Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	33786493	33786494	+	Intron	DEL	TC	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33786493_33786494delTC	uc001bxd.1	-							NM_001080438	NP_001073907			RecName: Full=Alpha 1,3-galactosyltransferase 2;          Short=A3galt2;          EC=2.4.1.87; AltName: Full=Isoglobotriaosylceramide synthase; AltName: Full=iGb3 synthase;          Short=iGb3S; Flags: Precursor;																														---	---	---	---
ASB17	127247	broad.mit.edu	37	1	76388173	76388174	+	Intron	INS	-	TTT	TTT			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76388173_76388174insTTT	uc001dhe.1	-						ASB17_uc001dhf.1_Intron	NM_080868	NP_543144			ankyrin repeat and SOCS box-containing 17						intracellular signal transduction					ovary(1)	1																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144220693	144220694	+	Intron	INS	-	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144220693_144220694insC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|uc010oxz.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
IL10	3586	broad.mit.edu	37	1	206944846	206944846	+	Intron	DEL	T	-	-	rs76688129		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206944846delT	uc001hen.1	-							NM_000572	NP_000563			interleukin 10 precursor						anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)															---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217975355	217975355	+	Intron	DEL	T	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217975355delT	uc001hlh.1	+						SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228402952	228402952	+	Intron	DEL	G	-	-	rs11314120		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228402952delG	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|uc001hsm.1_5'Flank	NM_001098623	NP_001092093			obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	-	-	rs35817759		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255569_240255571delGGC	uc010pyd.1	+	1	385_387	c.160_162delGGC	c.(160-162)GGCdel	p.G59del	FMN2_uc010pye.1_In_Frame_Del_p.G59del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	59					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
ZNF124	7678	broad.mit.edu	37	1	247323280	247323281	+	Intron	DEL	TC	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247323280_247323281delTC	uc001ick.2	-						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Intron	NM_003431	NP_003422			zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)															---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142888354	142888355	+	5'UTR	INS	-	CGG	CGG	rs3832053		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142888354_142888355insCGG	uc002tvj.1	-	1					LRP1B_uc010fnl.1_In_Frame_Ins_p.18_19insA	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
TANC1	85461	broad.mit.edu	37	2	159992541	159992562	+	Intron	DEL	GTGTGTGTGTGTGTGTGTGTGC	-	-	rs55994009	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992541_159992562delGTGTGTGTGTGTGTGTGTGTGC	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
FN1	2335	broad.mit.edu	37	2	216295678	216295678	+	Intron	DEL	T	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216295678delT	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vfl.2_Intron	NM_212482	NP_997647			fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185985334	185985335	+	Intron	INS	-	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185985334_185985335insA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
CCRN4L	25819	broad.mit.edu	37	4	139964675	139964675	+	Intron	DEL	T	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964675delT	uc003ihl.2	+						CCRN4L_uc003ihk.1_3'UTR	NM_012118	NP_036250			CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
ERCC8	1161	broad.mit.edu	37	5	60195751	60195752	+	Intron	INS	-	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60195751_60195752insA	uc003jsm.3	-						ERCC8_uc003jsk.2_Intron|ERCC8_uc003jsl.3_Intron|ERCC8_uc011cqp.1_Intron	NM_000082	NP_000073			excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)											Direct_reversal_of_damage|NER					---	---	---	---
GTF2H2C	728340	broad.mit.edu	37	5	68862371	68862372	+	Intron	DEL	GA	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68862371_68862372delGA	uc003jwx.3	+						GTF2H2C_uc003jww.1_Intron|GTF2H2C_uc003jwz.3_Intron|GTF2H2C_uc011cre.1_Intron|GTF2H2C_uc003jwy.3_Intron	NM_001098728	NP_001092198			general transcription factor IIH, polypeptide						DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0																		---	---	---	---
SLCO6A1	133482	broad.mit.edu	37	5	101709383	101709387	+	Intron	DEL	TATAA	-	-	rs67610026		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101709383_101709387delTATAA	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)														---	---	---	---
ISOC1	51015	broad.mit.edu	37	5	128440511	128440512	+	Intron	INS	-	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128440511_128440512insT	uc003kva.2	+							NM_016048	NP_057132			isochorismatase domain containing 1							peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)														---	---	---	---
MGC29506	51237	broad.mit.edu	37	5	138724126	138724126	+	Intron	DEL	T	-	-	rs139913070	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138724126delT	uc003lei.2	-						MGC29506_uc010jfd.2_Intron|MGC29506_uc010jfe.2_Intron|MGC29506_uc003lej.2_Intron	NM_016459	NP_057543			proapoptotic caspase adapter protein precursor						apoptosis|positive regulation of immunoglobulin biosynthetic process	cytoplasm|endoplasmic reticulum chaperone complex	protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
FGF18	8817	broad.mit.edu	37	5	170883961	170883961	+	3'UTR	DEL	G	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170883961delG	uc003mbk.2	+	5						NM_003862	NP_003853			fibroblast growth factor 18 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179442525	179442525	+	Intron	DEL	G	-	-	rs66797381		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442525delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165792990	165792991	+	Intron	INS	-	T	T	rs73030193	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165792990_165792991insT	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
AMPH	273	broad.mit.edu	37	7	38424702	38424703	+	Intron	INS	-	A	A	rs34834299		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38424702_38424703insA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133824009	133824009	+	Intron	DEL	T	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133824009delT	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144380279	144380279	+	Intron	DEL	T	-	-	rs137896700		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380279delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
PTDSS1	9791	broad.mit.edu	37	8	97321977	97321978	+	Intron	INS	-	TATATC	TATATC	rs146465884	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97321977_97321978insTATATC	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569			phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)													---	---	---	---
SEC61A2	55176	broad.mit.edu	37	10	12202709	12202710	+	Intron	DEL	AA	-	-	rs149915491		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12202709_12202710delAA	uc001ile.2	+						SEC61A2_uc010qbq.1_Intron|SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|SEC61A2_uc001ilg.3_Intron	NM_018144	NP_060614			Sec61 alpha form 2 isoform a							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	11158570	11158570	+	IGR	DEL	A	-	-	rs10574607		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158570delA								ZBED5 (278950 upstream) : GALNTL4 (133851 downstream)																																			---	---	---	---
ABCC8	6833	broad.mit.edu	37	11	17452093	17452093	+	Intron	DEL	G	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452093delG	uc001mnc.2	-							NM_000352	NP_000343			ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)													---	---	---	---
MLL	4297	broad.mit.edu	37	11	118353037	118353038	+	Intron	INS	-	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118353037_118353038insT	uc001pta.2	+						MLL_uc001ptb.2_Intron|MLL_uc001pte.1_Intron|MLL_uc009zab.1_Intron	NM_005933	NP_005924			myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)				T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								---	---	---	---
LASS5	91012	broad.mit.edu	37	12	50535722	50535723	+	Intron	INS	-	A	A	rs35739493		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50535722_50535723insA	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723			LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0																		---	---	---	---
TXNRD1	7296	broad.mit.edu	37	12	104659672	104659673	+	Intron	DEL	AA	-	-	rs34390973		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104659672_104659673delAA	uc010swk.1	+							NM_001093771	NP_001087240			thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0																		---	---	---	---
SLC41A2	84102	broad.mit.edu	37	12	105199285	105199286	+	Intron	INS	-	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105199285_105199286insA	uc001tla.2	-							NM_032148	NP_115524			solute carrier family 41, member 2							integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
SLC7A7	9056	broad.mit.edu	37	14	23247786	23247787	+	Intron	INS	-	A	A	rs143089787	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23247786_23247787insA	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973			solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)														---	---	---	---
C15orf29	79768	broad.mit.edu	37	15	34456098	34456098	+	Intron	DEL	T	-	-	rs5811822		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34456098delT	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989			hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)														---	---	---	---
BNIP2	663	broad.mit.edu	37	15	59963273	59963273	+	Intron	DEL	A	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59963273delA	uc010uhc.1	-						BNIP2_uc002agi.3_5'Flank|BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321			BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1																		---	---	---	---
AP3B2	8120	broad.mit.edu	37	15	83360356	83360356	+	Intron	DEL	A	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83360356delA	uc010uoh.1	-						AP3B2_uc010uoi.1_Intron|AP3B2_uc010uoj.1_Intron|AP3B2_uc010uok.1_Intron	NM_004644	NP_004635			adaptor-related protein complex 3, beta 2						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)															---	---	---	---
RPL23	9349	broad.mit.edu	37	17	37006922	37006923	+	Intron	DEL	TT	-	-	rs34258429		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37006922_37006923delTT	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_3'UTR	NM_000978	NP_000969			ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0																		---	---	---	---
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112			mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
ABCA10	10349	broad.mit.edu	37	17	67215523	67215526	+	Intron	DEL	CTTA	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67215523_67215526delCTTA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021			ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)																	---	---	---	---
SLC38A10	124565	broad.mit.edu	37	17	79257418	79257418	+	Intron	DEL	T	-	-	rs111438281		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79257418delT	uc002jzz.1	-						SLC38A10_uc002jzy.1_Intron|SLC38A10_uc002kab.2_Intron	NM_001037984	NP_001033073			solute carrier family 38, member 10 isoform a						amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)															---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43519364	43519365	+	Intron	DEL	GA	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43519364_43519365delGA	uc002lbm.2	-						KIAA1632_uc002lbo.1_Intron	NM_020964	NP_066015			hypothetical protein LOC57724						autophagy						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9794789	9794790	+	IGR	DEL	TT	-	-	rs111810059		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9794789_9794790delTT								ZNF562 (9013 upstream) : ZNF846 (68026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	35136443	35136446	+	Intron	DEL	ACAG	-	-	rs72337452		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35136443_35136446delACAG	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																														---	---	---	---
DIDO1	11083	broad.mit.edu	37	20	61526812	61526812	+	Intron	DEL	A	-	-	rs11086145		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61526812delA	uc002ydr.1	-						DIDO1_uc002yds.1_Intron|DIDO1_uc002ydt.1_Intron|DIDO1_uc002ydu.1_Intron	NM_033081	NP_149072			death inducer-obliterator 1 isoform c						apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)																	---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62658153	62658153	+	Intron	DEL	A	-	-	rs66797782		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62658153delA	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601			PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	44755923	44755925	+	IGR	DEL	CAT	-	-	rs66544012		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755923_44755925delCAT								CRYAA (163010 upstream) : SIK1 (78473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44755961	44755961	+	IGR	DEL	C	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755961delC								CRYAA (163048 upstream) : SIK1 (78437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	32614394	32614412	+	IGR	DEL	AAAAAAAAAAAAAAAAAAA	-	-	rs72175023		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32614394_32614412delAAAAAAAAAAAAAAAAAAA								RFPL2 (13676 upstream) : SLC5A4 (53 downstream)																																			---	---	---	---
ATXN10	25814	broad.mit.edu	37	22	46136597	46136598	+	Intron	INS	-	AT	AT	rs67765053		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136597_46136598insAT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368			ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)														---	---	---	---
BMX	660	broad.mit.edu	37	X	15554697	15554697	+	Intron	DEL	A	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15554697delA	uc004cww.2	+						BMX_uc004cwx.3_Intron|BMX_uc004cwy.3_Intron	NM_203281	NP_975010			BMX non-receptor tyrosine kinase						cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)																	---	---	---	---
CLCN5	1184	broad.mit.edu	37	X	49845141	49845142	+	Intron	INS	-	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49845141_49845142insT	uc004dos.1	+						CLCN5_uc004dor.1_Intron|CLCN5_uc004doq.1_Intron|CLCN5_uc004dot.1_Intron	NM_000084	NP_000075			chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)																	---	---	---	---
PLS3	5358	broad.mit.edu	37	X	114844800	114844802	+	Intron	DEL	TTT	-	-			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114844800_114844802delTTT	uc004eqd.2	+						PLS3_uc010nqf.2_Intron|PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Intron|PLS3_uc004eqe.2_Intron|PLS3_uc011mtg.1_Intron|PLS3_uc011mth.1_Intron	NM_005032	NP_005023			plastin 3							cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2																		---	---	---	---
SCNN1D	6339	broad.mit.edu	37	1	1222237	1222237	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1222237G>T	uc001adu.1	+	7	1133	c.509G>T	c.(508-510)GGC>GTC	p.G170V	SCNN1D_uc001adt.1_Missense_Mutation_p.G334V|SCNN1D_uc001adw.2_Missense_Mutation_p.G236V|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Missense_Mutation_p.G170V	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)														---	---	---	---
DMBX1	127343	broad.mit.edu	37	1	46972811	46972811	+	Silent	SNP	G	A	A	rs145308708	byFrequency	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46972811G>A	uc001cpx.2	+	1	144	c.129G>A	c.(127-129)GCG>GCA	p.A43A	DMBX1_uc001cpw.2_Silent_p.A43A	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1 isoform b	43	Interacts with OXT2 and is required for repressor activity (By similarity).				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
BEND5	79656	broad.mit.edu	37	1	49193689	49193689	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49193689C>G	uc001crx.3	-	6	1179	c.1135G>C	c.(1135-1137)GAA>CAA	p.E379Q	AGBL4_uc001cru.2_Intron|AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crw.3_Missense_Mutation_p.E210Q	NM_024603	NP_078879	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	379	BEN.									skin(1)	1																		---	---	---	---
BEND5	79656	broad.mit.edu	37	1	49208340	49208340	+	Silent	SNP	G	A	A	rs146041042		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49208340G>A	uc001crx.3	-	4	893	c.849C>T	c.(847-849)CCC>CCT	p.P283P	AGBL4_uc001cru.2_Intron|AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crw.3_Silent_p.P114P	NM_024603	NP_078879	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	283										skin(1)	1																		---	---	---	---
BARHL2	343472	broad.mit.edu	37	1	91178119	91178119	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91178119G>A	uc001dns.2	-	3	956	c.914C>T	c.(913-915)TCG>TTG	p.S305L		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	305						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)														---	---	---	---
CDC7	8317	broad.mit.edu	37	1	91977205	91977205	+	Silent	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91977205T>C	uc001doe.2	+	5	552	c.387T>C	c.(385-387)CAT>CAC	p.H129H	CDC7_uc001dof.2_Silent_p.H129H|CDC7_uc010osw.1_Silent_p.H101H|CDC7_uc009wdc.2_Silent_p.H129H	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7	129	Protein kinase.				cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)														---	---	---	---
GFI1	2672	broad.mit.edu	37	1	92941605	92941605	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92941605G>A	uc001dou.3	-	7	1414	c.1250C>T	c.(1249-1251)ACG>ATG	p.T417M	GFI1_uc001dov.3_Missense_Mutation_p.T417M|GFI1_uc001dow.3_Missense_Mutation_p.T417M	NM_001127215	NP_001120687	Q99684	GFI1_HUMAN	growth factor independent 1	417	C2H2-type 6.				negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)	1		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103387081	103387081	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103387081C>T	uc001dul.2	-	48	4019	c.3701G>A	c.(3700-3702)GGA>GAA	p.G1234E	COL11A1_uc001duk.2_Missense_Mutation_p.G430E|COL11A1_uc001dum.2_Missense_Mutation_p.G1246E|COL11A1_uc001dun.2_Missense_Mutation_p.G1195E|COL11A1_uc009weh.2_Missense_Mutation_p.G1118E	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1234	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120529603	120529603	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120529603C>T	uc001eik.2	-	5	1110	c.854G>A	c.(853-855)CGC>CAC	p.R285H	NOTCH2_uc001eil.2_Missense_Mutation_p.R285H|NOTCH2_uc001eim.3_Missense_Mutation_p.R202H	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	285	EGF-like 7; calcium-binding (Potential).|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
HIST2H2AB	317772	broad.mit.edu	37	1	149859253	149859253	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149859253G>A	uc001ete.2	-	1	214	c.214C>T	c.(214-216)CGG>TGG	p.R72W	HIST2H2BE_uc001etc.2_5'Flank	NM_175065	NP_778235	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	72					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|breast(1)	2	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)															---	---	---	---
SELENBP1	8991	broad.mit.edu	37	1	151337403	151337403	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151337403T>C	uc001exx.2	-	11	1302	c.1255A>G	c.(1255-1257)AGG>GGG	p.R419G	SELENBP1_uc010pcy.1_Missense_Mutation_p.R461G|SELENBP1_uc001exy.2_Missense_Mutation_p.R316G|SELENBP1_uc001exz.2_Missense_Mutation_p.R316G|SELENBP1_uc010pcz.1_Missense_Mutation_p.R357G|SELENBP1_uc009wms.2_Missense_Mutation_p.R255G|SELENBP1_uc009wmt.2_Missense_Mutation_p.R316G|SELENBP1_uc001eya.2_Missense_Mutation_p.R355G|SELENBP1_uc009wmu.2_3'UTR	NM_003944	NP_003935	Q13228	SBP1_HUMAN	selenium binding protein 1	419					protein transport	cytosol|membrane|nucleolus	protein binding|selenium binding				0	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152275879	152275879	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152275879G>A	uc001ezu.1	-	3	11519	c.11483C>T	c.(11482-11484)TCG>TTG	p.S3828L		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3828	Filaggrin 23.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
ADAR	103	broad.mit.edu	37	1	154570392	154570392	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154570392C>T	uc001ffh.2	-	4	2046	c.1846G>A	c.(1846-1848)GTC>ATC	p.V616I	ADAR_uc001ffj.2_Missense_Mutation_p.V616I|ADAR_uc001ffi.2_Missense_Mutation_p.V616I|ADAR_uc001ffk.2_Missense_Mutation_p.V321I	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	616	DRBM 2.				adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)														---	---	---	---
CADM3	57863	broad.mit.edu	37	1	159169578	159169578	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159169578C>G	uc001ftl.2	+	8	1132	c.990C>G	c.(988-990)CAC>CAG	p.H330Q	CADM3_uc001ftk.2_Missense_Mutation_p.H364Q|uc001ftm.1_RNA	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	330	Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
DDR2	4921	broad.mit.edu	37	1	162740230	162740230	+	Missense_Mutation	SNP	C	G	G	rs34869543		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162740230C>G	uc001gcf.2	+	13	1897	c.1432C>G	c.(1432-1434)CGC>GGC	p.R478G	DDR2_uc001gcg.2_Missense_Mutation_p.R478G	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	478	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)															---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178427010	178427010	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178427010G>A	uc001glr.2	+	12	2285	c.2160G>A	c.(2158-2160)GTG>GTA	p.V720V	RASAL2_uc001glq.2_Silent_p.V861V|RASAL2_uc009wxc.2_Silent_p.V234V	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	720					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
MOSC1	64757	broad.mit.edu	37	1	220971337	220971337	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220971337G>T	uc001hms.2	+	4	982	c.734G>T	c.(733-735)GGA>GTA	p.G245V	MOSC1_uc001hmt.2_Missense_Mutation_p.G245V	NM_022746	NP_073583	Q5VT66	MOSC1_HUMAN	MOCO sulphurase C-terminal domain containing 1	245	MOSC.						molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.0358)														---	---	---	---
PGBD5	79605	broad.mit.edu	37	1	230492629	230492629	+	Intron	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230492629G>A	uc010pwb.1	-						PGBD5_uc001htv.2_Intron	NM_024554	NP_078830			piggyBac transposable element derived 5							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)														---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235345675	235345675	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235345675G>A	uc001hwq.2	-	20	3057	c.2559C>T	c.(2557-2559)TGC>TGT	p.C853C	ARID4B_uc001hwr.2_Silent_p.C767C|ARID4B_uc001hws.3_Silent_p.C767C|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Silent_p.C534C	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	853					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
PROKR1	10887	broad.mit.edu	37	2	68882420	68882420	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68882420G>A	uc010yqj.1	+	2	894	c.894G>A	c.(892-894)GCG>GCA	p.A298A	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	298	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1																		---	---	---	---
ANXA4	307	broad.mit.edu	37	2	70015260	70015260	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70015260C>T	uc002sfr.3	+	3	311	c.84C>T	c.(82-84)GCC>GCT	p.A28A	ANXA4_uc010yqn.1_RNA|ANXA4_uc002sfs.3_Silent_p.A28A|ANXA4_uc010yqo.1_Intron	NM_001153	NP_001144	P09525	ANXA4_HUMAN	annexin IV	26	Annexin 1.				anti-apoptosis|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity				0																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71780317	71780317	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71780317C>T	uc002sie.2	+	20	2305	c.1929C>T	c.(1927-1929)GAC>GAT	p.D643D	DYSF_uc010feg.2_Silent_p.D674D|DYSF_uc010feh.2_Silent_p.D629D|DYSF_uc002sig.3_Silent_p.D629D|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.D643D|DYSF_uc010fef.2_Silent_p.D660D|DYSF_uc010fei.2_Silent_p.D660D|DYSF_uc010fek.2_Silent_p.D661D|DYSF_uc010fej.2_Silent_p.D630D|DYSF_uc010fel.2_Silent_p.D630D|DYSF_uc010feo.2_Silent_p.D675D|DYSF_uc010fem.2_Silent_p.D644D|DYSF_uc010fen.2_Silent_p.D661D|DYSF_uc002sif.2_Silent_p.D644D	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	643	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71825803	71825803	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71825803C>T	uc002sie.2	+	33	4006	c.3630C>T	c.(3628-3630)ATC>ATT	p.I1210I	DYSF_uc010feg.2_Silent_p.I1241I|DYSF_uc010feh.2_Silent_p.I1196I|DYSF_uc002sig.3_Silent_p.I1196I|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.I1210I|DYSF_uc010fef.2_Silent_p.I1227I|DYSF_uc010fei.2_Silent_p.I1227I|DYSF_uc010fek.2_Silent_p.I1228I|DYSF_uc010fej.2_Silent_p.I1197I|DYSF_uc010fel.2_Silent_p.I1197I|DYSF_uc010feo.2_Silent_p.I1242I|DYSF_uc010fem.2_Silent_p.I1211I|DYSF_uc010fen.2_Silent_p.I1228I|DYSF_uc002sif.2_Silent_p.I1211I|DYSF_uc010yqy.1_Silent_p.I91I	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1210	Cytoplasmic (Potential).|C2 4.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90260200	90260200	+	RNA	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90260200G>C	uc010fhm.2	+	30		c.4183G>C								Parts of antibodies, mostly variable regions.																														---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99636757	99636757	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99636757C>T	uc002szg.3	-	16	2431	c.1803G>A	c.(1801-1803)TTG>TTA	p.L601L	TSGA10_uc002szh.3_Silent_p.L601L|TSGA10_uc002szi.3_Silent_p.L601L|TSGA10_uc010fin.1_Silent_p.L601L	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	601	Interaction with HIF1A (By similarity).				spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
IL1F5	26525	broad.mit.edu	37	2	113818509	113818509	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113818509T>C	uc002tis.2	+	3	243	c.110T>C	c.(109-111)ATT>ACT	p.I37T	IL1F5_uc002tit.2_Missense_Mutation_p.I37T	NM_173170	NP_775262	Q9UBH0	I36RA_HUMAN	interleukin 1 family, member 5	37						extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0																		---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145157076	145157076	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157076G>A	uc002tvu.2	-	8	2158	c.1678C>T	c.(1678-1680)CGT>TGT	p.R560C	ZEB2_uc002tvv.2_Missense_Mutation_p.R554C|ZEB2_uc010zbm.1_Missense_Mutation_p.R531C|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.R589C	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	560						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166187901	166187901	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166187901G>C	uc002udc.2	+	14	2501	c.2211G>C	c.(2209-2211)TTG>TTC	p.L737F	SCN2A_uc002udd.2_Missense_Mutation_p.L737F|SCN2A_uc002ude.2_Missense_Mutation_p.L737F	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	737					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166221688	166221688	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166221688G>A	uc002udc.2	+	18	3725	c.3435G>A	c.(3433-3435)ACG>ACA	p.T1145T	SCN2A_uc002udd.2_Silent_p.T1145T|SCN2A_uc002ude.2_Silent_p.T1145T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1145					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
KBTBD10	10324	broad.mit.edu	37	2	170349529	170349529	+	Intron	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170349529A>G	uc010zdh.1	+						BBS5_uc002uet.2_Intron|BBS5_uc010fpw.2_Intron	NM_152384	NP_689597			Bardet-Biedl syndrome 5						striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179581831	179581831	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179581831C>G	uc010zfg.1	-	85	22122	c.21898G>C	c.(21898-21900)GGT>CGT	p.G7300R	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G3961R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8227							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196877523	196877523	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196877523G>C	uc002utj.3	-	10	1078	c.977C>G	c.(976-978)ACT>AGT	p.T326S		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	326	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
ALS2	57679	broad.mit.edu	37	2	202626541	202626541	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202626541T>C	uc002uyo.2	-	4	532	c.176A>G	c.(175-177)GAT>GGT	p.D59G	ALS2_uc002uyp.3_Missense_Mutation_p.D59G|ALS2_uc002uyq.2_Missense_Mutation_p.D59G|ALS2_uc002uyr.2_Missense_Mutation_p.D59G	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	59	RCC1 1.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7																		---	---	---	---
PTPRN	5798	broad.mit.edu	37	2	220168525	220168525	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220168525C>G	uc002vkz.2	-	4	398	c.309G>C	c.(307-309)CAG>CAC	p.Q103H	PTPRN_uc010zlc.1_Missense_Mutation_p.Q13H|PTPRN_uc002vla.2_Missense_Mutation_p.Q103H	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	103	Extracellular (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)														---	---	---	---
CPNE9	151835	broad.mit.edu	37	3	9746659	9746659	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9746659C>T	uc003bsd.2	+	4	412	c.241C>T	c.(241-243)CAA>TAA	p.Q81*		NM_153635	NP_705899	Q8IYJ1	CPNE9_HUMAN	copine-like protein	81	C2 1.									ovary(2)	2	Medulloblastoma(99;0.227)																	---	---	---	---
BRPF1	7862	broad.mit.edu	37	3	9788874	9788874	+	Silent	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788874G>C	uc003bse.2	+	14	3885	c.3486G>C	c.(3484-3486)CTG>CTC	p.L1162L	BRPF1_uc003bsf.2_Silent_p.L1168L|BRPF1_uc003bsg.2_Silent_p.L1161L|BRPF1_uc011ati.1_Silent_p.L1067L|OGG1_uc003bsh.2_5'Flank|OGG1_uc003bsi.2_5'Flank|OGG1_uc003bsj.2_5'Flank|OGG1_uc003bsk.2_5'Flank|OGG1_uc003bsl.2_5'Flank|OGG1_uc003bsm.2_5'Flank|OGG1_uc003bsn.2_5'Flank|OGG1_uc003bso.2_5'Flank	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1162	PWWP.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)																	---	---	---	---
CAPN7	23473	broad.mit.edu	37	3	15270563	15270563	+	Missense_Mutation	SNP	C	T	T	rs140855092		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15270563C>T	uc003bzn.2	+	8	1205	c.935C>T	c.(934-936)ACC>ATC	p.T312I		NM_014296	NP_055111	Q9Y6W3	CAN7_HUMAN	calpain 7	312	Calpain catalytic.				proteolysis	nucleus	calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	G	G	rs121913403		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266113C>G	uc010hia.1	+	4	266	c.110C>G	c.(109-111)TCT>TGT	p.S37C	CTNNB1_uc003ckp.2_Missense_Mutation_p.S37C|CTNNB1_uc003ckq.2_Missense_Mutation_p.S37C|CTNNB1_uc003ckr.2_Missense_Mutation_p.S37C|CTNNB1_uc011azf.1_Missense_Mutation_p.S30C|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	37			S -> C (in PTR, hepatoblastoma and ovarian cancer).|SG -> W (in hepatocellular carcinoma).|S -> F (in PTR).|S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes).|S -> Y (in hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.S37F(147)|p.S37C(124)|p.A5_A80del(63)|p.S37A(59)|p.S37Y(23)|p.S37P(16)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.W25_I140del(4)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.V22_G80>NNNNN(1)|p.GIHS34?(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.G34_S37del(1)|p.I35_S37>T(1)|p.I35_K170del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.S37S(1)|p.S37T(1)|p.V22_S71>A(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.S37_G38>W(1)|p.A5_Q143>E(1)|p.I35_G38del(1)|p.H36_E53>L(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.S37_A39>S(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.I35_T41del(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	S37F(HUTU80_SMALL_INTESTINE)|S37C(SNU398_LIVER)|S37C(JHUEM2_ENDOMETRIUM)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
ALS2CL	259173	broad.mit.edu	37	3	46718164	46718164	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46718164C>T	uc003cqa.1	-	18	2186	c.1996G>A	c.(1996-1998)GAG>AAG	p.E666K	ALS2CL_uc003cpx.1_Missense_Mutation_p.E13K|ALS2CL_uc003cpy.1_RNA|ALS2CL_uc003cpz.1_Missense_Mutation_p.E181K|ALS2CL_uc003cqb.1_Missense_Mutation_p.E666K|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	666					endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)														---	---	---	---
KIF9	64147	broad.mit.edu	37	3	47284533	47284533	+	Intron	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47284533C>A	uc010hjp.2	-						KIF9_uc003cqx.2_Intron|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|uc003cqw.1_RNA	NM_001134878	NP_001128350			kinesin family member 9 isoform 2						blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)														---	---	---	---
DHX30	22907	broad.mit.edu	37	3	47888357	47888357	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47888357T>A	uc003cru.2	+	11	2221	c.1795T>A	c.(1795-1797)TTC>ATC	p.F599I	DHX30_uc003crt.2_Missense_Mutation_p.F560I|MIR1226_hsa-mir-1226|MI0006313_5'Flank	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	599	Helicase ATP-binding.					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)														---	---	---	---
MITF	4286	broad.mit.edu	37	3	69988303	69988303	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69988303A>G	uc003dnz.2	+	4	753	c.637A>G	c.(637-639)AAC>GAC	p.N213D	MITF_uc011bgb.1_Missense_Mutation_p.N161D|MITF_uc003doa.2_Missense_Mutation_p.N212D|MITF_uc003dob.2_Missense_Mutation_p.N197D|MITF_uc003dod.2_Missense_Mutation_p.N188D|MITF_uc003doe.2_Missense_Mutation_p.N106D|MITF_uc003dof.2_Missense_Mutation_p.N106D	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor	213					melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)				A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						---	---	---	---
MYH15	22989	broad.mit.edu	37	3	108195277	108195277	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108195277G>A	uc003dxa.1	-	13	1317	c.1260C>T	c.(1258-1260)AAC>AAT	p.N420N		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	420	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7																		---	---	---	---
C3orf15	89876	broad.mit.edu	37	3	119421967	119421967	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119421967G>T	uc010hqx.1	+	1	99	c.22G>T	c.(22-24)GAG>TAG	p.E8*	C3orf15_uc003edc.2_Nonsense_Mutation_p.E8*|C3orf15_uc010hqy.1_Nonsense_Mutation_p.E8*|C3orf15_uc003ede.3_Nonsense_Mutation_p.E8*|C3orf15_uc010hqz.2_5'UTR|C3orf15_uc011bjd.1_5'UTR|C3orf15_uc011bje.1_5'UTR|C3orf15_uc010hra.1_5'Flank			Q7Z4T9	AAT1_HUMAN	RecName: Full=AMY-1-associating protein expressed in testis 1;          Short=AAT-1;	8						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)														---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	166960346	166960346	+	Silent	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166960346T>G	uc003fep.2	-	20	2546	c.2223A>C	c.(2221-2223)ACA>ACC	p.T741T	ZBBX_uc011bpc.1_Silent_p.T780T|ZBBX_uc003feq.2_Silent_p.T712T	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	741						intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
KLHL24	54800	broad.mit.edu	37	3	183368270	183368270	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183368270C>A	uc003flv.2	+	3	421	c.126C>A	c.(124-126)TTC>TTA	p.F42L	KLHL24_uc003flw.2_Missense_Mutation_p.F42L|KLHL24_uc003flx.2_Missense_Mutation_p.F42L	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	42						axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)															---	---	---	---
EIF4A2	1974	broad.mit.edu	37	3	186504980	186504980	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186504980T>C	uc003fqs.2	+	8	875	c.836T>C	c.(835-837)TTT>TCT	p.F279S	EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.F280S|EIF4A2_uc003fqv.2_Missense_Mutation_p.F184S|EIF4A2_uc003fqw.2_Missense_Mutation_p.F184S|EIF4A2_uc011bsb.1_Missense_Mutation_p.F152S|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	279	Helicase C-terminal.				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)				T	BCL6	NHL								---	---	---	---
UGDH	7358	broad.mit.edu	37	4	39505505	39505505	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505505A>G	uc003guk.1	-	11	1680	c.1364T>C	c.(1363-1365)ATT>ACT	p.I455T	UGDH_uc011byp.1_Missense_Mutation_p.I358T|UGDH_uc003gul.1_Missense_Mutation_p.I388T	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase	455					glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)													---	---	---	---
RBM47	54502	broad.mit.edu	37	4	40439969	40439969	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40439969C>T	uc003gvc.2	-	4	1652	c.942G>A	c.(940-942)ACG>ACA	p.T314T	RBM47_uc003gvd.2_Silent_p.T314T|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Silent_p.T276T|RBM47_uc003gvg.1_Silent_p.T314T	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	314	RRM 3.					nucleus	nucleotide binding|RNA binding			breast(3)	3																		---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47322236	47322236	+	Intron	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47322236T>G	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66509144	66509144	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66509144C>A	uc003hcy.2	-	2	376	c.183G>T	c.(181-183)GTG>GTT	p.V61V	EPHA5_uc003hcx.2_5'UTR|EPHA5_uc003hcz.2_Silent_p.V61V|EPHA5_uc011cah.1_Silent_p.V61V|EPHA5_uc011cai.1_Silent_p.V61V|EPHA5_uc003hda.2_Silent_p.V61V	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	61	Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	69433646	69433646	+	IGR	SNP	C	T	T	rs148107155		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69433646C>T								YTHDC1 (217822 upstream) : UGT2B15 (78670 downstream)																																			---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372210	126372210	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372210C>A	uc003ifj.3	+	9	10039	c.10039C>A	c.(10039-10041)CAG>AAG	p.Q3347K	FAT4_uc011cgp.1_Missense_Mutation_p.Q1645K|FAT4_uc003ifi.1_Missense_Mutation_p.Q825K	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3347	Cadherin 32.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126411351	126411351	+	Silent	SNP	G	A	A	rs146914959		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126411351G>A	uc003ifj.3	+	17	13374	c.13374G>A	c.(13372-13374)ACG>ACA	p.T4458T	FAT4_uc011cgp.1_Silent_p.T2699T|FAT4_uc003ifi.1_Silent_p.T1935T	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4458	EGF-like 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
GLRB	2743	broad.mit.edu	37	4	158060076	158060076	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158060076C>A	uc003ipj.2	+	7	928	c.726C>A	c.(724-726)AAC>AAA	p.N242K		NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor	242	Extracellular (Probable).				nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)													---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164506905	164506905	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164506905C>T	uc003iqs.1	-	6	1396	c.419G>A	c.(418-420)CGG>CAG	p.R140Q	MARCH1_uc003iqr.1_Missense_Mutation_p.R123Q	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	140					antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	165981453	165981453	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165981453G>T	uc011cjl.1	+	1	1154	c.1154G>T	c.(1153-1155)TGG>TTG	p.W385L		NM_001105575	NP_001099045			tripartite motif-containing 75																														---	---	---	---
SDHA	6389	broad.mit.edu	37	5	256491	256491	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:256491G>A	uc003jao.3	+	15	2066	c.1951G>A	c.(1951-1953)GAG>AAG	p.E651K	SDHA_uc011clw.1_Missense_Mutation_p.E603K|SDHA_uc003jap.3_Missense_Mutation_p.E570K|SDHA_uc003jaq.3_Missense_Mutation_p.E426K|SDHA_uc003jar.3_Missense_Mutation_p.E245K	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	651					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)									Familial_Paragangliomas				---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75587088	75587088	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75587088G>A	uc003kei.1	+	7	1314	c.1180G>A	c.(1180-1182)GAA>AAA	p.E394K		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	394	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
YTHDC2	64848	broad.mit.edu	37	5	112868662	112868662	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112868662C>T	uc003kqn.2	+	5	945	c.762C>T	c.(760-762)ATC>ATT	p.I254I	YTHDC2_uc010jce.1_Silent_p.I254I|YTHDC2_uc010jcf.1_5'UTR	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	254	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)														---	---	---	---
TCF7	6932	broad.mit.edu	37	5	133478792	133478792	+	Splice_Site	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133478792G>A	uc003kyt.2	+	8	1222	c.1026_splice	c.e8+1	p.Y342_splice	TCF7_uc003kyu.1_Splice_Site_p.Y227_splice|TCF7_uc003kyv.2_Splice_Site_p.Y227_splice|TCF7_uc003kyw.2_Splice_Site_p.Y227_splice|TCF7_uc003kyx.2_Splice_Site_p.Y140_splice|TCF7_uc003kyy.2_Splice_Site_p.Y227_splice|TCF7_uc003kyz.2_Splice_Site_p.Y227_splice|TCF7_uc003kza.2_Splice_Site_p.Y227_splice|TCF7_uc003kzb.2_Splice_Site_p.Y156_splice|TCF7_uc010jdu.2_5'Flank	NM_003202	NP_003193			transcription factor 7 (T-cell specific,						cellular response to interleukin-4|immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription regulatory region DNA binding				0		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
PCDHA9	9752	broad.mit.edu	37	5	140229470	140229470	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140229470G>A	uc003lhu.2	+	1	2114	c.1390G>A	c.(1390-1392)GTG>ATG	p.V464M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.V464M	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	464	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA12	56137	broad.mit.edu	37	5	140256833	140256833	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140256833G>A	uc003lic.2	+	1	1903	c.1776G>A	c.(1774-1776)GCG>GCA	p.A592A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A592A	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	592	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140595315	140595315	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595315G>A	uc003lja.1	+	1	1807	c.1620G>A	c.(1618-1620)GCG>GCA	p.A540A		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	540	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
FGF1	2246	broad.mit.edu	37	5	141993608	141993608	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141993608G>T	uc003lmm.2	-	2	165	c.85C>A	c.(85-87)CTC>ATC	p.L29I	FGF1_uc011dbi.1_Missense_Mutation_p.L29I|FGF1_uc003lmn.3_Missense_Mutation_p.L29I|FGF1_uc003lmp.3_Missense_Mutation_p.L29I|FGF1_uc003lmq.2_Missense_Mutation_p.L29I|FGF1_uc010jgj.2_Missense_Mutation_p.L29I|FGF1_uc003lmr.2_Missense_Mutation_p.L29I|FGF1_uc003lms.3_Missense_Mutation_p.L29I	NM_001144892	NP_001138364	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic) isoform 1	29					angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)													---	---	---	---
SH3TC2	79628	broad.mit.edu	37	5	148386652	148386652	+	Intron	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148386652A>T	uc003lpu.2	-						SH3TC2_uc003lpp.1_Intron|SH3TC2_uc010jgw.2_Intron|SH3TC2_uc003lps.2_Intron|SH3TC2_uc003lpt.2_Intron|SH3TC2_uc010jgx.2_Intron	NM_024577	NP_078853			SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
FAT2	2196	broad.mit.edu	37	5	150891882	150891882	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150891882C>T	uc003lue.3	-	20	11762	c.11749G>A	c.(11749-11751)GTG>ATG	p.V3917M	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.V524M	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3917	Extracellular (Potential).|Laminin G-like.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168175345	168175345	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168175345G>A	uc003mab.2	-	20	2652	c.2232C>T	c.(2230-2232)CGC>CGT	p.R744R	SLIT3_uc010jjg.2_Silent_p.R744R	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	744	LRRNT 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
GFPT2	9945	broad.mit.edu	37	5	179763495	179763495	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179763495G>A	uc003mlw.1	-	3	296	c.198C>T	c.(196-198)CTC>CTT	p.L66L		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	66	Glutamine amidotransferase type-2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)													---	---	---	---
KIAA0319	9856	broad.mit.edu	37	6	24559301	24559301	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24559301G>A	uc011djo.1	-	17	2911	c.2674C>T	c.(2674-2676)CGG>TGG	p.R892W	KIAA0319_uc011djp.1_Missense_Mutation_p.R847W|KIAA0319_uc003neh.1_Missense_Mutation_p.R892W|KIAA0319_uc011djq.1_Missense_Mutation_p.R883W|KIAA0319_uc011djr.1_Missense_Mutation_p.R892W|KIAA0319_uc010jpt.1_Missense_Mutation_p.R303W	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	892	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2																		---	---	---	---
RPS10	6204	broad.mit.edu	37	6	34392484	34392484	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34392484C>G	uc003ojm.2	-	3	504	c.284G>C	c.(283-285)CGC>CCC	p.R95P	RPS10_uc003ojn.2_Missense_Mutation_p.R95P	NM_001014	NP_001005	P46783	RS10_HUMAN	ribosomal protein S10	95					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding				0																		---	---	---	---
DST	667	broad.mit.edu	37	6	56462620	56462620	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56462620T>C	uc003pdf.2	-	41	5784	c.5756A>G	c.(5755-5757)AAT>AGT	p.N1919S	DST_uc003pcz.3_Missense_Mutation_p.N1741S|DST_uc011dxj.1_Missense_Mutation_p.N1770S|DST_uc011dxk.1_Missense_Mutation_p.N1781S|DST_uc003pcy.3_Missense_Mutation_p.N1415S|DST_uc010kaa.1_RNA	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	3827					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
KIAA1586	57691	broad.mit.edu	37	6	56919487	56919487	+	Silent	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56919487A>T	uc003pdj.2	+	4	2360	c.2190A>T	c.(2188-2190)GTA>GTT	p.V730V	KIAA1586_uc011dxm.1_Silent_p.V703V	NM_020931	NP_065982	Q9HCI6	K1586_HUMAN	hypothetical protein LOC57691	730							nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75797371	75797371	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75797371G>A	uc003phs.2	-	65	9269	c.9103C>T	c.(9103-9105)CGA>TGA	p.R3035*	COL12A1_uc003pht.2_Nonsense_Mutation_p.R1871*	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	3035	Triple-helical region (COL1) with 2 imperfections.			R -> Q (in Ref. 1; AAC51244).	cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
TTK	7272	broad.mit.edu	37	6	80745071	80745071	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80745071C>T	uc003pjc.2	+	16	1935	c.1861C>T	c.(1861-1863)CCA>TCA	p.P621S	TTK_uc003pjb.3_Missense_Mutation_p.P620S	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	621	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.T621R(1)		ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)														---	---	---	---
CYB5R4	51167	broad.mit.edu	37	6	84646074	84646074	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84646074G>C	uc003pkf.2	+	12	1219	c.1087G>C	c.(1087-1089)GAG>CAG	p.E363Q		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	363	FAD-binding FR-type.				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)														---	---	---	---
NCOA7	135112	broad.mit.edu	37	6	126249822	126249822	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126249822G>A	uc010kes.2	+	18	3183	c.2734G>A	c.(2734-2736)GGA>AGA	p.G912R	NCOA7_uc003qae.3_Missense_Mutation_p.G912R|NCOA7_uc003qah.2_Missense_Mutation_p.G901R|NCOA7_uc003qai.2_Missense_Mutation_p.G912R|NCOA7_uc010ket.2_Missense_Mutation_p.G797R|NCOA7_uc003qak.2_Missense_Mutation_p.G189R	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	912	TLD.				cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)														---	---	---	---
PERP	64065	broad.mit.edu	37	6	138413398	138413398	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138413398G>C	uc003qht.2	-	3	546	c.363C>G	c.(361-363)TTC>TTG	p.F121L		NM_022121	NP_071404	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	121	Helical; (Potential).				apoptosis|cell adhesion	desmosome|Golgi apparatus|integral to membrane|nucleus					0	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)														---	---	---	---
SNX9	51429	broad.mit.edu	37	6	158296134	158296134	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158296134G>A	uc003qqv.1	+	4	399	c.226G>A	c.(226-228)GAC>AAC	p.D76N		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	76					cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)														---	---	---	---
IGF2R	3482	broad.mit.edu	37	6	160526045	160526045	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160526045C>T	uc003qta.2	+	48	7553	c.7405C>T	c.(7405-7407)CAG>TAG	p.Q2469*		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	2469	Cytoplasmic (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)														---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21598554	21598554	+	Silent	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21598554T>G	uc003svc.2	+	3	661	c.630T>G	c.(628-630)ACT>ACG	p.T210T		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	210	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
TRIM50	135892	broad.mit.edu	37	7	72734221	72734221	+	Silent	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72734221G>T	uc010lbd.1	-	3	545	c.420C>A	c.(418-420)ATC>ATA	p.I140I	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Silent_p.I140I|TRIM50_uc003txz.1_Silent_p.I140I	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	140	Potential.					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82544530	82544530	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82544530A>G	uc003uhx.2	-	7	13061	c.12772T>C	c.(12772-12774)TCT>CCT	p.S4258P	PCLO_uc003uhv.2_Missense_Mutation_p.S4258P|PCLO_uc010lec.2_Missense_Mutation_p.S1223P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4189					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
ABCB4	5244	broad.mit.edu	37	7	87074291	87074291	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87074291C>A	uc003uiv.1	-	10	1082	c.1006G>T	c.(1006-1008)GTT>TTT	p.V336F	ABCB4_uc003uiw.1_Missense_Mutation_p.V336F|ABCB4_uc003uix.1_Missense_Mutation_p.V336F	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	336	Helical; (By similarity).|ABC transmembrane type-1 1.				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)																	---	---	---	---
ABCB1	5243	broad.mit.edu	37	7	87174159	87174159	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87174159G>A	uc003uiz.1	-	17	2462	c.2044C>T	c.(2044-2046)CTT>TTT	p.L682F	ABCB1_uc011khc.1_Missense_Mutation_p.L618F	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	682	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)													---	---	---	---
KCND2	3751	broad.mit.edu	37	7	120387763	120387763	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120387763G>T	uc003vjj.1	+	6	2709	c.1744G>T	c.(1744-1746)GAG>TAG	p.E582*		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	582	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)																	---	---	---	---
SMO	6608	broad.mit.edu	37	7	128846389	128846389	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128846389G>A	uc003vor.2	+	6	1505	c.1225G>A	c.(1225-1227)GGC>AGC	p.G409S	SMO_uc003vos.2_Missense_Mutation_p.G84S	NM_005631	NP_005622	Q99835	SMO_HUMAN	smoothened precursor	409	Helical; Name=5; (Potential).				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37								Mis		skin basal cell 								---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147844745	147844745	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147844745G>A	uc003weu.1	+	17	3233	c.2717G>A	c.(2716-2718)CGC>CAC	p.R906H		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	906	Laminin G-like 3.|Extracellular (Potential).		R -> H.		behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
ZNF746	155061	broad.mit.edu	37	7	149191094	149191094	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149191094G>A	uc003wfw.2	-	3	663	c.392C>T	c.(391-393)ACG>ATG	p.T131M	ZNF746_uc010lpi.2_Missense_Mutation_p.T131M	NM_152557	NP_689770	Q6NUN9	ZN746_HUMAN	zinc finger protein 746 isoform 2	131	KRAB.				negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|breast(1)	3	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)															---	---	---	---
FBXO25	26260	broad.mit.edu	37	8	401257	401257	+	Intron	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:401257T>C	uc003wox.2	+						FBXO25_uc003woy.2_Intron|FBXO25_uc003woz.2_Intron|FBXO25_uc003wpa.2_Intron	NM_183421	NP_904357			F-box only protein 25 isoform 1							nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)														---	---	---	---
MTMR9	66036	broad.mit.edu	37	8	11162339	11162339	+	Intron	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11162339G>C	uc003wtm.2	+						MTMR9_uc010lrx.2_Intron|MTMR9_uc011kxa.1_Intron	NM_015458	NP_056273			myotubularin related protein 9							cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)														---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15601095	15601095	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15601095C>T	uc003wwt.2	+	8	1121	c.911C>T	c.(910-912)TCG>TTG	p.S304L	TUSC3_uc003wwu.2_Missense_Mutation_p.S304L|TUSC3_uc003wwv.2_Missense_Mutation_p.S304L|TUSC3_uc003www.2_Missense_Mutation_p.S304L|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_3'UTR	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	304					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
SULF1	23213	broad.mit.edu	37	8	70512983	70512983	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70512983G>A	uc010lza.1	+	9	1597	c.880G>A	c.(880-882)GAG>AAG	p.E294K	SULF1_uc003xyd.2_Missense_Mutation_p.E294K|SULF1_uc003xye.2_Missense_Mutation_p.E294K|SULF1_uc003xyf.2_Missense_Mutation_p.E294K|SULF1_uc003xyg.2_Missense_Mutation_p.E294K|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	294					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)															---	---	---	---
LRP12	29967	broad.mit.edu	37	8	105509670	105509670	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105509670T>G	uc003yma.2	-	5	1205	c.1110A>C	c.(1108-1110)CAA>CAC	p.Q370H	LRP12_uc003ymb.2_Missense_Mutation_p.Q351H|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	370	Extracellular (Potential).|CUB 2.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113392635	113392635	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113392635T>G	uc003ynu.2	-	38	6241	c.6082A>C	c.(6082-6084)AAT>CAT	p.N2028H	CSMD3_uc003yns.2_Missense_Mutation_p.N1230H|CSMD3_uc003ynt.2_Missense_Mutation_p.N1988H|CSMD3_uc011lhx.1_Missense_Mutation_p.N1924H	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2028	Extracellular (Potential).|CUB 11.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
PLAA	9373	broad.mit.edu	37	9	26906075	26906075	+	Intron	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26906075C>G	uc003zqd.2	-							NM_001031689	NP_001026859			phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)														---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113234518	113234518	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113234518G>A	uc010mtz.2	-	15	3022	c.2685C>T	c.(2683-2685)ATC>ATT	p.I895I	SVEP1_uc010mua.1_Silent_p.I895I	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	895					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119097300	119097300	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119097300C>T	uc004bjn.2	+	13	3939	c.3558C>T	c.(3556-3558)CCC>CCT	p.P1186P	PAPPA_uc011lxp.1_Silent_p.P881P|PAPPA_uc011lxq.1_Silent_p.P561P	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	1186					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
PRRX2	51450	broad.mit.edu	37	9	132484623	132484623	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132484623G>T	uc004byh.2	+	4	981	c.754G>T	c.(754-756)GTG>TTG	p.V252L		NM_016307	NP_057391	Q99811	PRRX2_HUMAN	paired related homeobox 2	252						nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1		Ovarian(14;0.00556)																---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133963174	133963174	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133963174G>A	uc004caa.1	+	27	4545	c.4447G>A	c.(4447-4449)GAG>AAG	p.E1483K	LAMC3_uc010mze.1_Missense_Mutation_p.E171K	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1483	Domain II and I.|Potential.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	141016271	141016271	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141016271C>T	uc004cog.2	+	46	6985	c.6840C>T	c.(6838-6840)TTC>TTT	p.F2280F	CACNA1B_uc004coi.2_Silent_p.F1492F	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	2280	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)													---	---	---	---
SLC39A12	221074	broad.mit.edu	37	10	18250745	18250745	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18250745A>G	uc001ipo.2	+	3	770	c.497A>G	c.(496-498)GAT>GGT	p.D166G	SLC39A12_uc001ipn.2_Missense_Mutation_p.D166G|SLC39A12_uc001ipp.2_Missense_Mutation_p.D166G|SLC39A12_uc010qck.1_Missense_Mutation_p.D32G	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	166	Extracellular (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2																		---	---	---	---
ZEB1	6935	broad.mit.edu	37	10	31812911	31812911	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31812911G>C	uc001ivs.3	+	8	2715	c.2652G>C	c.(2650-2652)CAG>CAC	p.Q884H	ZEB1_uc001ivr.3_Missense_Mutation_p.Q666H|ZEB1_uc010qee.1_Missense_Mutation_p.Q666H|ZEB1_uc010qef.1_Missense_Mutation_p.Q666H|ZEB1_uc009xlk.1_Missense_Mutation_p.Q666H|ZEB1_uc001ivt.3_Missense_Mutation_p.Q666H|ZEB1_uc001ivu.3_Missense_Mutation_p.Q885H|ZEB1_uc001ivv.3_Missense_Mutation_p.Q864H|ZEB1_uc010qeh.1_Missense_Mutation_p.Q817H|ZEB1_uc009xlp.2_Missense_Mutation_p.Q868H	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	884					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)																---	---	---	---
ITGB1	3688	broad.mit.edu	37	10	33212672	33212672	+	Intron	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33212672G>C	uc001iws.3	-						ITGB1_uc001iwp.3_Intron|ITGB1_uc001iwq.3_Intron|ITGB1_uc001iwr.3_Intron|ITGB1_uc001iwt.3_Intron|ITGB1_uc001iwu.1_Intron	NM_133376	NP_596867			integrin beta 1 isoform 1A precursor						axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)																---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53893600	53893600	+	Silent	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53893600G>T	uc001jjm.2	+	8	1085	c.891G>T	c.(889-891)GGG>GGT	p.G297G	PRKG1_uc001jjo.2_Silent_p.G312G|PRKG1_uc009xow.1_Missense_Mutation_p.R15S	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	297	cGMP 2.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55663110	55663110	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55663110T>C	uc001jju.1	-	26	3789	c.3394A>G	c.(3394-3396)ATT>GTT	p.I1132V	PCDH15_uc010qhq.1_Missense_Mutation_p.I1137V|PCDH15_uc010qhr.1_Missense_Mutation_p.I1132V|PCDH15_uc010qhs.1_Missense_Mutation_p.I1144V|PCDH15_uc010qht.1_Missense_Mutation_p.I1139V|PCDH15_uc010qhu.1_Missense_Mutation_p.I1132V|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.I1132V|PCDH15_uc010qhw.1_Missense_Mutation_p.I1095V|PCDH15_uc010qhx.1_Missense_Mutation_p.I1061V|PCDH15_uc010qhy.1_Missense_Mutation_p.I1137V|PCDH15_uc010qhz.1_Missense_Mutation_p.I1132V|PCDH15_uc010qia.1_Missense_Mutation_p.I1110V|PCDH15_uc010qib.1_Missense_Mutation_p.I1110V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1132	Cadherin 10.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60556153	60556153	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60556153G>T	uc001jki.1	+	10	1233	c.1233G>T	c.(1231-1233)AGG>AGT	p.R411S	BICC1_uc001jkj.1_Missense_Mutation_p.R52S	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	411					multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69700775	69700775	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69700775G>A	uc001jng.3	-	21	2760	c.2449C>T	c.(2449-2451)CCT>TCT	p.P817S	HERC4_uc009xpq.2_Missense_Mutation_p.P350S|HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Missense_Mutation_p.P809S|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Missense_Mutation_p.P553S	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a	817	HECT.				cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
TTC18	118491	broad.mit.edu	37	10	75113305	75113305	+	Intron	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75113305A>T	uc009xrc.2	-						TTC18_uc001jty.2_Intron|TTC18_uc009xrd.1_Intron	NM_145170	NP_660153			tetratricopeptide repeat domain 18								binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)																	---	---	---	---
LDB1	8861	broad.mit.edu	37	10	103869244	103869244	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103869244G>A	uc009xwz.2	-	9	1096	c.753C>T	c.(751-753)CCC>CCT	p.P251P	LDB1_uc001kuk.3_Silent_p.P215P|LDB1_uc001kul.3_Silent_p.P215P	NM_001113407	NP_001106878	Q86U70	LDB1_HUMAN	LIM domain binding 1 isoform 1	251					histone H3-K4 acetylation|negative regulation of erythrocyte differentiation|negative regulation of transcription, DNA-dependent|positive regulation of hemoglobin biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription elongation, DNA-dependent|transcription, DNA-dependent|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery	nuclear chromatin|protein complex	LIM domain binding|protein homodimerization activity|transcription corepressor activity			large_intestine(1)	1		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)														---	---	---	---
ABCC8	6833	broad.mit.edu	37	11	17450207	17450207	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17450207G>A	uc001mnc.2	-	13	1954	c.1828C>T	c.(1828-1830)CTA>TTA	p.L610L		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	610	Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)													---	---	---	---
ABCC8	6833	broad.mit.edu	37	11	17482049	17482049	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17482049C>T	uc001mnc.2	-	6	1123	c.997G>A	c.(997-999)GTC>ATC	p.V333I	ABCC8_uc010rcy.1_Missense_Mutation_p.V332I	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	333	Extracellular (By similarity).|ABC transmembrane type-1 1.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)													---	---	---	---
DBX1	120237	broad.mit.edu	37	11	20180794	20180794	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20180794C>T	uc001mpw.1	-	2	412	c.412G>A	c.(412-414)GCC>ACC	p.A138T		NM_001029865	NP_001025036	A6NMT0	DBX1_HUMAN	developing brain homeobox 1	138					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26538454	26538454	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26538454G>A	uc001mqt.3	+	6	817	c.672G>A	c.(670-672)CTG>CTA	p.L224L	ANO3_uc010rdr.1_Silent_p.L208L|ANO3_uc010rds.1_Silent_p.L78L|ANO3_uc010rdt.1_Silent_p.L78L	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	224	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
AGBL2	79841	broad.mit.edu	37	11	47681771	47681771	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47681771G>A	uc001ngg.2	-	18	2763	c.2663C>T	c.(2662-2664)GCT>GTT	p.A888V	AGBL2_uc001ngf.2_RNA	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	888					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
PTPRJ	5795	broad.mit.edu	37	11	48177607	48177607	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48177607G>A	uc001ngp.3	+	21	3729	c.3374G>A	c.(3373-3375)CGT>CAT	p.R1125H		NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1125	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	55322894	55322894	+	IGR	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322894A>T								OR4C15 (1 upstream) : OR4C16 (16710 downstream)																																			---	---	---	---
OR8J3	81168	broad.mit.edu	37	11	55904988	55904988	+	Silent	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904988G>T	uc010riz.1	-	1	207	c.207C>A	c.(205-207)ATC>ATA	p.I69I		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)																	---	---	---	---
OR5T1	390155	broad.mit.edu	37	11	56043418	56043418	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043418A>G	uc001nio.1	+	1	304	c.304A>G	c.(304-306)AAA>GAA	p.K102E		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	102	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)																	---	---	---	---
HNRNPUL2	221092	broad.mit.edu	37	11	62482774	62482774	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62482774C>A	uc001nuw.2	-	14	2434	c.2241G>T	c.(2239-2241)CGG>CGT	p.R747R	HNRNPUL2_uc001nuu.1_Intron	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	747					cell killing	nucleus	ATP binding|nucleic acid binding				0																		---	---	---	---
STX5	6811	broad.mit.edu	37	11	62575109	62575109	+	Intron	SNP	A	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62575109A>C	uc001nvh.2	-						NXF1_uc001nvf.1_5'Flank|NXF1_uc001nvg.1_5'Flank|NXF1_uc009yog.1_5'Flank|NXF1_uc010rmh.1_5'Flank|STX5_uc010rmi.1_Intron|STX5_uc009yoh.2_Intron|STX5_uc001nvi.2_Intron|STX5_uc010rmj.1_Missense_Mutation_p.L313W|STX5_uc001nvj.2_Intron	NM_003164	NP_003155			syntaxin 5						intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2																		---	---	---	---
ACTN3	89	broad.mit.edu	37	11	66330604	66330604	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66330604G>A	uc001oio.1	+	22	2664	c.2646G>A	c.(2644-2646)CCG>CCA	p.P882P	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	882					focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0																		---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83182758	83182758	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83182758C>T	uc001paj.2	-	19	2345	c.2042G>A	c.(2041-2043)CGG>CAG	p.R681Q	DLG2_uc001pai.2_Missense_Mutation_p.R560Q|DLG2_uc010rsy.1_Missense_Mutation_p.R630Q|DLG2_uc010rsz.1_Missense_Mutation_p.R677Q|DLG2_uc010rta.1_Missense_Mutation_p.R663Q|DLG2_uc001pak.2_Missense_Mutation_p.R786Q|DLG2_uc010rtb.1_Missense_Mutation_p.R648Q|DLG2_uc010rsw.1_Missense_Mutation_p.R145Q|DLG2_uc010rsx.1_Missense_Mutation_p.R158Q	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	681	Guanylate kinase-like.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
ANKRD49	54851	broad.mit.edu	37	11	94231299	94231299	+	Silent	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94231299T>C	uc001pew.2	+	3	460	c.321T>C	c.(319-321)GAT>GAC	p.D107D	ANKRD49_uc001pex.2_3'UTR|ANKRD49_uc001pey.2_RNA	NM_017704	NP_060174	Q8WVL7	ANR49_HUMAN	fetal globin inducing factor	107	ANK 2.				positive regulation of transcription, DNA-dependent					central_nervous_system(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
C11orf87	399947	broad.mit.edu	37	11	109294891	109294891	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109294891G>A	uc001pkn.2	+	2	906	c.532G>A	c.(532-534)GCA>ACA	p.A178T	C11orf87_uc010rwb.1_RNA	NM_207645	NP_997528	Q6NUJ2	CK087_HUMAN	hypothetical protein LOC399947 precursor	178	Cytoplasmic (Potential).					integral to membrane				ovary(2)	2																		---	---	---	---
CLDN25	644672	broad.mit.edu	37	11	113650534	113650534	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113650534G>A	uc009yyw.1	+	1	17	c.17G>A	c.(16-18)CGT>CAT	p.R6H		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	6	Cytoplasmic (Potential).					integral to membrane|tight junction	structural molecule activity				0																		---	---	---	---
VWF	7450	broad.mit.edu	37	12	6103071	6103071	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6103071C>A	uc001qnn.1	-	37	6805	c.6555G>T	c.(6553-6555)CGG>CGT	p.R2185R	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2185					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
CHD4	1108	broad.mit.edu	37	12	6682232	6682232	+	Intron	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6682232C>A	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264			chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2																		---	---	---	---
SLC2A3	6515	broad.mit.edu	37	12	8077053	8077053	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8077053C>A	uc001qtr.2	-	8	1283	c.1021G>T	c.(1021-1023)GGG>TGG	p.G341W		NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	341	Helical; Name=9; (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)														---	---	---	---
TAS2R13	50838	broad.mit.edu	37	12	11060990	11060990	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11060990C>T	uc001qzg.1	-	1	1172	c.908G>A	c.(907-909)CGA>CAA	p.R303Q	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron	NM_023920	NP_076409	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	303	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			breast(1)|skin(1)	2																		---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	T	T	rs121913529		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25398284C>T	uc001rgp.1	-	2	216	c.35G>A	c.(34-36)GGT>GAT	p.G12D	KRAS_uc001rgq.1_Missense_Mutation_p.G12D|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
BICD1	636	broad.mit.edu	37	12	32458680	32458680	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32458680C>A	uc001rku.2	+	4	710	c.629C>A	c.(628-630)ACG>AAG	p.T210K	BICD1_uc001rkv.2_Missense_Mutation_p.T210K|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	210	Potential.				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
KRT84	3890	broad.mit.edu	37	12	52775182	52775182	+	Missense_Mutation	SNP	C	T	T	rs146876431		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52775182C>T	uc001sah.1	-	5	1088	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	347	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)														---	---	---	---
KRT2	3849	broad.mit.edu	37	12	53042031	53042031	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53042031C>T	uc001sat.2	-	5	1081	c.1048G>A	c.(1048-1050)GCC>ACC	p.A350T		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	350	Coil 2.|Rod.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)														---	---	---	---
NPFF	8620	broad.mit.edu	37	12	53900562	53900562	+	Nonstop_Mutation	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53900562A>T	uc001sdw.1	-	3	504	c.340T>A	c.(340-342)TGA>AGA	p.*114R		NM_003717	NP_003708	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide preproprotein	114					neuropeptide signaling pathway|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0																		---	---	---	---
ITGA5	3678	broad.mit.edu	37	12	54790125	54790125	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54790125G>A	uc001sga.2	-	30	3170	c.3102C>T	c.(3100-3102)ACC>ACT	p.T1034T		NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor	1034	Cytoplasmic (Potential).				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2																		---	---	---	---
SLC16A7	9194	broad.mit.edu	37	12	60098669	60098669	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60098669C>A	uc001sqs.2	+	3	386	c.87C>A	c.(85-87)TCC>TCA	p.S29S	SLC16A7_uc001sqt.2_Silent_p.S29S|SLC16A7_uc001squ.2_Silent_p.S29S|SLC16A7_uc009zqi.2_5'UTR|SLC16A7_uc010ssi.1_5'UTR	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7	29	Helical; (Potential).					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)													---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78594292	78594292	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78594292G>A	uc001syp.2	+	38	6928	c.6755G>A	c.(6754-6756)GGT>GAT	p.G2252D	NAV3_uc001syo.2_Missense_Mutation_p.G2230D|NAV3_uc010sub.1_Missense_Mutation_p.G1709D|NAV3_uc009zsf.2_Missense_Mutation_p.G1061D	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2252						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
UHRF1BP1L	23074	broad.mit.edu	37	12	100496647	100496647	+	Intron	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100496647G>A	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron	NM_015054	NP_055869			UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2																		---	---	---	---
GAS2L3	283431	broad.mit.edu	37	12	101017746	101017746	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101017746C>T	uc001thu.2	+	10	1389	c.1163C>T	c.(1162-1164)TCA>TTA	p.S388L	GAS2L3_uc009zty.2_Missense_Mutation_p.S388L|GAS2L3_uc001thv.2_Missense_Mutation_p.S284L	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	388					cell cycle arrest					skin(1)	1																		---	---	---	---
TCHP	84260	broad.mit.edu	37	12	110345342	110345342	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110345342C>T	uc001tpn.2	+	6	690	c.537C>T	c.(535-537)ACC>ACT	p.T179T	TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Silent_p.T179T	NM_001143852	NP_001137324	Q9BT92	TCHP_HUMAN	trichoplein	179	Glu-rich.|Interaction with keratin proteins.|Potential.				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding			skin(1)	1																		---	---	---	---
EP400	57634	broad.mit.edu	37	12	132464291	132464291	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132464291C>T	uc001ujn.2	+	2	1423	c.1388C>T	c.(1387-1389)ACG>ATG	p.T463M	EP400_uc001ujl.2_Missense_Mutation_p.T462M|EP400_uc001ujm.2_Missense_Mutation_p.T463M|EP400_uc001ujj.1_Missense_Mutation_p.T462M|EP400_uc001ujk.2_Missense_Mutation_p.T499M	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	499					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)														---	---	---	---
SLITRK6	84189	broad.mit.edu	37	13	86369237	86369237	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86369237G>T	uc001vll.1	-	2	1866	c.1407C>A	c.(1405-1407)AAC>AAA	p.N469K	SLITRK6_uc010afe.1_Intron	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	469	Extracellular (Potential).|LRR 10.			N -> H (in Ref. 1).		integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)														---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88328906	88328906	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88328906C>T	uc001vln.2	+	2	1482	c.1263C>T	c.(1261-1263)ATC>ATT	p.I421I	SLITRK5_uc010tic.1_Silent_p.I180I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	421	LRR 7.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
ADCK1	57143	broad.mit.edu	37	14	78374153	78374153	+	Missense_Mutation	SNP	G	A	A	rs140603078		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78374153G>A	uc001xui.2	+	7	848	c.749G>A	c.(748-750)CGA>CAA	p.R250Q	ADCK1_uc010tvo.1_RNA|ADCK1_uc001xuj.2_Missense_Mutation_p.R182Q|ADCK1_uc001xuk.1_Missense_Mutation_p.R124Q	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	257	Protein kinase.					extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---
SERPINA3	12	broad.mit.edu	37	14	95088714	95088714	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95088714C>T	uc001ydp.2	+	4	1033	c.954C>T	c.(952-954)ATC>ATT	p.I318I	SERPINA3_uc001ydo.3_Silent_p.I343I|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Silent_p.I318I|SERPINA3_uc001yds.2_Silent_p.I318I|SERPINA3_uc010avg.2_Silent_p.I318I	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	318					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)														---	---	---	---
MIR412	574433	broad.mit.edu	37	14	101531868	101531868	+	RNA	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101531868G>A	hsa-mir-412|MI0002464	+			c.85G>A			uc010txp.1_5'Flank|MIR369_hsa-mir-369|MI0000777_5'Flank|MIR410_hsa-mir-410|MI0002465_5'Flank|MIR656_hsa-mir-656|MI0003678_5'Flank																	0																		---	---	---	---
TECPR2	9895	broad.mit.edu	37	14	102918810	102918810	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102918810G>A	uc001ylw.1	+	16	3634	c.3486G>A	c.(3484-3486)ACG>ACA	p.T1162T	TECPR2_uc010awl.2_Silent_p.T1162T|TECPR2_uc010txx.1_Silent_p.T325T	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1162							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105415602	105415602	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105415602G>A	uc010axc.1	-	7	6306	c.6186C>T	c.(6184-6186)CCC>CCT	p.P2062P	AHNAK2_uc001ypx.2_Silent_p.P1962P	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2062						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
NDN	4692	broad.mit.edu	37	15	23931569	23931569	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931569C>G	uc001ywk.2	-	1	882	c.796G>C	c.(796-798)GCC>CCC	p.A266P		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	266	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)										Prader-Willi_syndrome				---	---	---	---
STRC	161497	broad.mit.edu	37	15	43893582	43893582	+	Intron	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43893582G>T	uc001zsf.2	-						STRC_uc010bdl.2_Intron|STRC_uc001zse.2_Intron	NM_153700	NP_714544			stereocilin precursor						sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)														---	---	---	---
SLC28A2	9153	broad.mit.edu	37	15	45555448	45555448	+	Intron	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45555448A>T	uc001zva.2	+							NM_004212	NP_004203			solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)														---	---	---	---
NOX5	79400	broad.mit.edu	37	15	69339812	69339812	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69339812C>T	uc002ars.1	+	12	1772	c.1752C>T	c.(1750-1752)GCC>GCT	p.A584A	NOX5_uc002arp.1_Silent_p.A566A|NOX5_uc002arq.1_Silent_p.A538A|NOX5_uc010bid.1_Silent_p.A549A|NOX5_uc002arr.1_Silent_p.A556A|NOX5_uc010bie.1_Silent_p.A384A|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	584	Helical; (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2																		---	---	---	---
C15orf26	161502	broad.mit.edu	37	15	81440853	81440853	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81440853C>A	uc002bgb.2	+	7	912	c.885C>A	c.(883-885)GCC>GCA	p.A295A		NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	295											0																		---	---	---	---
TMC3	342125	broad.mit.edu	37	15	81627266	81627266	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81627266C>T	uc002bgo.1	-	21	2254	c.2254G>A	c.(2254-2256)GAT>AAT	p.D752N	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	752	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2																		---	---	---	---
ST8SIA2	8128	broad.mit.edu	37	15	92988117	92988117	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92988117G>A	uc002bra.2	+	5	955	c.800G>A	c.(799-801)CGC>CAC	p.R267H	ST8SIA2_uc002brb.2_Missense_Mutation_p.R246H	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide	267	Lumenal (Potential).				axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)															---	---	---	---
CHSY1	22856	broad.mit.edu	37	15	101717818	101717818	+	Silent	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101717818G>T	uc002bwt.1	-	4	2667	c.2184C>A	c.(2182-2184)GTC>GTA	p.V728V	CHSY1_uc010usd.1_Silent_p.V456V	NM_014918	NP_055733	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	728	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity				0	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2329025	2329025	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2329025C>T	uc002cpy.1	-	29	5178	c.4466G>A	c.(4465-4467)CGC>CAC	p.R1489H	ABCA3_uc010bsk.1_Missense_Mutation_p.R1431H	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	1489	ABC transporter 2.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
VASN	114990	broad.mit.edu	37	16	4431585	4431585	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4431585G>A	uc002cwj.1	+	2	862	c.707G>A	c.(706-708)CGA>CAA	p.R236Q	CORO7_uc002cwe.2_Intron|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc002cwh.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron|CORO7_uc002cwi.1_Intron|CORO7_uc010uxj.1_Intron|CORO7_uc010btp.1_Intron	NM_138440	NP_612449	Q6EMK4	VASN_HUMAN	slit-like 2 precursor	236	Extracellular (Potential).|LRR 8.					extracellular region|integral to membrane					0																		---	---	---	---
CES7	221223	broad.mit.edu	37	16	55883653	55883653	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55883653G>A	uc002eip.2	-	11	1455	c.1306C>T	c.(1306-1308)CGG>TGG	p.R436W	CES7_uc002eio.2_Intron|CES7_uc002eiq.2_Missense_Mutation_p.R197W|CES7_uc002eir.2_Missense_Mutation_p.R330W	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1	436						extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)														---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70708398	70708398	+	Silent	SNP	G	A	A	rs147002775		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70708398G>A	uc002ezj.2	-	11	1124	c.864C>T	c.(862-864)GGC>GGT	p.G288G		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	288	Ser-rich.				filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
SPG7	6687	broad.mit.edu	37	16	89623299	89623299	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89623299C>T	uc002fnj.2	+	17	2207	c.2186C>T	c.(2185-2187)GCA>GTA	p.A729V	SPG7_uc002fnl.2_Missense_Mutation_p.A138V	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1	729	Mitochondrial matrix (Potential).				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)														---	---	---	---
SLC43A2	124935	broad.mit.edu	37	17	1478995	1478995	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1478995T>C	uc002fsv.2	-	14	1702	c.1613A>G	c.(1612-1614)TAC>TGC	p.Y538C	SLC43A2_uc002fsu.2_Missense_Mutation_p.Y542C	NM_152346	NP_689559	Q8N370	LAT4_HUMAN	solute carrier family 43, member 2	538					cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)														---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577130A>G	uc002gim.2	-	8	1002	c.808T>C	c.(808-810)TTT>CTT	p.F270L	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.F270L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.F138L|TP53_uc010cng.1_Missense_Mutation_p.F138L|TP53_uc002gii.1_Missense_Mutation_p.F138L|TP53_uc010cnh.1_Missense_Mutation_p.F270L|TP53_uc010cni.1_Missense_Mutation_p.F270L|TP53_uc002gij.2_Missense_Mutation_p.F270L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	270	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		F -> L (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).|F -> C (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.F270L(22)|p.F270C(15)|p.F270V(8)|p.0?(7)|p.F270S(7)|p.F270Y(5)|p.F270I(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CWC25	54883	broad.mit.edu	37	17	36971114	36971114	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36971114C>T	uc002hqu.2	-	3	581	c.428G>A	c.(427-429)AGG>AAG	p.R143K	CWC25_uc010wdv.1_Missense_Mutation_p.R80K|CWC25_uc010wdw.1_RNA|CWC25_uc010wdx.1_RNA	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49	143											0																		---	---	---	---
FKBP10	60681	broad.mit.edu	37	17	39975631	39975631	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39975631C>T	uc002hxv.2	+	5	1222	c.897C>T	c.(895-897)GAC>GAT	p.D299D	FKBP10_uc002hxw.1_Silent_p.D2D	NM_021939	NP_068758	Q96AY3	FKB10_HUMAN	FK506 binding protein 10 precursor	299	PPIase FKBP-type 3.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)														---	---	---	---
PLEKHH3	79990	broad.mit.edu	37	17	40820258	40820258	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40820258T>A	uc002iau.2	-	13	2736	c.2269A>T	c.(2269-2271)AGC>TGC	p.S757C	PLEKHH3_uc010cyl.1_RNA|PLEKHH3_uc002iat.1_RNA|PLEKHH3_uc002iav.2_RNA|PLEKHH3_uc010cym.1_Missense_Mutation_p.S118C|PLEKHH3_uc002iaw.2_3'UTR	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	757	Poly-Ser.				signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)														---	---	---	---
SEPT4	5414	broad.mit.edu	37	17	56598621	56598621	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56598621C>T	uc002iwm.1	-	9	1236	c.1108G>A	c.(1108-1110)GTG>ATG	p.V370M	SEPT4_uc002iwk.1_Missense_Mutation_p.V223M|SEPT4_uc010wnw.1_Missense_Mutation_p.V223M|SEPT4_uc002iwl.1_Missense_Mutation_p.V223M|SEPT4_uc002iwn.1_Missense_Mutation_p.V271M|SEPT4_uc002iwo.1_Missense_Mutation_p.V351M|SEPT4_uc002iwp.1_3'UTR|SEPT4_uc010wnx.1_Missense_Mutation_p.V385M|SEPT4_uc010wny.1_Missense_Mutation_p.V362M|SEPT4_uc010dcy.1_3'UTR	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1	370					apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)															OREG0024614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59093117	59093117	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59093117C>G	uc002iyv.3	+	16	1601	c.1492C>G	c.(1492-1494)CTG>GTG	p.L498V	BCAS3_uc010wow.1_Missense_Mutation_p.L285V|BCAS3_uc002iyu.3_Missense_Mutation_p.L498V|BCAS3_uc002iyw.3_Missense_Mutation_p.L494V|BCAS3_uc002iyy.3_Missense_Mutation_p.L269V|BCAS3_uc002iyz.3_Missense_Mutation_p.L52V|BCAS3_uc002iza.3_Missense_Mutation_p.L52V	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	498						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
GH2	2689	broad.mit.edu	37	17	61949672	61949672	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61949672G>A	uc002jcj.2	-	5	526	c.464C>T	c.(463-465)ACG>ATG	p.T155M	CSH2_uc002jcg.2_Silent_p.D61D|CSH2_uc002jch.2_Silent_p.D156D|CSH2_uc002jci.2_3'UTR|CSH2_uc002jck.2_Silent_p.D156D	NM_022557	NP_072051	P01242	SOM2_HUMAN	growth hormone 2 isoform 2	Error:Variant_position_missing_in_P01242_after_alignment						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3																		---	---	---	---
KIF19	124602	broad.mit.edu	37	17	72350375	72350375	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72350375A>C	uc002jkm.3	+	18	2521	c.2383A>C	c.(2383-2385)ACC>CCC	p.T795P		NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	795					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0																		---	---	---	---
SS18	6760	broad.mit.edu	37	18	23615079	23615079	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23615079T>G	uc002kvm.2	-	9	1064	c.986A>C	c.(985-987)TAT>TCT	p.Y329S	SS18_uc002kvn.2_Missense_Mutation_p.Y298S|SS18_uc010xbf.1_Missense_Mutation_p.Y247S|SS18_uc010xbg.1_Missense_Mutation_p.Y246S|SS18_uc010xbh.1_Missense_Mutation_p.Y246S|SS18_uc010xbi.1_Missense_Mutation_p.Y306S|SS18_uc010dlz.1_Missense_Mutation_p.Y277S	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	329	Gln-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)							T	SSX1| SSX2	synovial sarcoma								---	---	---	---
NARS	4677	broad.mit.edu	37	18	55268941	55268941	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55268941C>A	uc002lgs.2	-	14	1818	c.1590G>T	c.(1588-1590)AGG>AGT	p.R530S	NARS_uc002lgt.2_Missense_Mutation_p.R529S|NARS_uc010xea.1_Missense_Mutation_p.R281S	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	530					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)													---	---	---	---
C19orf26	255057	broad.mit.edu	37	19	1235849	1235849	+	Silent	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1235849G>T	uc002lrm.2	-	3	431	c.156C>A	c.(154-156)GGC>GGA	p.G52G		NM_152769	NP_689982	Q8N350	DOS_HUMAN	downstream of Stk11	52	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)											HNSCC(14;0.022)			---	---	---	---
TCF3	6929	broad.mit.edu	37	19	1612362	1612362	+	Intron	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1612362C>T	uc002ltr.2	-						TCF3_uc002ltn.2_Missense_Mutation_p.A5T|TCF3_uc002lto.2_Intron|TCF3_uc002ltt.3_Missense_Mutation_p.A553T|TCF3_uc002ltq.2_Intron|TCF3_uc002lts.1_Missense_Mutation_p.A468T	NM_003200	NP_003191			transcription factor 3 isoform E12						B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding			lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)				T	PBX1|HLF|TFPT	pre B-ALL								---	---	---	---
C3	718	broad.mit.edu	37	19	6680225	6680225	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6680225A>T	uc002mfm.2	-	36	4462	c.4400T>A	c.(4399-4401)TTT>TAT	p.F1467Y	C3_uc002mfl.2_Missense_Mutation_p.F203Y	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1467					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
C3	718	broad.mit.edu	37	19	6711199	6711199	+	Silent	SNP	C	T	T	rs138824784		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6711199C>T	uc002mfm.2	-	12	1340	c.1278G>A	c.(1276-1278)ACG>ACA	p.T426T		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	426					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
OR10H5	284433	broad.mit.edu	37	19	15905399	15905399	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15905399G>A	uc010xos.1	+	1	541	c.541G>A	c.(541-543)GTG>ATG	p.V181M		NM_001004466	NP_001004466	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17737485	17737485	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17737485C>T	uc002nhd.2	-	34	4294	c.4294G>A	c.(4294-4296)GCG>ACG	p.A1432T		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1344					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
SF4	57794	broad.mit.edu	37	19	19414582	19414582	+	Missense_Mutation	SNP	C	T	T	rs150375001		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19414582C>T	uc002nmh.2	-	5	615	c.613G>A	c.(613-615)GAG>AAG	p.E205K	SF4_uc002nmf.2_5'Flank|SF4_uc002nmg.2_5'UTR|SF4_uc002nmi.2_5'UTR|SF4_uc002nmj.2_5'UTR|SF4_uc010xqr.1_RNA|SF4_uc010xqs.1_Intron	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4	205	SURP motif 1.				nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0																		---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31769042	31769042	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769042C>T	uc002nsy.3	-	2	1722	c.1657G>A	c.(1657-1659)GCC>ACC	p.A553T		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	553					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
DPY19L3	147991	broad.mit.edu	37	19	32930708	32930708	+	Silent	SNP	A	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32930708A>T	uc002ntg.2	+	8	923	c.747A>T	c.(745-747)ATA>ATT	p.I249I	DPY19L3_uc002nth.1_Silent_p.I249I|DPY19L3_uc002nti.1_RNA	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	249	Helical; (Potential).					integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)																	---	---	---	---
DPY19L3	147991	broad.mit.edu	37	19	32930709	32930709	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32930709T>A	uc002ntg.2	+	8	924	c.748T>A	c.(748-750)TCA>ACA	p.S250T	DPY19L3_uc002nth.1_Missense_Mutation_p.S250T|DPY19L3_uc002nti.1_RNA	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	250	Helical; (Potential).					integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)																	---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38573359	38573359	+	Missense_Mutation	SNP	C	T	T	rs141710131		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38573359C>T	uc002ohk.2	+	3	1663	c.1154C>T	c.(1153-1155)ACG>ATG	p.T385M		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	385					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38976356	38976356	+	Silent	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38976356C>T	uc002oit.2	+	34	5191	c.5061C>T	c.(5059-5061)CAC>CAT	p.H1687H	RYR1_uc002oiu.2_Silent_p.H1687H	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1687	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
AKT2	208	broad.mit.edu	37	19	40741065	40741065	+	Intron	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40741065G>C	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc002one.2_Intron	NM_001626	NP_001617			AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)					A		ovarian|pancreatic 								---	---	---	---
ERF	2077	broad.mit.edu	37	19	42753352	42753352	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42753352G>A	uc002ote.3	-	4	1070	c.912C>T	c.(910-912)TCC>TCT	p.S304S	ERF_uc002otd.3_Silent_p.S35S	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	304					cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)																---	---	---	---
PSG5	5673	broad.mit.edu	37	19	43683290	43683290	+	Intron	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43683290G>T	uc002ovu.2	-						PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Silent_p.S78S|PSG5_uc002ovx.2_Intron|PSG5_uc002ovv.2_Silent_p.S150S|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772			pregnancy specific beta-1-glycoprotein 5						female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)																---	---	---	---
PSG5	5673	broad.mit.edu	37	19	43683291	43683291	+	Intron	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43683291G>T	uc002ovu.2	-						PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.S78Y|PSG5_uc002ovx.2_Intron|PSG5_uc002ovv.2_Missense_Mutation_p.S150Y|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772			pregnancy specific beta-1-glycoprotein 5						female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)																---	---	---	---
PPP2R1A	5518	broad.mit.edu	37	19	52714526	52714526	+	Missense_Mutation	SNP	C	T	T	rs148604195		TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52714526C>T	uc002pyp.2	+	4	443	c.284C>T	c.(283-285)TCG>TTG	p.S95L	PPP2R1A_uc010ydk.1_Missense_Mutation_p.S40L|PPP2R1A_uc010epm.1_Missense_Mutation_p.S135L|PPP2R1A_uc002pyq.2_5'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	95	PP2A subunit B binding.|SV40 small T antigen binding.|HEAT 3.|Polyoma small and medium T antigens Binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)				Mis		clear cell ovarian carcinoma								---	---	---	---
ZNF578	147660	broad.mit.edu	37	19	53014551	53014551	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53014551G>A	uc002pzp.3	+	6	1161	c.917G>A	c.(916-918)CGT>CAT	p.R306H		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	81	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)														---	---	---	---
ZNF331	55422	broad.mit.edu	37	19	54080995	54080995	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54080995A>G	uc002qbx.1	+	7	2615	c.1181A>G	c.(1180-1182)TAT>TGT	p.Y394C	ZNF331_uc002qby.1_Missense_Mutation_p.Y394C|ZNF331_uc002qbz.1_Missense_Mutation_p.Y394C|ZNF331_uc002qca.1_Missense_Mutation_p.Y394C|ZNF331_uc010eqr.1_Missense_Mutation_p.Y394C|ZNF331_uc002qcb.1_Missense_Mutation_p.Y394C|ZNF331_uc002qcc.1_Missense_Mutation_p.Y394C|ZNF331_uc002qcd.1_Missense_Mutation_p.Y394C	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	394	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)				T	?	follicular thyroid adenoma								---	---	---	---
KIR2DL4	3805	broad.mit.edu	37	19	55316320	55316320	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55316320G>A	uc010yfm.1	+	3	189	c.149G>A	c.(148-150)CGG>CAG	p.R50Q	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Missense_Mutation_p.R45Q|KIR2DL4_uc002qhg.2_Missense_Mutation_p.R50Q|KIR2DL4_uc002qhi.2_Missense_Mutation_p.R50Q|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Missense_Mutation_p.R50Q|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Missense_Mutation_p.R50Q|KIR2DL4_uc010ese.2_5'Flank	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	50	Ig-like C2-type 1.|Extracellular (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)														---	---	---	---
ZNF71	58491	broad.mit.edu	37	19	57133750	57133750	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133750G>C	uc002qnm.3	+	3	1333	c.1095G>C	c.(1093-1095)AAG>AAC	p.K365N		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	365	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)														---	---	---	---
ZNF264	9422	broad.mit.edu	37	19	57705342	57705342	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57705342G>A	uc002qob.2	+	2	546	c.133G>A	c.(133-135)GAA>AAA	p.E45K		NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264	45	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)														---	---	---	---
RBCK1	10616	broad.mit.edu	37	20	409672	409672	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:409672G>C	uc002wdp.3	+	11	2079	c.1386G>C	c.(1384-1386)TGG>TGC	p.W462C	RBCK1_uc002wdq.3_Missense_Mutation_p.W420C|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_Missense_Mutation_p.W292C	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	462	IBR-type 2.				interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)																---	---	---	---
RASSF2	9770	broad.mit.edu	37	20	4771170	4771170	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4771170A>G	uc002wld.2	-	6	518	c.464T>C	c.(463-465)GTG>GCG	p.V155A	RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.V155A	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	155					cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6																		---	---	---	---
SPTLC3	55304	broad.mit.edu	37	20	13098334	13098334	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13098334A>C	uc002wod.1	+	8	1403	c.1114A>C	c.(1114-1116)AGT>CGT	p.S372R		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	372					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
CST2	1470	broad.mit.edu	37	20	23807102	23807102	+	Missense_Mutation	SNP	G	A	A	rs112783512	byFrequency	TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23807102G>A	uc002wtq.1	-	1	211	c.196C>T	c.(196-198)CGC>TGC	p.R66C		NM_001322	NP_001313	P09228	CYTT_HUMAN	cystatin SA precursor	66						extracellular region	cysteine-type endopeptidase inhibitor activity				0																		---	---	---	---
DYNLRB1	83658	broad.mit.edu	37	20	33122521	33122521	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33122521G>A	uc002xal.2	+	3	229	c.169G>A	c.(169-171)GTG>ATG	p.V57M	DYNLRB1_uc010zuk.1_Missense_Mutation_p.V57M|DYNLRB1_uc002xam.2_RNA|DYNLRB1_uc002xan.2_RNA	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1	57					microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0																		---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41100955	41100955	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41100955G>A	uc002xkg.2	-	8	1585	c.1401C>T	c.(1399-1401)CCC>CCT	p.P467P	PTPRT_uc010ggj.2_Silent_p.P467P	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	467	Extracellular (Potential).|Fibronectin type-III 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
SEMG1	6406	broad.mit.edu	37	20	43836661	43836661	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836661G>A	uc002xni.2	+	2	780	c.723G>A	c.(721-723)GCG>GCA	p.A241A	SEMG1_uc002xnj.2_Silent_p.A241A|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Silent_p.A241A	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	241	42 AA repeat 2.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZNF217	7764	broad.mit.edu	37	20	52192732	52192732	+	Silent	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52192732G>A	uc002xwq.3	-	3	2842	c.2571C>T	c.(2569-2571)CCC>CCT	p.P857P	ZNF217_uc010gij.1_Silent_p.P849P	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	857					negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)															---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58443634	58443634	+	Intron	SNP	G	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58443634G>C	uc002yaz.2	-							NM_014258	NP_055073			synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10941947	10941947	+	Silent	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10941947T>C	uc002yip.1	-	14	1124	c.756A>G	c.(754-756)CCA>CCG	p.P252P	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.P234P|TPTE_uc002yir.1_Silent_p.P214P|TPTE_uc010gkv.1_Silent_p.P114P	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	252	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
KRTAP13-1	140258	broad.mit.edu	37	21	31768846	31768846	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768846C>T	uc002yoa.2	+	1	455	c.442C>T	c.(442-444)CGC>TGC	p.R148C		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	148						intermediate filament				ovary(1)	1																		---	---	---	---
SON	6651	broad.mit.edu	37	21	34924449	34924449	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34924449G>A	uc002yse.1	+	3	2961	c.2912G>A	c.(2911-2913)AGG>AAG	p.R971K	SON_uc002ysb.1_Missense_Mutation_p.R971K|SON_uc002ysc.2_Missense_Mutation_p.R971K|SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	971	11 X 7 AA tandem repeats of [DR]-P-Y-R- [LI][AG][QHP].				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6																		---	---	---	---
ZNF295	49854	broad.mit.edu	37	21	43413582	43413582	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43413582C>A	uc002zab.3	-	3	837	c.623G>T	c.(622-624)TGG>TTG	p.W208L	ZNF295_uc002yzz.3_Missense_Mutation_p.W208L|ZNF295_uc002yzy.3_Missense_Mutation_p.W208L|ZNF295_uc002zaa.3_Missense_Mutation_p.W208L|ZNF295_uc010gov.1_Missense_Mutation_p.W208L|ZNF295_uc002zac.2_Missense_Mutation_p.W208L	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	208					negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
PRMT2	3275	broad.mit.edu	37	21	48081793	48081793	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48081793C>T	uc002zjx.2	+	10	1356	c.1042C>T	c.(1042-1044)CAG>TAG	p.Q348*	PRMT2_uc002zjy.2_Nonsense_Mutation_p.Q348*|PRMT2_uc010gqm.2_Nonsense_Mutation_p.Q246*|PRMT2_uc011aga.1_Intron|PRMT2_uc011agb.1_Intron|PRMT2_uc011agc.1_Intron|PRMT2_uc002zjz.1_3'UTR	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1	348					developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)														---	---	---	---
PVALB	5816	broad.mit.edu	37	22	37209779	37209779	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37209779G>T	uc010gwz.2	-	3	245	c.215C>A	c.(214-216)TCC>TAC	p.S72Y	PVALB_uc003apx.2_Missense_Mutation_p.S72Y	NM_002854	NP_002845	P20472	PRVA_HUMAN	parvalbumin	72	EF-hand 1.						calcium ion binding			skin(1)	1																		---	---	---	---
CSF2RB	1439	broad.mit.edu	37	22	37331471	37331471	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37331471T>C	uc003aqa.3	+	11	1611	c.1394T>C	c.(1393-1395)ATC>ACC	p.I465T	CSF2RB_uc003aqc.3_Missense_Mutation_p.I471T	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	465	Cytoplasmic (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)													---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67940949	67940949	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67940949C>A	uc004dxa.2	+	8	2365	c.1993C>A	c.(1993-1995)CTC>ATC	p.L665I	STARD8_uc004dxb.2_Missense_Mutation_p.L745I|STARD8_uc004dxc.3_Missense_Mutation_p.L665I	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	665	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
DLG3	1741	broad.mit.edu	37	X	69719090	69719090	+	Silent	SNP	C	A	A			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69719090C>A	uc004dyi.1	+	15	2263	c.1935C>A	c.(1933-1935)ATC>ATA	p.I645I	DLG3_uc004dyj.1_Silent_p.I340I|DLG3_uc011mpn.1_Silent_p.I193I	NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a	645	Guanylate kinase-like.				axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)																	---	---	---	---
ATP11C	286410	broad.mit.edu	37	X	138864763	138864763	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-5727-01	TCGA-CG-5727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138864763A>G	uc004faz.2	-	18	2003	c.1904T>C	c.(1903-1905)GTT>GCT	p.V635A	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.V635A	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	635	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
