Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ESPNP	284729	broad.mit.edu	37	1	17034110	17034110	+	Missense_Mutation	SNP	C	T	T	rs55767123		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17034110C>T	uc001azn.1	-	3	494	c.380G>A	c.(379-381)GGC>GAC	p.G127D	ESPNP_uc010ocj.1_Missense_Mutation_p.G57D	NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GATCTCCCCGCCGTGCAGCAG	0.612													3	10	---	---	---	---	PASS
TRIM33	51592	broad.mit.edu	37	1	115005788	115005788	+	Silent	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115005788G>A	uc001eew.2	-	4	945	c.861C>T	c.(859-861)TTC>TTT	p.F287F	TRIM33_uc010ows.1_5'UTR|TRIM33_uc001eex.2_Silent_p.F287F	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform	287	B box-type 2.				negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTTTCACAGAAAAGTTTCA	0.353			T	RET	papillary thyroid								5	74	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145530284	145530284	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145530284G>T	uc001eoa.2	+	6	575	c.499G>T	c.(499-501)GAT>TAT	p.D167Y	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.D36Y|ITGA10_uc009wiw.2_Missense_Mutation_p.D24Y|ITGA10_uc010oyw.1_Missense_Mutation_p.D112Y	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	167	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AACATACATGGATGTTGTCAT	0.498													7	205	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161021490	161021490	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161021490A>C	uc001fxl.2	-	10	1380	c.1034T>G	c.(1033-1035)GTG>GGG	p.V345G	ARHGAP30_uc001fxk.2_Missense_Mutation_p.V345G|ARHGAP30_uc001fxm.2_Missense_Mutation_p.V191G|ARHGAP30_uc009wtx.2_Missense_Mutation_p.V18G|ARHGAP30_uc001fxn.1_Missense_Mutation_p.V191G	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	345					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCTGGGCCCCACCAGCCCCTC	0.582													10	29	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276508	186276508	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276508T>G	uc001gru.3	+	7	1708	c.1657T>G	c.(1657-1659)TCA>GCA	p.S553A	PRG4_uc001grt.3_Missense_Mutation_p.S512A|PRG4_uc009wyl.2_Missense_Mutation_p.S460A|PRG4_uc009wym.2_Missense_Mutation_p.S419A|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	553	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|27.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CAAGGAGCCTTCACCCACCAC	0.642													4	64	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179426189	179426189	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179426189T>G	uc010zfg.1	-	275	77190	c.76966A>C	c.(76966-76968)ATG>CTG	p.M25656L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M19351L|TTN_uc010zfi.1_Missense_Mutation_p.M19284L|TTN_uc010zfj.1_Missense_Mutation_p.M19159L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26583							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTCATACATCAGTCCTTCA	0.398													74	149	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47361170	47361170	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47361170C>T	uc003crd.2	+	2	283	c.157C>T	c.(157-159)CGG>TGG	p.R53W	KLHL18_uc003crc.2_Missense_Mutation_p.R53W|KLHL18_uc011bav.1_Intron	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	53											0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CAGTGCCCACCGGATTGTCTT	0.418													60	170	---	---	---	---	PASS
SPINK8	646424	broad.mit.edu	37	3	48348452	48348452	+	3'UTR	SNP	C	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48348452C>A	uc003csq.1	-	5						NM_001080525	NP_001073994	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8							extracellular region	serine-type endopeptidase inhibitor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TCTGGAGATTCAGTAGGTTTT	0.353													6	29	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52366398	52366398	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52366398G>A	uc011bef.1	+	8	1535	c.1274G>A	c.(1273-1275)CGC>CAC	p.R425H	DNAH1_uc003ddt.1_Missense_Mutation_p.R425H	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	425	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCTCGGATGCGCAAAGGCCCC	0.582													5	98	---	---	---	---	PASS
TMPRSS7	344805	broad.mit.edu	37	3	111795794	111795794	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111795794C>T	uc010hqb.2	+	14	1819	c.1649C>T	c.(1648-1650)CCG>CTG	p.P550L	TMPRSS7_uc011bhr.1_Missense_Mutation_p.P405L	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	676	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						TTTGTCTCCCCGGTGAGAAGA	0.453													121	215	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128521	147128521	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128521C>A	uc003ewe.2	+	1	1341	c.622C>A	c.(622-624)CAC>AAC	p.H208N		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	208					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GGCCGCGCATCACGGCGCCGG	0.642													15	64	---	---	---	---	PASS
P2RY1	5028	broad.mit.edu	37	3	152554551	152554551	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152554551C>T	uc003ezq.2	+	1	1816	c.980C>T	c.(979-981)GCG>GTG	p.A327V		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	327	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TATTTCTTGGCGGGAGATACT	0.463													5	129	---	---	---	---	PASS
SOD3	6649	broad.mit.edu	37	4	24801303	24801303	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24801303G>A	uc003gqz.2	+	2	365	c.160G>A	c.(160-162)GAC>AAC	p.D54N	SOD3_uc003gqy.1_RNA	NM_003102	NP_003093	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular precursor	54					removal of superoxide radicals	extracellular space|nucleus|soluble fraction	copper ion binding|heparin binding|protein binding|superoxide dismutase activity|zinc ion binding				0		Breast(46;0.0503)				GCAGCGGCGGGACGACGACGG	0.716													14	8	---	---	---	---	PASS
ANKRD56	345079	broad.mit.edu	37	4	77818329	77818329	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77818329G>A	uc003hki.2	-	1	674	c.674C>T	c.(673-675)CCG>CTG	p.P225L		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	225	Ala-rich.										0						AGCCCGTGCCGGCTTCTCCTC	0.706													4	9	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101834316	101834316	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101834316G>A	uc003knn.2	-	1	405	c.233C>T	c.(232-234)CCG>CTG	p.P78L	SLCO6A1_uc003kno.2_Missense_Mutation_p.P78L|SLCO6A1_uc003knp.2_Missense_Mutation_p.P78L|SLCO6A1_uc003knq.2_Missense_Mutation_p.P78L	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	78	Cytoplasmic (Potential).			KPG -> NRE (in Ref. 1; AAP33048).		integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CACTTCTCCCGGCTTCTTGGA	0.488													55	242	---	---	---	---	PASS
PCDHGC4	56098	broad.mit.edu	37	5	140865886	140865886	+	Silent	SNP	C	T	T	rs148184642	byFrequency	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140865886C>T	uc003lky.1	+	1	1146	c.1146C>T	c.(1144-1146)AAC>AAT	p.N382N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Silent_p.N382N|PCDHGC5_uc011dbc.1_5'Flank|PCDHGC5_uc003lla.1_5'Flank	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	382	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGGTCAAACGGAGATGTGA	0.562													6	98	---	---	---	---	PASS
KAAG1	353219	broad.mit.edu	37	6	24357720	24357720	+	Translation_Start_Site	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24357720C>T	uc003ndz.1	+	1	590	c.-147C>T	c.(-149--145)CACGT>CATGT		DCDC2_uc003ndx.2_Missense_Mutation_p.V87M|DCDC2_uc003ndy.2_Missense_Mutation_p.V87M	NM_181337	NP_851854	Q9UBP8	KAAG1_HUMAN	kidney associated antigen 1						immune response						0						CCTCCAGCCACGTAATTGCCC	0.587													40	105	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25472740	25472740	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25472740G>T	uc011djw.1	+	11	1241	c.865G>T	c.(865-867)GAG>TAG	p.E289*	LRRC16A_uc010jpx.2_Nonsense_Mutation_p.E289*|LRRC16A_uc010jpy.2_Nonsense_Mutation_p.E289*|LRRC16A_uc003nez.1_Nonsense_Mutation_p.E128*	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	289	LRR 2.				actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						CAACCCACTGGAGGATAGAGG	0.423													2	1	---	---	---	---	PASS
KIFC1	3833	broad.mit.edu	37	6	33377450	33377450	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33377450C>T	uc003oef.3	+	11	2455	c.2005C>T	c.(2005-2007)CAG>TAG	p.Q669*	KIFC1_uc011drf.1_Nonsense_Mutation_p.Q661*|PHF1_uc011drh.1_5'Flank|PHF1_uc003oeh.2_5'Flank|PHF1_uc003oei.2_5'Flank|PHF1_uc010jux.2_5'Flank	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	669					blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						TGGTACTGCTCAGGCCAACAG	0.363													39	259	---	---	---	---	PASS
FBXL4	26235	broad.mit.edu	37	6	99323344	99323344	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99323344T>G	uc003ppf.1	-	8	2007	c.1649A>C	c.(1648-1650)GAC>GCC	p.D550A	FBXL4_uc003ppg.1_Missense_Mutation_p.D550A|FBXL4_uc003pph.1_Missense_Mutation_p.D152A|FBXL4_uc010kcp.2_Missense_Mutation_p.D128A	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	550	LRR 7.				ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TTCATCAATGTCTGTGTCACA	0.413													46	121	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142764680	142764680	+	3'UTR	SNP	C	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142764680C>A	uc010khc.2	+	26					GPR126_uc010khd.2_3'UTR|GPR126_uc010khe.2_3'UTR|GPR126_uc010khf.2_3'UTR|GPR126_uc011edv.1_3'UTR	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		AATCAATCTGCAGAAATGTGA	0.323													5	73	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31377922	31377922	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31377922G>A	uc003tch.2	-	2	1314	c.961C>T	c.(961-963)CGC>TGC	p.R321C		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	321					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						GATTGGCTGCGCAGATGTAAG	0.478													10	145	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33573723	33573723	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33573723T>C	uc003tdn.1	+	21	2969	c.2456T>C	c.(2455-2457)TTA>TCA	p.L819S	BBS9_uc003tdo.1_Missense_Mutation_p.L784S|BBS9_uc003tdp.1_Missense_Mutation_p.L814S|BBS9_uc003tdq.1_Missense_Mutation_p.L779S|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Missense_Mutation_p.L343S|BBS9_uc003tds.1_Missense_Mutation_p.L242S|BBS9_uc003tdt.2_RNA	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	819					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			TGCGATAGATTATCCAAAGGT	0.493									Bardet-Biedl_syndrome				45	86	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	82996706	82996706	+	3'UTR	SNP	A	T	T	rs3801661	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82996706A>T	uc003uhy.1	-	17						NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				GCatttatttaaaaaattagt	0.249													7	5	---	---	---	---	PASS
C7orf23	79161	broad.mit.edu	37	7	86848787	86848787	+	Silent	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86848787G>A	uc003uio.2	-	1	245	c.33C>T	c.(31-33)ACC>ACT	p.T11T		NM_024315	NP_077291	Q9BU79	CG023_HUMAN	chromosome 7 open reading frame 23	11						integral to membrane					0	Esophageal squamous(14;0.0058)|all_lung(186;0.191)|Lung NSC(181;0.192)					CCAGGCCACTGGTGCCGTAGG	0.572										HNSCC(41;0.11)			16	68	---	---	---	---	PASS
FAM66D	100132923	broad.mit.edu	37	8	11985923	11985923	+	Intron	SNP	G	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11985923G>C	uc011kxo.1	+						FAM66D_uc011kxp.1_Intron|LOC392196_uc003wvb.1_RNA	NR_027425				Homo sapiens cDNA FLJ56781 complete cds.												0						GGATATTGCAGATTCTTGGCA	0.498													4	48	---	---	---	---	PASS
DOK2	9046	broad.mit.edu	37	8	21768190	21768190	+	Silent	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21768190C>T	uc003wzy.1	-	4	705	c.612G>A	c.(610-612)CGG>CGA	p.R204R	DOK2_uc003wzx.1_Silent_p.R204R|DOK2_uc003wzz.1_Silent_p.R50R|DOK2_uc010lth.1_Silent_p.R50R	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2	204	IRS-type PTB.				blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		TCACCTTGTCCCGCCCAAAGC	0.507													15	23	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144942667	144942667	+	Missense_Mutation	SNP	C	A	A	rs111431754		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144942667C>A	uc003zaa.1	-	1	4768	c.4755G>T	c.(4753-4755)ATG>ATT	p.M1585I		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1585	Plectin 26.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTGGGATGCTCATCCTCTCCT	0.647													33	26	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52595982	52595982	+	Silent	SNP	G	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52595982G>T	uc001jjj.2	-	6	644	c.456C>A	c.(454-456)ATC>ATA	p.I152I	A1CF_uc010qhn.1_Silent_p.I160I|A1CF_uc001jji.2_Silent_p.I152I|A1CF_uc001jjh.2_Silent_p.I160I|A1CF_uc010qho.1_Silent_p.I160I|A1CF_uc009xov.2_Silent_p.I152I	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	152	RRM 2.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TCTCCGATAAGATTTCTTCTC	0.463													19	196	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28058051	28058051	+	Silent	SNP	A	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28058051A>G	uc001msc.2	-	14	2291	c.2109T>C	c.(2107-2109)ATT>ATC	p.I703I		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	703					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GTGTATATACAATAGGCTGAA	0.383													48	191	---	---	---	---	PASS
CATSPER1	117144	broad.mit.edu	37	11	65793239	65793239	+	Silent	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65793239G>A	uc001ogt.2	-	1	750	c.612C>T	c.(610-612)CAC>CAT	p.H204H		NM_053054	NP_444282	Q8NEC5	CTSR1_HUMAN	sperm-associated cation channel 1	204	His-rich.|Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding			ovary(2)	2						GGGACTCATCGTGTTGGAGCC	0.617													5	137	---	---	---	---	PASS
CABP4	57010	broad.mit.edu	37	11	67223061	67223061	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67223061G>A	uc001olo.2	+	1	244	c.167G>A	c.(166-168)GGC>GAC	p.G56D	GPR152_uc001olm.2_5'Flank|CABP4_uc001oln.2_Intron	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	56					visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			AAGCGCACTGGCAGCTCTGGG	0.687													13	9	---	---	---	---	PASS
ACY3	91703	broad.mit.edu	37	11	67412278	67412278	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67412278G>A	uc001omq.2	-	7	868	c.697C>T	c.(697-699)CGC>TGC	p.R233C		NM_080658	NP_542389	Q96HD9	ACY3_HUMAN	aspartoacylase 3	233					interspecies interaction between organisms	apical plasma membrane|cytoplasm	hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)	GCCTCGGTGCGGGGGAAGTCC	0.562													4	7	---	---	---	---	PASS
GPR83	10888	broad.mit.edu	37	11	94134513	94134513	+	5'UTR	SNP	G	C	C	rs12791316	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94134513G>C	uc001pet.2	-	1						NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor							integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CAGCATACAAGGCCGTCCCGA	0.751													9	7	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101374961	101374961	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101374961G>A	uc001pgk.3	-	2	1164	c.739C>T	c.(739-741)CGG>TGG	p.R247W	TRPC6_uc009ywy.2_Missense_Mutation_p.R247W|TRPC6_uc009ywz.1_Missense_Mutation_p.R247W	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	247	Cytoplasmic (Potential).|ANK 4.				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TCATGAGGCCGTTCAATCCTA	0.478													79	180	---	---	---	---	PASS
CASP1	834	broad.mit.edu	37	11	104936938	104936938	+	Intron	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104936938C>T	uc010rve.1	-						CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|uc001piq.1_RNA	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor						cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	GTGCTCTGGGCGGTGAGCAAA	0.473													13	77	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22035727	22035727	+	Silent	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22035727G>A	uc001rfi.1	-	14	2012	c.1992C>T	c.(1990-1992)CCC>CCT	p.P664P	ABCC9_uc001rfh.2_Silent_p.P664P|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	664	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CTGTTTCTGCGGGACGTAGAC	0.383													56	232	---	---	---	---	PASS
KRT81	3887	broad.mit.edu	37	12	52680993	52680993	+	Silent	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52680993C>T	uc001sab.2	-	7	1190	c.1140G>A	c.(1138-1140)CAG>CAA	p.Q380Q	KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_5'UTR	NM_002281	NP_002272	Q14533	KRT81_HUMAN	keratin, hair, basic, 1	380	Rod.|Coil 2.					keratin filament	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCCATGTCCTGCTTGGCCT	0.672													5	152	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329453	88329453	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329453C>T	uc001vln.2	+	2	2029	c.1810C>T	c.(1810-1812)CGC>TGC	p.R604C	SLITRK5_uc010tic.1_Missense_Mutation_p.R363C	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	604	LRRCT 2.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GACCGACATGCGCTCCATTAA	0.567													21	208	---	---	---	---	PASS
COCH	1690	broad.mit.edu	37	14	31344035	31344035	+	Intron	SNP	G	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31344035G>T	uc001wqr.2	+						COCH_uc001wqp.2_5'UTR|COCH_uc001wqq.3_5'UTR	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor						sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		CGCCGCGCCCGGGGATCCGAA	0.711													3	53	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997025	54997025	+	Intron	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997025C>T	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						ATTGATCATTCTTGGTATACT	0.353													5	76	---	---	---	---	PASS
FUT8	2530	broad.mit.edu	37	14	66208993	66208993	+	Silent	SNP	G	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66208993G>C	uc001xin.2	+	11	2790	c.1593G>C	c.(1591-1593)GTG>GTC	p.V531V	FUT8_uc001xio.2_Silent_p.V531V|FUT8_uc010tsp.1_Silent_p.V368V|FUT8_uc001xir.3_RNA|FUT8_uc001xip.2_Silent_p.V531V|FUT8_uc001xiq.2_Silent_p.V402V|FUT8_uc001xis.2_Silent_p.V125V	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a	531	SH3.|Lumenal (Potential).				in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		TCATTGGTGTGGCTGGAAATC	0.463													20	181	---	---	---	---	PASS
MIR543	100126335	broad.mit.edu	37	14	101498368	101498368	+	RNA	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101498368C>T	hsa-mir-543|MI0005565	+			c.45C>T			MIR495_hsa-mir-495|MI0003135_5'Flank																	0						TTATTTGTGACGAAACATTCG	0.502													8	120	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106691922	106691922	+	RNA	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106691922C>T	uc010tyt.1	-	754		c.20441G>A								Parts of antibodies, mostly variable regions.												0						TCAGGGACCCCCCAGGCTTGA	0.587													9	185	---	---	---	---	PASS
BCL8	606	broad.mit.edu	37	15	20874901	20874901	+	Silent	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20874901G>A	uc010tze.1	-	3	444	c.237C>T	c.(235-237)ACC>ACT	p.T79T	BCL8_uc010tzd.1_RNA	NR_027992				RecName: Full=Putative protein BCL8;												0						TTCTGCATATGGTGGTGTAGA	0.333													3	67	---	---	---	---	PASS
IL21R	50615	broad.mit.edu	37	16	27455956	27455956	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27455956C>T	uc002doq.1	+	6	834	c.601C>T	c.(601-603)CGG>TGG	p.R201W	IL21R_uc002dor.1_Missense_Mutation_p.R201W|IL21R_uc002dos.1_Missense_Mutation_p.R201W	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	201	Extracellular (Potential).|Fibronectin type-III.				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						GCTGCAGGTGCGGGCAGGGCC	0.597			T	BCL6	NHL								8	239	---	---	---	---	PASS
ATP2C2	9914	broad.mit.edu	37	16	84402275	84402275	+	Silent	SNP	G	C	C	rs62048787	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84402275G>C	uc002fhx.2	+	1	143	c.54G>C	c.(52-54)GGG>GGC	p.G18G	ATP2C2_uc010chj.2_Silent_p.G18G	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	18	Cytoplasmic (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						TCTCGGGCGGGGGCCGCCAGT	0.706													4	1	---	---	---	---	PASS
TRIM16L	147166	broad.mit.edu	37	17	18638817	18638817	+	3'UTR	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18638817G>A	uc002gug.1	+	10					TRIM16L_uc010vyf.1_3'UTR|TRIM16L_uc002guh.1_3'UTR|TRIM16L_uc010cqg.1_3'UTR|TRIM16L_uc002gui.1_3'UTR|TRIM16L_uc010vyg.1_3'UTR|TRIM16L_uc010vyh.1_3'UTR	NM_001037330	NP_001032407	Q309B1	TR16L_HUMAN	tripartite motif-containing 16-like							cytoplasm					0						TACAGTGATGGGATTTGCATT	0.512													4	28	---	---	---	---	PASS
TBC1D29	26083	broad.mit.edu	37	17	28890361	28890361	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28890361G>A	uc002hfh.2	+	5	520	c.371G>A	c.(370-372)CGG>CAG	p.R124Q	TBC1D29_uc002hfi.2_RNA	NM_015594	NP_056409	Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	124						intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)				GCCTTGAGCCGGGGAGACAAG	0.423													5	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76497744	76497744	+	RNA	SNP	T	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76497744T>G	uc002jvt.1	+	2		c.3203T>G								Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		AGTGGCAGGGTCTGAAGTCCC	0.627													13	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76497776	76497776	+	RNA	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76497776G>A	uc002jvt.1	+	2		c.3235G>A								Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		CCCTGAACCCGGTGTCCCCTT	0.632													9	125	---	---	---	---	PASS
SGSH	6448	broad.mit.edu	37	17	78187975	78187975	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78187975A>G	uc002jxz.3	-	5	746	c.659T>C	c.(658-660)GTG>GCG	p.V220A	SGSH_uc002jya.3_Missense_Mutation_p.V17A|SGSH_uc002jxy.2_Missense_Mutation_p.V220A|SGSH_uc010wue.1_Missense_Mutation_p.C232R	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	220					proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TCCTACCAGCACGTCCAGTGG	0.637													11	21	---	---	---	---	PASS
AATK	9625	broad.mit.edu	37	17	79094618	79094618	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79094618T>C	uc010dia.2	-	11	3198	c.3118A>G	c.(3118-3120)AGG>GGG	p.R1040G	AATK_uc010dhz.2_Intron	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1040						integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			ACCCCAGGCCTGAGACAGACC	0.716													2	11	---	---	---	---	PASS
THOC4	10189	broad.mit.edu	37	17	79845849	79845849	+	3'UTR	SNP	A	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79845849A>G	uc002kbu.2	-	6						NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4						intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			aaaaaaaaaaagaaaaaaaaa	0.358													2	2	---	---	---	---	PASS
ZNF24	7572	broad.mit.edu	37	18	32917272	32917272	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32917272T>C	uc002kyt.2	-	4	1188	c.1031A>G	c.(1030-1032)TAT>TGT	p.Y344C	ZNF24_uc002kys.2_Missense_Mutation_p.Y344C	NM_006965	NP_008896	P17028	ZNF24_HUMAN	zinc finger protein 24	344	C2H2-type 4.				myelination|negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GCTTTGACTATACGATTTCCC	0.358													21	169	---	---	---	---	PASS
GZMM	3004	broad.mit.edu	37	19	548562	548562	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:548562T>G	uc002low.1	+	3	278	c.233T>G	c.(232-234)GTG>GGG	p.V78G		NM_005317	NP_005308	P51124	GRAM_HUMAN	granzyme M precursor	78	Peptidase S1.				apoptosis|cytolysis|innate immune response|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGAGGCTGGTGCTGGGGCTC	0.687													11	54	---	---	---	---	PASS
PIP5K1C	23396	broad.mit.edu	37	19	3661952	3661952	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3661952G>T	uc002lyj.1	-	4	324	c.267C>A	c.(265-267)TAC>TAA	p.Y89*	PIP5K1C_uc010xhq.1_Nonsense_Mutation_p.Y89*|PIP5K1C_uc010xhr.1_Nonsense_Mutation_p.Y89*	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	89	PIPK.				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GGCCCACGGTGTAGCCGATGC	0.682													5	15	---	---	---	---	PASS
UBXN6	80700	broad.mit.edu	37	19	4445365	4445365	+	3'UTR	SNP	C	G	G	rs59258359	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4445365C>G	uc002man.1	-	11					UBXN6_uc010dty.1_3'UTR|UBXN6_uc002mam.1_3'UTR	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6							microtubule organizing center|nucleus	protein binding				0						CCACGGCTGGCGCCCCTCCCG	0.692													8	19	---	---	---	---	PASS
AKAP8L	26993	broad.mit.edu	37	19	15512380	15512380	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15512380C>T	uc002naw.1	-	5	496	c.397G>A	c.(397-399)GTC>ATC	p.V133I	AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Missense_Mutation_p.V72I|AKAP8L_uc002nay.1_Missense_Mutation_p.V133I|AKAP8L_uc002naz.2_5'UTR	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	133						cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						TCACTCAGGACGGCCCTCGAG	0.592													5	23	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	16003198	16003198	+	Missense_Mutation	SNP	C	T	T	rs140630977		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16003198C>T	uc002nbs.1	-	5	496	c.446G>A	c.(445-447)CGG>CAG	p.R149Q	CYP4F2_uc010xot.1_5'UTR|CYP4F2_uc010xou.1_5'UTR	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	149					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding	p.R149Q(1)		ovary(1)|skin(1)	2						CGTCAGCATCCGACGGTGGCG	0.567													27	131	---	---	---	---	PASS
IGFL4	444882	broad.mit.edu	37	19	46543095	46543095	+	3'UTR	SNP	A	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46543095A>G	uc002pdy.1	-	4						NM_001002923	NP_001002923	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4 precursor							extracellular region					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		AATGCAGTATAATTACCAAGT	0.239													4	69	---	---	---	---	PASS
PTPRA	5786	broad.mit.edu	37	20	2968390	2968390	+	3'UTR	SNP	C	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2968390C>G	uc010zqb.1	+	6					PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_5'UTR|PTPRA_uc002whn.2_Intron|PTPRA_uc002who.2_5'UTR			P18433	PTPRA_HUMAN	SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						CACTCACCCTCTCTCTACCTG	0.507													2	10	---	---	---	---	PASS
LOC644165	644165	broad.mit.edu	37	22	25042887	25042887	+	Intron	SNP	G	A	A	rs75939659	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25042887G>A	uc011ajv.1	+						POM121L10P_uc003aaz.3_RNA|POM121L10P_uc003abc.2_RNA	NR_024494				Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).												0						CCCACCTCCGGGTGTGCAGAT	0.612													4	10	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42524924	42524924	+	Silent	SNP	A	G	G	rs111606937	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42524924A>G	uc003bce.2	-	4	618	c.528T>C	c.(526-528)GGT>GGC	p.G176G	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_5'UTR|CYP2D6_uc003bcf.2_Silent_p.G125G	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	176							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TGTCCAAGAGACCGTTGGGGC	0.667													3	13	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73061256	73061256	+	RNA	SNP	C	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73061256C>T	uc004ebm.1	-	1		c.11333G>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						TACAGCTGTCCGAGGAGCTAG	0.393													26	21	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86888856	86888856	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86888856G>A	uc004efb.2	+	8	1839	c.1657G>A	c.(1657-1659)GTA>ATA	p.V553I	KLHL4_uc004efa.2_Missense_Mutation_p.V553I	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	553	Kelch 3.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GTGGAATTACGTAGCCAGTAT	0.433													5	41	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3418615	3418615	+	Intron	DEL	G	-	-	rs111656273		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3418615delG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GTGCCCCCCCGGCGCCTCCTC	0.711													7	4	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484633	121484633	+	IGR	DEL	T	-	-	rs4898120		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484633delT								LOC647121 (170947 upstream) : None (None downstream)																							agagtttaacttttcttttca	0.000													2630	15	---	---	---	---	
ETV3	2117	broad.mit.edu	37	1	157104016	157104017	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157104016_157104017insT	uc001fqr.2	-	4	576_577	c.287_288insA	c.(286-288)TACfs	p.Y96fs	ETV3_uc001fqt.2_Frame_Shift_Ins_p.Y96fs	NM_001145312	NP_001138784	P41162	ETV3_HUMAN	ets variant gene 3 isoform 1	96	ETS.						sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TGTTGTAATAGTATCTGTAAAA	0.371													39	46	---	---	---	---	
CENPL	91687	broad.mit.edu	37	1	173772815	173772816	+	Intron	INS	-	T	T	rs141936109		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173772815_173772816insT	uc001gje.3	-						CENPL_uc009wwg.2_Intron|CENPL_uc001gjg.3_Intron|CENPL_uc001gjf.3_Intron	NM_033319	NP_201576	Q8N0S6	CENPL_HUMAN	centromere protein L isoform 2						mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus					0						AATAATTGGCCttttttttttt	0.163													6	3	---	---	---	---	
ACBD6	84320	broad.mit.edu	37	1	180471041	180471041	+	Intron	DEL	A	-	-	rs5779061		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180471041delA	uc001gog.2	-							NM_032360	NP_115736	Q9BR61	ACBD6_HUMAN	acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1						GCAGATGGTCAAAAAAAAAAA	0.383													4	2	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183211975	183211975	+	Intron	DEL	T	-	-	rs34898091		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183211975delT	uc001gqa.2	+							NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TTCAGTCCTCTTTTTTTTTTT	0.393													5	3	---	---	---	---	
C1orf106	55765	broad.mit.edu	37	1	200876788	200876789	+	Intron	INS	-	A	A	rs72126102		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200876788_200876789insA	uc001gvo.2	+						C1orf106_uc010ppm.1_Intron	NM_018265	NP_060735	Q3KP66	CA106_HUMAN	hypothetical protein LOC55765 isoform 1											skin(2)|ovary(1)	3						ccctgtctcttaaaaaaaaaaa	0.218													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222641941	222641942	+	IGR	INS	-	C	C			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222641941_222641942insC								DUSP10 (726480 upstream) : HHIPL2 (53660 downstream)																							GTCCCTCAGTGCCTGCGCAAGG	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71004413	71004414	+	IGR	INS	-	A	A	rs55926232		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004413_71004414insA								ADD2 (9084 upstream) : FIGLA (28 downstream)																							aactctatctcaaaaaaaaaaa	0.163													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91634445	91634448	+	IGR	DEL	TTTG	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91634445_91634448delTTTG								None (None upstream) : LOC654342 (170744 downstream)																							AACTTACATCTTTGTTTGTCTTCC	0.392													4	2	---	---	---	---	
HIBCH	26275	broad.mit.edu	37	2	191110716	191110716	+	Intron	DEL	A	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191110716delA	uc002uru.2	-						HIBCH_uc002urv.2_Intron	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform						branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			actctgtctcaaaaaaaaaaa	0.104													5	3	---	---	---	---	
SUCLG2	8801	broad.mit.edu	37	3	67666046	67666047	+	Intron	DEL	AC	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67666046_67666047delAC	uc003dna.3	-							NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	acaaacacaaacacacacacac	0.010													4	2	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541861	81541868	+	Intron	DEL	TTCCTTCC	-	-	rs67220037		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541861_81541868delTTCCTTCC	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ctttcttcctttccttccttccttcctt	0.000									Glycogen_Storage_Disease_type_IV				5	3	---	---	---	---	
CEP97	79598	broad.mit.edu	37	3	101483456	101483457	+	Intron	DEL	AA	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101483456_101483457delAA	uc003dvk.1	+						CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Intron|CEP97_uc003dvm.1_Intron	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2						actccatctcaaaaaaaaaaaa	0.000													3	3	---	---	---	---	
DCLK2	166614	broad.mit.edu	37	4	151120062	151120063	+	Intron	INS	-	C	C	rs71596224		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151120062_151120063insC	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					CCCTTTCAGCACCCCCCCCCCC	0.446													4	2	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64595644	64595644	+	Intron	DEL	A	-	-	rs3832321		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64595644delA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTATATGAAGAAAAAAAAATT	0.308													1	5	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73142411	73142412	+	Intron	INS	-	T	T	rs142259999	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73142411_73142412insT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CATATGAACTATTTTTTTGAGA	0.287													8	5	---	---	---	---	
DHFR	1719	broad.mit.edu	37	5	79945228	79945232	+	Frame_Shift_Del	DEL	TAAAT	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79945228_79945232delTAAAT	uc003kgy.1	-	3	710_714	c.218_222delATTTA	c.(217-222)AATTTAfs	p.N73fs	DHFR_uc011ctl.1_Frame_Shift_Del_p.N153fs|DHFR_uc011ctm.1_Frame_Shift_Del_p.N21fs|DHFR_uc010jap.1_RNA|DHFR_uc003kgx.1_Frame_Shift_Del_p.N222fs	NM_000791	NP_000782	P00374	DYR_HUMAN	dihydrofolate reductase	73_74	DHFR.				folic acid metabolic process|glycine biosynthetic process|nucleotide biosynthetic process|one-carbon metabolic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to methotrexate|tetrahydrofolate metabolic process	cytosol	dihydrofolate reductase activity|drug binding|folate reductase activity|NADP binding				0		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.69e-46)|Epithelial(54;7.49e-41)|all cancers(79;1.54e-35)	Dapsone(DB00250)|Dimethyl sulfoxide(DB01093)|Lamotrigine(DB00555)|Methotrexate(DB00563)|NADH(DB00157)|Pemetrexed(DB00642)|Proguanil(DB01131)|Pyrimethamine(DB00205)|Trimethoprim(DB00440)|Trimetrexate(DB01157)	TGCTGAGAACTAAATTAATTCTACC	0.332													74	23	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7576359	7576359	+	Intron	DEL	T	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7576359delT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ttgtttccagtttttggctgt	0.000													4	2	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72662349	72662350	+	Intron	DEL	AA	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72662349_72662350delAA	uc003txs.1	-						FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						ctctgtctccaaaaaaaaaaaa	0.183													9	4	---	---	---	---	
PCOLCE	5118	broad.mit.edu	37	7	100201002	100201002	+	Intron	DEL	C	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100201002delC	uc003uvo.2	+						uc011kjy.1_Intron|PCOLCE_uc011kkb.1_Intron|PCOLCE_uc010lhb.1_Intron|PCOLCE_uc003uvp.1_5'Flank	NM_002593	NP_002584	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer						multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity				0	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TGCCAGTGCTCCCCCGTCCCA	0.582													55	19	---	---	---	---	
AGBL3	340351	broad.mit.edu	37	7	134813072	134813073	+	Intron	DEL	CG	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134813072_134813073delCG	uc011kpw.1	+						uc003vsg.2_Intron|C7orf49_uc003vsh.2_Intron	NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						aaaaaaaaaacgaaaaaaaaaa	0.005													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142190796	142190796	+	Intron	DEL	T	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142190796delT	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		AACTCAGCAATTCCAGTCCCT	0.463													3	4	---	---	---	---	
ASB10	136371	broad.mit.edu	37	7	150878702	150878702	+	Intron	DEL	T	-	-	rs112543142		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150878702delT	uc003wjm.1	-						ASB10_uc003wjl.1_Intron|ASB10_uc003wjn.1_Intron	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10						intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTGCCCttcttttttttttt	0.284													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3205827	3205828	+	Intron	INS	-	T	T	rs140023053	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3205827_3205828insT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAGATCAGTGATTTTTTTTTAT	0.302													4	3	---	---	---	---	
STC1	6781	broad.mit.edu	37	8	23709570	23709571	+	Intron	DEL	TG	-	-	rs113294965		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23709570_23709571delTG	uc003xdw.1	-							NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor						cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TGAGTGCCTCtgtgtgtgtgtg	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93591561	93591562	+	IGR	INS	-	TTTC	TTTC	rs34835405		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93591561_93591562insTTTC								RUNX1T1 (483855 upstream) : C8orf83 (304303 downstream)																							ctttctttctttttctttcttt	0.000													5	3	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100026338	100026339	+	Intron	INS	-	TTT	TTT			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100026338_100026339insTTT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yit.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yis.2_Intron|VPS13B_uc011lgy.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ttctttctttcttttttttttt	0.139													32	7	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101116558	101116561	+	Intron	DEL	GTGT	-	-	rs34385626		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101116558_101116561delGTGT	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			aaaTAtgtgcgtgtgtgtgtgtgt	0.127													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140027649	140027650	+	IGR	INS	-	GTGTGTGTGTGT	GTGTGTGTGTGT	rs139596738	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140027649_140027650insGTGTGTGTGTGT								COL22A1 (101413 upstream) : KCNK9 (585432 downstream)																							tacctatcgcagtgtgtgtgtg	0.153													5	3	---	---	---	---	
UBQLN1	29979	broad.mit.edu	37	9	86276533	86276533	+	3'UTR	DEL	T	-	-	rs33950155		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86276533delT	uc004amv.2	-	11					UBQLN1_uc004amw.2_3'UTR	NM_013438	NP_038466	Q9UMX0	UBQL1_HUMAN	ubiquilin 1 isoform 1						apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0						AAAAGAAAAATACAGAAAAAC	0.338													2	7	---	---	---	---	
NOL8	55035	broad.mit.edu	37	9	95069196	95069199	+	Frame_Shift_Del	DEL	TGTT	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95069196_95069199delTGTT	uc004arv.2	-	11	3131_3134	c.2794_2797delAACA	c.(2794-2799)AACAGAfs	p.N932fs	NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Frame_Shift_Del_p.N164fs|NOL8_uc011ltw.1_Frame_Shift_Del_p.N864fs	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN	nucleolar protein 8	932_933					DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding			ovary(1)	1						ACTGATCCTCTGTTTGTAGAATTG	0.338													281	7	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138838420	138838420	+	Intron	DEL	A	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138838420delA	uc004cgt.2	-						UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_Intron	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		AAGCCAGTGGAAAGGGACAGG	0.622													4	2	---	---	---	---	
AKR1C3	8644	broad.mit.edu	37	10	5091308	5091309	+	Intron	INS	-	T	T	rs144498722	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5091308_5091309insT	uc001ihr.2	+							NM_003739	NP_003730	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3						prostaglandin metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (A-specific) activity|indanol dehydrogenase activity|prostaglandin-F synthase activity|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			skin(1)	1					Dimethyl sulfoxide(DB01093)|NADH(DB00157)	TTGGGGCACTGTTTTTTTTCTT	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599753	42599753	+	IGR	DEL	A	-	-	rs144849414		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599753delA								None (None upstream) : LOC441666 (227562 downstream)																							tggaatcgtcatcgaatgaat	0.000													1086	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42600089	42600091	+	IGR	DEL	TCG	-	-	rs76005385		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42600089_42600091delTCG								None (None upstream) : LOC441666 (227224 downstream)																							acgaatggaatcgtcatcgaatg	0.000													265	8	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73405973	73405974	+	Intron	INS	-	A	A	rs143606744	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73405973_73405974insA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jry.2_Intron|CDH23_uc001jrz.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTCCCATCAGGAGCCTCTGCAA	0.564													4	6	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73570839	73570839	+	Intron	DEL	A	-	-	rs35466313		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73570839delA	uc001jrx.3	+						CDH23_uc001jsg.3_Intron|CDH23_uc001jsh.3_Intron|CDH23_uc001jsi.3_Intron|CDH23_uc001jsj.3_5'Flank|CDH23_uc010qjr.1_5'Flank	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						actccatctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88836153	88836153	+	Intron	DEL	A	-	-	rs5786757		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88836153delA	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCCCCCATGTAAAAAAAAAAG	0.259													4	3	---	---	---	---	
C11orf74	119710	broad.mit.edu	37	11	36631556	36631566	+	Intron	DEL	CCTACCCATCC	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36631556_36631566delCCTACCCATCC	uc001mwy.1	+						C11orf74_uc010rfd.1_Intron|C11orf74_uc001mww.1_Intron|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Intron|C11orf74_uc010rfe.1_Intron	NM_138787	NP_620142	Q86VG3	CK074_HUMAN	hypothetical protein LOC119710												0	all_lung(20;0.226)	all_hematologic(20;0.0118)				AATTTTTCAACCTACCCATCCAGAATATTTT	0.408													51	12	---	---	---	---	
C11orf85	283129	broad.mit.edu	37	11	64708307	64708308	+	Intron	INS	-	TTT	TTT	rs56019033		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708307_64708308insTTT	uc001ocb.1	-						C11orf85_uc001occ.1_Intron|C11orf85_uc001ocd.1_Intron	NM_001037225	NP_001032302	Q3KP22	CK085_HUMAN	hypothetical protein LOC283129												0						ttttttctttcttttttttttt	0.173													6	3	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077186	73077187	+	Intron	DEL	GC	-	-	rs55848894		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077186_73077187delGC	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						gtgtgtgtgtgCGCACCTGCAT	0.366													8	4	---	---	---	---	
RND1	27289	broad.mit.edu	37	12	49252172	49252172	+	Intron	DEL	C	-	-	rs74088505		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49252172delC	uc001rsn.2	-							NM_014470	NP_055285	Q92730	RND1_HUMAN	GTP-binding protein RHO6 precursor						actin filament organization|axon guidance|negative regulation of cell adhesion|neuron remodeling|small GTPase mediated signal transduction	adherens junction|cytoskeleton|cytosol	GTP binding|GTPase activity|receptor binding			ovary(1)	1						ATTATCttttctttttttttt	0.388													6	4	---	---	---	---	
MYBPC1	4604	broad.mit.edu	37	12	102008088	102008089	+	Intron	DEL	GT	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102008088_102008089delGT	uc001tii.2	+						MYBPC1_uc001tif.1_Intron|MYBPC1_uc001tig.2_Intron|MYBPC1_uc010svq.1_Intron|MYBPC1_uc001tih.2_Intron|MYBPC1_uc001tij.2_Intron|MYBPC1_uc010svr.1_Intron|MYBPC1_uc010svs.1_Intron|MYBPC1_uc010svt.1_Intron|MYBPC1_uc010svu.1_Intron|MYBPC1_uc001tik.2_Intron	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						ATGCAGTAGGGTGTGTGTGTGT	0.411													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145491	119145492	+	IGR	INS	-	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145491_119145492insG								SUDS3 (289652 upstream) : SRRM4 (273904 downstream)																							gtggtggtgatgtggtggtgat	0.000													6	5	---	---	---	---	
UCHL3	7347	broad.mit.edu	37	13	76141688	76141688	+	Intron	DEL	T	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76141688delT	uc001vjq.2	+						UCHL3_uc001vjr.2_Intron	NM_006002	NP_005993	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3						ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)		GATTTACAAAttttttttttt	0.149													4	2	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101833193	101833194	+	Intron	DEL	TC	-	-	rs34427526		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101833193_101833194delTC	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_3'UTR|NALCN_uc001vpa.2_3'UTR	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACACGCTTTGTCTCTCTCTCTC	0.485													4	3	---	---	---	---	
CCDC78	124093	broad.mit.edu	37	16	773292	773292	+	Intron	DEL	C	-	-	rs67977308		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773292delC	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GAGGCATGGGCCCCCCCCGTG	0.687													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3010024	3010035	+	IGR	DEL	ACCTACCTACCT	-	-	rs111260640		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3010024_3010035delACCTACCTACCT								FLYWCH1 (8816 upstream) : KREMEN2 (4182 downstream)																							caaccaaccaacctacctacctacctacctac	0.009													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													55	7	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58540061	58540062	+	Intron	DEL	TC	-	-	rs72499708		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58540061_58540062delTC	uc002eno.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc002enm.2_Intron|NDRG4_uc010vif.1_Intron|NDRG4_uc010cdk.2_Intron|NDRG4_uc010vig.1_Intron|NDRG4_uc010vih.1_Intron|NDRG4_uc010vii.1_Intron|NDRG4_uc002enp.2_Intron|NDRG4_uc002enq.1_5'UTR	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						tgtgtgtgtgtctgtgtgtgtg	0.307													4	2	---	---	---	---	
NLRP1	22861	broad.mit.edu	37	17	5462267	5462268	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5462267_5462268insT	uc002gci.2	-	4	2303_2304	c.1748_1749insA	c.(1747-1749)AAGfs	p.K583fs	NLRP1_uc002gcg.1_Frame_Shift_Ins_p.K583fs|NLRP1_uc002gck.2_Frame_Shift_Ins_p.K583fs|NLRP1_uc002gcj.2_Frame_Shift_Ins_p.K583fs|NLRP1_uc002gcl.2_Frame_Shift_Ins_p.K583fs|NLRP1_uc002gch.3_Frame_Shift_Ins_p.K583fs|NLRP1_uc010clh.2_Frame_Shift_Ins_p.K583fs	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	583	NACHT.				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				TGAAAAGGGTCTTTTTTTGCCA	0.535													101	7	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													4	3	---	---	---	---	
AKAP10	11216	broad.mit.edu	37	17	19851058	19851058	+	Intron	DEL	C	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19851058delC	uc002gwo.2	-						AKAP10_uc002gwp.1_Intron|AKAP10_uc010cqw.1_Intron|AKAP10_uc010vze.1_Intron	NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					tacttttacaccaaaataaac	0.065													4	2	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36909737	36909737	+	Intron	DEL	T	-	-	rs35484180		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36909737delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						CTTCCCtttcttttttttttt	0.264													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													6	3	---	---	---	---	
ABCA5	23461	broad.mit.edu	37	17	67248158	67248158	+	Intron	DEL	T	-	-	rs12942723		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67248158delT	uc002jif.2	-						ABCA5_uc002jib.2_Intron|ABCA5_uc002jic.2_Intron|ABCA5_uc002jid.2_Intron|ABCA5_uc002jie.2_Intron|ABCA5_uc002jig.2_Intron	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					CCAACTATGAttttttttttt	0.149													4	2	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76425005	76425006	+	Intron	INS	-	A	A	rs60351485		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76425005_76425006insA	uc010dhp.1	-						DNAH17_uc002jvq.2_Intron|DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTTCTTTCTTTaaaaaaaaaaa	0.446													4	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78576273	78576274	+	Intron	INS	-	G	G			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78576273_78576274insG	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gcagaggggctGGTTCAGTTTT	0.173													4	2	---	---	---	---	
ZCCHC2	54877	broad.mit.edu	37	18	60228069	60228073	+	Intron	DEL	TTTTG	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60228069_60228073delTTTTG	uc002lip.3	+						ZCCHC2_uc002lio.2_Intron|ZCCHC2_uc002liq.2_Intron	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2						cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						tgtggtttttttttgttttgttttg	0.000													4	2	---	---	---	---	
MKNK2	2872	broad.mit.edu	37	19	2039434	2039435	+	3'UTR	INS	-	A	A	rs141256199	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2039434_2039435insA	uc002lus.2	-	14					MKNK2_uc002luq.1_Intron|MKNK2_uc010xgu.1_3'UTR|MKNK2_uc010xgv.1_3'UTR|MKNK2_uc002lur.2_Intron|MKNK2_uc002lut.1_3'UTR	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGAAACAGGAAAAAAAAAAC	0.535													6	4	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13345546	13345570	+	Intron	DEL	CCCCTACCGGAAGAGAAGGGCACGC	-	-	rs3835077	by1000genomes	TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13345546_13345570delCCCCTACCGGAAGAGAAGGGCACGC	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GCCGGCACGTCCCCTACCGGAAGAGAAGGGCACGCCCCCTACCGG	0.604											OREG0025293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	6	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16617403	16617404	+	Intron	INS	-	A	A			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16617403_16617404insA	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						gactctatctcaaaaaaaaaaa	0.084													5	3	---	---	---	---	
COMP	1311	broad.mit.edu	37	19	18898679	18898680	+	Intron	INS	-	TT	TT	rs71825512		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18898679_18898680insTT	uc002nke.2	-						COMP_uc002nkd.2_Intron|COMP_uc010xqj.1_Intron	NM_000095	NP_000086	P49747	COMP_HUMAN	cartilage oligomeric matrix protein precursor						anti-apoptosis|apoptosis|cell adhesion|limb development	extracellular space|proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent|heparan sulfate proteoglycan binding|heparin binding				0						ttttctctttctttctttcttt	0.228													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27731986	27731989	+	IGR	DEL	TGTT	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27731986_27731989delTGTT								None (None upstream) : LOC148189 (549413 downstream)																							ggaaacactctgtttgtaaagtct	0.000													693	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27732215	27732216	+	IGR	INS	-	C	C	rs74197760		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27732215_27732216insC								None (None upstream) : LOC148189 (549186 downstream)																							agaaaaggaaatatcttcgtat	0.000													1790	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736453	27736453	+	IGR	DEL	T	-	-	rs4567863		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736453delT								None (None upstream) : LOC148189 (544949 downstream)																							tggaaacgggtttttttcttg	0.000													471	14	---	---	---	---	
SIRT2	22933	broad.mit.edu	37	19	39370448	39370449	+	Intron	INS	-	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39370448_39370449insT	uc002ojt.1	-						RINL_uc002ojq.2_5'Flank|RINL_uc010xuo.1_5'Flank|SIRT2_uc010egh.1_Intron|SIRT2_uc010egi.1_Intron|SIRT2_uc002ojs.1_Intron|SIRT2_uc002oju.1_Intron|SIRT2_uc010egj.1_Intron|SIRT2_uc002ojv.1_Intron	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1						cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			ctgtgactttgttttttttttg	0.139													4	2	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56569395	56569395	+	Intron	DEL	A	-	-	rs150910153		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56569395delA	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		atgctatctcaaaaaaaaaaa	0.005													6	5	---	---	---	---	
RBBP9	10741	broad.mit.edu	37	20	18476307	18476307	+	Intron	DEL	G	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18476307delG	uc002wqy.2	-							NM_006606	NP_006597	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9							cytoplasm|nucleus	hydrolase activity			haematopoietic_and_lymphoid_tissue(1)	1						aaaaaaAAAAGAATTTTCTAT	0.209													5	4	---	---	---	---	
UMODL1	89766	broad.mit.edu	37	21	43542773	43542774	+	Intron	DEL	GT	-	-	rs111885176		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43542773_43542774delGT	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|UMODL1_uc002zal.1_Intron	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						atatgtgtgcgtgtgtgtgtgt	0.223													6	3	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47787225	47787226	+	Intron	INS	-	T	T			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47787225_47787226insT	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					GTGAACTGGGCttttttttttt	0.292													4	3	---	---	---	---	
MAPK1	5594	broad.mit.edu	37	22	22153007	22153007	+	Intron	DEL	A	-	-			TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22153007delA	uc002zvn.2	-						MAPK1_uc002zvo.2_Intron|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26761678	26761678	+	Intron	DEL	A	-	-	rs675083		TCGA-CH-5751-01	TCGA-CH-5751-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26761678delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						catctctaccaaaaaaaaaaa	0.114													4	2	---	---	---	---	
