Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16972067	16972067	+	5'Flank	SNP	C	T	T	rs1360574	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16972067C>T	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|uc001azj.1_5'Flank|MST1P2_uc009vow.2_5'Flank|MST1P2_uc010ocg.1_5'Flank|MST1P2_uc010och.1_5'Flank|MST1P2_uc010oci.1_5'Flank|MST1P2_uc001azk.2_5'Flank|MST1P2_uc001azl.3_5'Flank|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GGACAGGTTTCACAACTTCCC	0.632													4	15	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17264920	17264920	+	Missense_Mutation	SNP	C	T	T	rs4463721	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264920C>T	uc001azt.2	+	11	1385	c.1316C>T	c.(1315-1317)GCG>GTG	p.A439V	CROCC_uc009voy.1_Missense_Mutation_p.A142V|CROCC_uc009voz.1_Missense_Mutation_p.A202V|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	439	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGGAGCAGGCGGCCCTGGAG	0.617													4	2	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74808773	74808773	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74808773G>A	uc001dgf.1	+	9	893	c.842G>A	c.(841-843)GGC>GAC	p.G281D	TNNI3K_uc001dgc.1_Missense_Mutation_p.G382D|TNNI3K_uc001dgd.2_Missense_Mutation_p.G382D|TNNI3K_uc001dge.1_Missense_Mutation_p.G382D	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	281	ANK 7.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TGCTACAATGGCAAATTTGAA	0.348													4	94	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097555	167097555	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097555G>T	uc001geb.1	+	5	3187	c.3187G>T	c.(3187-3189)GCC>TCC	p.A1063S		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1063					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CCCAAATTGGGCCAGGTCCAG	0.552													6	57	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226516429	226516429	+	3'UTR	SNP	A	G	G	rs3791734	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226516429A>G	uc002voe.2	+	6					KIAA1486_uc010fxa.1_3'UTR|KIAA1486_uc002vof.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TTCATTTGAAAAAGAATATCT	0.373													3	63	---	---	---	---	PASS
PELO	53918	broad.mit.edu	37	5	52096850	52096850	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52096850G>T	uc003jos.2	+	2	1607	c.622G>T	c.(622-624)GCC>TCC	p.A208S	ITGA1_uc003jov.2_Intron|ITGA1_uc003jou.2_Intron|PELO_uc003jot.1_Intron	NM_015946	NP_057030	Q9BRX2	PELO_HUMAN	pelota homolog	208					cell cycle|cell division|translation	cytoplasm|nucleus	endonuclease activity|metal ion binding|protein binding				0		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				CATCCTGGTGGCCAGCCCAGG	0.517													9	145	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43111336	43111336	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43111336G>T	uc003oub.1	+	14	2427	c.2229G>T	c.(2227-2229)GAG>GAT	p.E743D	PTK7_uc003ouc.1_Missense_Mutation_p.E687D|PTK7_uc003oud.1_Missense_Mutation_p.E703D|PTK7_uc003oue.1_Missense_Mutation_p.E613D|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Missense_Mutation_p.E751D|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	743	Cytoplasmic (Potential).				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGGGCGAGGAGCCAGAGATGG	0.677											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	41	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													3	73	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37956173	37956173	+	5'UTR	SNP	C	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37956173C>A	uc003tfo.3	-	1						NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor						brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CCCCGGCAGACAGAAAGCGCC	0.647													3	27	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832122C>T	uc010qey.1	-	3		c.1853G>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTAAAAGGCTTTGCCACAT	0.348													3	14	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50713893	50713893	+	Intron	SNP	G	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50713893G>T	uc001jhs.3	-						ERCC6_uc001jhr.3_5'UTR	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						ATAATGGCTTGATAGCAAATA	0.343								Direct_reversal_of_damage|NER					7	30	---	---	---	---	PASS
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13028751G>C	uc010sho.1	+	1	341	c.319G>C	c.(319-321)GGC>CGC	p.G107R		NR_003932				SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;												0						GGTGTTTGACGGCATCCCACC	0.612													3	24	---	---	---	---	PASS
PYROXD1	79912	broad.mit.edu	37	12	21590621	21590621	+	5'UTR	SNP	T	C	C	rs2058464	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21590621T>C	uc001rew.2	+	1					PYROXD1_uc009ziq.2_5'UTR|PYROXD1_uc009zir.2_5'UTR	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			ovary(1)	1						CAGAGTCCCGTTGCTCCGCCG	0.652													6	2	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45605353	45605353	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45605353C>A	uc001wwd.3	+	1	218	c.119C>A	c.(118-120)GCG>GAG	p.A40E	FANCM_uc001wwc.2_Missense_Mutation_p.A40E|FANCM_uc010anf.2_Missense_Mutation_p.A40E|FKBP3_uc010tqf.1_5'Flank	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	40					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AGCTCCAAGGCGCCTTTGCCA	0.607								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	83	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997025	54997025	+	Intron	SNP	C	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997025C>T	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						ATTGATCATTCTTGGTATACT	0.353													3	70	---	---	---	---	PASS
GPR135	64582	broad.mit.edu	37	14	59930471	59930471	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59930471T>G	uc010apj.2	-	1	1589	c.1474A>C	c.(1474-1476)ACC>CCC	p.T492P	GPR135_uc001xed.2_RNA	NM_022571	NP_072093	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	492	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)		TAGAGGCTGGTATCCCCAGCT	0.498													6	17	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79059182	79059182	+	Missense_Mutation	SNP	T	C	C	rs143974743		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79059182T>C	uc002bej.3	-	19	3282	c.3071A>G	c.(3070-3072)CAC>CGC	p.H1024R	ADAMTS7_uc010und.1_3'UTR	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1024					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GGCCAGGTGGTGCGGGATGAA	0.682													3	32	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													6	79	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51175658	51175658	+	Missense_Mutation	SNP	T	C	C	rs13336129	byFrequency	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175658T>C	uc010vgs.1	-	2	506	c.475A>G	c.(475-477)AGC>GGC	p.S159G	SALL1_uc010vgr.1_Missense_Mutation_p.S62G|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	159	Poly-Ser.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ccgccgccgctgctgctgctg	0.463													2	6	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9820540	9820540	+	3'UTR	SNP	C	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9820540C>A	uc002gmg.1	-	14					GAS7_uc010vvc.1_3'UTR|GAS7_uc002gmh.1_3'UTR|GAS7_uc010vvd.1_3'UTR|GAS7_uc002gmi.2_3'UTR|GAS7_uc002gmj.1_3'UTR|GAS7_uc010coh.1_3'UTR	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						GCTGCACAGGCCCATCTAGAT	0.657			T	MLL	AML*								8	80	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	16734727	16734727	+	Nonsense_Mutation	SNP	C	A	A	rs659569		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16734727C>A	uc010vwr.1	-	3	848	c.406G>T	c.(406-408)GAG>TAG	p.E136*						SubName: Full=cDNA FLJ53570, highly similar to Keratin, type I cytoskeletal 16;																		CACACCTCCTCGTGGTTCTTC	0.632													4	83	---	---	---	---	PASS
MAP2K3	5606	broad.mit.edu	37	17	21203907	21203907	+	Silent	SNP	T	C	C	rs73311539	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21203907T>C	uc002gys.2	+	4	481	c.216T>C	c.(214-216)CGT>CGC	p.R72R	MAP2K3_uc002gyt.2_Silent_p.R43R|MAP2K3_uc002gyu.2_Silent_p.R43R	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	72	ATP (By similarity).|Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		AACTGGGCCGTGGAGCCTATG	0.607													4	17	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066259	9066259	+	Missense_Mutation	SNP	T	C	C	rs17000770	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066259T>C	uc002mkp.2	-	3	21391	c.21187A>G	c.(21187-21189)ACT>GCT	p.T7063A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7065	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AATCTCTGAGTCAAAGTTGAA	0.498													4	178	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10463692	10463692	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10463692A>C	uc002moc.3	-	22	3488	c.3110T>G	c.(3109-3111)GTC>GGC	p.V1037G	TYK2_uc010dxe.2_Missense_Mutation_p.V852G	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	1037	Protein kinase 2.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCCGATCTTGACCAGCCTGTC	0.667													5	28	---	---	---	---	PASS
IFNAR2	3455	broad.mit.edu	37	21	34635097	34635097	+	Splice_Site	SNP	G	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34635097G>A	uc002yrd.2	+	9	1169	c.841_splice	c.e9-1	p.N281_splice	IFNAR2_uc002yre.2_Splice_Site_p.N281_splice|IFNAR2_uc002yrf.2_Splice_Site_p.E237_splice|IL10RB_uc002yrh.1_Intron|IL10RB_uc002yri.1_Intron	NM_207585	NP_997468	P48551	INAR2_HUMAN	interferon alpha/beta receptor 2 isoform a						JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to interferon-alpha|response to virus|type I interferon-mediated signaling pathway	extracellular region|extracellular space|integral to plasma membrane	protein kinase binding|type I interferon binding|type I interferon receptor activity				0					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	TTTTTTTTAAGAATTTTCATA	0.328													8	82	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119894	38119894	+	Missense_Mutation	SNP	G	A	A	rs35105846		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119894G>A	uc003atr.2	+	7	1602	c.1331G>A	c.(1330-1332)AGT>AAT	p.S444N	TRIOBP_uc003atu.2_Missense_Mutation_p.S272N|TRIOBP_uc003atq.1_Missense_Mutation_p.S444N|TRIOBP_uc003ats.1_Missense_Mutation_p.S272N	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	444					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TCCTCTCCCAGTAGAGCTACA	0.587													3	104	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119902	38119902	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119902A>G	uc003atr.2	+	7	1610	c.1339A>G	c.(1339-1341)ACA>GCA	p.T447A	TRIOBP_uc003atu.2_Missense_Mutation_p.T275A|TRIOBP_uc003atq.1_Missense_Mutation_p.T447A|TRIOBP_uc003ats.1_Missense_Mutation_p.T275A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	447					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CAGTAGAGCTACACGAGACAA	0.587													3	93	---	---	---	---	PASS
CAPZA1	829	broad.mit.edu	37	1	113202197	113202198	+	Intron	DEL	TC	-	-	rs113906793		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113202197_113202198delTC	uc001ecj.1	+							NM_006135	NP_006126	P52907	CAZA1_HUMAN	F-actin capping protein alpha-1 subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex|WASH complex	actin binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGACAGTTTCTCTCTCTCTC	0.396													4	3	---	---	---	---	
NBPF7	343505	broad.mit.edu	37	1	120379737	120379738	+	Intron	INS	-	A	A	rs67014534		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120379737_120379738insA	uc010oxk.1	-							NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		tctcaaaaaagaaaaaaaaaga	0.144													4	3	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147090441	147090441	+	Intron	DEL	A	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147090441delA	uc001epq.2	+						BCL9_uc010ozr.1_Intron	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9						Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					CAGTAAGTTTAAAAAAAAAAA	0.388			T	IGH@|IGL@	B-ALL								9	4	---	---	---	---	
DCST1	149095	broad.mit.edu	37	1	155020445	155020446	+	Intron	DEL	CA	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155020445_155020446delCA	uc001fgn.1	+						DCST1_uc010pes.1_Intron|uc001fgo.2_Intron|ADAM15_uc001fgq.1_5'Flank	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1 isoform 1							integral to membrane	zinc ion binding			ovary(1)|skin(1)	2	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TACACACCTGCACACACACACA	0.579													57	9	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180805493	180805493	+	Intron	DEL	A	-	-	rs72155316		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180805493delA	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						actcagtctcaaaaaaaaaaa	0.124													4	4	---	---	---	---	
AIDA	64853	broad.mit.edu	37	1	222876705	222876706	+	Intron	INS	-	A	A			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222876705_222876706insA	uc001hnn.2	-						AIDA_uc001hno.2_Intron|AIDA_uc010pus.1_Intron	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						AAATTCTTCTCAAAAAAAAAAA	0.272													6	3	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8891386	8891387	+	Intron	INS	-	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8891386_8891387insT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qzb.2_5'Flank|KIDINS220_uc002qze.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACAGGAttttcttttttttttt	0.347													4	2	---	---	---	---	
ITSN2	50618	broad.mit.edu	37	2	24521896	24521897	+	Intron	DEL	TT	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24521896_24521897delTT	uc002rfe.2	-						ITSN2_uc002rff.2_Intron|ITSN2_uc002rfg.2_Intron|ITSN2_uc010eyd.2_Intron	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1						endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACGAGATCtttttttttttt	0.183													3	3	---	---	---	---	
LOC541471	541471	broad.mit.edu	37	2	112009159	112009161	+	Intron	DEL	ATT	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112009159_112009161delATT	uc002the.2	-											Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0						caccatcaccattaccaccacca	0.000													4	2	---	---	---	---	
C2orf85	285093	broad.mit.edu	37	2	242813752	242813752	+	Intron	DEL	G	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242813752delG	uc010fzu.1	+							NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093							integral to membrane				ovary(1)	1						ATGTGAGGCAGGGGGCAGCGA	0.672													4	2	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3344469	3344470	+	Intron	INS	-	T	T	rs112112932		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3344469_3344470insT	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc003ggx.1_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGGGATGACTGTTTTTTTTTCA	0.218													4	2	---	---	---	---	
USO1	8615	broad.mit.edu	37	4	76726517	76726517	+	Intron	DEL	T	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76726517delT	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTATCCTGCCTTTTTTTTTTT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6422643	6422646	+	IGR	DEL	GAAG	-	-	rs5865653		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6422643_6422646delGAAG								MED10 (44004 upstream) : UBE2QL1 (26090 downstream)																							aagagagagagaaggaaggaagga	0.162													4	2	---	---	---	---	
C7	730	broad.mit.edu	37	5	40979699	40979699	+	Intron	DEL	T	-	-	rs35148902		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40979699delT	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGTTTCCACCTTTTTTTTTTT	0.313													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	74285946	74285946	+	IGR	DEL	T	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74285946delT								FAM169A (94158 upstream) : GCNT4 (37344 downstream)																							aattgctttcttttttttttt	0.184													4	4	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26460170	26460171	+	Intron	INS	-	CACAGGGAGATTCCACAGGGA	CACAGGGAGATTCCACAGGGA	rs142117310	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26460170_26460171insCACAGGGAGATTCCACAGGGA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						ACTCCCTTTTCCACTCTCCCTG	0.480													4	3	---	---	---	---	
PBX2	5089	broad.mit.edu	37	6	32157697	32157697	+	5'UTR	DEL	G	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32157697delG	uc003oav.1	-	1					PBX2_uc003oaw.2_5'UTR	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2								transcription factor binding			ovary(1)	1						GTCCATAGCTGGGGGGGGGCC	0.602													7	4	---	---	---	---	
CDC40	51362	broad.mit.edu	37	6	110536283	110536284	+	Intron	DEL	TG	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110536283_110536284delTG	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TGTGTGACTCTGTGTGTGTGTG	0.307													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157298298	157298301	+	Intron	DEL	TTTC	-	-	rs75964118		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157298298_157298301delTTTC	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ctggtgtggttttctttgtgtgtc	0.034													5	7	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32763380	32763381	+	Intron	DEL	TG	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32763380_32763381delTG	uc011kai.1	+							NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						TATAAGAGTTtgtgtgtgtgtg	0.243													4	4	---	---	---	---	
STEAP2	261729	broad.mit.edu	37	7	89859612	89859613	+	Intron	INS	-	A	A	rs146827619	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89859612_89859613insA	uc003ujz.2	+						STEAP2_uc010len.2_Intron|STEAP2_uc003uka.2_Intron|STEAP2_uc003ukb.2_Intron|STEAP2_uc003ukc.2_Intron|STEAP2_uc003ukd.2_Intron	NM_152999	NP_694544	Q8NFT2	STEA2_HUMAN	six transmembrane epithelial antigen of the						electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity			ovary(2)	2	all_hematologic(106;0.112)					TCTTAAAAGAGAAAAAAAAAAT	0.287													6	3	---	---	---	---	
COL1A2	1278	broad.mit.edu	37	7	94022791	94022792	+	5'Flank	DEL	CG	-	-	rs62464615		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94022791_94022792delCG	uc003ung.1	+						COL1A2_uc011kib.1_5'Flank	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	cacacacacacgcacacgcgcg	0.396										HNSCC(75;0.22)			4	2	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101438951	101438953	+	IGR	DEL	ACT	-	-	rs151175364		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101438951_101438953delACT								RNF19A (116624 upstream) : ANKRD46 (83034 downstream)																							caccaccaccactaccatcacca	0.000													3	4	---	---	---	---	
AKR1C4	1109	broad.mit.edu	37	10	5260506	5260507	+	Intron	DEL	AA	-	-	rs3038974		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5260506_5260507delAA	uc001ihw.2	+							NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4						androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	TCTTATTTTGAAAAAAAAAAAA	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11704259	11704260	+	IGR	INS	-	GAAGGAAA	GAAGGAAA	rs113401656		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11704259_11704260insGAAGGAAA								USP6NL (50580 upstream) : ECHDC3 (80096 downstream)																							aaggaaggaagggaaggaagga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89466545	89466548	+	IGR	DEL	TAAT	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89466545_89466548delTAAT								TRIM77 (15507 upstream) : TRIM49 (64276 downstream)																							AACATACAAATAATTGAGAGTCAT	0.422													6	3	---	---	---	---	
KLRG1	10219	broad.mit.edu	37	12	9161834	9161834	+	Intron	DEL	A	-	-	rs112576720		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9161834delA	uc001qvh.2	+						KLRG1_uc001qvg.2_Intron	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,						cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1						gggtaagggcaaaaaaaaaaa	0.159													5	4	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77243103	77243104	+	Intron	INS	-	AAA	AAA	rs34062414		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77243103_77243104insAAA	uc001syk.1	+							NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						ggtcctgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
GOLGA2B	55592	broad.mit.edu	37	12	100562920	100562921	+	Intron	INS	-	T	T			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100562920_100562921insT	uc001tgu.2	-						GOLGA2B_uc001tgy.3_5'Flank|GOLGA2B_uc001tgz.3_RNA	NM_017600	NP_060070			golgi autoantigen, golgin subfamily a, 2-like 1												0						GGTCTCATTTGTTTTttttttt	0.198													4	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109859032	109859033	+	Intron	INS	-	C	C	rs138762056	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109859032_109859033insC	uc010sxn.1	+							NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H							myosin complex	motor activity				0						tgtgtatgatgccccctgggca	0.158													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120706717	120706717	+	IGR	DEL	A	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120706717delA								PXN (3154 upstream) : NME2P1 (13223 downstream)																							agactctgtcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	121011388	121011389	+	Intron	INS	-	A	A	rs113333301		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121011388_121011389insA	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					agtcatttatcaaaaaaaaaaa	0.025													4	3	---	---	---	---	
RSRC2	65117	broad.mit.edu	37	12	122991162	122991163	+	Intron	DEL	TC	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122991162_122991163delTC	uc001ucr.2	-						RSRC2_uc001uco.2_Intron|RSRC2_uc001ucp.2_Intron|RSRC2_uc001ucq.2_Intron|RSRC2_uc001ucs.2_Intron|RSRC2_uc001uct.2_Intron|RSRC2_uc001ucu.2_Intron	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a											ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		caaaaccccgtctcTCTCTCTC	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66422569	66422572	+	IGR	DEL	GGAA	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66422569_66422572delGGAA								None (None upstream) : PCDH9 (454395 downstream)																							aaggaaagatggaaggaaggaagg	0.044													4	3	---	---	---	---	
TOX4	9878	broad.mit.edu	37	14	21963139	21963140	+	Intron	INS	-	A	A	rs146735196	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21963139_21963140insA	uc001waz.2	+						TOX4_uc001way.2_Intron|TOX4_uc001wba.2_Intron|TOX4_uc010tlu.1_Intron|TOX4_uc010tlv.1_Intron	NM_014828	NP_055643	O94842	TOX4_HUMAN	epidermal Langerhans cell protein LCP1							chromatin|nucleus|PTW/PP1 phosphatase complex	DNA binding|protein binding			ovary(1)	1	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		GCTTAACAGGGAAAAAAAAGCA	0.347													7	4	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105686238	105686239	+	Intron	INS	-	G	G	rs145414919	by1000genomes	TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105686238_105686239insG	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yqk.2_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GAAGAGAGTGTGGGGGGGGGTC	0.713													4	2	---	---	---	---	
SYT17	51760	broad.mit.edu	37	16	19195719	19195719	+	Intron	DEL	T	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19195719delT	uc002dfw.2	+						SYT17_uc002dfx.2_Intron|SYT17_uc002dfy.2_Intron|SYT17_uc002dfv.1_Intron	NM_016524	NP_057608	Q9BSW7	SYT17_HUMAN	B/K protein							membrane|synaptic vesicle	transporter activity			ovary(1)	1						atttcagtagttttttttttt	0.000													4	2	---	---	---	---	
IL4R	3566	broad.mit.edu	37	16	27367406	27367406	+	Intron	DEL	T	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367406delT	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CACttttttcttttttttttt	0.214													6	3	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1387740	1387754	+	Intron	DEL	GGGCCTGGGTGCTGA	-	-	rs71886519		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1387740_1387754delGGGCCTGGGTGCTGA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGGTGCGGGGGGCCTGGGTGCTGAGGGCCTGGGT	0.698													4	4	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938558	41938559	+	Intron	INS	-	GTGTGTGT	GTGTGTGT			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938558_41938559insGTGTGTGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						TACAGGACAGCgtgtgtgtgtg	0.327													4	2	---	---	---	---	
PRR19	284338	broad.mit.edu	37	19	42806337	42806337	+	5'UTR	DEL	C	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42806337delC	uc002oti.2	+	1					PAFAH1B3_uc002otg.2_Intron|PAFAH1B3_uc010xwi.1_Intron|PAFAH1B3_uc010xwj.1_Intron|PRR19_uc002oth.1_5'UTR	NM_199285	NP_954979	A6NJB7	PRR19_HUMAN	proline rich 19												0		Prostate(69;0.00682)				TCCTGAGCCACCCCCCGCGCC	0.672													4	2	---	---	---	---	
HM13	81502	broad.mit.edu	37	20	30156903	30156904	+	Intron	INS	-	T	T	rs11376444		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30156903_30156904insT	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTTTATTGTTGTTTTTTTTTTT	0.490											OREG0025852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	5	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32339915	32339915	+	Intron	DEL	C	-	-	rs11477069		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32339915delC	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						tgcaagcaagccCCCCCCCCT	0.164													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074313	62074315	+	Intron	DEL	CAC	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074313_62074315delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	tcatcaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11144780	11144781	+	IGR	INS	-	TGTA	TGTA	rs146882288		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11144780_11144781insTGTA								BAGE (45843 upstream) : None (None downstream)																							gtctgtgtgtgtgtgtgtgtgt	0.371													4	2	---	---	---	---	
DNAJC28	54943	broad.mit.edu	37	21	34861875	34861875	+	Intron	DEL	T	-	-	rs77181674		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34861875delT	uc002yrv.2	-						DNAJC28_uc002yrw.2_Intron	NM_017833	NP_060303	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28								heat shock protein binding				0						AACTTTttccttttttttttt	0.154													8	4	---	---	---	---	
RAB36	9609	broad.mit.edu	37	22	23498332	23498333	+	Intron	INS	-	AA	AA	rs56254210		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23498332_23498333insAA	uc002zwv.1	+						RAB36_uc010gtw.1_Intron	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TGTCCTCCAAGACCCACTGAGA	0.594													4	2	---	---	---	---	
C22orf31	25770	broad.mit.edu	37	22	29456183	29456183	+	Intron	DEL	T	-	-	rs71910260		TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456183delT	uc003aej.1	-							NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770												0						catgcctggcttttttttttt	0.000													6	3	---	---	---	---	
INPP5J	27124	broad.mit.edu	37	22	31509421	31509421	+	Intron	DEL	A	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31509421delA	uc010gwf.2	+						SELM_uc011alj.1_Intron			Q15735	PI5PA_HUMAN	RecName: Full=Phosphatidylinositol 4,5-bisphosphate 5-phosphatase A;          EC=3.1.3.56; AltName: Full=Inositol polyphosphate 5-phosphatase J;							cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						GCCTACaattaaaaaaaaaaa	0.378													8	4	---	---	---	---	
SSX3	10214	broad.mit.edu	37	X	48217953	48217953	+	5'Flank	DEL	A	-	-			TCGA-CH-5743-01	TCGA-CH-5743-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48217953delA	uc004djd.1	-						SSX3_uc004dje.2_5'Flank|SSX3_uc010nic.2_5'Flank	NM_021014	NP_066294	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						agcaagactgaaaaaaaaaaa	0.015													6	3	---	---	---	---	
