Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892587	16892587	+	Intron	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892587T>C	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CACTCTGAGTTAGTGCCCTCG	0.373													5	74	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959698	16959698	+	Intron	SNP	G	A	A	rs9730434	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959698G>A	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						GGTCCTTCTCGTGGAGCACCT	0.657													8	18	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24676595	24676595	+	Nonsense_Mutation	SNP	C	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24676595C>G	uc001biy.2	+	15	1738	c.1692C>G	c.(1690-1692)TAC>TAG	p.Y564*	GRHL3_uc001bix.2_Nonsense_Mutation_p.Y559*|GRHL3_uc001biz.2_Nonsense_Mutation_p.Y466*	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	559					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		ACAAAGTCTACAAGAAATGCA	0.498													3	51	---	---	---	---	PASS
RUNX3	864	broad.mit.edu	37	1	25229113	25229113	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25229113G>A	uc001bjq.2	-	5	1159	c.748C>T	c.(748-750)CGC>TGC	p.R250C	RUNX3_uc010oen.1_Missense_Mutation_p.R197C|RUNX3_uc009vrj.2_Missense_Mutation_p.R264C|RUNX3_uc001bjr.2_Missense_Mutation_p.R264C|RUNX3_uc001bjs.2_RNA	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	250	Pro/Ser/Thr-rich.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGGAAGGAGCGGTCAAACTGG	0.637													5	202	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52827241	52827241	+	Missense_Mutation	SNP	G	A	A	rs149044360		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52827241G>A	uc001ctq.1	-	4	400	c.262C>T	c.(262-264)CGG>TGG	p.R88W	CC2D1B_uc001cts.2_5'Flank	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	88										ovary(2)	2						tccACATCCCGCATACAGTCT	0.473													4	93	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803746	142803746	+	Intron	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803746A>G	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		actatggattagagctgatta	0.000													3	26	---	---	---	---	PASS
ARNT	405	broad.mit.edu	37	1	150801579	150801579	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150801579T>G	uc001evr.1	-	12	1300	c.1157A>C	c.(1156-1158)TAC>TCC	p.Y386S	ARNT_uc001evs.1_Missense_Mutation_p.Y371S|ARNT_uc009wmb.1_Missense_Mutation_p.Y372S|ARNT_uc009wmc.1_Missense_Mutation_p.Y386S|ARNT_uc009wmd.1_Missense_Mutation_p.Y371S|ARNT_uc009wme.1_Missense_Mutation_p.Y386S|ARNT_uc010pcl.1_Missense_Mutation_p.Y370S	NM_001668	NP_001659	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	386	PAS 2.				positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity			skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGTGGCTGGTAGCCAACAGT	0.453			T	ETV6	AML								9	29	---	---	---	---	PASS
MIR555	693140	broad.mit.edu	37	1	155316142	155316142	+	RNA	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155316142T>C	hsa-mir-555|MI0003561	-			c.95T>C			RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Intron|ASH1L_uc009wqq.2_Intron																	0						CTCCTACTTATAGATCAGAGT	0.378													6	179	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156849827	156849827	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156849827C>T	uc001fqh.1	+	16	2139	c.2083C>T	c.(2083-2085)CCG>TCG	p.P695S	NTRK1_uc001fqf.1_Missense_Mutation_p.P659S|NTRK1_uc009wsi.1_Missense_Mutation_p.P394S|NTRK1_uc001fqi.1_Missense_Mutation_p.P689S|NTRK1_uc009wsk.1_Missense_Mutation_p.P692S	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	695	Cytoplasmic (Potential).|Protein kinase.		P -> L (in CIPA).		activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	TCGCTGGATGCCGCCCGAGAG	0.647			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			4	96	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157667368	157667368	+	Intron	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157667368G>T	uc001frb.2	-						FCRL3_uc001fqx.3_Intron|FCRL3_uc001fqy.3_Intron|FCRL3_uc001fqz.3_Intron|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_Intron|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Intron	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					GACTCTTTATGAAATTCCCAC	0.448													37	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	179557504	179557504	+	5'Flank	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179557504G>T	uc001gmt.2	-						uc010pnm.1_5'Flank|uc001gmu.2_5'Flank|uc001gmv.2_5'Flank|uc001gmw.2_5'Flank|uc001gmx.2_5'Flank|uc001gmz.1_RNA					DQ571986																		ATCCTGGCCAGCCTGCAGTCG	0.582													28	28	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201061108	201061108	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201061108C>A	uc001gvv.2	-	4	760	c.533G>T	c.(532-534)GGG>GTG	p.G178V		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	178	Helical; Name=S4 of repeat I; (Potential).|I.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	ACTAGGCACCCCCGACACCAG	0.612													3	69	---	---	---	---	PASS
EML4	27436	broad.mit.edu	37	2	42513409	42513409	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42513409C>T	uc002rsi.2	+	10	1274	c.1012C>T	c.(1012-1014)CCT>TCT	p.P338S	EML4_uc010fap.2_Missense_Mutation_p.P280S|EML4_uc002rsj.2_Missense_Mutation_p.P27S	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	338	WD 1.				microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						GTTTTTGCAGCCTCTACAACC	0.443			T	ALK	NSCLC								73	116	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													3	11	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179659235	179659235	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179659235A>T	uc010zfg.1	-	8	1513	c.1289T>A	c.(1288-1290)GTT>GAT	p.V430D	TTN_uc010zfh.1_Missense_Mutation_p.V430D|TTN_uc010zfi.1_Missense_Mutation_p.V430D|TTN_uc010zfj.1_Missense_Mutation_p.V430D|TTN_uc002unb.2_Missense_Mutation_p.V430D|TTN_uc010frg.1_Missense_Mutation_p.V104D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	430							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACGGCAGCAACAACAGTCGC	0.458													9	151	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189856917	189856917	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189856917G>A	uc002uqj.1	+	14	1076	c.959G>A	c.(958-960)CGG>CAG	p.R320Q	COL3A1_uc010frw.1_RNA	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	320	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TAGGGTGCTCGGGGTAATGAC	0.378													30	190	---	---	---	---	PASS
PPARG	5468	broad.mit.edu	37	3	12475528	12475528	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12475528A>G	uc003bwx.2	+	7	1493	c.1402A>G	c.(1402-1404)ACA>GCA	p.T468A	PPARG_uc003bwr.2_Missense_Mutation_p.T440A|PPARG_uc003bws.2_Missense_Mutation_p.T440A|PPARG_uc003bwu.2_Missense_Mutation_p.T440A|PPARG_uc003bwv.2_3'UTR	NM_015869	NP_056953	P37231	PPARG_HUMAN	peroxisome proliferative activated receptor	468	Ligand-binding.				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)	CCAGAAAATGACAGACCTCAG	0.522			T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						3	101	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39230128	39230128	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39230128C>T	uc003cjk.1	-	2	1030	c.809G>A	c.(808-810)CGC>CAC	p.R270H	XIRP1_uc003cji.2_Missense_Mutation_p.R270H|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	270	Xin 6.						actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AAAGAGCCAGCGGGCAGACCT	0.677													42	73	---	---	---	---	PASS
KCNIP4	80333	broad.mit.edu	37	4	20751288	20751288	+	Silent	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20751288G>A	uc003gqe.2	-	4	459	c.375C>T	c.(373-375)TTC>TTT	p.F125F	KCNIP4_uc003gqf.1_Silent_p.F121F|KCNIP4_uc003gqg.1_Silent_p.F80F|KCNIP4_uc003gqh.1_Silent_p.F117F|KCNIP4_uc003gqi.1_Silent_p.F80F|PACRGL_uc003gpu.2_Intron|PACRGL_uc003gpx.3_Intron|PACRGL_uc003gpw.2_Intron|KCNIP4_uc010iel.2_Silent_p.F122F|KCNIP4_uc003gqd.3_Silent_p.F105F	NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3	142	EF-hand 2.|1 (Potential).					plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				AGCTTACCTCGAAACTCACAG	0.358													22	85	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190883030	190883030	+	Missense_Mutation	SNP	G	T	T	rs112946446		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190883030G>T	uc003izs.2	+	8	874	c.683G>T	c.(682-684)AGT>ATT	p.S228I		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	228					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AAAGAAGACAGTAAAATTCTT	0.318													14	323	---	---	---	---	PASS
NDUFS6	4726	broad.mit.edu	37	5	1816163	1816163	+	3'UTR	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1816163C>A	uc003jcy.2	+	4						NM_004553	NP_004544	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6,						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1					NADH(DB00157)	TCAAGGCTGACAATTTGTAAG	0.517													3	27	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35991394	35991394	+	5'UTR	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35991394C>T	uc003jjv.1	-	1					UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_5'UTR|UGT3A1_uc011cor.1_5'UTR|UGT3A1_uc003jjy.1_Intron	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGCCCTGCGCCGGGCTAAGGA	0.617													4	47	---	---	---	---	PASS
HOMER1	9456	broad.mit.edu	37	5	78697840	78697840	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78697840G>T	uc003kfy.2	-	6	1669	c.566C>A	c.(565-567)ACC>AAC	p.T189N	HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Missense_Mutation_p.T15N	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1	189	Potential.				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		TCCTTTGAGGGTAGCCAGTTC	0.428													10	162	---	---	---	---	PASS
ATG12	9140	broad.mit.edu	37	5	115177236	115177236	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115177236G>A	uc003krh.2	-	1	264	c.155C>T	c.(154-156)CCG>CTG	p.P52L	AP3S1_uc003krl.2_5'Flank|AP3S1_uc003krk.2_5'Flank|AP3S1_uc003krm.2_5'Flank|ATG12_uc003kri.2_Missense_Mutation_p.P52L|ATG12_uc003krj.2_RNA	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like	5					autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		CACAGACTGCGGCTCCTCCGC	0.607													81	92	---	---	---	---	PASS
PCDHA5	56143	broad.mit.edu	37	5	140202486	140202486	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140202486C>T	uc003lhl.2	+	1	1126	c.1126C>T	c.(1126-1128)CGT>TGT	p.R376C	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.R376C|PCDHA5_uc003lhj.1_Missense_Mutation_p.R376C	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	376	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGTCTGACCGTGACTCAGG	0.542													14	186	---	---	---	---	PASS
TBC1D9B	23061	broad.mit.edu	37	5	179290365	179290365	+	3'UTR	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179290365A>G	uc003mlh.2	-	22					TBC1D9B_uc003mli.2_3'UTR|TBC1D9B_uc003mlj.2_3'UTR|TBC1D9B_uc003mlf.2_3'UTR|TBC1D9B_uc003mlg.2_3'UTR|TBC1D9B_uc011dgv.1_3'UTR	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)							integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTTAAAGAGAAACTGATAAG	0.582													2	21	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43111336	43111336	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43111336G>T	uc003oub.1	+	14	2427	c.2229G>T	c.(2227-2229)GAG>GAT	p.E743D	PTK7_uc003ouc.1_Missense_Mutation_p.E687D|PTK7_uc003oud.1_Missense_Mutation_p.E703D|PTK7_uc003oue.1_Missense_Mutation_p.E613D|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Missense_Mutation_p.E751D|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	743	Cytoplasmic (Potential).				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGGGCGAGGAGCCAGAGATGG	0.677											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	34	---	---	---	---	PASS
SUN1	23353	broad.mit.edu	37	7	888226	888226	+	Intron	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:888226A>G	uc011jvp.1	+						SUN1_uc003sje.1_Missense_Mutation_p.Y277C|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Missense_Mutation_p.Y88C|SUN1_uc011jvr.1_Missense_Mutation_p.Y25C|SUN1_uc003sji.2_5'Flank	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						TCCGAAAGCTATAAGTCAAAA	0.328													65	154	---	---	---	---	PASS
DLX5	1749	broad.mit.edu	37	7	96653697	96653697	+	Missense_Mutation	SNP	A	T	T	rs149635296	byFrequency	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96653697A>T	uc003uon.2	-	1	447	c.239T>A	c.(238-240)GTG>GAG	p.V80E	DLX5_uc011kim.1_Missense_Mutation_p.V80E	NM_005221	NP_005212	P56178	DLX5_HUMAN	distal-less homeobox 5	80					cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GGAGCCGTTCACGCCGTGATA	0.612													22	58	---	---	---	---	PASS
RGS20	8601	broad.mit.edu	37	8	54791832	54791832	+	Silent	SNP	A	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54791832A>T	uc003xrp.2	+	2	272	c.180A>T	c.(178-180)GCA>GCT	p.A60A	RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrr.2_5'Flank|RGS20_uc003xrs.2_5'Flank|RGS20_uc003xrt.2_5'Flank	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	60					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TCCCGCCTGCACAGCTCCCAG	0.597													88	166	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70498706	70498706	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70498706A>G	uc010lza.1	+	7	1244	c.527A>G	c.(526-528)AAT>AGT	p.N176S	SULF1_uc003xyd.2_Missense_Mutation_p.N176S|SULF1_uc003xye.2_Missense_Mutation_p.N176S|SULF1_uc003xyf.2_Missense_Mutation_p.N176S|SULF1_uc003xyg.2_Missense_Mutation_p.N176S	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	176					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GTTTGTCGCAATGGCATCAAA	0.388													16	293	---	---	---	---	PASS
RBM12B	389677	broad.mit.edu	37	8	94746488	94746488	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94746488C>G	uc003yfz.2	-	3	2344	c.2151G>C	c.(2149-2151)CAG>CAC	p.Q717H		NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	717							nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CCTGGGGTGACTGCCTGAAGT	0.627													145	235	---	---	---	---	PASS
ANXA13	312	broad.mit.edu	37	8	124705463	124705463	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124705463G>A	uc003yqu.2	-	8	689	c.616C>T	c.(616-618)CGA>TGA	p.R206*	ANXA13_uc003yqt.2_Nonsense_Mutation_p.R247*	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a	206	Annexin 3.				cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			AAGGTGGCTCGTAACTGCTTG	0.448													9	404	---	---	---	---	PASS
CYC1	1537	broad.mit.edu	37	8	145150822	145150822	+	Silent	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145150822G>A	uc003zaz.3	+	2	259	c.216G>A	c.(214-216)GCG>GCA	p.A72A	CYC1_uc003zay.2_Silent_p.A13A	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	72					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGGGGTGCGGGGCTGGCCA	0.652											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	67	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5968943	5968943	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5968943G>T	uc003zjq.3	-	3	1504	c.1288C>A	c.(1288-1290)CTT>ATT	p.L430I		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	430										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGACCCTTAAGTAGCCACACT	0.383													5	32	---	---	---	---	PASS
NDUFB6	4712	broad.mit.edu	37	9	32573158	32573158	+	5'UTR	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32573158G>T	uc003zre.1	-	1					NDUFB6_uc003zrf.1_5'UTR	NM_002493	NP_002484	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)	NADH(DB00157)	TTGCGGGAACGCCGAGCGCCG	0.612													4	6	---	---	---	---	PASS
ATP8B5P	158381	broad.mit.edu	37	9	35450217	35450217	+	RNA	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35450217C>T	uc010mkn.1	+	10		c.3067C>T			ATP8B5P_uc010mko.2_RNA|ATP8B5P_uc010mkp.2_RNA|ATP8B5P_uc003zwu.2_Intron					Homo sapiens cDNA, FLJ17320.												0						GGTTTGAATGCGGTGTAGAAA	0.373													3	63	---	---	---	---	PASS
RNF183	138065	broad.mit.edu	37	9	116059733	116059733	+	3'UTR	SNP	A	T	T	rs3750535	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116059733A>T	uc004bgz.2	-	2					RNF183_uc004bha.2_3'UTR	NM_145051	NP_659488	Q96D59	RN183_HUMAN	ring finger protein 183							integral to membrane	zinc ion binding				0						GTTTTTTTTTAAAATTGTTCC	0.443													4	3	---	---	---	---	PASS
HSPA12A	259217	broad.mit.edu	37	10	118441315	118441315	+	Silent	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118441315G>T	uc001lct.2	-	8	1014	c.909C>A	c.(907-909)TCC>TCA	p.S303S	HSPA12A_uc001lcu.2_Silent_p.S220S	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	303							ATP binding			ovary(1)	1				all cancers(201;0.0158)		CCTCCAGCTCGGACCAGATTT	0.478											OREG0020558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	73	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5905957	5905957	+	Silent	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5905957C>T	uc010qzs.1	+	1	435	c.435C>T	c.(433-435)ATC>ATT	p.I145I	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATCAGTATCCTAGCTTCTG	0.453													6	256	---	---	---	---	PASS
DNAJC4	3338	broad.mit.edu	37	11	64000258	64000258	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64000258C>A	uc001nys.2	+	5	910	c.448C>A	c.(448-450)CAC>AAC	p.H150N	uc001nyr.1_5'Flank|DNAJC4_uc001nyt.2_Missense_Mutation_p.H151N|DNAJC4_uc001nyu.2_Missense_Mutation_p.H150N|VEGFB_uc001nyw.2_5'Flank|VEGFB_uc001nyx.2_5'Flank	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	150					protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding				0						GCAGCAGCAACACAAACAAAA	0.607													3	107	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88781128	88781128	+	Translation_Start_Site	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88781128G>A	uc001pcq.2	-	1	113	c.-87C>T	c.(-89--85)AACGT>AATGT		GRM5_uc009yvm.2_Translation_Start_Site|GRM5_uc009yvn.1_Translation_Start_Site	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GATGTCCTACGTTGAGTCGCA	0.408													14	21	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99690380	99690380	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99690380A>C	uc001pga.2	+	4	500	c.161A>C	c.(160-162)TAC>TCC	p.Y54S	CNTN5_uc009ywv.1_Missense_Mutation_p.Y54S|CNTN5_uc001pfz.2_Missense_Mutation_p.Y54S|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	54					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGACCACGATACAGCAGCCCT	0.428													5	188	---	---	---	---	PASS
C11orf70	85016	broad.mit.edu	37	11	101946634	101946634	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101946634G>T	uc001pgp.2	+	5	494	c.466G>T	c.(466-468)GAA>TAA	p.E156*	C11orf70_uc001pgo.2_Nonstop_Mutation_p.*100L|C11orf70_uc001pgq.2_Nonsense_Mutation_p.E118*	NM_032930	NP_116319	Q9BRQ4	CK070_HUMAN	hypothetical protein LOC85016	156										skin(1)	1	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		AGAAAAATATGAAATATTCAG	0.343													17	191	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	123988076	123988076	+	Intron	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123988076T>C	uc001pzu.2	+						VWA5A_uc001pzr.2_Intron|VWA5A_uc001pzs.2_Intron|VWA5A_uc010sae.1_5'UTR|VWA5A_uc001pzt.2_Intron	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1											upper_aerodigestive_tract(1)|ovary(1)	2						TTTTAAAGGTTCCAACTTCCT	0.388													4	19	---	---	---	---	PASS
MIP	4284	broad.mit.edu	37	12	56848144	56848144	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56848144C>T	uc001slh.2	-	1	286	c.254G>A	c.(253-255)CGT>CAT	p.R85H		NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	85	Helical; (By similarity).				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						GCAGAAGGCACGGAGCAGGGA	0.597													34	46	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66725033	66725033	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725033T>C	uc001sti.2	+	12	2798	c.2770T>C	c.(2770-2772)TAT>CAT	p.Y924H	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	924					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		CTGCCGAGTGTATGTGATTGC	0.532													43	99	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20000609	20000609	+	Missense_Mutation	SNP	C	T	T	rs141691551	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20000609C>T	uc001umd.2	-	19	1562	c.1351G>A	c.(1351-1353)GGT>AGT	p.G451S	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Missense_Mutation_p.G340S|TPTE2_uc001ume.2_Missense_Mutation_p.G374S|TPTE2_uc009zzm.2_Missense_Mutation_p.G122S|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Missense_Mutation_p.G122S	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	451	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGAGGTGGACCGTCATATACA	0.338													7	206	---	---	---	---	PASS
C14orf101	54916	broad.mit.edu	37	14	57114085	57114085	+	Missense_Mutation	SNP	C	T	T	rs147042249		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57114085C>T	uc001xcm.2	+	16	2116	c.1994C>T	c.(1993-1995)TCG>TTG	p.S665L	C14orf101_uc001xcj.2_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_Missense_Mutation_p.S198L|C14orf101_uc001xco.2_Missense_Mutation_p.S198L	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916	665						integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		GTGCTGTTATCGGAAACCATC	0.478													10	126	---	---	---	---	PASS
SMEK1	55671	broad.mit.edu	37	14	91924967	91924967	+	3'UTR	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91924967C>A	uc001xzn.2	-	15					SMEK1_uc001xzm.2_3'UTR|SMEK1_uc001xzo.2_3'UTR|SMEK1_uc010atz.2_3'UTR	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		ACTTGATGAGCAGAAGTCAAG	0.473													8	74	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102474613	102474613	+	Silent	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102474613C>A	uc001yks.2	+	29	6080	c.5916C>A	c.(5914-5916)TCC>TCA	p.S1972S		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1972	AAA 1 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CGGCTGTGTCCCAGCAGGTGC	0.537													38	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	28948349	28948349	+	5'Flank	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28948349T>C	uc001zcd.2	+											DQ593033																		CCACTGGCTCTCAGAAGGGGT	0.567													2	7	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79051880	79051880	+	Silent	SNP	C	T	T	rs1045121	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79051880C>T	uc002bej.3	-	24	5155	c.4944G>A	c.(4942-4944)ACG>ACA	p.T1648T		NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1648	PLAC.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GTAGGCGCAGCGTCTCGCAGA	0.697													4	16	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2503242	2503242	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2503242C>A	uc002cqd.1	+	14	1607	c.1519C>A	c.(1519-1521)CAA>AAA	p.Q507K	CCNF_uc002cqe.1_Missense_Mutation_p.Q199K	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	507					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				GGACTACAGGCAAGTCTCTCT	0.572													6	99	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15122751	15122751	+	Silent	SNP	C	T	T	rs117411702	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15122751C>T	uc002dda.3	+	15	1445	c.1221C>T	c.(1219-1221)GCC>GCT	p.A407A	PDXDC1_uc010uzl.1_Silent_p.A392A|PDXDC1_uc010uzm.1_Silent_p.A316A|PDXDC1_uc002dcz.2_Silent_p.A384A|PDXDC1_uc002ddb.3_Silent_p.A380A|PDXDC1_uc010uzn.1_Silent_p.A379A|PDXDC1_uc002ddc.2_Silent_p.A407A	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	407					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding	p.A407A(1)		skin(1)	1					Pyridoxal Phosphate(DB00114)	TGTTTAAAGCCGTCCCAGTGC	0.552													3	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	18441762	18441762	+	Silent	SNP	A	G	G	rs149995059		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18441762A>G	uc010bvw.2	-	7	1139	c.483T>C	c.(481-483)CCT>CCC	p.P161P						SubName: Full=cDNA FLJ59085, highly similar to Polycystin-1;																		CCTGGGGACCAGGGTGGCCGG	0.706													5	5	---	---	---	---	PASS
TIMM22	29928	broad.mit.edu	37	17	900589	900589	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:900589C>A	uc002fsc.2	+	1	233	c.207C>A	c.(205-207)TGC>TGA	p.C69*		NM_013337	NP_037469	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22	69					transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGGAAAGCTGCGCTTTCAAGG	0.662													3	47	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5418327	5418327	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5418327A>G	uc002gci.2	-	17	4724	c.4169T>C	c.(4168-4170)ATA>ACA	p.I1390T	NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Missense_Mutation_p.I1346T|NLRP1_uc002gcj.2_Missense_Mutation_p.I1360T|NLRP1_uc002gcl.2_Missense_Mutation_p.I1316T|NLRP1_uc002gch.3_Missense_Mutation_p.I1346T	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1390	CARD.				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				CACTCGGGCTATCAGCTGCTC	0.582													3	93	---	---	---	---	PASS
KRT25	147183	broad.mit.edu	37	17	38911399	38911399	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38911399C>A	uc002hve.2	-	1	186	c.125G>T	c.(124-126)GGA>GTA	p.G42V		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	42	Head.|Gly-rich.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)				GAAGCCACTTCCAATCCCTGA	0.557													5	67	---	---	---	---	PASS
CALCOCO2	10241	broad.mit.edu	37	17	46940488	46940488	+	3'UTR	SNP	G	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46940488G>C	uc002iof.2	+	13					CALCOCO2_uc010wlp.1_3'UTR|CALCOCO2_uc010wlq.1_3'UTR|CALCOCO2_uc010wlr.1_3'UTR|CALCOCO2_uc010wls.1_3'UTR	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						ACTCAGCCCTGCTGCCGCTAA	0.418													4	13	---	---	---	---	PASS
C17orf28	283987	broad.mit.edu	37	17	72949181	72949181	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72949181C>A	uc002jmj.3	-	16	2121	c.1972G>T	c.(1972-1974)GAG>TAG	p.E658*	C17orf28_uc002jmi.2_Nonsense_Mutation_p.E60*|C17orf28_uc010wrs.1_Nonsense_Mutation_p.E457*	NM_030630	NP_085133	Q8IV36	CQ028_HUMAN	hypothetical protein LOC283987	658						integral to membrane|plasma membrane	protein binding				0	all_lung(278;0.151)|Lung NSC(278;0.185)					TGGCTGGGCTCCTGGCCCCCA	0.672													3	13	---	---	---	---	PASS
ANKRD30B	374860	broad.mit.edu	37	18	14757889	14757889	+	Silent	SNP	C	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14757889C>G	uc010dlo.2	+	5	873	c.693C>G	c.(691-693)GTC>GTG	p.V231V	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	231	ANK 5.									ovary(1)|skin(1)	2						ATGTTGACGTCTTTGCTGAAG	0.378													3	65	---	---	---	---	PASS
TTC39C	125488	broad.mit.edu	37	18	21663014	21663014	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21663014T>C	uc002kuw.2	+	6	1405	c.953T>C	c.(952-954)ATG>ACG	p.M318T	TTC39C_uc002kuu.2_Missense_Mutation_p.M257T	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1	318	TPR 1.						binding			ovary(1)	1						TCCCTCTTTATGTTTTTCAAG	0.398													71	47	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31326361	31326361	+	Silent	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31326361T>C	uc010dmg.1	+	12	6604	c.6549T>C	c.(6547-6549)AAT>AAC	p.N2183N	ASXL3_uc002kxq.2_Silent_p.N1890N	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	2183					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						GTGGCTCCAATCCTGCCACAG	0.478													12	99	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1041420	1041420	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1041420A>C	uc002lqw.3	+	2	291	c.60A>C	c.(58-60)AGA>AGC	p.R20S	ABCA7_uc010dsb.1_5'Flank|ABCA7_uc010dsa.2_Missense_Mutation_p.R20S	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	20					phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCGCCGGAGACAGCCGGTAA	0.632													9	72	---	---	---	---	PASS
GNG7	2788	broad.mit.edu	37	19	2514984	2514984	+	3'UTR	SNP	A	G	G	rs62121669		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2514984A>G	uc002lwd.2	-	5					GNG7_uc010dte.1_Intron	NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gagagagagaaagagagagag	0.303													8	70	---	---	---	---	PASS
GNG7	2788	broad.mit.edu	37	19	2514986	2514986	+	3'UTR	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2514986G>A	uc002lwd.2	-	5					GNG7_uc010dte.1_Intron	NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gagagagaaagagagagagag	0.308													6	79	---	---	---	---	PASS
TBXA2R	6915	broad.mit.edu	37	19	3600348	3600348	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600348C>T	uc002lyg.1	-	2	499	c.285G>A	c.(283-285)TGG>TGA	p.W95*	TBXA2R_uc002lye.1_Nonsense_Mutation_p.W95*	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	95	Extracellular (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CCACGGCGTGCCACTCGAAGA	0.672													3	50	---	---	---	---	PASS
ZNF844	284391	broad.mit.edu	37	19	12187394	12187394	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12187394T>C	uc002mtb.2	+	4	1602	c.1459T>C	c.(1459-1461)TTT>CTT	p.F487L	ZNF844_uc010dym.1_Missense_Mutation_p.F330L	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	487					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCTTCATTTTTTCCACTTCC	0.448													3	127	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22585603	22585603	+	Missense_Mutation	SNP	T	C	C	rs2957812	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22585603T>C	uc002nqt.2	-	3	363	c.241A>G	c.(241-243)ACT>GCT	p.T81A		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	81	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GGGGGTTCAGTTACCATCTCA	0.403													4	213	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760066	54760066	+	Silent	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760066G>T	uc002qex.2	-	4	606	c.495C>A	c.(493-495)ACC>ACA	p.T165T	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.T156T|LILRB5_uc002qey.2_Silent_p.T165T|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Intron|LILRB5_uc010yes.1_Intron	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	165	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTGAGTACAGGGTCCTGGGGA	0.557													57	105	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													7	29	---	---	---	---	PASS
TCF15	6939	broad.mit.edu	37	20	585299	585299	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:585299C>A	uc002wdz.2	-	2	565	c.536G>T	c.(535-537)CGT>CTT	p.R179L		NM_004609	NP_004600	Q12870	TCF15_HUMAN	basic helix-loop-helix transcription factor 15	179					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Breast(17;0.231)				CCCCAGGTCACGACGGCCACC	0.507													2	3	---	---	---	---	PASS
SNAP25	6616	broad.mit.edu	37	20	10277647	10277647	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10277647G>A	uc002wnq.1	+	6	568	c.356G>A	c.(355-357)CGT>CAT	p.R119H	SNAP25_uc002wnr.1_Missense_Mutation_p.R119H|SNAP25_uc002wns.1_Missense_Mutation_p.R56H|SNAP25_uc010gca.1_Missense_Mutation_p.R119H|SNAP25_uc010gcb.1_Missense_Mutation_p.R56H|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824	P60880	SNP25_HUMAN	synaptosomal-associated protein 25 isoform	119					energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)	CAGCCTGCTCGTGTAGTGGAC	0.478													34	49	---	---	---	---	PASS
PLUNC	51297	broad.mit.edu	37	20	31825550	31825550	+	Silent	SNP	C	T	T	rs6120177	byFrequency	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31825550C>T	uc002wyv.2	+	2	103	c.33C>T	c.(31-33)TAC>TAT	p.Y11Y	PLUNC_uc002wyt.3_Silent_p.Y11Y|PLUNC_uc002wyu.3_Silent_p.Y11Y	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	11					innate immune response	extracellular region	lipid binding				0						TTGTCTTCTACGGGCTGTTAG	0.537													51	71	---	---	---	---	PASS
MMP24	10893	broad.mit.edu	37	20	33839802	33839802	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33839802A>G	uc002xbu.2	+	3	493	c.490A>G	c.(490-492)AGG>GGG	p.R164G	EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein	164	Extracellular (Potential).				proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)			ACAGAAGTGGAGGCAAAAACA	0.552													4	121	---	---	---	---	PASS
C21orf99	149992	broad.mit.edu	37	21	14439357	14439357	+	RNA	SNP	C	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14439357C>G	uc002yja.3	+	10		c.2875C>G				NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						TGAATCAGCTCAATCAATCGC	0.274													2	3	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9912815	9912815	+	Silent	SNP	C	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9912815C>T	uc004csu.1	+	9	4536	c.4446C>T	c.(4444-4446)CCC>CCT	p.P1482P	SHROOM2_uc004csv.2_Silent_p.P316P|SHROOM2_uc011mic.1_Silent_p.P317P|SHROOM2_uc004csw.1_Silent_p.P317P	NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	1482	ASD2.				apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				TCTGCAAGCCCAGCGAGTTTG	0.647													3	42	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70471027	70471027	+	Splice_Site	SNP	C	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70471027C>A	uc004dzh.1	-	4	865	c.778_splice	c.e4+1	p.I260_splice	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Splice_Site_p.I260_splice|ZMYM3_uc004dzj.1_Splice_Site_p.I260_splice|ZMYM3_uc011mpu.1_Splice_Site|ZMYM3_uc004dzk.3_Splice_Site_p.I260_splice|ZMYM3_uc004dzl.3_Splice_Site_p.I260_splice|ZMYM3_uc004dzm.3_Splice_Site_p.I260_splice	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261						multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					ATCCTACTTACTGCTCTCAGT	0.532													65	15	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70767813	70767813	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70767813T>G	uc004eaa.1	+	5	805	c.588T>G	c.(586-588)AAT>AAG	p.N196K	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.N186K|OGT_uc004eac.2_Missense_Mutation_p.N57K|OGT_uc004ead.2_5'UTR	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	196	TPR 5.				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					CTTGGAGTAATCTTGGCTGTG	0.378													9	189	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12957	12957	+	RNA	SNP	T	C	C			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12957T>C	uc004cox.3	+	1		c.621T>C			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CTAAACGCTAATCCAAGCCTC	0.522													12	1	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1588535	1588536	+	Intron	INS	-	TAA	TAA	rs138141689	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1588535_1588536insTAA	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|uc001ahc.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						TATGAACATACTAATGAACCGA	0.292													6	4	---	---	---	---	
WDR8	49856	broad.mit.edu	37	1	3548450	3548450	+	Intron	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3548450delT	uc001ako.2	-						WDR8_uc001akn.3_Intron	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8							centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TTCTTTGGTATTTTTTTTTTT	0.522													7	4	---	---	---	---	
ZCCHC11	23318	broad.mit.edu	37	1	52927296	52927296	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52927296delA	uc001ctx.2	-						ZCCHC11_uc001cty.2_Intron|ZCCHC11_uc001ctz.2_Intron|ZCCHC11_uc009vze.1_Intron|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cua.1_5'Flank	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform						miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						AACCTAATTTAAAAAAAAAAG	0.284													117	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92066062	92066062	+	IGR	DEL	A	-	-	rs144829580		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92066062delA								CDC7 (74742 upstream) : HSP90B3P (34506 downstream)																							CCTTTCATTTAAAAAAAAAAA	0.294													9	6	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113992210	113992210	+	Intron	DEL	T	-	-	rs34091729		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113992210delT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCAAGTGCATTTTTTTTTCC	0.353													4	2	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116147	145116148	+	3'UTR	INS	-	A	A	rs138980379		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116147_145116148insA	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						AGTAGATTGTTATTTCGTTTTT	0.416													6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145209324	145209332	+	5'UTR	DEL	GGCGGCGGC	-	-	rs72083240	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209324_145209332delGGCGGCGGC	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATCTGCCCAggcggcggcggcggcggcg	0.589													7	4	---	---	---	---	
FCRL3	115352	broad.mit.edu	37	1	157664876	157664877	+	Intron	INS	-	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157664876_157664877insA	uc001frb.2	-						FCRL3_uc001fqx.3_Intron|FCRL3_uc001fqy.3_Intron|FCRL3_uc001fqz.3_Intron|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_Intron|FCRL3_uc001fra.2_Intron|FCRL3_uc001frc.1_Intron	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					GCCTCTACCAGAAAAAAAAATG	0.371													6	3	---	---	---	---	
CD84	8832	broad.mit.edu	37	1	160535663	160535663	+	Intron	DEL	T	-	-	rs34290381		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160535663delT	uc001fwh.3	-						CD84_uc001fwf.3_Intron|CD84_uc001fwg.3_Intron|CD84_uc009wtn.2_Intron|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Intron|CD84_uc001fwk.2_Intron	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule						blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TGAGGATGCCTTTTTTTTTTT	0.378													4	2	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37260027	37260028	+	Intron	INS	-	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37260027_37260028insT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				Gttttgttttgttttttttttt	0.094													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42208582	42208601	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGG	-	-	rs75432692	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42208582_42208601delAAGGAAGGAAGGAAGGAAGG								None (None upstream) : PKDCC (66560 downstream)																							aagaagaagaaaggaaggaaggaaggaaggaaggaaggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85930718	85930725	+	IGR	DEL	TCCCTCCC	-	-	rs113231454		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85930718_85930725delTCCCTCCC								GNLY (4844 upstream) : ATOH8 (50184 downstream)																							tttccttccttccctccctccctccctc	0.034													4	5	---	---	---	---	
LASS6	253782	broad.mit.edu	37	2	169417720	169417720	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169417720delT	uc002ueb.1	+	3	419	c.295delT	c.(295-297)TTGfs	p.L99fs	LASS6_uc002uec.1_Frame_Shift_Del_p.L99fs	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6	99	Cytoplasmic (Potential).|Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1						TGAAAAGAGATTGGAAGGCCT	0.428													250	14	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170038236	170038260	+	Intron	DEL	AGACTGCATTCTGAATTCTTTTCTG	-	-	rs61106961		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038236_170038260delAGACTGCATTCTGAATTCTTTTCTG	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCTGTAGAGCAGACTGCATTCTGAATTCTTTTCTGCATTCAGAAA	0.378													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24555252	24555253	+	IGR	DEL	CT	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24555252_24555253delCT								THRB (18799 upstream) : RARB (660570 downstream)																							cacacacaAACTCTCTCTCTCT	0.297													4	2	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89448278	89448278	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89448278delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		gactttgtctaaaaaaaaaaa	0.109										TSP Lung(6;0.00050)			9	4	---	---	---	---	
CHCHD6	84303	broad.mit.edu	37	3	126583239	126583241	+	Intron	DEL	CCT	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126583239_126583241delCCT	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719	Q9BRQ6	CHCH6_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						tacaccaccacctcctcctcctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184339351	184339352	+	IGR	INS	-	CACA	CACA	rs149921533	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184339351_184339352insCACA								EPHB3 (39156 upstream) : MAGEF1 (88804 downstream)																							agtgttttcaccacacacacac	0.000													1	5	---	---	---	---	
PRKG2	5593	broad.mit.edu	37	4	82064125	82064126	+	Intron	DEL	AC	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82064125_82064126delAC	uc003hmh.2	-						PRKG2_uc011ccf.1_Intron|PRKG2_uc011ccg.1_Intron|PRKG2_uc011cch.1_Intron	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II						platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						GTGAAACTTTACACACACACAC	0.416													187	7	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114119995	114119996	+	Intron	INS	-	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114119995_114119996insT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGGTGGCCAATTTTTTTTTTT	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95170388	95170388	+	IGR	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95170388delT								GLRX (11811 upstream) : C5orf27 (17548 downstream)																							CATATGTTCCttttttttttt	0.174													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115387475	115387475	+	IGR	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115387475delT								AQPEP (24177 upstream) : COMMD10 (33252 downstream)																							TGTACCCTGATTTTTAGCCCA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141209025	141209026	+	IGR	INS	-	GGAA	GGAA	rs70991709		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141209025_141209026insGGAA								ARAP3 (147225 upstream) : PCDH1 (23657 downstream)																							gaaggaaggaagaaattagcaa	0.000													4	2	---	---	---	---	
SLC36A2	153201	broad.mit.edu	37	5	150718878	150718879	+	Intron	INS	-	T	T	rs113317650		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150718878_150718879insT	uc003lty.2	-						GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_Intron|SLC36A2_uc003lua.2_Intron|SLC36A2_uc010jhv.2_Intron|SLC36A2_uc011dct.1_Intron	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2						cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACAATCGttcttttttttttt	0.243													3	4	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158523852	158523853	+	Intron	INS	-	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158523852_158523853insT	uc010jip.2	-						EBF1_uc011ddw.1_5'Flank|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGGAAGTGGCTTGGGGGACCC	0.639			T	HMGA2	lipoma								4	2	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43492091	43492091	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43492091delA	uc003ovp.2	-						POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			accccatctcaaaaaaaaaaa	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	101557311	101557330	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTT	-	-	rs71028063	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101557311_101557330delCTTCCTTCCTTCCTTCCTTT								ASCC3 (228087 upstream) : GRIK2 (289575 downstream)																							tccttccttccttccttccttccttcctttctttctttct	0.000													3	5	---	---	---	---	
ENPP1	5167	broad.mit.edu	37	6	132168802	132168809	+	Intron	DEL	TGCCACTG	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132168802_132168809delTGCCACTG	uc011ecf.1	+							NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	actatgatcatgccactgtaccctagcc	0.048													2	4	---	---	---	---	
CYTH3	9265	broad.mit.edu	37	7	6230060	6230061	+	Intron	DEL	TT	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6230060_6230061delTT	uc003spt.2	-							NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						GGATTTTTGGTTTTTTTTTTTT	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98130600	98130601	+	IGR	INS	-	TCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCT			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98130600_98130601insTCCTTCCTTCCTTCCT								BAIAP2L1 (100173 upstream) : NPTX2 (115996 downstream)																							ttttctttCTCtccttccttcc	0.089													4	2	---	---	---	---	
HBP1	26959	broad.mit.edu	37	7	106826612	106826612	+	Intron	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106826612delT	uc003vdy.2	+						HBP1_uc011klv.1_Intron|HBP1_uc003vdz.2_Intron|HBP1_uc003vea.2_Intron|HBP1_uc003veb.1_Intron	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1						cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						tttttttttcttttttttttt	0.184													4	3	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94985154	94985154	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94985154delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	GGGGAAAAAGAAAAAAAAAAA	0.433													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114918647	114918647	+	Intron	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114918647delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron|TCF7L2_uc010qrv.1_Intron|TCF7L2_uc010qrw.1_Intron|TCF7L2_uc010qrx.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		gttgcttctgttttttttttt	0.224													4	2	---	---	---	---	
LMO1	4004	broad.mit.edu	37	11	8251736	8251736	+	Intron	DEL	G	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8251736delG	uc001mgg.1	-						LMO1_uc009yfo.1_Intron|LMO1_uc001mgh.1_Intron	NM_002315	NP_002306	P25800	RBTN1_HUMAN	LIM domain only 1						cell proliferation|multicellular organismal development|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;1.59e-07)|BRCA - Breast invasive adenocarcinoma(625;0.203)		AGGACACACAGGGTACTGGGT	0.622			T|A	TRD@	T-ALL|neuroblastoma	neuroblastoma							8	7	---	---	---	---	
GIF	2694	broad.mit.edu	37	11	59611619	59611620	+	Intron	INS	-	T	T	rs72085643		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59611619_59611620insT	uc001noi.2	-						GIF_uc010rkz.1_Intron	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)						cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						ttctttctttcttttttttttg	0.198													27	9	---	---	---	---	
VPS29	51699	broad.mit.edu	37	12	110937445	110937446	+	Intron	INS	-	A	A			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110937445_110937446insA	uc001tqy.2	-						VPS29_uc001tqw.2_5'Flank|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron|RAD9B_uc001trc.1_5'Flank|RAD9B_uc001trf.3_5'Flank|RAD9B_uc001trg.3_5'Flank|RAD9B_uc010sya.1_5'Flank|RAD9B_uc001tre.3_5'Flank|RAD9B_uc001trd.3_5'Flank	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						aaaaagaaaccaaaaaaaaaaa	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21835723	21835728	+	IGR	DEL	GGCGAG	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21835723_21835728delGGCGAG								MRP63 (82505 upstream) : ZDHHC20 (114782 downstream)																							GATGGACTGAGGCGAGGGGTGGGACT	0.646													7	4	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95900172	95900173	+	Intron	INS	-	CACACACA	CACACACA	rs145006616	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95900172_95900173insCACACACA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	gttaacatgtgcacacacacac	0.054													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	34029216	34029216	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34029216delA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		actctgtctcaaaaaaaaaaa	0.090													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																							aacagagcaagaTggatggatgga	0.000													10	6	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42277638	42277639	+	Intron	INS	-	GAGG	GAGG	rs142271830	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42277638_42277639insGAGG	uc001wvm.2	+						LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		aaggaagaatcgagggagggag	0.099										HNSCC(30;0.082)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23098652	23098655	+	Intron	DEL	TTCT	-	-	rs3057778		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23098652_23098655delTTCT	uc001yvf.2	-											Homo sapiens cDNA clone IMAGE:5275816.																		tgagtcctacttctctctccatct	0.211													10	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31712898	31712899	+	IGR	INS	-	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31712898_31712899insT								KLF13 (42797 upstream) : OTUD7A (62431 downstream)																							ttttttctttcttttttttttt	0.223													4	3	---	---	---	---	
ELL3	80237	broad.mit.edu	37	15	44089000	44089000	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44089000delA	uc001zsx.1	-						C15orf63_uc001ztb.2_Intron|SERINC4_uc001ztc.1_Intron|SERINC4_uc001ztd.1_Intron|SERINC4_uc010bds.1_Intron|SERINC4_uc001zte.1_Intron	NM_025165	NP_079441	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3						positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				ovary(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		TGGCAGGGGCAAAAAAAGGTC	0.493													346	7	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64217878	64217881	+	Intron	DEL	CACA	-	-	rs72280699		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64217878_64217881delCACA	uc002amr.2	-						DAPK2_uc010uim.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		ACTTGTAGCGcacacacacacaca	0.333													4	2	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4952694	4952694	+	Intron	DEL	T	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4952694delT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TCCCATGCACttttttttttt	0.299													2	4	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19041901	19041902	+	Intron	DEL	TT	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19041901_19041902delTT	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						GAGGttcttctttttttttttt	0.238													6	3	---	---	---	---	
CALB2	794	broad.mit.edu	37	16	71416027	71416028	+	Intron	INS	-	AAGGAAGGAAGGAAAG	AAGGAAGGAAGGAAAG	rs67540929		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71416027_71416028insAAGGAAGGAAGGAAAG	uc002faa.3	+						CALB2_uc010vme.1_Intron|CALB2_uc002fac.3_Intron	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1								calcium ion binding				0		Ovarian(137;0.125)				aaaggaagaaaaaggaaggaag	0.054													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88226611	88226611	+	IGR	DEL	G	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88226611delG								BANP (115688 upstream) : ZNF469 (267268 downstream)																							tggtggtgatggtggtgatgg	0.000													7	4	---	---	---	---	
ENO3	2027	broad.mit.edu	37	17	4859643	4859643	+	Intron	DEL	C	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4859643delC	uc002gab.3	+						ENO3_uc002gac.3_Intron|ENO3_uc010vss.1_Intron|ENO3_uc010vst.1_Intron	NM_053013	NP_443739	P13929	ENOB_HUMAN	enolase 3						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex	magnesium ion binding|phosphopyruvate hydratase activity			ovary(1)	1						TGACCCCCCACCCCCAGCCCA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34295123	34295126	+	IGR	DEL	TCTC	-	-	rs150052095		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34295123_34295126delTCTC								LYZL6 (24452 upstream) : CCL16 (8410 downstream)																							tttctttctttctctctctctctc	0.127													2	4	---	---	---	---	
CA4	762	broad.mit.edu	37	17	58232860	58232861	+	Intron	DEL	AC	-	-	rs3830362		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58232860_58232861delAC	uc002iym.3	+						CA4_uc010wou.1_Intron	NM_000717	NP_000708	P22748	CAH4_HUMAN	carbonic anhydrase IV precursor						bicarbonate transport|one-carbon metabolic process	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	TTCCCAGcatacacacacacac	0.292													2	4	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													4	5	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12351548	12351549	+	Intron	INS	-	T	T	rs12960286		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12351548_12351549insT	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	AGTGttttttgttttttttttt	0.178													4	2	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						GTGGTTGTTATTCAATAGAATA	0.257													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	55431560	55431573	+	IGR	DEL	TTTCTTTCTTTCTT	-	-	rs68047140		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55431560_55431573delTTTCTTTCTTTCTT								ATP8B1 (32521 upstream) : NEDD4L (280046 downstream)																							tttctttttctttctttctttctttttctttctt	0.065													5	3	---	---	---	---	
ZNF236	7776	broad.mit.edu	37	18	74638773	74638776	+	Intron	DEL	TAAG	-	-	rs66610142	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74638773_74638776delTAAG	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		ATGGTATAAATAAGGGGTGATTAG	0.363													4	2	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2405704	2405704	+	Intron	DEL	C	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2405704delC	uc010xgx.1	+						TMPRSS9_uc002lvv.1_Intron	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGGGCAttctttttttttt	0.214													4	2	---	---	---	---	
ZNF77	58492	broad.mit.edu	37	19	2938961	2938962	+	Intron	INS	-	A	A	rs150985080		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2938961_2938962insA	uc002lws.3	-							NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		ctcaaaaaaataaaaaaaaaaa	0.228													5	3	---	---	---	---	
CCDC123	84902	broad.mit.edu	37	19	33418019	33418020	+	Intron	INS	-	ACCCACCT	ACCCACCT	rs11280765		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33418019_33418020insACCCACCT	uc002nty.2	-						CCDC123_uc002ntx.2_Intron|CCDC123_uc010edg.2_Intron|CCDC123_uc002ntz.1_Intron	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)					tctgcctacccacccacctacc	0.114													7	4	---	---	---	---	
CEACAM22P	388550	broad.mit.edu	37	19	45050956	45050957	+	Intron	INS	-	AGGA	AGGA	rs28711499	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45050956_45050957insAGGA	uc010ejr.1	-							NR_027754				Homo sapiens cDNA FLJ41856 fis, clone NT2RI3006171, weakly similar to Carcinoembryonic antigen-related celladhesion molecule 5 precursor.												0						gggagggagggaggaaggaagg	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	30038166	30038166	+	IGR	DEL	T	-	-	rs113431917		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30038166delT								DEFB123 (107 upstream) : DEFB124 (15143 downstream)																							cattttttaattttttttttt	0.040													4	3	---	---	---	---	
C20orf112	140688	broad.mit.edu	37	20	31035206	31035207	+	3'UTR	INS	-	AAAAA	AAAAA	rs149650216		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31035206_31035207insAAAAA	uc002wxu.3	-	8					C20orf112_uc010gec.2_3'UTR	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688												0						GGTGAGATTCCaaaaaaaaaaa	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32823673	32823680	+	IGR	DEL	AAGGAAGG	-	-	rs71337945		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32823673_32823680delAAGGAAGG								EIF2S2 (123588 upstream) : ASIP (24491 downstream)																							gaaggaaggaaaggaaggaaggaaggaa	0.000													4	3	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36468606	36468607	+	Intron	INS	-	TGAC	TGAC			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36468606_36468607insTGAC	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				GAGAAGGTGGGTGACTGTTGGA	0.510													82	8	---	---	---	---	
RAE1	8480	broad.mit.edu	37	20	55942169	55942169	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55942169delA	uc002xyg.2	+						RAE1_uc010gis.1_Intron|RAE1_uc010git.1_Intron|RAE1_uc002xyh.2_Intron|RAE1_uc002xyi.2_Intron	NM_003610	NP_003601	P78406	RAE1L_HUMAN	RAE1 (RNA export 1, S.pombe) homolog						carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			TATTTACTTTAAAAAAAAAAC	0.353													190	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18511131	18511132	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs140421958	by1000genomes	TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18511131_18511132insGAAGGAAG								C21orf34 (529037 upstream) : CXADR (374198 downstream)																							AGTTGTGTGCAgaaggaaggaa	0.099													6	3	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1547216	1547216	+	Intron	DEL	A	-	-			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1547216delA	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGGCATCTCaaaaaaaaaaa	0.050													3	3	---	---	---	---	
PIR	8544	broad.mit.edu	37	X	15478038	15478038	+	Intron	DEL	A	-	-	rs146737236		TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15478038delA	uc004cwu.2	-						PIR_uc004cwv.2_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin						transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					ccttttcattAAAAAAAAAAa	0.000													9	5	---	---	---	---	
GPR64	10149	broad.mit.edu	37	X	19026198	19026199	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5741-01	TCGA-CH-5741-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19026198_19026199insT	uc004cyx.2	-	19	1629_1630	c.1465_1466insA	c.(1465-1467)ATTfs	p.I489fs	GPR64_uc004cyy.2_Frame_Shift_Ins_p.I486fs|GPR64_uc004cyz.2_Frame_Shift_Ins_p.I475fs|GPR64_uc004czb.2_Frame_Shift_Ins_p.I489fs|GPR64_uc004czc.2_Frame_Shift_Ins_p.I473fs|GPR64_uc004czd.2_Frame_Shift_Ins_p.I465fs|GPR64_uc004cze.2_Frame_Shift_Ins_p.I459fs|GPR64_uc004czf.2_Frame_Shift_Ins_p.I451fs|GPR64_uc004cza.2_Frame_Shift_Ins_p.I467fs|GPR64_uc004cyw.2_Frame_Shift_Ins_p.I473fs|GPR64_uc010nfj.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	489	Extracellular (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					AGGAAGAGTAATTGTGCCAATA	0.391													23	91	---	---	---	---	
