.1_Silent_p.D327D|NOL4_uc010dmh.2_Silent_p.D327D|NOL4_uc010xbu.1_Silent_p.D401D|NOL4_uc002kxt.3_Silent_p.D401D|NOL4_uc010xbv.1_Silent_p.D150D|NOL4_uc010xbw.1_Silent_p.D287D	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	401						nucleolus	RNA binding			ovary(3)	3																		---	---	---	---
C18orf25	147339	broad.mit.edu	37	18	43843012	43843012	+	Silent	SNP	T	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43843012T>C	uc002lbw.2	+	6	1525	c.1146T>C	c.(1144-1146)ACT>ACC	p.T382T	C18orf25_uc002lbx.2_Silent_p.T321T	NM_145055	NP_659492	Q96B23	CR025_HUMAN	ARKadia-like 1 isoform a	381										central_nervous_system(2)	2																		---	---	---	---
TCEB3C	162699	broad.mit.edu	37	18	44554665	44554665	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44554665C>T	uc010xdb.1	-	1	1785	c.1549G>A	c.(1549-1551)GCG>ACG	p.A517T	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	517					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50731602	50731602	+	Silent	SNP	A	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50731602A>G	uc002lfe.1	+	10	2177	c.1590A>G	c.(1588-1590)CCA>CCG	p.P530P	DCC_uc010xdr.1_Silent_p.P378P|DCC_uc010dpf.1_Silent_p.P185P	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	530	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
TICAM1	148022	broad.mit.edu	37	19	4816472	4816472	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4816472T>G	uc002mbi.2	-	2	2169	c.1918A>C	c.(1918-1920)ACC>CCC	p.T640P		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	640	Sufficient to induce apoptosis.|Pro-rich.			Missing (in Ref. 6; AAO85488).	apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9010689	9010689	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9010689A>C	uc002mkp.2	-	38	39176	c.38972T>G	c.(38971-38973)CTT>CGT	p.L12991R	MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12993	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19349171	19349171	+	Silent	SNP	C	T	T	rs146079504		TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19349171C>T	uc002nlz.2	+	11	3459	c.3360C>T	c.(3358-3360)TCC>TCT	p.S1120S	NCAN_uc010ecc.1_Silent_p.S684S|NCAN_uc002nma.2_5'Flank	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1120	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22155518	22155518	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155518A>C	uc002nqp.2	-	5	2167	c.2018T>G	c.(2017-2019)GTA>GGA	p.V673G	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22156695	22156695	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156695G>A	uc002nqp.2	-	4	1290	c.1141C>T	c.(1141-1143)CCC>TCC	p.P381S	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22156714	22156714	+	Silent	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156714G>A	uc002nqp.2	-	4	1271	c.1122C>T	c.(1120-1122)TGC>TGT	p.C374C	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF790	388536	broad.mit.edu	37	19	37314605	37314605	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37314605C>T	uc002oew.2	-	3	216	c.97G>A	c.(97-99)GTG>ATG	p.V33M	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	33	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38983186	38983186	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38983186C>T	uc002oit.2	+	38	6314	c.6184C>T	c.(6184-6186)CGC>TGC	p.R2062C	RYR1_uc002oiu.2_Missense_Mutation_p.R2062C	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2062	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
OVOL2	58495	broad.mit.edu	37	20	18005276	18005276	+	3'UTR	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18005276C>T	uc002wqi.1	-	4						NM_021220	NP_067043			zinc finger protein 339						negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
GART	2618	broad.mit.edu	37	21	34876432	34876432	+	Nonstop_Mutation	SNP	C	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34876432C>A	uc002yrx.2	-	22	3167	c.3032G>T	c.(3031-3033)TGA>TTA	p.*1011L	GART_uc002yrz.2_Nonstop_Mutation_p.*1011L|GART_uc010gmd.2_Nonstop_Mutation_p.*673L|GART_uc002yry.2_Nonstop_Mutation_p.*1011L	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,	1011					'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)													---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41450635	41450635	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41450635C>T	uc002yyq.1	-	26	5142	c.4690G>A	c.(4690-4692)GCT>ACT	p.A1564T	DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1564	Extracellular (Potential).|Fibronectin type-III 6.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
BCOR	54880	broad.mit.edu	37	X	39932171	39932171	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39932171G>A	uc004den.3	-	4	2720	c.2428C>T	c.(2428-2430)CGA>TGA	p.R810*	BCOR_uc004dep.3_Nonsense_Mutation_p.R810*|BCOR_uc004deo.3_Nonsense_Mutation_p.R810*|BCOR_uc004dem.3_Nonsense_Mutation_p.R810*|BCOR_uc004deq.3_Nonsense_Mutation_p.R810*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	810					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4																		---	---	---	---
KLHL4	56062	broad.mit.edu	37	X	86890779	86890779	+	Intron	SNP	A	C	C			TCGA-CG-5724-01	TCGA-CG-5724-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86890779A>C	uc004efb.2	+						KLHL4_uc004efa.2_Intron	NM_019117	NP_061990			kelch-like 4 isoform 1							cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5																		---	---	---	---
