Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16972067	16972067	+	5'Flank	SNP	C	T	T	rs1360574	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16972067C>T	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|uc001azj.1_5'Flank|MST1P2_uc009vow.2_5'Flank|MST1P2_uc010ocg.1_5'Flank|MST1P2_uc010och.1_5'Flank|MST1P2_uc010oci.1_5'Flank|MST1P2_uc001azk.2_5'Flank|MST1P2_uc001azl.3_5'Flank|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GGACAGGTTTCACAACTTCCC	0.632													3	10	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16972068	16972068	+	5'Flank	SNP	A	G	G	rs1360575	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16972068A>G	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|uc001azj.1_5'Flank|MST1P2_uc009vow.2_5'Flank|MST1P2_uc010ocg.1_5'Flank|MST1P2_uc010och.1_5'Flank|MST1P2_uc010oci.1_5'Flank|MST1P2_uc001azk.2_5'Flank|MST1P2_uc001azl.3_5'Flank|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GACAGGTTTCACAACTTCCCG	0.627													3	11	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085699	17085699	+	Intron	SNP	T	C	C	rs3863804		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085699T>C	uc010ock.1	-						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						GGCCGAGACCTCGCCCCGGCC	0.711													3	25	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038884	75038884	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038884C>A	uc001dgg.2	-	14	2729	c.2510G>T	c.(2509-2511)AGG>ATG	p.R837M		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	837	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTCTGCCCCCCTTTCTATGCC	0.562													21	227	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107961230	107961230	+	Intron	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107961230G>A	uc001dvh.3	+						NTNG1_uc001dvf.3_Silent_p.P372P|NTNG1_uc010out.1_Silent_p.P372P|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvi.2_Intron|NTNG1_uc001dve.2_RNA|NTNG1_uc009wek.2_RNA|NTNG1_uc001dvg.2_RNA|NTNG1_uc009wem.2_Intron	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GGATATGGCCGAATATTTCTT	0.368													16	26	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111969101	111969101	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111969101T>C	uc001eba.2	-	3	274	c.218A>G	c.(217-219)GAT>GGT	p.D73G	OVGP1_uc001eaz.2_Missense_Mutation_p.D13G|OVGP1_uc010owb.1_5'UTR|OVGP1_uc010owc.1_Missense_Mutation_p.D63G	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	73					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		AATTTTCTCATCCTGGAGATC	0.428													11	201	---	---	---	---	PASS
AP4B1	10717	broad.mit.edu	37	1	114442814	114442814	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114442814G>A	uc001eeb.2	-	5	969	c.826C>T	c.(826-828)CGG>TGG	p.R276W	uc001edv.1_RNA|AP4B1_uc001eec.2_Missense_Mutation_p.R108W|AP4B1_uc001eed.2_Missense_Mutation_p.R276W|AP4B1_uc010owp.1_Missense_Mutation_p.R177W|AP4B1_uc001eea.1_Missense_Mutation_p.R70W|AP4B1_uc010owq.1_Missense_Mutation_p.R183W	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1	276					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCTTGACCCGCACAAGGACA	0.483													5	128	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144856817	144856817	+	Missense_Mutation	SNP	T	C	C	rs3844239	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144856817T>C	uc001elw.3	-	40	6959	c.6668A>G	c.(6667-6669)GAG>GGG	p.E2223G	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.E2117G|PDE4DIP_uc001elv.3_Missense_Mutation_p.E1230G	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2223					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGTGATTACCTCTGTGCCTTG	0.478			T	PDGFRB	MPD								3	41	---	---	---	---	PASS
LCE2D	353141	broad.mit.edu	37	1	152636733	152636733	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152636733G>T	uc001fag.2	+	2	207	c.152G>T	c.(151-153)AGC>ATC	p.S51I		NM_178430	NP_848517	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	51	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGGTCCCAGCTCTGGGAGC	0.647													109	191	---	---	---	---	PASS
AIM2	9447	broad.mit.edu	37	1	159033301	159033301	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159033301G>A	uc001ftj.1	-	5	1225	c.980C>T	c.(979-981)ACA>ATA	p.T327I		NM_004833	NP_004824	O14862	AIM2_HUMAN	absent in melanoma 2	327	HIN-200.				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus				ovary(2)|pancreas(1)	3	all_hematologic(112;0.0429)					AACTCCAGATGTCAGCTGTAG	0.423													91	348	---	---	---	---	PASS
CR1L	1379	broad.mit.edu	37	1	207870862	207870862	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207870862C>A	uc001hga.3	+	6	998	c.877C>A	c.(877-879)CCA>ACA	p.P293T	CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	293	Sushi 5.					cytoplasm|extracellular region|membrane					0						TCAGCCACCTCCAGATGTCCT	0.478													110	249	---	---	---	---	PASS
CD46	4179	broad.mit.edu	37	1	207932991	207932991	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207932991T>G	uc001hgc.2	+	4	553	c.397T>G	c.(397-399)TTA>GTA	p.L133V	CD46_uc001hgd.2_Missense_Mutation_p.L133V|CD46_uc001hge.2_Missense_Mutation_p.L133V|CD46_uc001hgf.2_Missense_Mutation_p.L133V|CD46_uc001hgg.2_Missense_Mutation_p.L133V|CD46_uc001hgh.2_Missense_Mutation_p.L133V|CD46_uc001hgi.2_Missense_Mutation_p.L133V|CD46_uc001hgj.2_Missense_Mutation_p.L133V|CD46_uc001hgk.2_Missense_Mutation_p.L133V|CD46_uc001hgl.2_Missense_Mutation_p.L133V|CD46_uc001hgm.2_Missense_Mutation_p.L133V|CD46_uc001hgn.2_Missense_Mutation_p.L133V|CD46_uc001hgo.2_Missense_Mutation_p.L133V|CD46_uc001hgp.2_Missense_Mutation_p.L133V	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	133	Extracellular (Potential).|Sushi 2.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						TAGTTATTACTTAATTGGTGA	0.279													23	45	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236760202	236760202	+	Silent	SNP	C	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236760202C>G	uc001hyd.1	-	6	803	c.678G>C	c.(676-678)TCG>TCC	p.S226S		NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	226					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTACCAGCGCCGACACTATGG	0.448													3	116	---	---	---	---	PASS
TFB2M	64216	broad.mit.edu	37	1	246729167	246729167	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246729167G>C	uc001ibn.2	-	1	399	c.274C>G	c.(274-276)CCA>GCA	p.P92A	CNST_uc001ibo.3_5'Flank|CNST_uc001ibp.2_5'Flank|TFB2M_uc010pys.1_RNA	NM_022366	NP_071761	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	92					positive regulation of transcription, DNA-dependent|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity|transcription cofactor activity			ovary(1)	1	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			GGTCTACTTGGTTTTCCCAAA	0.473													3	137	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004290	248004290	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004290C>A	uc001idn.1	-	1	909	c.909G>T	c.(907-909)AAG>AAT	p.K303N		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTCTCATGACCTTTCTAACAG	0.378													49	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	95539132	95539132	+	Splice_Site	SNP	A	G	G	rs74376788	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95539132A>G	uc002stv.1	-	9		c.1317_splice	c.e9+1		TEKT4_uc002stw.1_Intron|TEKT4_uc010fhr.1_RNA					Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																		AGCAGAACTTACACAGTCAGA	0.567													3	18	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125367413	125367413	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125367413C>A	uc002tno.2	+	12	2153	c.1789C>A	c.(1789-1791)CAG>AAG	p.Q597K	CNTNAP5_uc010flu.2_Missense_Mutation_p.Q598K	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	597	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTACAGGCACCAGGGGAATAC	0.527													4	162	---	---	---	---	PASS
LOC440905	440905	broad.mit.edu	37	2	130786002	130786002	+	RNA	SNP	G	A	A	rs34238944		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130786002G>A	uc002tpz.2	-	11		c.2866C>T			LOC440905_uc002tpy.1_RNA	NR_026758				Homo sapiens cDNA FLJ43933 fis, clone TESTI4013685.												0						ATATGGCCTCGTCAAAGCTCT	0.468													3	23	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38592323	38592323	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592323C>T	uc003cio.2	-	28	5734	c.5540G>A	c.(5539-5541)CGC>CAC	p.R1847H	SCN5A_uc003cin.2_Missense_Mutation_p.R1846H|SCN5A_uc003cil.3_Missense_Mutation_p.R1847H|SCN5A_uc010hhi.2_Missense_Mutation_p.R1829H|SCN5A_uc010hhk.2_Missense_Mutation_p.R1814H|SCN5A_uc011ayr.1_Missense_Mutation_p.R1793H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1847					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCAATGGATGCGGTCCCCACT	0.557													4	140	---	---	---	---	PASS
PLCXD2	257068	broad.mit.edu	37	3	111564793	111564793	+	3'UTR	SNP	T	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111564793T>C	uc003dya.2	+	5					PLCXD2_uc003dxz.2_3'UTR|PHLDB2_uc003dyc.2_Intron	NM_001134478	NP_001127950	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(1)	1						GTGAGAACTTTATTGTCAGAG	0.428													32	60	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515854	195515854	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515854G>A	uc011bto.1	-	2	3057	c.2597C>T	c.(2596-2598)TCG>TTG	p.S866L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.S748L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	871	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGACGATCGAAGACGCCAT	0.592													4	54	---	---	---	---	PASS
CRIPAK	285464	broad.mit.edu	37	4	1389372	1389372	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1389372A>T	uc003gdf.2	+	1	4033	c.1073A>T	c.(1072-1074)CAT>CTT	p.H358L		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	358				H -> Y (in Ref. 1; BAC03741).	ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			ACACGTGCCCATGTGGAGTGC	0.652													6	174	---	---	---	---	PASS
CYTL1	54360	broad.mit.edu	37	4	5016888	5016888	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5016888C>T	uc003gig.2	-	4	426	c.401G>A	c.(400-402)CGT>CAT	p.R134H		NM_018659	NP_061129	Q9NRR1	CYTL1_HUMAN	cytokine-like 1 precursor	134					signal transduction	extracellular space|soluble fraction	receptor binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TTAGCGCTGACGATCTGGCAG	0.493													37	66	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73186511	73186511	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73186511C>G	uc003hgk.1	-	7	1059	c.1022G>C	c.(1021-1023)AGA>ACA	p.R341T		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	341	Peptidase M12B.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGATCAGATCTTTGCTGTTG	0.443													10	227	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126373735	126373735	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126373735C>T	uc003ifj.3	+	9	11564	c.11564C>T	c.(11563-11565)GCG>GTG	p.A3855V	FAT4_uc011cgp.1_Missense_Mutation_p.A2153V|FAT4_uc003ifi.1_Missense_Mutation_p.A1333V	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3855	Extracellular (Potential).|EGF-like 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CCAGGATATGCGGGTAGCTGG	0.473													3	73	---	---	---	---	PASS
RBM46	166863	broad.mit.edu	37	4	155748928	155748928	+	Intron	SNP	A	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155748928A>T	uc003ioo.2	+						RBM46_uc011cim.1_3'UTR|RBM46_uc003iop.1_3'UTR	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46								nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2	all_hematologic(180;0.24)	Renal(120;0.0854)				ACATTATGTTAAAATGTGATT	0.289													4	75	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80408654	80408654	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80408654G>T	uc003kha.1	+	14	2064	c.2064G>T	c.(2062-2064)AGG>AGT	p.R688S	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	688	N-terminal Ras-GEF.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TATACAAGAGGCCTTTCACCT	0.493													9	191	---	---	---	---	PASS
C6orf218	221718	broad.mit.edu	37	6	10430010	10430010	+	RNA	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430010G>A	uc003myz.2	-	3		c.1026C>T				NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				GTAGAGGCTAGAACTGGAATT	0.368											OREG0017184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	20	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25845505	25845505	+	3'UTR	SNP	T	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25845505T>C	uc003nfi.3	-	12					SLC17A3_uc003nfk.3_3'UTR	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						GCCTAATGACTTTTCCATCCA	0.338													3	69	---	---	---	---	PASS
EFHC1	114327	broad.mit.edu	37	6	52285247	52285247	+	Silent	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52285247G>A	uc003pap.3	+	1	254	c.39G>A	c.(37-39)CCG>CCA	p.P13P	EFHC1_uc011dwv.1_5'UTR|EFHC1_uc011dww.1_5'Flank	NM_018100	NP_060570	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	13						axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)					CCTTTCTTCCGGGCACGTCCT	0.622													3	72	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	63989841	63989841	+	3'UTR	SNP	A	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63989841A>T	uc003peh.2	-	4					LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase						glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TGCTGTTGTTAATTACAAAAG	0.303													4	97	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76604978	76604978	+	Splice_Site	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76604978G>A	uc003pih.1	+	29	3416	c.3137_splice	c.e29+1	p.P1046_splice	MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron|MYO6_uc003pij.1_Splice_Site_p.P3_splice	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAATGACACCGTATGTCACTT	0.289													42	91	---	---	---	---	PASS
SMPDL3A	10924	broad.mit.edu	37	6	123127429	123127429	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123127429G>A	uc003pzg.2	+	7	1492	c.971G>A	c.(970-972)AGT>AAT	p.S324N	SMPDL3A_uc003pzh.2_Missense_Mutation_p.S193N	NM_006714	NP_006705	Q92484	ASM3A_HUMAN	acid sphingomyelinase-like phosphodiesterase 3A	324					sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity				0				GBM - Glioblastoma multiforme(226;0.236)		CCAGTGAAGAGTGTTTTAGAA	0.358													14	124	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152831401	152831401	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152831401G>A	uc010kiw.2	-	8	1110	c.508C>T	c.(508-510)CGG>TGG	p.R170W	SYNE1_uc003qot.3_Missense_Mutation_p.R177W|SYNE1_uc003qou.3_Missense_Mutation_p.R170W|SYNE1_uc010kjb.1_Missense_Mutation_p.R170W|SYNE1_uc003qpa.1_Missense_Mutation_p.R170W	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	170	Actin-binding.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCACCTTCCGTTTACTTGGT	0.483										HNSCC(10;0.0054)			6	306	---	---	---	---	PASS
EZR	7430	broad.mit.edu	37	6	159191838	159191838	+	Silent	SNP	G	T	T	rs141741749		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159191838G>T	uc003qrt.3	-	9	1263	c.1048C>A	c.(1048-1050)CGG>AGG	p.R350R	EZR_uc011efr.1_5'Flank|EZR_uc011efs.1_Silent_p.R318R|EZR_uc003qru.3_Silent_p.R350R	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	350	Interaction with SCYL3.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TCCTGCAGCCGCAGCATCAAC	0.547													4	208	---	---	---	---	PASS
INMT	11185	broad.mit.edu	37	7	30793464	30793464	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30793464G>A	uc003tbs.1	+	2	288	c.272G>A	c.(271-273)CGG>CAG	p.R91Q	FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Missense_Mutation_p.R90Q	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	91						cytoplasm	amine N-methyltransferase activity				0						GACCGCAACCGGGAGGAGCTG	0.557													6	407	---	---	---	---	PASS
MEPCE	56257	broad.mit.edu	37	7	100028387	100028387	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100028387A>C	uc003uuw.2	+	1	859	c.746A>C	c.(745-747)CAT>CCT	p.H249P	ZCWPW1_uc003uut.2_5'Flank|ZCWPW1_uc011kjr.1_5'Flank|ZCWPW1_uc003uuu.1_5'Flank|ZCWPW1_uc011kjt.1_5'Flank|ZCWPW1_uc011kju.1_5'Flank|MEPCE_uc003uuv.2_5'UTR	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN	bin3, bicoid-interacting 3	249							methyltransferase activity			upper_aerodigestive_tract(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GATGAGGGCCATGTAGTTCTT	0.582													18	291	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100681317	100681317	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100681317G>A	uc003uxp.1	+	3	6673	c.6620G>A	c.(6619-6621)GGT>GAT	p.G2207D	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2207	Extracellular (Potential).|35.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTTCTGAAGGTACCAGCATG	0.502													88	358	---	---	---	---	PASS
VGF	7425	broad.mit.edu	37	7	100807590	100807590	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100807590C>G	uc003uxx.3	-	2	753	c.535G>C	c.(535-537)GAG>CAG	p.E179Q		NM_003378	NP_003369	O15240	VGF_HUMAN	VGF nerve growth factor inducible precursor	179					response to cAMP	extracellular space|transport vesicle	growth factor activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					GCCGCCGTCTCCTGCTGGCGC	0.672													3	80	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74464238	74464238	+	Intron	SNP	A	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74464238A>T	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_3'UTR|STAU2_uc003xzp.2_3'UTR|STAU2_uc011lfi.1_3'UTR|STAU2_uc003xzq.2_3'UTR|STAU2_uc010lzk.2_3'UTR	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TTTTGCTTTTAATTCATACCT	0.378													5	137	---	---	---	---	PASS
KLF10	7071	broad.mit.edu	37	8	103664291	103664291	+	Splice_Site	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103664291T>A	uc011lhk.1	-	3	425	c.271_splice	c.e3-1	p.C91_splice	KLF10_uc011lhj.1_Splice_Site_p.C80_splice	NM_005655	NP_005646	Q13118	KLF10_HUMAN	Kruppel-like factor 10 isoform a						cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			AGTCAAACACTAAAGAAAAGG	0.328											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	74	---	---	---	---	PASS
ZHX1	11244	broad.mit.edu	37	8	124265827	124265827	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124265827T>C	uc003yqe.2	-	3	2790	c.2360A>G	c.(2359-2361)GAT>GGT	p.D787G	C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.D787G|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.D787G	NM_007222	NP_009153	Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	787	Homeobox 5.				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CAGGTAATAATCCTTAAGTAT	0.423													6	565	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79981645	79981645	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79981645A>T	uc004akr.2	+	61	8588	c.8328A>T	c.(8326-8328)TTA>TTT	p.L2776F	VPS13A_uc004akp.3_Missense_Mutation_p.L2776F|VPS13A_uc004akq.3_Missense_Mutation_p.L2776F|VPS13A_uc004aks.2_Missense_Mutation_p.L2737F	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	2776					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CTTTTTAGTTACATTTAAGTG	0.269													4	79	---	---	---	---	PASS
LOC100133308	100133308	broad.mit.edu	37	10	45652235	45652235	+	5'Flank	SNP	C	G	G	rs149362183		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45652235C>G	uc009xmq.1	-						uc001jca.3_RNA|uc001jcb.1_RNA|uc009xmr.1_RNA	NR_024472				Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						GAAGGAACATCTGAAGGAACA	0.338													3	25	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85985269	85985269	+	Missense_Mutation	SNP	G	A	A	rs79267836		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85985269G>A	uc001kcy.2	-	1	16	c.8C>T	c.(7-9)TCA>TTA	p.S3L	LRIT2_uc010qmc.1_Missense_Mutation_p.S3L	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	3						integral to membrane				ovary(2)	2						ATGAAAAACTGAAGCCATATT	0.428													7	26	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89720826	89720826	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89720826A>G	uc001kfb.2	+	9	2008	c.977A>G	c.(976-978)GAC>GGC	p.D326G		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	326	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.D326G(1)|p.G165_K342del(1)|p.D326fs*4(1)|p.W274_F341del(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AATGATCTTGACAAAGCAAAT	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			7	161	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26734248	26734248	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26734248T>A	uc001mra.2	-	2	658	c.345A>T	c.(343-345)TTA>TTT	p.L115F	SLC5A12_uc001mrb.2_RNA|SLC5A12_uc001mrc.3_Missense_Mutation_p.L115F	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	115	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						ATCGTAGTTGTAAGTACTAAA	0.428													8	453	---	---	---	---	PASS
FBXO3	26273	broad.mit.edu	37	11	33792428	33792428	+	Intron	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33792428T>A	uc001muz.2	-						FBXO3_uc001muy.2_5'UTR|FBXO3_uc009ykb.2_Intron|FBXO3_uc001mva.1_Intron|FBXO3_uc001mvb.1_Intron|FBXO3_uc010rek.1_Intron	NM_012175	NP_036307	Q9UK99	FBX3_HUMAN	F-box only protein 3 isoform 1						proteolysis	nucleus	ubiquitin-protein ligase activity			pancreas(1)	1		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		GAAAACAATTTAAAAATAAAG	0.294													5	125	---	---	---	---	PASS
OR4C45	403257	broad.mit.edu	37	11	48367363	48367363	+	Silent	SNP	C	T	T	rs73453183		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48367363C>T	uc010rhw.1	-	4	456	c.456G>A	c.(454-456)GGG>GGA	p.G152G		NM_001005513	NP_001005513			olfactory receptor, family 4, subfamily C,												0						AAGTCTGGATCCCTCCATGCA	0.502													4	8	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595427	55595427	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595427C>A	uc001nhy.1	+	1	733	c.733C>A	c.(733-735)CTC>ATC	p.L245I		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TGCCTCCCACCTCACAGCCAT	0.498										HNSCC(27;0.073)			5	179	---	---	---	---	PASS
UBC	7316	broad.mit.edu	37	12	125398090	125398090	+	Silent	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125398090C>T	uc001ugs.3	-	2	676	c.228G>A	c.(226-228)GGG>GGA	p.G76G	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.G76G|UBC_uc001ugt.2_Silent_p.G76G|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Intron	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	76	Ubiquitin-like 1.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		AGATTTGCATCCCACCTCTGA	0.532													8	346	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20006639	20006639	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20006639T>A	uc001umd.2	-	17	1407	c.1196A>T	c.(1195-1197)AAA>ATA	p.K399I	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.K288I|TPTE2_uc001ume.2_Missense_Mutation_p.K322I|TPTE2_uc009zzm.2_Missense_Mutation_p.K70I|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Missense_Mutation_p.K70I	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	399	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AATGAATCTTTTTATAAAGAG	0.383													5	127	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25376711	25376711	+	Splice_Site	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25376711T>A	uc001upr.2	+	14	1990	c.1949_splice	c.e14+2	p.K650_splice	RNF17_uc010tdd.1_Splice_Site_p.K509_splice|RNF17_uc010aab.2_Splice_Site|RNF17_uc010tde.1_Splice_Site_p.K650_splice|RNF17_uc001ups.2_Splice_Site_p.K589_splice	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ACTAGCAAAGTAAGTAACTTA	0.323													5	183	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44976299	44976299	+	5'UTR	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44976299T>A	uc001wvn.2	-	1						NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein							cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TCAAACTTATTAATTTTCAAG	0.363													4	92	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170202	20170202	+	IGR	SNP	T	C	C	rs148436068	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170202T>C								None (None upstream) : GOLGA6L6 (566892 downstream)																							CCAGACTGCATCAGCTGTACC	0.557													3	117	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40284368	40284368	+	Intron	SNP	A	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40284368A>G	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Translation_Start_Site	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GCTTACTTATATTTTTAGGCT	0.338													5	145	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101938639	101938639	+	Silent	SNP	A	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101938639A>C	uc002bwy.2	-	8	1280	c.966T>G	c.(964-966)GCT>GCG	p.A322A	PCSK6_uc010bpd.2_Silent_p.A192A|PCSK6_uc010bpe.2_Silent_p.A322A|PCSK6_uc002bxa.2_Silent_p.A322A|PCSK6_uc002bxb.2_Silent_p.A322A|PCSK6_uc002bxc.1_Silent_p.A322A|PCSK6_uc002bxd.1_Silent_p.A322A|PCSK6_uc002bxe.2_Silent_p.A322A|PCSK6_uc002bxg.1_Silent_p.A322A	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	322	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAGCCTGCTTAGCCAGTCGGC	0.552													7	171	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102304770	102304770	+	5'Flank	SNP	C	T	T	rs62026988	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102304770C>T	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccf.3_RNA|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		GGCACAGCGGCGTGACGAGAC	0.592													5	20	---	---	---	---	PASS
TPSB2	64499	broad.mit.edu	37	16	1278478	1278478	+	3'UTR	SNP	T	C	C	rs11548897	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1278478T>C	uc002cky.2	-	7					TPSB2_uc010brk.1_Intron|TPSB2_uc002ckx.2_3'UTR	NM_024164	NP_077078	P20231	TRYB2_HUMAN	tryptase beta 2 precursor						proteolysis	extracellular region	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				GGAAGGGTCCTCAGGACAGGG	0.697													3	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	15023280	15023280	+	Splice_Site	SNP	T	C	C			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15023280T>C	uc010uzk.1	+	6	1123	c.847_splice	c.e6+2	p.G283_splice	NPIP_uc002dcx.3_Splice_Site					SubName: Full=cDNA FLJ57488, highly similar to Polycystin-1;																		CGCTGGCGGGTGAGGAGATCG	0.701													3	13	---	---	---	---	PASS
RUNDC2C	440352	broad.mit.edu	37	16	29376056	29376056	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29376056T>A	uc002dsj.1	+	5	795	c.398T>A	c.(397-399)ATC>AAC	p.I133N	uc010vct.1_Intron|RUNDC2C_uc010bys.1_RNA|RUNDC2C_uc010vdo.1_Missense_Mutation_p.I114N	NM_001012391	NP_001012391			RecName: Full=RUN domain-containing protein 2A;												0						ACCAACATTATCTCATTTGAT	0.393													4	121	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61935093	61935093	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61935093C>A	uc002eog.1	-	3	789	c.537G>T	c.(535-537)ATG>ATT	p.M179I		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	179	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CCAAAATGGACATTTCTGGCA	0.383													5	193	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5042422	5042422	+	Intron	SNP	G	A	A	rs4080179	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5042422G>A	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Missense_Mutation_p.V25I|uc002gbd.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CAGGCGTGTCGTCAGTGTCAG	0.657			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								14	33	---	---	---	---	PASS
POLDIP2	26073	broad.mit.edu	37	17	26680002	26680002	+	Silent	SNP	G	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680002G>A	uc002haz.2	-	9	690	c.558C>T	c.(556-558)TCC>TCT	p.S186S	POLDIP2_uc010wag.1_RNA	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	186						mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CCTGATCAGTGGAGGTGTAGG	0.488													17	41	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358													4	118	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7174736	7174736	+	Silent	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7174736C>A	uc002mgd.1	-	4	1090	c.981G>T	c.(979-981)CTG>CTT	p.L327L	INSR_uc002mge.1_Silent_p.L327L|INSR_uc002mgf.2_Silent_p.L327L	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	327	Cys-rich.				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ATGGGGTGCACAGCAAGCTAA	0.587													3	37	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7670197	7670197	+	Silent	SNP	G	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7670197G>T	uc002mgv.3	+	2	335	c.234G>T	c.(232-234)CTG>CTT	p.L78L	KIAA1543_uc002mgu.3_Silent_p.L78L	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	78					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CACGGCTGCTGCTCTCAGCCG	0.667													10	102	---	---	---	---	PASS
SPC24	147841	broad.mit.edu	37	19	11258496	11258496	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11258496C>A	uc002mql.2	-	4	517	c.485G>T	c.(484-486)GGC>GTC	p.G162V		NM_182513	NP_872319	Q8NBT2	SPC24_HUMAN	spindle pole body component 24 homolog	162	Interaction with the C-terminus of SPBC25.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding				0						AAGGATACTGCCTTTGACCAT	0.264													3	37	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41116397	41116397	+	Intron	SNP	G	A	A	rs1318544	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41116397G>A	uc002ooh.1	+						LTBP4_uc002oog.1_Intron|LTBP4_uc002ooi.1_Intron|LTBP4_uc002ooj.1_Intron|LTBP4_uc010xvo.1_5'UTR|LTBP4_uc010ehb.1_5'Flank|LTBP4_uc002ook.1_5'Flank	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding						growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTCTCCCGGGGCTGTCTGCCC	0.706													6	6	---	---	---	---	PASS
GLTSCR1	29998	broad.mit.edu	37	19	48202015	48202015	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48202015C>T	uc002phh.3	+	12	3567	c.3373C>T	c.(3373-3375)CCC>TCC	p.P1125S	GLTSCR1_uc002phi.3_Missense_Mutation_p.P883S	NM_015711	NP_056526	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1125							protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GGGCGCCCTCCCCTCCCCCAG	0.682											OREG0025594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	9	---	---	---	---	PASS
KIR2DL4	3805	broad.mit.edu	37	19	55324635	55324635	+	Silent	SNP	T	C	C	rs649216	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55324635T>C	uc010yfm.1	+	6	802	c.762T>C	c.(760-762)TTT>TTC	p.F254F	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Silent_p.F249F|KIR2DL4_uc002qhg.2_Intron|KIR2DL4_uc002qhi.2_Silent_p.F237F|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Intron|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Intron|KIR2DL4_uc010ese.2_RNA	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	254	Helical; (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		TCATCCTCTTTACCATCCTTC	0.502													3	112	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17639555	17639555	+	5'UTR	SNP	C	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17639555C>G	uc002wpu.2	-	1					RRBP1_uc002wpv.1_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron	NM_004587	NP_004578	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						TTGGTTGGGACTCCTTTCTGC	0.522													4	156	---	---	---	---	PASS
XKR7	343702	broad.mit.edu	37	20	30584459	30584459	+	Silent	SNP	C	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30584459C>T	uc002wxe.2	+	3	1113	c.939C>T	c.(937-939)CGC>CGT	p.R313R		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	313						integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTGCCGCCCGCGGCCTGGCCT	0.637													26	57	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30904102	30904102	+	Nonsense_Mutation	SNP	C	T	T	rs149015672		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30904102C>T	uc002wxq.2	+	3	1653	c.1486C>T	c.(1486-1488)CGA>TGA	p.R496*	KIF3B_uc010ztw.1_Nonsense_Mutation_p.R434*	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	496	Potential.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGAGCAGAAACGACAGGAAAT	0.408													63	128	---	---	---	---	PASS
TMPRSS2	7113	broad.mit.edu	37	21	42852443	42852443	+	Missense_Mutation	SNP	C	T	T	rs139092674		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42852443C>T	uc002yzj.2	-	6	666	c.532G>A	c.(532-534)GAG>AAG	p.E178K	TMPRSS2_uc010gor.2_Missense_Mutation_p.E215K|TMPRSS2_uc010gos.1_Missense_Mutation_p.E178K	NM_005656	NP_005647	O15393	TMPS2_HUMAN	transmembrane protease, serine 2 isoform 2	178	Extracellular (Potential).|SRCR.				proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				CCGTAGTTCTCGTTCCAGTCG	0.572			T	ERG|ETV1|ETV4|ETV5	prostate 								40	68	---	---	---	---	PASS
RFPL1	5988	broad.mit.edu	37	22	29837827	29837827	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29837827A>G	uc003afn.2	+	2	879	c.670A>G	c.(670-672)AGC>GGC	p.S224G	RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306	O75677	RFPL1_HUMAN	ret finger protein-like 1	224	B30.2/SPRY.						zinc ion binding				0						GAGGGATGGAAGCCGCCTCTC	0.542													7	124	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38120343	38120343	+	Missense_Mutation	SNP	A	G	G	rs71317067		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38120343A>G	uc003atr.2	+	7	2051	c.1780A>G	c.(1780-1782)ACA>GCA	p.T594A	TRIOBP_uc003atu.2_Missense_Mutation_p.T422A|TRIOBP_uc003atq.1_Missense_Mutation_p.T594A|TRIOBP_uc003ats.1_Missense_Mutation_p.T422A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	594					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CAATAGAGCTACACGAGACAA	0.572													4	166	---	---	---	---	PASS
OFD1	8481	broad.mit.edu	37	X	13778461	13778461	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13778461G>T	uc004cvp.3	+	16	2241	c.1882G>T	c.(1882-1884)GTA>TTA	p.V628L	OFD1_uc004cvr.3_Missense_Mutation_p.V195L|OFD1_uc011mil.1_Missense_Mutation_p.V195L|OFD1_uc004cvq.3_Missense_Mutation_p.V488L|OFD1_uc010nen.2_Missense_Mutation_p.V627L|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.V587L|OFD1_uc004cvv.3_Missense_Mutation_p.V587L	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	628	Potential.|Mediates the interaction with SDCCAG8.|Mediates homooligomerization.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						CCTTGAGTTTGTAGCCAATAC	0.453													7	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	25301653	25301654	+	IGR	INS	-	GGAA	GGAA	rs7547501	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25301653_25301654insGGAA								RUNX3 (10041 upstream) : SYF2 (247113 downstream)																							tagaAGCAGATggaaggaagga	0.015													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145209324	145209332	+	5'UTR	DEL	GGCGGCGGC	-	-	rs72083240	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209324_145209332delGGCGGCGGC	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATCTGCCCAggcggcggcggcggcggcg	0.589													5	4	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220355434	220355434	+	Intron	DEL	T	-	-	rs11343960		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220355434delT	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ATAATATTACTTCTATTAAAT	0.139													4	4	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2162475	2162476	+	Intron	INS	-	AC	AC	rs143788533	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2162475_2162476insAC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		aacattcaagtacacacacaca	0.173													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43446787	43446788	+	IGR	DEL	AC	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43446787_43446788delAC								HAAO (427036 upstream) : ZFP36L2 (2754 downstream)																							aacacacacaacacacacacac	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66955302	66955309	+	IGR	DEL	TGTGTGTG	-	-	rs141332560		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66955302_66955309delTGTGTGTG								MEIS1 (155412 upstream) : ETAA1 (669133 downstream)																							CCCTAATCATtgtgtgtgtgtgtgtgtg	0.202													4	2	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100633275	100633289	+	Intron	DEL	TGATGGTGGTGGTGG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100633275_100633289delTGATGGTGGTGGTGG	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						gcagtgatgctgatggtggtggtggtgatggtggt	0.009													4	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141298313	141298314	+	Intron	INS	-	C	C	rs148238992	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141298313_141298314insC	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTAGTGCACAACAGGAGGGTAA	0.396										TSP Lung(27;0.18)			5	6	---	---	---	---	
CDCA7	83879	broad.mit.edu	37	2	174232025	174232025	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174232025delT	uc002uid.1	+						CDCA7_uc002uic.1_Intron|CDCA7_uc010zej.1_Intron|CDCA7_uc010zek.1_Intron	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2						regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			GTAGTGGGTGTTTTTTTTTCC	0.323													239	7	---	---	---	---	
DNAJC10	54431	broad.mit.edu	37	2	183621404	183621404	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183621404delT	uc002uow.1	+						DNAJC10_uc002uox.1_Intron|DNAJC10_uc002uoy.1_Intron|DNAJC10_uc002uoz.1_Intron|DNAJC10_uc010fro.1_Intron	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10						apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTGGTACACTTTTTTTTTTT	0.244													4	2	---	---	---	---	
PASK	23178	broad.mit.edu	37	2	242063236	242063236	+	Intron	DEL	A	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242063236delA	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_Intron|PASK_uc002waq.2_Intron	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		tccgtcccagaaaaaaaaaaa	0.204													4	2	---	---	---	---	
HDLBP	3069	broad.mit.edu	37	2	242176393	242176396	+	Intron	DEL	GGGG	-	-	rs72214250	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242176393_242176396delGGGG	uc002waz.2	-						HDLBP_uc002wba.2_Intron|HDLBP_uc002wbb.2_Intron	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCCAGACCTTgggggggggggggg	0.201													4	2	---	---	---	---	
C3orf35	339883	broad.mit.edu	37	3	37459334	37459335	+	Intron	INS	-	AC	AC	rs60085343		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37459334_37459335insAC	uc003cha.3	+						C3orf35_uc003chb.2_3'UTR	NM_178339	NP_848029	Q8IVJ8	APRG1_HUMAN	AP20 region protein isoform B							integral to membrane				central_nervous_system(1)	1						GACATACCGATacacacacaca	0.198													4	2	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37547430	37547431	+	Intron	INS	-	T	T	rs79449442		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37547430_37547431insT	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TCTGATGGATGTTTTTTTTTCC	0.480													4	2	---	---	---	---	
NAA50	80218	broad.mit.edu	37	3	113459588	113459588	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113459588delT	uc003ean.1	-						NAA50_uc010hqm.1_5'Flank|NAA50_uc011bij.1_Intron	NM_025146	NP_079422	Q9GZZ1	NAA50_HUMAN	N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0						ACATTTTTTCTTTTTTTTTTT	0.239													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168807995	168807995	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168807995delT	uc003ffi.3	-	14	2899	c.2630delA	c.(2629-2631)AAGfs	p.K877fs	MECOM_uc010hwk.1_Frame_Shift_Del_p.K891fs|MECOM_uc003ffj.3_Frame_Shift_Del_p.K942fs|MECOM_uc011bpi.1_Frame_Shift_Del_p.K869fs|MECOM_uc003ffn.3_Frame_Shift_Del_p.K877fs|MECOM_uc003ffk.2_Frame_Shift_Del_p.K868fs|MECOM_uc003ffl.2_Frame_Shift_Del_p.K1028fs|MECOM_uc011bpj.1_Frame_Shift_Del_p.K1065fs|MECOM_uc011bpk.1_Frame_Shift_Del_p.K867fs	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	877					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CACCAAAGCCTTTTCATCTTT	0.318													286	38	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184561140	184561141	+	Intron	INS	-	A	A	rs144501206	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184561140_184561141insA	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGCTTATTGAAAAAAACCCA	0.168													3	3	---	---	---	---	
CLRN2	645104	broad.mit.edu	37	4	17524836	17524836	+	Intron	DEL	C	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17524836delC	uc003gpg.1	+							NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2							integral to membrane					0						ttttctttttctttttttttt	0.214													4	2	---	---	---	---	
FAM190A	401145	broad.mit.edu	37	4	91121213	91121214	+	Intron	DEL	AC	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91121213_91121214delAC	uc003hsv.3	+						FAM190A_uc003hsu.3_Intron|FAM190A_uc010ikv.2_Intron	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						GTGcacgcagacacacacacac	0.272													4	2	---	---	---	---	
GLRB	2743	broad.mit.edu	37	4	158060274	158060274	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158060274delT	uc003ipj.2	+							NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	TTCACTAGAGTTTTTTGAACT	0.264													3	4	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64629824	64629825	+	Intron	INS	-	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64629824_64629825insA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTACCTTTATTaaaaaaaaaaa	0.257													63	7	---	---	---	---	
CHD1	1105	broad.mit.edu	37	5	98208031	98208032	+	Intron	INS	-	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98208031_98208032insT	uc003knf.2	-						CHD1_uc010jbn.2_5'UTR	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TTTTTTCAAAACTAGCCAATAA	0.252													67	7	---	---	---	---	
ADAMTS19	171019	broad.mit.edu	37	5	128844720	128844721	+	Intron	INS	-	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128844720_128844721insT	uc003kvb.1	+						ADAMTS19_uc003kvc.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ATCTAAAAGTATTTTTTCAAAT	0.312													31	13	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168173703	168173703	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168173703delT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			gtggtgtgggtgtggtggtgt	0.000													4	2	---	---	---	---	
CPLX2	10814	broad.mit.edu	37	5	175287502	175287523	+	Intron	DEL	AAAGAAAGAAAGAAAGAAAAAG	-	-	rs59334477		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175287502_175287523delAAAGAAAGAAAGAAAGAAAAAG	uc003mde.1	+							NM_006650	NP_006641	Q6PUV4	CPLX2_HUMAN	complexin 2						mast cell degranulation|positive regulation of synaptic plasticity|vesicle docking involved in exocytosis	cytosol				ovary(1)	1	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			gaaagaaagaaaagaaagaaagaaagaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8323271	8323278	+	IGR	DEL	TTTCCTTT	-	-	rs70982168	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323271_8323278delTTTCCTTT								EEF1E1 (220443 upstream) : SLC35B3 (88455 downstream)																							tccttccttctttcctttcttccttcct	0.000													8	5	---	---	---	---	
C6orf182	285753	broad.mit.edu	37	6	109476463	109476466	+	Frame_Shift_Del	DEL	AAGG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109476463_109476466delAAGG	uc010kdk.2	+	8	1187_1190	c.610_613delAAGG	c.(610-615)AAGGAAfs	p.K204fs	C6orf182_uc003psv.3_Frame_Shift_Del_p.K188fs|C6orf182_uc003psw.3_Frame_Shift_Del_p.K204fs|C6orf182_uc003psx.3_Frame_Shift_Del_p.K204fs|C6orf182_uc010kdl.2_Frame_Shift_Del_p.K204fs|C6orf182_uc003psy.3_Frame_Shift_Del_p.K204fs	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN	hypothetical protein LOC285753	204_205	Potential.					microtubule|microtubule organizing center					0		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)		AGAAAAACTTAAGGAAGAAGAACA	0.275													134	33	---	---	---	---	
THEMIS	387357	broad.mit.edu	37	6	128031312	128031312	+	Intron	DEL	A	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128031312delA	uc003qbi.2	-						THEMIS_uc010kfa.2_Intron|THEMIS_uc011ebt.1_Intron|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform						negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						CAAAATAAAGAAAAAAAAAAA	0.323													5	4	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158502669	158502669	+	Intron	DEL	T	-	-	rs56991071		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502669delT	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		tttttttttctctgagacaaa	0.179													7	4	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5963823	5963824	+	Intron	INS	-	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5963823_5963824insA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		TCTACAATTCTAAAAAAAAAAA	0.223													4	2	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99779525	99779525	+	Intron	DEL	A	-	-	rs35532527		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99779525delA	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actccgtctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3216949	3216949	+	Intron	DEL	A	-	-	rs34858861		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3216949delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTATTACTAAAAAAAAAAA	0.308													10	5	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17871605	17871605	+	Intron	DEL	A	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17871605delA	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		CTTTAAAGCTAAAAAAAAAAA	0.284			T	RET|JAK2	papillary thyroid|CML|MPD								9	4	---	---	---	---	
ZNF704	619279	broad.mit.edu	37	8	81553805	81553805	+	Intron	DEL	A	-	-	rs78833157	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81553805delA	uc003yby.1	-							NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GTGAGGGAGGAAAAAAAAAAA	0.239													6	3	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													4	4	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317126	126317126	+	Intron	DEL	A	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317126delA	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			ccagactctgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134129130	134129131	+	Intron	INS	-	A	A	rs35664939		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134129130_134129131insA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		cggggaaagttaaaaaaaaaaa	0.054													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67917596	67917598	+	IGR	DEL	GAG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67917596_67917598delGAG								FAM27B (123407 upstream) : None (None downstream)																							CATGGAAGATGAGGAGTCCGTTG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68420686	68420686	+	IGR	DEL	C	-	-	rs151320630		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68420686delC								FAM27B (626497 upstream) : MIR1299 (581553 downstream)																							ACATTTCTAACATTGCTGGAC	0.363													6	3	---	---	---	---	
C9orf3	84909	broad.mit.edu	37	9	97584252	97584253	+	Intron	INS	-	AC	AC	rs10536993		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97584252_97584253insAC	uc004ava.2	+						C9orf3_uc004aux.1_Intron|C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGTGTGTGTAAacacacacaca	0.322													3	3	---	---	---	---	
BAT2L1	84726	broad.mit.edu	37	9	134305441	134305441	+	5'Flank	DEL	C	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134305441delC	uc004can.3	+						BAT2L1_uc004cam.1_Intron	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like								protein binding				0						ttttttttttctctctctttt	0.378													4	2	---	---	---	---	
ACBD7	414149	broad.mit.edu	37	10	15060006	15060009	+	Intron	DEL	AAAC	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15060006_15060009delAAAC	uc010qby.1	-									Q8N6N7	ACBD7_HUMAN	SubName: Full=cDNA FLJ52263, highly similar to Artemis protein (EC 3.1.-.-);								fatty-acyl-CoA binding				0						ccgtttcacaaaacaaacaaacaa	0.225													154	7	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29751492	29751495	+	Intron	DEL	TGTT	-	-	rs144445879		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29751492_29751495delTGTT	uc001iut.1	-						LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTATATAAGATGTTTGTTAGTTTC	0.368													4	3	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93719496	93719511	+	Intron	DEL	TGTATATATATATATA	-	-	rs67566711		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93719496_93719511delTGTATATATATATATA	uc001khr.2	+						BTAF1_uc009xua.1_Intron|BTAF1_uc001khs.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				tgtgtgtgtgtgtatatatatatatatatatatata	0.250													4	2	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104134959	104134960	+	Intron	INS	-	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104134959_104134960insA	uc001kux.1	+						GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		atttctatttgaaaaaaaaaaa	0.208													5	3	---	---	---	---	
SLK	9748	broad.mit.edu	37	10	105781987	105781990	+	Intron	DEL	AAGG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105781987_105781990delAAGG	uc001kxo.1	+						SLK_uc001kxp.1_Intron	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2						apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ggaggaagaaaaggaaggaaggaa	0.069													4	2	---	---	---	---	
RNH1	6050	broad.mit.edu	37	11	494682	494683	+	3'UTR	DEL	GG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:494682_494683delGG	uc001lpk.1	-	9					RNH1_uc001lpl.1_3'UTR|RNH1_uc001lpm.1_3'UTR|RNH1_uc001lpn.1_3'UTR|RNH1_uc001lpo.1_3'UTR|RNH1_uc009ybw.1_RNA|RNH1_uc001lpp.1_3'UTR|RNH1_uc001lpt.1_3'UTR|RNH1_uc001lpq.1_3'UTR|RNH1_uc001lpr.1_3'UTR|RNH1_uc001lps.1_3'UTR	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor						mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGCAGCAGCAGGAAGAGCCTCA	0.609													176	35	---	---	---	---	
IPO7	10527	broad.mit.edu	37	11	9430250	9430251	+	Intron	DEL	GG	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9430250_9430251delGG	uc001mho.2	+							NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7						interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		tttgttttttggtttttttttt	0.163													162	7	---	---	---	---	
MTCH2	23788	broad.mit.edu	37	11	47648879	47648879	+	Intron	DEL	T	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47648879delT	uc010rho.1	-						MTCH2_uc001nge.2_Intron|MTCH2_uc010rhp.1_Intron	NM_014342	NP_055157	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2						transport	integral to membrane|mitochondrial inner membrane					0						AAATGGTGTCttttttttttt	0.119													4	2	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63472093	63472093	+	Intron	DEL	A	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63472093delA	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						ATGTTTGACTAAAAAAAAAAA	0.323													2	4	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134086630	134086631	+	Intron	INS	-	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134086630_134086631insA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AACTTCGGATGAAAAAAAAAAG	0.441													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253705	48253706	+	Intron	DEL	TT	-	-	rs67136609		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253705_48253706delTT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tccttctttctttttctttctt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22646862	22646862	+	IGR	DEL	C	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22646862delC								MIR1268 (133582 upstream) : GOLGA8DP (55423 downstream)																							CCCAAGTGAGCAggctggggc	0.463													12	7	---	---	---	---	
WDR76	79968	broad.mit.edu	37	15	44158821	44158821	+	3'UTR	DEL	T	-	-	rs33935797		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44158821delT	uc001zti.1	+	13						NM_024908	NP_079184	Q9H967	WDR76_HUMAN	WD repeat domain 76												0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		CCGTCAGGACttttttttttt	0.259													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15102452	15102453	+	Intron	INS	-	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15102452_15102453insT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GAAATTCACCCTTTTTTTTTTT	0.277													7	4	---	---	---	---	
VWA3A	146177	broad.mit.edu	37	16	22149613	22149614	+	Intron	DEL	TG	-	-	rs66986818		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22149613_22149614delTG	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc010bxc.2_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		TCCCTCCTGCtgtgtgtgtgtg	0.505													4	2	---	---	---	---	
SRCAP	10847	broad.mit.edu	37	16	30741093	30741094	+	Intron	INS	-	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30741093_30741094insT	uc002dze.1	+						SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Intron	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein						interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			TGACtttcttctttttttttat	0.045													6	3	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31383487	31383487	+	Intron	DEL	G	-	-	rs67981265		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31383487delG	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						cgggaggtctgggggggggga	0.144													4	2	---	---	---	---	
HERPUD1	9709	broad.mit.edu	37	16	56974235	56974236	+	Intron	INS	-	T	T			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56974235_56974236insT	uc002eke.1	+						HERPUD1_uc002ekf.1_Intron|HERPUD1_uc002ekg.1_Intron|HERPUD1_uc010cco.1_Intron|HERPUD1_uc010ccp.1_Intron|HERPUD1_uc002ekh.1_Intron	NM_014685	NP_055500	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum							endoplasmic reticulum membrane|integral to membrane	protein binding				0						tttgtttcttgttttttttgag	0.163			T	ERG	prostate								32	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6097571	6097573	+	IGR	DEL	GGA	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6097571_6097573delGGA								WSCD1 (69826 upstream) : AIPL1 (229487 downstream)																							tggtggtgatggaggtggtggtg	0.000													4	2	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	37248431	37248454	+	Intron	DEL	AGGGAGGAAGGAAGGAAGGAAGGA	-	-	rs11270312	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37248431_37248454delAGGGAGGAAGGAAGGAAGGAAGGA	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						ggagggagggagggaggaaggaaggaaggaaggaaggaaggaag	0.098													4	4	---	---	---	---	
FSD1	79187	broad.mit.edu	37	19	4311682	4311683	+	Intron	INS	-	A	A			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4311682_4311683insA	uc002lzy.2	+						FSD1_uc002lzz.2_Intron|FSD1_uc002maa.2_5'UTR	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing						cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgtctctaaaaaaaaaaa	0.262													4	2	---	---	---	---	
GIPR	2696	broad.mit.edu	37	19	46177122	46177122	+	Intron	DEL	A	-	-	rs35790297		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46177122delA	uc002pcu.1	+						GIPR_uc002pct.1_Intron|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_Intron|MIR642_hsa-mir-642|MI0003657_5'Flank	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		accatgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
VRK3	51231	broad.mit.edu	37	19	50511057	50511058	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50511057_50511058insG	uc002prg.2	-	5	413_414	c.315_316insC	c.(313-318)CCCAAAfs	p.P105fs	VRK3_uc002prh.1_Frame_Shift_Ins_p.P105fs|VRK3_uc002pri.1_Frame_Shift_Ins_p.P55fs|VRK3_uc010ens.2_Frame_Shift_Ins_p.P105fs|VRK3_uc010ybl.1_Frame_Shift_Ins_p.P55fs|VRK3_uc010ybm.1_5'UTR|VRK3_uc002prj.1_Frame_Shift_Ins_p.P55fs|VRK3_uc002prk.1_Frame_Shift_Ins_p.P105fs|VRK3_uc010ent.1_5'UTR|VRK3_uc002prl.2_Frame_Shift_Ins_p.P105fs|VRK3_uc010ybn.1_Frame_Shift_Ins_p.P105fs	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1	105_106						nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GGGCTGCTTTTGGGGGTTGGGG	0.564													251	7	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074492	62074494	+	Intron	DEL	CAC	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074492_62074494delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccatcatcaccaccaccatc	0.000													3	3	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39774633	39774635	+	Intron	DEL	ACA	-	-	rs11702504		TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39774633_39774635delACA	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gny.1_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				TACCTTTCTTACaaaaaaaaaaa	0.310													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755913	44755914	+	IGR	INS	-	CAC	CAC	rs150119883	by1000genomes	TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755913_44755914insCAC								CRYAA (163000 upstream) : SIK1 (78484 downstream)																							atcaccaccatcaccatcacca	0.000													7	4	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31985765	31985768	+	Intron	DEL	TTTA	-	-			TCGA-CH-5740-01	TCGA-CH-5740-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31985765_31985768delTTTA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TTTGTCCATCTTTATTTATTTATT	0.333													5	3	---	---	---	---	
