Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLCH2	9651	broad.mit.edu	37	1	2419086	2419086	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2419086C>A	uc001aji.1	+	8	1438	c.1164C>A	c.(1162-1164)TAC>TAA	p.Y388*	PLCH2_uc010nyz.1_Nonsense_Mutation_p.Y176*|PLCH2_uc009vle.1_Nonsense_Mutation_p.Y176*|PLCH2_uc001ajj.1_Nonsense_Mutation_p.Y176*|PLCH2_uc001ajk.1_Nonsense_Mutation_p.Y176*	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	388	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		ACCATGGCTACACTCTGACTT	0.592													5	64	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10231330	10231330	+	Silent	SNP	G	A	A	rs142901446		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10231330G>A	uc001aqs.3	+	25	4181	c.3468G>A	c.(3466-3468)ACG>ACA	p.T1156T	UBE4B_uc001aqr.3_Silent_p.T1027T|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Silent_p.T611T|UBE4B_uc001aqu.2_Silent_p.T37T	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	1156					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		ACCAACTGACGGATATTTACT	0.478													81	232	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12337950	12337950	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12337950T>G	uc001atv.2	+	19	4446	c.4305T>G	c.(4303-4305)AAT>AAG	p.N1435K	VPS13D_uc001atw.2_Missense_Mutation_p.N1435K|VPS13D_uc001atx.2_Missense_Mutation_p.N623K	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1435					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATTCTTTGAATTGCACCCAGT	0.498													88	179	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918717	16918717	+	5'UTR	SNP	C	T	T	rs3872321	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918717C>T	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AAACAAGGTTCGAGGTGCCTG	0.478													3	26	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16955128	16955128	+	5'Flank	SNP	A	G	G	rs1762949	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16955128A>G	uc010ocf.1	-						CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA|CROCCL1_uc001azg.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CAGGCTGTGGACCAGGTTGCT	0.682													2	10	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23110993	23110993	+	Missense_Mutation	SNP	C	T	T	rs139122679		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23110993C>T	uc009vqj.1	+	3	380	c.235C>T	c.(235-237)CGG>TGG	p.R79W	EPHB2_uc001bge.2_Missense_Mutation_p.R79W|EPHB2_uc001bgf.2_Missense_Mutation_p.R79W|EPHB2_uc010odu.1_Missense_Mutation_p.R79W	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	79	Extracellular (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CAAGTTTATCCGGCGCCGTGG	0.577									Hereditary_Prostate_Cancer				20	33	---	---	---	---	PASS
GJB3	2707	broad.mit.edu	37	1	35250643	35250643	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35250643C>A	uc001bxx.2	+	2	895	c.280C>A	c.(280-282)CAC>AAC	p.H94N	GJB3_uc001bxy.2_Missense_Mutation_p.H94N|GJB3_uc001bxz.3_Missense_Mutation_p.H94N|uc010ohs.1_RNA	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	94	Helical; (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GGTCATCCTGCACGTGGCCTA	0.632													11	82	---	---	---	---	PASS
EDN2	1907	broad.mit.edu	37	1	41948239	41948239	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41948239A>T	uc001cgx.2	-	3	314	c.242T>A	c.(241-243)CTG>CAG	p.L81Q	EDN2_uc001cgu.2_RNA|EDN2_uc001cgv.2_RNA|EDN2_uc009vwh.2_5'UTR|EDN2_uc001cgw.2_RNA|EDN2_uc009vwi.2_Intron|EDN2_uc009vwj.2_Intron	NM_001956	NP_001947	P20800	EDN2_HUMAN	endothelin 2 preproprotein	81					artery smooth muscle contraction|calcium-mediated signaling|cytokine-mediated signaling pathway|elevation of cytosolic calcium ion concentration|hormonal regulation of the force of heart contraction|inositol phosphate-mediated signaling|macrophage activation|macrophage chemotaxis|neutrophil chemotaxis|positive regulation of cell proliferation|positive regulation of heart rate|positive regulation of leukocyte chemotaxis|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of the force of heart contraction by chemical signal|prostaglandin biosynthetic process|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space	endothelin B receptor binding|hormone activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGGTTTCCCAGGCCGTAAGG	0.547													7	20	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65845169	65845169	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65845169C>A	uc001dcd.1	+	5	621	c.457C>A	c.(457-459)CTG>ATG	p.L153M	DNAJC6_uc001dcc.1_Missense_Mutation_p.L184M|DNAJC6_uc010opc.1_Missense_Mutation_p.L140M|DNAJC6_uc001dce.1_Missense_Mutation_p.L210M	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	153	Phosphatase tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						TAACTGGCTACTGCAGAATCC	0.468													10	291	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92262994	92262994	+	Silent	SNP	A	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92262994A>T	uc001doh.2	-	3	562	c.96T>A	c.(94-96)CCT>CCA	p.P32P	TGFBR3_uc009wde.2_5'UTR|TGFBR3_uc010osy.1_5'UTR|TGFBR3_uc001doi.2_Silent_p.P32P|TGFBR3_uc001doj.2_Silent_p.P32P	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	32	Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AGGCACTGACAGGTGACAGTT	0.552													42	96	---	---	---	---	PASS
VAV3	10451	broad.mit.edu	37	1	108417620	108417620	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108417620A>C	uc001dvk.1	-	2	278	c.224T>G	c.(223-225)ATA>AGA	p.I75R	VAV3_uc010ouw.1_Missense_Mutation_p.I75R|VAV3_uc001dvl.1_5'UTR|VAV3_uc010oux.1_Missense_Mutation_p.I75R	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	75	CH.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AAATGTCCTTATGTTCTTCAA	0.398													48	104	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171605619	171605619	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605619G>T	uc001ghu.2	-	3	983	c.961C>A	c.(961-963)CCA>ACA	p.P321T	MYOC_uc010pmk.1_Missense_Mutation_p.P263T	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	321	Olfactomedin-like.				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CTTTCCAGTGGCCTAGGCAGT	0.517													10	133	---	---	---	---	PASS
CACYBP	27101	broad.mit.edu	37	1	174979201	174979201	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174979201G>A	uc001gkj.1	+	6	1098	c.673G>A	c.(673-675)GAC>AAC	p.D225N	CACYBP_uc001gki.1_Missense_Mutation_p.D182N	NM_014412	NP_055227	Q9HB71	CYBP_HUMAN	calcyclin binding protein isoform 1	225	SGS.|Interaction with S100A6 (By similarity).|Interaction with SKP1.					beta-catenin destruction complex	protein homodimerization activity				0						AGCCAAAGGAGACACGGAATT	0.378													30	77	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179638343	179638343	+	Silent	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179638343T>C	uc001gnf.1	+	16	2752	c.2502T>C	c.(2500-2502)AAT>AAC	p.N834N	TDRD5_uc010pnp.1_Silent_p.N888N|TDRD5_uc001gnh.1_Silent_p.N389N	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	834					DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						TAGACATAAATGGTTCTTCAG	0.403													69	148	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030932	197030932	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030932T>C	uc001gtt.1	-	3	477	c.433A>G	c.(433-435)ACC>GCC	p.T145A		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	145	Sushi 2.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TTCCTACAGGTTGGTTGAGAA	0.373													36	79	---	---	---	---	PASS
GPR37L1	9283	broad.mit.edu	37	1	202092294	202092294	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202092294C>T	uc001gxj.2	+	1	266	c.203C>T	c.(202-204)CCC>CTC	p.P68L		NM_004767	NP_004758	O60883	ETBR2_HUMAN	G-protein coupled receptor 37 like 1 precursor	68	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2						GCGGAGTACCCCCGGCCCATT	0.672													6	45	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204393789	204393789	+	3'UTR	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204393789T>G	uc001haw.2	-	34					PIK3C2B_uc010pqv.1_3'UTR	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCAAGTTCAGTCTCCAGAGGA	0.552													3	92	---	---	---	---	PASS
GPATCH2	55105	broad.mit.edu	37	1	217604605	217604605	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217604605C>T	uc001hlf.1	-	10	1565	c.1469G>A	c.(1468-1470)GGC>GAC	p.G490D		NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	490	G-patch.					intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		GATCCCCTTGCCATCTCGTCC	0.478													6	377	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247587856	247587856	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587856C>A	uc001icr.2	+	5	1249	c.1111C>A	c.(1111-1113)CTG>ATG	p.L371M	NLRP3_uc001ics.2_Missense_Mutation_p.L371M|NLRP3_uc001icu.2_Missense_Mutation_p.L371M|NLRP3_uc001icw.2_Missense_Mutation_p.L371M|NLRP3_uc001icv.2_Missense_Mutation_p.L371M|NLRP3_uc010pyw.1_Missense_Mutation_p.L369M|NLRP3_uc001ict.1_Missense_Mutation_p.L369M	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	371	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGTGGAGATCCTGGGTTTCTC	0.547													58	129	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89246951	89246951	+	RNA	SNP	C	T	T	rs10865492	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89246951C>T	uc010ytr.1	-	101		c.8108G>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CTAAACTAGACGCCTTATAGA	0.517													65	136	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96970455	96970455	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96970455T>G	uc002svu.2	-	2	283	c.197A>C	c.(196-198)GAA>GCA	p.E66A		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	66	Potential.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						GGCTCTTCTTTCCTCCTGCAT	0.517													41	104	---	---	---	---	PASS
SLC5A7	60482	broad.mit.edu	37	2	108614336	108614336	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108614336C>G	uc002tdv.2	+	5	767	c.491C>G	c.(490-492)TCT>TGT	p.S164C	SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.S164C|SLC5A7_uc010ywn.1_Missense_Mutation_p.S51C	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	164	Cytoplasmic (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	ATGCACATTTCTGTCATCATC	0.468													174	372	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112551673	112551673	+	Silent	SNP	G	A	A	rs141030655	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112551673G>A	uc002thi.2	-	37	4747	c.4500C>T	c.(4498-4500)TCC>TCT	p.S1500S		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1500	PC 3.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						CATTAGGTGCGGACAAATAAG	0.279													6	9	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173850293	173850293	+	Intron	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173850293G>T	uc002uhv.3	+						RAPGEF4_uc002uhu.2_3'UTR|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron|RAPGEF4_uc010zef.1_Intron|RAPGEF4_uc010zeg.1_Intron|RAPGEF4_uc010fqp.1_Intron|RAPGEF4_uc010zeh.1_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GGGAAGCCAGGCTGCTAACGC	0.557													10	174	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217279676	217279676	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217279676C>G	uc002vgc.3	+	3	579	c.249C>G	c.(247-249)GAC>GAG	p.D83E	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.D83E|SMARCAL1_uc010fvg.2_Missense_Mutation_p.D83E	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	83					chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CTAATGCTGACCAAAGACCTC	0.478									Schimke_Immuno-Osseous_Dysplasia				27	134	---	---	---	---	PASS
VIL1	7429	broad.mit.edu	37	2	219305571	219305571	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219305571C>T	uc002via.2	+	19	2421	c.2356C>T	c.(2356-2358)CCC>TCC	p.P786S	VIL1_uc010zke.1_Missense_Mutation_p.P475S|VIL1_uc002vib.2_Missense_Mutation_p.P786S	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	786	Headpiece.|HP.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGTGTGGACCCCAGCAGGAA	0.483													17	45	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220348803	220348803	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220348803C>T	uc010fwg.2	+	30	6618	c.6618C>T	c.(6616-6618)CCC>CCT	p.P2206P		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2206	Pro-rich.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCAGCCCCCCGCACCCCAGC	0.677													32	44	---	---	---	---	PASS
RNPEPL1	57140	broad.mit.edu	37	2	241513449	241513449	+	Intron	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241513449T>C	uc002vzi.2	+						RNPEPL1_uc010fzf.2_5'UTR|RNPEPL1_uc002vzj.2_5'Flank	NM_018226	NP_060696	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like						leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		TGATCCCTGCTGGGTGGAAGG	0.687													6	14	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	T	T	rs80258959	byFrequency	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10108913G>T	uc003buw.2	+	26	2484	c.2406G>T	c.(2404-2406)CAG>CAT	p.Q802H	FANCD2_uc003bux.1_Missense_Mutation_p.Q802H|FANCD2_uc003buy.1_Missense_Mutation_p.Q802H|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	802					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	44	---	---	---	---	PASS
STAC	6769	broad.mit.edu	37	3	36524554	36524554	+	Silent	SNP	C	T	T	rs145962483		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36524554C>T	uc003cgh.1	+	3	498	c.459C>T	c.(457-459)GGC>GGT	p.G153G	STAC_uc010hgd.1_RNA|STAC_uc011aya.1_Intron	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	153	Phorbol-ester/DAG-type.				intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4						GCACAGATGGCCTGGCACCCC	0.562													33	90	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38618225	38618225	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38618225G>A	uc003cio.2	-	19	3632	c.3438C>T	c.(3436-3438)AAC>AAT	p.N1146N	SCN5A_uc003cin.2_Silent_p.N1145N|SCN5A_uc003cil.3_Silent_p.N1146N|SCN5A_uc010hhi.2_Silent_p.N1146N|SCN5A_uc010hhk.2_Silent_p.N1145N|SCN5A_uc011ayr.1_Silent_p.N1092N|SCN5A_uc010hhj.1_Silent_p.N756N	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1146					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCTCAGCGGTGTTGGTCATGT	0.617													3	24	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38946767	38946767	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38946767G>T	uc011ays.1	-	11	1718	c.1519C>A	c.(1519-1521)CTG>ATG	p.L507M		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	507					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	AAGTGGTCCAGTGATAGATTC	0.512													85	190	---	---	---	---	PASS
GPR27	2850	broad.mit.edu	37	3	71804047	71804047	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71804047T>G	uc011bge.1	+	1	847	c.847T>G	c.(847-849)TGC>GGC	p.C283G	EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	283	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		GAAGAGGCTGTGCAAGATGTT	0.552													9	30	---	---	---	---	PASS
GBE1	2632	broad.mit.edu	37	3	81695585	81695585	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81695585G>A	uc003dqg.2	-	7	1023	c.740C>T	c.(739-741)GCC>GTC	p.A247V	GBE1_uc011bgm.1_Missense_Mutation_p.A206V	NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	247					glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ACCAAAGCTGGCATAGTAAGC	0.338									Glycogen_Storage_Disease_type_IV				54	111	---	---	---	---	PASS
CD200R1	131450	broad.mit.edu	37	3	112642488	112642488	+	3'UTR	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112642488G>A	uc003dzk.1	-	7					CD200R1_uc003dzj.1_3'UTR|CD200R1_uc011bhx.1_3'UTR	NM_170780	NP_740750	Q8TD46	MO2R1_HUMAN	CD200 receptor 1 isoform d						interspecies interaction between organisms|regulation of immune response	extracellular region|integral to membrane|plasma membrane	receptor activity			ovary(2)|pancreas(1)	3						AATGTATCTCGTTTGTTGTTG	0.338													32	101	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132198111	132198111	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132198111T>C	uc003eor.2	+	25	2815	c.2750T>C	c.(2749-2751)CTT>CCT	p.L917P		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	917							heat shock protein binding			ovary(1)|breast(1)	2						ATTCTCTTCCTTAACAAGTTG	0.303													15	152	---	---	---	---	PASS
CEP63	80254	broad.mit.edu	37	3	134264447	134264447	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134264447A>C	uc003eqo.1	+	8	1024	c.575A>C	c.(574-576)AAA>ACA	p.K192T	CEP63_uc003eql.1_Missense_Mutation_p.K192T|CEP63_uc003eqm.2_Missense_Mutation_p.K192T|CEP63_uc003eqn.1_Missense_Mutation_p.K192T	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a	192	Potential.				cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						GTCAATCGGAAACAGAAATTA	0.353													34	119	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151161667	151161667	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151161667C>G	uc011bod.1	-	5	5068	c.5068G>C	c.(5068-5070)GAT>CAT	p.D1690H		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1690	Ig-like C2-type 3.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTAGATAAATCAAGTCCTGAG	0.398													24	96	---	---	---	---	PASS
HTR3D	200909	broad.mit.edu	37	3	183756897	183756897	+	3'UTR	SNP	A	G	G	rs55953689	byFrequency	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183756897A>G	uc011bqv.1	+	8					HTR3D_uc003fmj.2_3'UTR|HTR3D_uc011bqu.1_3'UTR|HTR3D_uc010hxp.2_3'UTR	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform							integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTAGTTTCAGACCAGACCTGA	0.547													11	11	---	---	---	---	PASS
AP2M1	1173	broad.mit.edu	37	3	183894728	183894728	+	Intron	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183894728G>A	uc011bqx.1	+						AP2M1_uc003fmw.2_Intron|AP2M1_uc003fmx.2_Intron|AP2M1_uc003fmy.2_5'UTR	NM_004068	NP_004059	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit						axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity				0	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCCTGCCCCCGCCTGTCCTAG	0.537													23	16	---	---	---	---	PASS
PSMD2	5708	broad.mit.edu	37	3	184026525	184026525	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184026525G>C	uc003fnn.1	+	21	2607	c.2574G>C	c.(2572-2574)AAG>AAC	p.K858N	PSMD2_uc011brj.1_Missense_Mutation_p.K699N|PSMD2_uc011brk.1_Missense_Mutation_p.K728N	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	858					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	AGGCTGGCAAGCCGAAGACTA	0.547											OREG0015948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	106	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186971086	186971086	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186971086T>G	uc003frh.1	-	6	1094	c.762A>C	c.(760-762)AAA>AAC	p.K254N	MASP1_uc003fri.2_Missense_Mutation_p.K254N|MASP1_uc003frj.2_Missense_Mutation_p.K223N|MASP1_uc003frk.1_Missense_Mutation_p.K254N|MASP1_uc011bse.1_Missense_Mutation_p.K228N	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	254	Interaction with FCN2.|CUB 2.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GCCCCAAAACTTTTGGACCAA	0.498													159	436	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194126843	194126843	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194126843C>T	uc003fty.3	-	32	3888	c.3486G>A	c.(3484-3486)GAG>GAA	p.E1162E	ATP13A3_uc003ftx.3_Silent_p.E71E	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	1162	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		GATCCACTGACTCCTAAGAAA	0.428													14	133	---	---	---	---	PASS
TXK	7294	broad.mit.edu	37	4	48114380	48114380	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48114380T>A	uc003gxx.3	-	4	410	c.324A>T	c.(322-324)GAA>GAT	p.E108D	TXK_uc003gxy.1_Missense_Mutation_p.E108D	NM_003328	NP_003319	P42681	TXK_HUMAN	TXK tyrosine kinase	108	SH3.					cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GTATCAGGTATTCTTCTGCTC	0.443													8	328	---	---	---	---	PASS
NUP54	53371	broad.mit.edu	37	4	77036593	77036593	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77036593C>A	uc003hjs.2	-	12	1578	c.1450G>T	c.(1450-1452)GAT>TAT	p.D484Y	NUP54_uc010ije.2_Missense_Mutation_p.D202Y|NUP54_uc011cbs.1_Missense_Mutation_p.D304Y|NUP54_uc011cbt.1_Missense_Mutation_p.D436Y|NUP54_uc003hjt.2_Missense_Mutation_p.D268Y	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	484					carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						TCTTCTAGATCGTCTTTAATG	0.333													44	92	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162577600	162577600	+	Silent	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162577600A>G	uc003iqh.2	-	7	1210	c.774T>C	c.(772-774)ACT>ACC	p.T258T	FSTL5_uc003iqi.2_Silent_p.T257T|FSTL5_uc010iqv.2_Silent_p.T257T	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	258	Ig-like 1.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CAGTTGCTGCAGTGATGCTTA	0.398													18	88	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1593386	1593386	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1593386A>C	uc010itg.1	-	2	151	c.74T>G	c.(73-75)GTG>GGG	p.V25G	SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA clone IMAGE:40127561.												0						CTGGCCATTCACGTGCCTCAG	0.597													4	89	---	---	---	---	PASS
CCT5	22948	broad.mit.edu	37	5	10256077	10256077	+	Silent	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10256077T>G	uc003jeq.2	+	4	513	c.342T>G	c.(340-342)GGT>GGG	p.G114G	CCT5_uc011cmq.1_Intron|CCT5_uc003jer.2_Silent_p.G114G|CCT5_uc010its.2_Silent_p.G114G|CCT5_uc011cmr.1_Silent_p.G59G|CCT5_uc011cms.1_Silent_p.G76G|CCT5_uc011cmt.1_Silent_p.G21G	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	114					'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						TCCTGGCTGGTGCCTTGTTAG	0.453													10	32	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140166478	140166478	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166478T>A	uc003lhb.2	+	1	603	c.603T>A	c.(601-603)GAT>GAA	p.D201E	PCDHA1_uc003lha.2_Missense_Mutation_p.D201E|PCDHA1_uc003lgz.2_Missense_Mutation_p.D201E	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	201	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATATTTGGATAGAGAAGAAA	0.453													11	122	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515667	140515667	+	Silent	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515667T>G	uc003liq.2	+	1	868	c.651T>G	c.(649-651)GGT>GGG	p.G217G		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	217	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACTGGACGGTGGGGCTCCGC	0.552													14	213	---	---	---	---	PASS
GRK6	2870	broad.mit.edu	37	5	176863212	176863212	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176863212G>A	uc011dfz.1	+	12	1356	c.1196G>A	c.(1195-1197)CGG>CAG	p.R399Q	GRK6_uc003mgp.2_Missense_Mutation_p.R399Q|GRK6_uc003mgq.2_Missense_Mutation_p.R399Q|GRK6_uc003mgs.1_Missense_Mutation_p.R369Q	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B	399	Protein kinase.				regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGGTGGAGCGGCTGGTGAAG	0.637													5	95	---	---	---	---	PASS
SQSTM1	8878	broad.mit.edu	37	5	179247902	179247902	+	5'UTR	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179247902G>C	uc003mkw.3	+	1					SQSTM1_uc011dgr.1_Intron|SQSTM1_uc011dgs.1_Intron|SQSTM1_uc003mkv.3_5'UTR|SQSTM1_uc003mkx.2_5'Flank	NM_003900	NP_003891	Q13501	SQSTM_HUMAN	sequestosome 1 isoform 1						anti-apoptosis|apoptosis|cell differentiation|endosome transport|induction of apoptosis by extracellular signals|intracellular signal transduction|macroautophagy|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein localization|regulation of I-kappaB kinase/NF-kappaB cascade|ubiquitin-dependent protein catabolic process	cytosol|late endosome|nucleoplasm	protein kinase C binding|receptor tyrosine kinase binding|SH2 domain binding|ubiquitin binding|zinc ion binding		SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTGCGACCGGGACGGCCCG	0.746									Paget_Disease_of_Bone				3	6	---	---	---	---	PASS
MGAT1	4245	broad.mit.edu	37	5	180218578	180218578	+	3'UTR	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180218578G>T	uc003mmg.3	-	2					MGAT1_uc010jlf.2_3'UTR|MGAT1_uc010jlg.2_3'UTR|MGAT1_uc003mmh.3_3'UTR|MGAT1_uc010jlh.2_3'UTR|MGAT1_uc003mmi.3_3'UTR	NM_002406	NP_002397	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGGGACTGTGGTCCCACCTC	0.537													34	76	---	---	---	---	PASS
PGBD1	84547	broad.mit.edu	37	6	28269738	28269738	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28269738G>C	uc003nky.2	+	7	2477	c.2107G>C	c.(2107-2109)GGC>CGC	p.G703R	PGBD1_uc003nkz.2_Missense_Mutation_p.G703R	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	703					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						CAATGCTGTGGGCATAGAACC	0.398													24	251	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	47976509	47976509	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47976509G>C	uc011dwm.1	-	2	802	c.717C>G	c.(715-717)GAC>GAG	p.D239E	C6orf138_uc011dwn.1_Missense_Mutation_p.D3E|C6orf138_uc003ozf.2_Missense_Mutation_p.D256E	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	256	SSD.					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						TGCGCAAGCAGTCCTTCATGG	0.567													8	73	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56341001	56341001	+	Silent	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56341001T>C	uc003pdf.2	-	86	15481	c.15453A>G	c.(15451-15453)AAA>AAG	p.K5151K	DST_uc003pcz.3_Silent_p.K4973K|DST_uc011dxj.1_Silent_p.K5002K|DST_uc011dxk.1_Silent_p.K5013K|DST_uc003pcy.3_Silent_p.K4647K	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	7059					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGATGACTTCTTTATCCTTAT	0.423													7	43	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	100964147	100964147	+	Missense_Mutation	SNP	G	C	C	rs240780	byFrequency	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100964147G>C	uc003pqk.2	-	39	6313	c.5984C>G	c.(5983-5985)TCC>TGC	p.S1995C		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1995					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTCAGGAAGGGACTCGATGGA	0.458													4	174	---	---	---	---	PASS
AKAP12	9590	broad.mit.edu	37	6	151671236	151671236	+	Silent	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151671236T>C	uc011eep.1	+	4	1950	c.1710T>C	c.(1708-1710)CCT>CCC	p.P570P	AKAP12_uc003qoe.2_Silent_p.P570P|AKAP12_uc003qof.2_Silent_p.P472P|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Silent_p.P465P	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1	570					G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CCTCATCCCCTGAGGAGCCCG	0.577													3	88	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	161969991	161969991	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161969991C>A	uc003qtx.3	-	9	1112	c.978G>T	c.(976-978)CAG>CAT	p.Q326H	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Missense_Mutation_p.Q135H|PARK2_uc003qtw.3_Missense_Mutation_p.Q135H|PARK2_uc003qty.3_Missense_Mutation_p.Q298H|PARK2_uc003qtz.3_Missense_Mutation_p.Q177H|PARK2_uc010kke.1_Missense_Mutation_p.Q345H|PARK2_uc011egf.1_5'UTR	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	326	IBR-type.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CGCCCCCCATCTGCAGGACAC	0.577													60	150	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28452471	28452471	+	5'UTR	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28452471G>A	uc003szq.2	+	1					CREB5_uc003szo.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AGAAAGAAAGGAAGAAAAAAC	0.353													26	109	---	---	---	---	PASS
CDC14C	168448	broad.mit.edu	37	7	48964337	48964337	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48964337C>T	uc010kyv.1	+	1	181	c.69C>T	c.(67-69)ACC>ACT	p.T23T		NR_003595				SubName: Full=Putative uncharacterized protein MGC26484;												0						TGGACATCACCGATCGCCTTC	0.532													43	101	---	---	---	---	PASS
OR2AE1	81392	broad.mit.edu	37	7	99474214	99474214	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474214G>T	uc003usc.1	-	1	443	c.443C>A	c.(442-444)TCA>TAA	p.S148*		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CCCCAACCATGACATGACAGC	0.502													54	122	---	---	---	---	PASS
SERPINE1	5054	broad.mit.edu	37	7	100775170	100775170	+	Silent	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100775170T>C	uc003uxt.2	+	4	668	c.520T>C	c.(520-522)TTG>CTG	p.L174L	SERPINE1_uc011kkj.1_Silent_p.L159L|SERPINE1_uc003uxu.1_Silent_p.L5L	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1	174					angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	GATCAGCAACTTGCTTGGGAA	0.418													20	317	---	---	---	---	PASS
SERPINE1	5054	broad.mit.edu	37	7	100775172	100775172	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100775172G>A	uc003uxt.2	+	4	670	c.522G>A	c.(520-522)TTG>TTA	p.L174L	SERPINE1_uc011kkj.1_Silent_p.L159L|SERPINE1_uc003uxu.1_Silent_p.L5L	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1	174					angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	TCAGCAACTTGCTTGGGAAAG	0.428													19	311	---	---	---	---	PASS
C7orf60	154743	broad.mit.edu	37	7	112555403	112555403	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112555403G>C	uc003vgo.1	-	2	387	c.260C>G	c.(259-261)GCA>GGA	p.A87G	C7orf60_uc011kms.1_Missense_Mutation_p.A113G	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	87										ovary(2)|skin(1)	3						ACAAGTTTTTGCCCAATGATT	0.358													49	148	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120935741	120935741	+	3'UTR	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120935741A>G	uc003vjq.3	+	23						NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GGAGCTGGAGACGAGCTAGTC	0.507													3	58	---	---	---	---	PASS
CNOT4	4850	broad.mit.edu	37	7	135106938	135106938	+	Silent	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135106938A>C	uc003vsv.1	-	3	646	c.339T>G	c.(337-339)GTT>GTG	p.V113V	CNOT4_uc003vss.2_Silent_p.V113V|CNOT4_uc011kpz.1_Silent_p.V113V|CNOT4_uc003vst.2_Silent_p.V113V|CNOT4_uc003vsu.1_Silent_p.V113V|CNOT4_uc011kpy.1_Silent_p.V113V	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	113	RRM.				nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						ATAAACCTACAACAAAGACGA	0.348													54	128	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143043270	143043270	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143043270C>A	uc003wcr.1	+	18	2297	c.2210C>A	c.(2209-2211)GCC>GAC	p.A737D	CLCN1_uc011ktc.1_Missense_Mutation_p.A349D	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	737	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					TCTACTACTGCCCCTCTGTCC	0.597													4	158	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143043271	143043271	+	Silent	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143043271C>A	uc003wcr.1	+	18	2298	c.2211C>A	c.(2209-2211)GCC>GCA	p.A737A	CLCN1_uc011ktc.1_Silent_p.A349A	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	737	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CTACTACTGCCCCTCTGTCCC	0.597													4	156	---	---	---	---	PASS
ESYT2	57488	broad.mit.edu	37	7	158557460	158557460	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158557460C>G	uc003wob.1	-	9	1219	c.1153G>C	c.(1153-1155)GAC>CAC	p.D385H	ESYT2_uc003woc.1_Missense_Mutation_p.D209H|ESYT2_uc003wod.1_Missense_Mutation_p.D385H|ESYT2_uc003woa.1_5'Flank	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain	413	C2 1.					integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						CCATAGGGGTCTGACTTTCCC	0.433													41	323	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69002823	69002823	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002823C>T	uc003xxv.1	+	20	2150	c.2123C>T	c.(2122-2124)GCT>GTT	p.A708V	PREX2_uc003xxu.1_Missense_Mutation_p.A708V|PREX2_uc011lez.1_Missense_Mutation_p.A643V	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	708	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GGAACTGTGGCTGCAGCAGCT	0.368													54	64	---	---	---	---	PASS
GRHL2	79977	broad.mit.edu	37	8	102570788	102570788	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102570788C>A	uc010mbu.2	+	4	756	c.426C>A	c.(424-426)AGC>AGA	p.S142R	GRHL2_uc011lhi.1_Missense_Mutation_p.S142R	NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3	142						cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			ACAGCATCAGCTTCCCCGAGA	0.517													70	235	---	---	---	---	PASS
SNTB1	6641	broad.mit.edu	37	8	121554095	121554095	+	Silent	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121554095T>A	uc010mdg.2	-	6	1705	c.1479A>T	c.(1477-1479)GGA>GGT	p.G493G		NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	493	SU.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GCATCCTGATTCCATCATCTG	0.363													10	219	---	---	---	---	PASS
FAM83A	84985	broad.mit.edu	37	8	124219675	124219675	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124219675C>T	uc003ypv.2	+	5	3066	c.1052C>T	c.(1051-1053)GCG>GTG	p.A351V	FAM83A_uc003ypw.2_Intron|FAM83A_uc003ypy.2_Intron|FAM83A_uc003ypx.2_Missense_Mutation_p.A351V|FAM83A_uc003ypz.2_Intron	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	351	Ser-rich.									ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGTGTGTCCGCGTCTTCAGGG	0.731													6	28	---	---	---	---	PASS
EIF2C2	27161	broad.mit.edu	37	8	141567320	141567320	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141567320C>T	uc003yvn.2	-	8	934	c.894G>A	c.(892-894)CAG>CAA	p.Q298Q	EIF2C2_uc010men.2_Silent_p.Q221Q|EIF2C2_uc010meo.2_Silent_p.Q298Q	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	298	PAZ.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			GCCCGCTCTCCTGCTGCAGCG	0.592													6	286	---	---	---	---	PASS
TSTA3	7264	broad.mit.edu	37	8	144696809	144696809	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144696809A>C	uc003yza.2	-	5	485	c.449T>G	c.(448-450)ATC>AGC	p.I150S	TSTA3_uc003yzb.2_Missense_Mutation_p.I150S|TSTA3_uc011lko.1_3'UTR	NM_003313	NP_003304	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	150					'de novo' GDP-L-fucose biosynthetic process|leukocyte cell-cell adhesion		coenzyme binding|electron carrier activity|GDP-4-dehydro-D-rhamnose reductase activity|GDP-L-fucose synthase activity|isomerase activity			pancreas(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		NADH(DB00157)	CTGCACGTCGATCATCCTCTT	0.662													27	118	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	14863	14863	+	Silent	SNP	A	G	G	rs141792353	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14863A>G	uc010mgm.1	-	11	1485	c.1342T>C	c.(1342-1344)TTG>CTG	p.L448L	WASH5P_uc003zfr.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						GGTGGCGGCAAAGGAGGGATG	0.647													4	32	---	---	---	---	PASS
KANK1	23189	broad.mit.edu	37	9	711931	711931	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:711931T>C	uc003zgl.1	+	7	1814	c.1165T>C	c.(1165-1167)TCC>CCC	p.S389P	KANK1_uc003zgm.2_Missense_Mutation_p.S389P|KANK1_uc003zgn.1_Missense_Mutation_p.S389P|KANK1_uc003zgo.1_Missense_Mutation_p.S389P|KANK1_uc003zgp.1_Missense_Mutation_p.S389P|KANK1_uc003zgq.2_Missense_Mutation_p.S231P|KANK1_uc003zgr.1_Missense_Mutation_p.S231P|KANK1_uc003zgs.1_Missense_Mutation_p.S231P	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	389	Potential.				negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CTGTGAGGCCTCCTCAGAGCT	0.577													22	68	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32632549	32632549	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32632549G>A	uc003zrg.1	-	1	3119	c.3029C>T	c.(3028-3030)ACA>ATA	p.T1010I	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1010					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GTCTGCATCTGTTCCTGTCAC	0.458													155	334	---	---	---	---	PASS
KIF24	347240	broad.mit.edu	37	9	34257426	34257426	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34257426C>T	uc003zua.3	-	11	2299	c.2179G>A	c.(2179-2181)GCC>ACC	p.A727T	KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	727					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			CTGTGGTGGGCGTTGCCAAAG	0.567													134	303	---	---	---	---	PASS
C9orf40	55071	broad.mit.edu	37	9	77562852	77562852	+	3'UTR	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77562852G>C	uc004ajo.3	-	2						NM_017998	NP_060468	Q8IXQ3	CI040_HUMAN	hypothetical protein LOC55071												0						TCATTTCTCAGGTTTGGAAAT	0.358													9	55	---	---	---	---	PASS
ZBTB43	23099	broad.mit.edu	37	9	129595973	129595973	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129595973C>T	uc004bql.2	+	3	1458	c.1185C>T	c.(1183-1185)CTC>CTT	p.L395L	ZBTB43_uc010mxf.2_Silent_p.L395L	NM_014007	NP_054726	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	395					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GCATGCACCTCGGTCTTCGGC	0.498													71	124	---	---	---	---	PASS
FBXW5	54461	broad.mit.edu	37	9	139837186	139837186	+	Intron	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139837186G>C	uc004cjx.2	-						FBXW5_uc010nbx.2_5'Flank|FBXW5_uc004cjy.2_Intron|FBXW5_uc004cjz.2_5'UTR|C8G_uc004cka.2_5'Flank	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5								catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GTCGGCGTGGGGCGGGGGCAG	0.682													3	20	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5948526	5948526	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5948526G>A	uc001iis.2	+	3	779	c.684G>A	c.(682-684)CCG>CCA	p.P228P	FBXO18_uc001iir.2_Silent_p.P154P|FBXO18_uc009xig.2_Silent_p.P154P|FBXO18_uc001iit.2_Silent_p.P279P	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	228					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						CCTTCCTCCCGGTGGAAGACC	0.428													42	138	---	---	---	---	PASS
SPAG6	9576	broad.mit.edu	37	10	22690118	22690118	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22690118A>G	uc001iri.2	+	9	1368	c.1226A>G	c.(1225-1227)CAA>CGA	p.Q409R	SPAG6_uc001irj.2_Missense_Mutation_p.Q409R|SPAG6_uc010qct.1_Missense_Mutation_p.Q379R|SPAG6_uc009xkh.2_Missense_Mutation_p.Q387R	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1	409	ARM 8.				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						AATATCCTGCAAAAATGTACC	0.348													11	124	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43319164	43319164	+	Missense_Mutation	SNP	C	T	T	rs138529489		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43319164C>T	uc001jaj.2	+	21	3746	c.3388C>T	c.(3388-3390)CGG>TGG	p.R1130W		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1130					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						GTCAGGAATGCGGACCACGGG	0.507													4	187	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48390797	48390797	+	Silent	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48390797C>A	uc001jez.2	-	1	195	c.81G>T	c.(79-81)CTG>CTT	p.L27L		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	27	4 X approximate tandem repeats.|1.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	TGTCCAGCACCAGGCTTGGCT	0.602													23	64	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63212595	63212595	+	Intron	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63212595G>T	uc001jlo.2	-						TMEM26_uc010qij.1_Intron|TMEM26_uc001jlq.2_Intron|uc001jlr.2_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26							integral to membrane					0	Prostate(12;0.0112)					CGAGTGCGGTGGGGGACAATA	0.617													23	122	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97918959	97918959	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97918959G>C	uc001klp.2	+	6	3737	c.2880G>C	c.(2878-2880)TTG>TTC	p.L960F	ZNF518A_uc001klo.1_Missense_Mutation_p.L430F|ZNF518A_uc001klq.2_Missense_Mutation_p.L960F|ZNF518A_uc001klr.2_Missense_Mutation_p.L960F	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	960					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		CACTTCCATTGGTTAATTCAC	0.363													55	262	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99655149	99655149	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99655149G>A	uc001kou.1	-	11	1695	c.1339C>T	c.(1339-1341)CGA>TGA	p.R447*	CRTAC1_uc001kov.2_Nonsense_Mutation_p.R436*|CRTAC1_uc001kot.1_Nonsense_Mutation_p.R237*	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	447						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GGCACCACTCGCAGCCAGTTG	0.542													42	93	---	---	---	---	PASS
ZDHHC6	64429	broad.mit.edu	37	10	114205268	114205268	+	5'UTR	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114205268G>T	uc001kzv.2	-	2					VTI1A_uc001kzy.2_5'Flank|VTI1A_uc001kzz.2_5'Flank|ZDHHC6_uc001kzw.2_5'UTR|ZDHHC6_uc009xya.1_5'UTR|VTI1A_uc001kzx.2_5'Flank	NM_022494	NP_071939	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6							integral to membrane	acyltransferase activity|zinc ion binding				0		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		ATTTCCATGTGCCACAAGTCC	0.398													7	46	---	---	---	---	PASS
OR5P2	120065	broad.mit.edu	37	11	7818051	7818051	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7818051C>A	uc001mfp.1	-	1	439	c.439G>T	c.(439-441)GCT>TCT	p.A147S		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGAAAACCAGCTATGTAAACT	0.403													42	137	---	---	---	---	PASS
BSCL2	26580	broad.mit.edu	37	11	62462097	62462097	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62462097C>G	uc001nuo.1	-	4	805	c.381G>C	c.(379-381)TTG>TTC	p.L127F	BSCL2_uc009yoc.1_Missense_Mutation_p.L127F|BSCL2_uc001nup.2_Missense_Mutation_p.L127F|BSCL2_uc001nuq.1_Missense_Mutation_p.L127F|BSCL2_uc001nur.3_Missense_Mutation_p.L191F|BSCL2_uc009yod.2_Missense_Mutation_p.L191F|BSCL2_uc001nut.3_Missense_Mutation_p.L191F|HNRNPUL2_uc001nuu.1_RNA	NM_032667	NP_116056	Q96G97	BSCL2_HUMAN	seipin isoform 2	127	Lumenal (Potential).				cell death	integral to endoplasmic reticulum membrane					0						AAATGGTGACCAAGAACATGC	0.522											OREG0021029	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	67	---	---	---	---	PASS
MARK2	2011	broad.mit.edu	37	11	63656358	63656358	+	Intron	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63656358C>G	uc001nxw.2	+						MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron|MARK2_uc009yox.2_5'UTR|MARK2_uc001nxz.3_5'UTR	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2						cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						CTGTACTTTGCCCTCGCTGCC	0.607													3	21	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67173158	67173158	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67173158G>A	uc001ola.2	+	5	482	c.453G>A	c.(451-453)TCG>TCA	p.S151S	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_Silent_p.S151S|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	151	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TGTTTGTGTCGCCTCAGGGCC	0.642													40	83	---	---	---	---	PASS
KRTAP5-10	387273	broad.mit.edu	37	11	71277008	71277008	+	Silent	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71277008T>G	uc001oqt.1	+	1	400	c.375T>G	c.(373-375)GGT>GGG	p.G125G		NM_001012710	NP_001012728	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	125	7 X 4 AA repeats of C-C-X-P.					keratin filament				skin(1)	1						GTGGCTGTGGTTCCTGTGGGG	0.547													39	87	---	---	---	---	PASS
CHRDL2	25884	broad.mit.edu	37	11	74421957	74421957	+	Silent	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74421957G>T	uc001ovi.2	-	4	622	c.369C>A	c.(367-369)ATC>ATA	p.I123I	CHRDL2_uc001ovg.2_Silent_p.I7I|CHRDL2_uc001ovh.2_Silent_p.I123I|CHRDL2_uc001ovk.1_Silent_p.I123I			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;	123	VWFC 2.				cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					GGGCACTGAAGATCTCTCCGT	0.622													6	54	---	---	---	---	PASS
INTS4	92105	broad.mit.edu	37	11	77702308	77702308	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77702308G>C	uc001oys.2	-	2	120	c.92C>G	c.(91-93)ACA>AGA	p.T31R	INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.T31R|INTS4_uc001oyv.1_RNA	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	31					snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ACTTGGTTTTGTTAGTCGGAG	0.443													50	125	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92570900	92570900	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92570900C>T	uc001pdj.3	+	16	10313	c.10296C>T	c.(10294-10296)GTC>GTT	p.V3432V	FAT3_uc001pdi.3_5'Flank	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3432	Extracellular (Potential).|Cadherin 31.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTGCAACTGTCAACATTGATA	0.463										TCGA Ovarian(4;0.039)			32	66	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101832589	101832589	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101832589T>C	uc001pgm.2	+	6	1093	c.823T>C	c.(823-825)TCC>CCC	p.S275P	KIAA1377_uc001pgn.2_Missense_Mutation_p.S231P|KIAA1377_uc010run.1_Missense_Mutation_p.S76P|KIAA1377_uc009yxa.1_Missense_Mutation_p.S76P	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	275							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GCATTCCACATCCATCCAGCG	0.373													42	90	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117335686	117335686	+	Silent	SNP	G	A	A	rs61743159	byFrequency	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117335686G>A	uc001prh.1	-	17	3419	c.3417C>T	c.(3415-3417)AGC>AGT	p.S1139S		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1079	Extracellular (Potential).|Fibronectin type-III 2.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CATTGATCTCGCTGGAAGAGG	0.622													36	87	---	---	---	---	PASS
FAM90A1	55138	broad.mit.edu	37	12	8374854	8374854	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8374854A>G	uc001qui.2	-	7	1518	c.959T>C	c.(958-960)ATC>ACC	p.I320T	FAM90A1_uc001quh.2_Missense_Mutation_p.I320T	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	320							nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		ACCTCCCTGGATGGCGCTTTC	0.642													4	47	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546799	11546799	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546799G>A	uc010shk.1	-	3	248	c.213C>T	c.(211-213)CCC>CCT	p.P71P		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGAGGTGGGGGACCTTGAG	0.612													11	442	---	---	---	---	PASS
ACVR1B	91	broad.mit.edu	37	12	52369127	52369127	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52369127T>G	uc001rzn.2	+	2	212	c.170T>G	c.(169-171)TTC>TGC	p.F57C	ACVR1B_uc001rzl.2_Missense_Mutation_p.F57C|ACVR1B_uc001rzm.2_Missense_Mutation_p.F57C|ACVR1B_uc010snn.1_Missense_Mutation_p.F57C	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor	57	Extracellular (Potential).				G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GTTTCCATTTTCAATCTGGAT	0.592													3	142	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68720902	68720902	+	Intron	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68720902G>A	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron|MDM1_uc001sua.3_Intron|MDM1_uc010std.1_3'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TTTAAATTTAGTTCAGATATA	0.254													6	15	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101473041	101473041	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101473041G>C	uc010svm.1	+	15	1955	c.1383G>C	c.(1381-1383)TGG>TGC	p.W461C	ANO4_uc001thw.2_Missense_Mutation_p.W426C|ANO4_uc001thx.2_Missense_Mutation_p.W461C|ANO4_uc001thy.2_Missense_Mutation_p.W28C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	461	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						TGATAGACTGGGAAGAAGAGG	0.433										HNSCC(74;0.22)			63	159	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	103981230	103981230	+	5'UTR	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103981230A>C	uc001tjw.2	+	1						NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GGTGCTTGGCACAGAGAAGGA	0.373													5	41	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111785947	111785947	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111785947G>A	uc001tsa.1	+	22	4432	c.4279G>A	c.(4279-4281)GCC>ACC	p.A1427T		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1427	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						CCCACCTGGCGCCCCCCCTGC	0.657													12	121	---	---	---	---	PASS
FAM70B	348013	broad.mit.edu	37	13	114514745	114514745	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114514745C>T	uc001vuh.2	+	9	877	c.850C>T	c.(850-852)CTG>TTG	p.L284L		NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B	284	Pro-rich.					integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			CTCCTCTGCCCTGGCTTCGTC	0.657													39	107	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23398392	23398392	+	Intron	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23398392T>A	uc001whm.1	-						PRMT5_uc001whl.1_Missense_Mutation_p.I15F|PRMT5_uc010akd.1_Intron|PRMT5_uc010tnf.1_5'UTR|PRMT5_uc010tng.1_Missense_Mutation_p.I15F|PRMT5_uc010tnh.1_Intron|PRMT5_uc001whn.1_Missense_Mutation_p.I15F	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a						cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TTCTCCGGGATGACTAGTCTG	0.627													41	91	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24885319	24885319	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24885319G>C	uc001wpf.3	+	9	4682	c.4364G>C	c.(4363-4365)TGG>TCG	p.W1455S		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1455					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GGTGGGCAGTGGTGGAGTTTG	0.592													36	62	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44976183	44976183	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44976183C>A	uc001wvn.2	-	1	317	c.8G>T	c.(7-9)GGC>GTC	p.G3V		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	3						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		CTGGGATTTGCCTACCATTGG	0.413													105	275	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45639925	45639925	+	Silent	SNP	T	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45639925T>G	uc001wwd.3	+	12	2235	c.2136T>G	c.(2134-2136)TCT>TCG	p.S712S	FANCM_uc010anf.2_Silent_p.S686S|FANCM_uc001wwe.3_Silent_p.S248S	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	712					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AGTTTTCTTCTTTACAAAATG	0.323								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				62	122	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71514563	71514563	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71514563G>A	uc001xmo.2	+	22	4646	c.4200G>A	c.(4198-4200)TTG>TTA	p.L1400L	PCNX_uc010are.1_Silent_p.L1289L|PCNX_uc010arf.1_Silent_p.L260L	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1400						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GTTTGAAGTTGCTACGATCCT	0.373													46	234	---	---	---	---	PASS
ZNF410	57862	broad.mit.edu	37	14	74370665	74370665	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74370665G>A	uc001xoz.1	+	6	765	c.583G>A	c.(583-585)GAA>AAA	p.E195K	ZNF410_uc001xoy.1_RNA|ZNF410_uc010ary.1_RNA|ZNF410_uc010tuf.1_Intron|ZNF410_uc010tug.1_5'UTR|ZNF410_uc010tuh.1_Missense_Mutation_p.E122K|ZNF410_uc010tui.1_RNA|ZNF410_uc010arz.1_Missense_Mutation_p.E212K|ZNF410_uc001xpa.1_Silent_p.E8E|ZNF410_uc001xpb.1_Missense_Mutation_p.E195K|ZNF410_uc001xpc.1_Missense_Mutation_p.E142K|ZNF410_uc010tuj.1_Silent_p.E8E	NM_021188	NP_067011	Q86VK4	ZN410_HUMAN	zinc finger protein 410	195					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)		TGTTACAGGAGAAAATGTCCA	0.428													39	105	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77294750	77294750	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77294750C>A	uc001xsx.2	+	2	319	c.205C>A	c.(205-207)CTG>ATG	p.L69M	C14orf166B_uc010asn.1_Translation_Start_Site|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010aso.1_RNA|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_5'Flank	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	69											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		GGAAACAGACCTGGAGATTGA	0.532													27	89	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107062535	107062535	+	RNA	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107062535C>G	uc010tyt.1	-	130		c.6143G>C								Parts of antibodies, mostly variable regions.												0						CTGCCACCAGCAGGAGGAAGA	0.512													3	51	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936917	21936917	+	RNA	SNP	C	T	T	rs8026508		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936917C>T	uc010tzj.1	-	1		c.3823G>A				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						TCCAGTATGGCGTTCTGACCA	0.502													24	338	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35185937	35185937	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35185937G>A	uc001ziv.2	-	23	2679	c.2498C>T	c.(2497-2499)GCA>GTA	p.A833V		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	833						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GATCTGAACTGCCACATCTGT	0.368													58	144	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35185966	35185966	+	Silent	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35185966G>C	uc001ziv.2	-	23	2650	c.2469C>G	c.(2467-2469)GGC>GGG	p.G823G		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	823						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TACCAGGTGGGCCCACAACCT	0.373													29	123	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35185970	35185970	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35185970A>C	uc001ziv.2	-	23	2646	c.2465T>G	c.(2464-2466)GTG>GGG	p.V822G		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	822						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AGGTGGGCCCACAACCTAAAA	0.368													27	122	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43044437	43044437	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43044437G>C	uc001zqo.2	-	14	3446	c.3007C>G	c.(3007-3009)CTA>GTA	p.L1003V	TTBK2_uc010bcy.2_Missense_Mutation_p.L934V	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1003					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TTCTCCTCTAGCAATTTATCA	0.468													13	150	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54305247	54305247	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305247G>T	uc002ack.2	+	1	147	c.147G>T	c.(145-147)CAG>CAT	p.Q49H		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	49					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTGCTGGCCAGACCAAATCCC	0.398													43	82	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65623027	65623027	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623027C>G	uc002aos.2	-	10	1866	c.1614G>C	c.(1612-1614)CAG>CAC	p.Q538H	IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	538	Extracellular (Potential).|Fibronectin type-III 2.									ovary(3)	3						CCCACAGCAGCTGCAAGGAGG	0.657													9	22	---	---	---	---	PASS
C15orf44	81556	broad.mit.edu	37	15	65890710	65890710	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65890710G>C	uc002apd.2	-	6	1033	c.697C>G	c.(697-699)CCT>GCT	p.P233A	C15orf44_uc010uix.1_Missense_Mutation_p.P269A|C15orf44_uc010uiz.1_Missense_Mutation_p.P197A|C15orf44_uc010uja.1_Missense_Mutation_p.P184A|C15orf44_uc010ujb.1_Missense_Mutation_p.P154A|C15orf44_uc002ape.3_Missense_Mutation_p.P233A|C15orf44_uc010uiy.1_Missense_Mutation_p.P154A	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	233										ovary(1)	1						ACAACAAAAGGTTCTGGCCTG	0.363													47	100	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74327406	74327406	+	Intron	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74327406A>G	uc002awv.2	+						PML_uc002awm.2_3'UTR|PML_uc002awl.2_3'UTR|PML_uc002awj.1_3'UTR|PML_uc002awk.2_Intron|PML_uc002awn.2_Intron|PML_uc002awo.2_Intron|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002awx.2_Intron|PML_uc002awy.2_5'UTR	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						tagaggctggactatcacctg	0.035			T	RARA|PAX5	APL|ALL								7	24	---	---	---	---	PASS
CSPG4	1464	broad.mit.edu	37	15	75981610	75981610	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75981610G>C	uc002baw.2	-	3	1889	c.1796C>G	c.(1795-1797)TCT>TGT	p.S599C		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	599	Extracellular (Potential).|CSPG 2.|Globular or compact configuration stabilized by disulfide bonds.|Interaction with COL6A2 (By similarity).|Neurite growth inhibition (By similarity).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						GGGGAGGCCAGAGGAGGTGCC	0.672													8	54	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	91016148	91016148	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91016148T>A	uc002bpl.1	+	19	2356	c.2255T>A	c.(2254-2256)CTG>CAG	p.L752Q		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	752	IQ 1.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			ATCACCAGGCTGCAGGCTCGC	0.498													63	123	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1816093	1816093	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1816093G>A	uc002cmk.2	+	21	2696	c.2576G>A	c.(2575-2577)CGG>CAG	p.R859Q	MAPK8IP3_uc002cml.2_Missense_Mutation_p.R853Q|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.R860Q	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	859					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						AACGTGCCGCGGAGCAACTGC	0.662													6	55	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31498984	31498984	+	Nonsense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31498984C>G	uc002ecf.3	+	7	808	c.789C>G	c.(787-789)TAC>TAG	p.Y263*	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	263	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						CCGACTCCTACCACCTGCTCC	0.652													10	89	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31885211	31885211	+	5'UTR	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31885211G>A	uc002ecs.3	+	1						NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						AGAATAAACAGAACCTCTGTT	0.612													21	77	---	---	---	---	PASS
LRRC36	55282	broad.mit.edu	37	16	67405081	67405081	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67405081G>C	uc002esv.2	+	9	1449	c.1430G>C	c.(1429-1431)TGG>TCG	p.W477S	LRRC36_uc002esw.2_RNA|LRRC36_uc010ceh.2_Missense_Mutation_p.W209S|LRRC36_uc002esx.2_Missense_Mutation_p.W356S|LRRC36_uc010vjk.1_Missense_Mutation_p.W356S|LRRC36_uc010vjl.1_Missense_Mutation_p.M1I|LRRC36_uc002esy.2_Intron	NM_018296	NP_060766	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36 isoform 1	477											0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		GGATTCAAATGGAAGGACAAT	0.463													25	238	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70867982	70867982	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70867982C>G	uc002ezr.2	-	79	13612	c.13484G>C	c.(13483-13485)CGT>CCT	p.R4495P	HYDIN_uc010cfy.2_RNA	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	4496										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GGGAGGGACACGCTTCTTCGG	0.552													32	35	---	---	---	---	PASS
ADAD2	161931	broad.mit.edu	37	16	84229837	84229837	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84229837G>A	uc002fhr.2	+	8	1501	c.1387G>A	c.(1387-1389)GCC>ACC	p.A463T	ADAD2_uc002fhq.2_Missense_Mutation_p.A545T|uc002fhs.1_Intron	NM_001145400	NP_001138872	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2 isoform	463	A to I editase.				RNA processing	intracellular	adenosine deaminase activity|double-stranded RNA binding				0						CGTCCGGACCGCCCTGCACCT	0.697													71	94	---	---	---	---	PASS
BCL6B	255877	broad.mit.edu	37	17	6930071	6930071	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6930071C>G	uc002geg.2	+	7	1159	c.1102C>G	c.(1102-1104)CCA>GCA	p.P368A	BCL6B_uc010clt.1_Missense_Mutation_p.P369A	NM_181844	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B (zinc finger	368	C2H2-type 2.					nucleus	zinc ion binding			skin(1)	1						TTTTAACCGGCCAGCAAACCT	0.577													8	103	---	---	---	---	PASS
CCDC144NL	339184	broad.mit.edu	37	17	20768601	20768601	+	3'UTR	SNP	C	T	T	rs62066973	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768601C>T	uc002gyf.2	-	4						NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						ATGCATAAACCTCTAGAGTGA	0.318													10	11	---	---	---	---	PASS
FOXN1	8456	broad.mit.edu	37	17	26851603	26851603	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851603G>A	uc010crm.2	+	3	404	c.206G>A	c.(205-207)CGC>CAC	p.R69H	FOXN1_uc002hbj.2_Missense_Mutation_p.R69H	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	69					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					CACAGCCCCCGCATTGCGTCA	0.647													51	111	---	---	---	---	PASS
FOXN1	8456	broad.mit.edu	37	17	26851604	26851604	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851604C>T	uc010crm.2	+	3	405	c.207C>T	c.(205-207)CGC>CGT	p.R69R	FOXN1_uc002hbj.2_Silent_p.R69R	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	69					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					ACAGCCCCCGCATTGCGTCAC	0.652													51	107	---	---	---	---	PASS
CSF3	1440	broad.mit.edu	37	17	38172080	38172080	+	Silent	SNP	A	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38172080A>G	uc002htp.2	+	2	217	c.177A>G	c.(175-177)GCA>GCG	p.A59A	CSF3_uc002hto.2_Silent_p.A59A|CSF3_uc002htq.2_Silent_p.A55A|CSF3_uc010wep.1_Silent_p.A55A	NM_000759	NP_000750	P09919	CSF3_HUMAN	colony stimulating factor 3 isoform a precursor	59					cytokine-mediated signaling pathway|granulocyte differentiation|immune response|positive regulation of cell proliferation	extracellular space	cytokine activity|enzyme binding|granulocyte colony-stimulating factor receptor binding|growth factor activity			ovary(1)	1	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCGATGGCGCAGCGCTCCAGG	0.642													5	42	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630632	44630632	+	3'UTR	SNP	C	T	T	rs142505146	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630632C>T	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TGTTACACAGCATACAATTCC	0.234													6	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	45128735	45128735	+	5'Flank	SNP	T	C	C	rs138973461	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45128735T>C	uc010wkl.1	-						uc010wkm.1_RNA					Homo sapiens cDNA FLJ38031 fis, clone CTONG2013348.																		GAAATACTAATGATTTTTATT	0.308													4	172	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71354148	71354148	+	Intron	SNP	C	A	A	rs138950824	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71354148C>A	uc010dfm.2	-						SDK2_uc002jjt.3_Intron|SDK2_uc010dfn.2_Missense_Mutation_p.W1567L	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						GCAAGTGCCCCAAGTGGAGGG	0.627													5	212	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79478427	79478427	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79478427C>T	uc002kaj.1	-	3	614	c.589G>A	c.(589-591)GGC>AGC	p.G197S	ACTG1_uc002kah.1_Missense_Mutation_p.G75S|ACTG1_uc002kai.1_Missense_Mutation_p.G154S|ACTG1_uc002kak.1_Missense_Mutation_p.G197S|ACTG1_uc010wun.1_Missense_Mutation_p.G197S|ACTG1_uc002kal.1_Missense_Mutation_p.G197S|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide	197					adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			AAGCTGTAGCCTCGCTCAGTG	0.642													39	86	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76754200	76754200	+	Missense_Mutation	SNP	G	A	A	rs147654064		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76754200G>A	uc002lmt.2	+	2	2209	c.2209G>A	c.(2209-2211)GTG>ATG	p.V737M	SALL3_uc010dra.2_Missense_Mutation_p.V344M	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	737					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCCCCTGCGCGTGCAGCACTC	0.652													28	21	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9071591	9071591	+	Silent	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9071591G>T	uc002mkp.2	-	3	16059	c.15855C>A	c.(15853-15855)CCC>CCA	p.P5285P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5287	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATGTGTCCAAGGGAAGGGTAC	0.522													42	118	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9071592	9071592	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9071592G>T	uc002mkp.2	-	3	16058	c.15854C>A	c.(15853-15855)CCC>CAC	p.P5285H		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5287	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTGTCCAAGGGAAGGGTACT	0.517													43	117	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935327	30935327	+	Silent	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935327C>T	uc002nsu.1	+	2	996	c.858C>T	c.(856-858)CGC>CGT	p.R286R	ZNF536_uc010edd.1_Silent_p.R286R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	286	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCAAGAAGCGCGAGGAGCTGG	0.662													34	75	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45858935	45858935	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45858935G>A	uc002pbj.2	-	16	1578	c.1531C>T	c.(1531-1533)CGG>TGG	p.R511W	ERCC2_uc002pbh.2_Missense_Mutation_p.R74W|ERCC2_uc002pbi.2_Missense_Mutation_p.R204W|ERCC2_uc010ejz.2_Missense_Mutation_p.R433W|ERCC2_uc002pbk.2_Missense_Mutation_p.R487W	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	511	Mediates interaction with MMS19.		R -> Q (in XP-D).		cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ATATCCTCCCGGGTCTCAAAT	0.453			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				22	63	---	---	---	---	PASS
NTN5	126147	broad.mit.edu	37	19	49165010	49165010	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49165010C>T	uc002pkb.2	-	7	1490	c.1394G>A	c.(1393-1395)CGG>CAG	p.R465Q	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor	465	NTR.					extracellular region				large_intestine(1)|pancreas(1)	2						CTGCTGCAGCCGCTTCAGGGG	0.766													2	1	---	---	---	---	PASS
FAM71E1	112703	broad.mit.edu	37	19	50979132	50979132	+	Silent	SNP	G	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50979132G>A	uc002psh.2	-	2	676	c.318C>T	c.(316-318)GAC>GAT	p.D106D	FAM71E1_uc002psg.2_Silent_p.D106D|FAM71E1_uc002psi.2_RNA|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	106										breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		CCCGAAACTGGTCGAATTCGC	0.627													12	48	---	---	---	---	PASS
ZNF432	9668	broad.mit.edu	37	19	52538071	52538071	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52538071T>A	uc002pyk.2	-	5	1179	c.861A>T	c.(859-861)AAA>AAT	p.K287N		NM_014650	NP_055465	O94892	ZN432_HUMAN	zinc finger protein 432	287					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|pancreas(1)	3		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		ATATGTAGGGTTTCTCTCCAG	0.388													48	225	---	---	---	---	PASS
BANF2	140836	broad.mit.edu	37	20	17716422	17716422	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17716422A>C	uc002wpz.2	+	4	513	c.239A>C	c.(238-240)CAC>CCC	p.H80P	BANF2_uc010zrs.1_Missense_Mutation_p.H87P|BANF2_uc002wqa.2_Missense_Mutation_p.H80P	NM_178477	NP_848572	Q9H503	BAFL_HUMAN	barrier to autointegration factor 2 isoform 1	80						cytoplasm|nucleus	DNA binding			skin(1)	1						CAGACTTCTCACTGCCTCAAG	0.542													38	86	---	---	---	---	PASS
SLC35C2	51006	broad.mit.edu	37	20	44979077	44979077	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44979077C>A	uc002xro.2	-	10	1595	c.1054G>T	c.(1054-1056)GAC>TAC	p.D352Y	SLC35C2_uc002xrp.2_Missense_Mutation_p.D331Y|SLC35C2_uc002xrq.2_Missense_Mutation_p.D352Y|SLC35C2_uc002xrr.2_Missense_Mutation_p.D352Y|SLC35C2_uc010zxn.1_Missense_Mutation_p.D217Y|SLC35C2_uc010zxo.1_Missense_Mutation_p.D238Y|SLC35C2_uc010zxp.1_Missense_Mutation_p.D381Y	NM_173179	NP_775271	Q9NQQ7	S35C2_HUMAN	solute carrier family 35, member C2 isoform a	352					transport	integral to membrane				ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TCCTCATTGTCACCTTCCTCC	0.642													33	135	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10921956	10921956	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10921956G>C	uc002yip.1	-	18	1435	c.1067C>G	c.(1066-1068)TCT>TGT	p.S356C	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.S338C|TPTE_uc002yir.1_Missense_Mutation_p.S318C|TPTE_uc010gkv.1_Missense_Mutation_p.S218C	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	356	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACATATTTCAGAGGCAATAAG	0.343													28	170	---	---	---	---	PASS
RIMBP3	85376	broad.mit.edu	37	22	20458475	20458475	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20458475C>T	uc002zsd.3	-	1	3312	c.2827G>A	c.(2827-2829)GGG>AGG	p.G943R		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TGGCACAGCCCTCTGTCCACC	0.577													19	84	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46658215	46658215	+	Silent	SNP	G	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46658215G>T	uc003bhh.2	-	1	1005	c.1005C>A	c.(1003-1005)TCC>TCA	p.S335S		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	335	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CCGCCTGCAGGGAACTCCTGA	0.552													50	196	---	---	---	---	PASS
RBM10	8241	broad.mit.edu	37	X	47039694	47039694	+	Silent	SNP	C	G	G			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47039694C>G	uc004dhf.2	+	11	1525	c.1146C>G	c.(1144-1146)GCC>GCG	p.A382A	RBM10_uc004dhg.2_Silent_p.A304A|RBM10_uc004dhh.2_Silent_p.A381A|RBM10_uc010nhq.2_Silent_p.A305A|RBM10_uc004dhi.2_Silent_p.A447A	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	382	RRM 2.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						TTGAGTTTGCCAAGGGTTCTA	0.488													17	9	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36563769	36563770	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36563769_36563770insC	uc001bzv.1	-	2	1519_1520	c.1512_1513insG	c.(1510-1515)GGGCCCfs	p.G504fs	COL8A2_uc001bzw.1_Frame_Shift_Ins_p.G439fs	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	504_505	Triple-helical region.				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCCCCGTGGGCCCAGCCGTGC	0.762													8	4	---	---	---	---	
TRIT1	54802	broad.mit.edu	37	1	40318337	40318345	+	Intron	DEL	AAACTGAAG	-	-	rs60331110		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40318337_40318345delAAACTGAAG	uc010oiz.1	-						TRIT1_uc001cec.3_Intron|TRIT1_uc001ced.3_Intron|TRIT1_uc001cee.3_Intron|TRIT1_uc001cef.3_Intron|TRIT1_uc001ceg.3_Intron|TRIT1_uc001ceh.3_Intron|TRIT1_uc009vvv.2_Intron|TRIT1_uc001cei.3_Intron|TRIT1_uc001ceq.2_Intron|TRIT1_uc001cek.2_Intron|TRIT1_uc009vvx.2_Intron|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Intron|TRIT1_uc001cen.2_Intron|TRIT1_uc001ceo.2_Intron|TRIT1_uc001cep.2_Intron	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TCATCTGGGCAAACTGAAGAACTGACTGC	0.483													331	90	---	---	---	---	
PRKACB	5567	broad.mit.edu	37	1	84609919	84609941	+	Intron	DEL	AGTGGTTTGAATACCCTGCAAAC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84609919_84609941delAGTGGTTTGAATACCCTGCAAAC	uc001djj.2	+						PRKACB_uc001djl.2_5'Flank|PRKACB_uc001dji.2_Intron|PRKACB_uc001djk.2_5'Flank	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		GAACAGCAGTAGTGGTTTGAATACCCTGCAAACAGGAAGTTTG	0.363													24	12	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175620037	175620037	+	Intron	DEL	T	-	-	rs112456733		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175620037delT	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					ACTACCCCTCTCCCACCTCAT	0.065													4	3	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131014	54131015	+	Intron	INS	-	T	T	rs72533956		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131014_54131015insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			attaaaaaaaagaacagatatg	0.069													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60189838	60189857	+	IGR	DEL	TGTGTGTGTGTGTGTGTGTA	-	-	rs72027129		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60189838_60189857delTGTGTGTGTGTGTGTGTGTA								None (None upstream) : BCL11A (488446 downstream)																							tgtgtgtgtgtgtgtgtgtgtgtgtgtgtatgtgtgtgtg	0.286													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GTTTGTTACCTCTATCTACTGTCT	0.353													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92075769	92075770	+	IGR	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92075769_92075770insA								GGT8P (105616 upstream) : FKSG73 (53389 downstream)																							ACAATGATAATAAAAATGAATA	0.297													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103847	113103848	+	IGR	INS	-	CAT	CAT			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103847_113103848insCAT								ZC3H6 (6207 upstream) : RGPD8 (22118 downstream)																							caccatcacaccaccaccatca	0.114													1	5	---	---	---	---	
LCT	3938	broad.mit.edu	37	2	136587400	136587401	+	Intron	INS	-	GTGT	GTGT	rs137885947	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136587400_136587401insGTGT	uc002tuu.1	-							NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGAATGAGAAAgtgtgtgtgtg	0.416													5	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141298313	141298314	+	Intron	INS	-	C	C	rs148238992	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141298313_141298314insC	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTAGTGCACAACAGGAGGGTAA	0.396										TSP Lung(27;0.18)			7	5	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166895860	166895860	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166895860delA	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CAAAAAAACTATGACATTGCT	0.294													23	9	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179669192	179669214	+	Intron	DEL	AACTTGGCGTCAAGTCCTGCAGC	-	-	rs148127052	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179669192_179669214delAACTTGGCGTCAAGTCCTGCAGC	uc002und.2	-						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002unb.2_Intron			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAGGGCTTAAACTTGGCGTCAAGTCCTGCAGCAACGTTAACT	0.408													20	10	---	---	---	---	
STK11IP	114790	broad.mit.edu	37	2	220478010	220478011	+	Intron	INS	-	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220478010_220478011insT	uc002vml.2	+							NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein						protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		gggagatgggggagtgaggggg	0.054													4	4	---	---	---	---	
AGFG1	3267	broad.mit.edu	37	2	228418611	228418616	+	Intron	DEL	ATATTG	-	-	rs71873735		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228418611_228418616delATATTG	uc002vpc.2	+						AGFG1_uc002vpd.2_Intron|AGFG1_uc002vpe.2_Intron|AGFG1_uc002vpf.2_Intron	NM_004504	NP_004495	P52594	AGFG1_HUMAN	HIV-1 Rev binding protein isoform 2						cell differentiation|mRNA export from nucleus|multicellular organismal development|regulation of ARF GTPase activity|spermatogenesis	cytoplasmic membrane-bounded vesicle|Golgi apparatus|nuclear pore	ARF GTPase activator activity|DNA binding|protein binding|RNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4						ATTTGGTGTTATATTGATATGAGTGA	0.248													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239667253	239667260	+	IGR	DEL	CTTCCTTC	-	-	rs71043164		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239667253_239667260delCTTCCTTC								ASB1 (306363 upstream) : TWIST2 (89413 downstream)																							ttctttctttcttccttccttccttcct	0.043													4	3	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241720244	241720247	+	Intron	DEL	GCTC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241720244_241720247delGCTC	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cacacacacagctccacacacaca	0.123													4	2	---	---	---	---	
THRB	7068	broad.mit.edu	37	3	24310879	24310882	+	Intron	DEL	CGCG	-	-	rs10575859		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24310879_24310882delCGCG	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron|THRB_uc003cdc.2_Intron|THRB_uc003cdd.2_Intron|THRB_uc003cde.1_Intron	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	atagcTcacacgcgcgcgcgcgcg	0.020													4	2	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37549871	37549872	+	Intron	INS	-	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37549871_37549872insT	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TTGAAGGACCCTTTTTTTTGCA	0.431													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52596174	52596174	+	Intron	DEL	A	-	-	rs35217588		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52596174delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		cgtttctactaaaaaaaaaaa	0.000			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								4	2	---	---	---	---	
ARL13B	200894	broad.mit.edu	37	3	93699571	93699572	+	Intron	DEL	GT	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93699571_93699572delGT	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						TTGTTAAAAAgtgtgtgtgtgt	0.267													7	4	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113167135	113167135	+	Intron	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113167135delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						CTTGAAAGACTTTTTTTTTTT	0.323													7	4	---	---	---	---	
TM4SF18	116441	broad.mit.edu	37	3	149042947	149042947	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149042947delA	uc003exa.2	-							NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18							integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACATAGAAATAAAAAAAAAAG	0.313													4	3	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169890162	169890163	+	Intron	INS	-	A	A	rs147807222	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169890162_169890163insA	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron|PHC3_uc003fgp.3_Intron|PHC3_uc003fgq.3_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CAGAGTAACATAAAAAAACATA	0.337													5	7	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													9	7	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20270681	20270681	+	Intron	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20270681delT	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						GTTCCAGTTGTTTTATTTGGT	0.303													3	3	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39827205	39827205	+	Intron	DEL	T	-	-	rs72009420		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39827205delT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ATCTAAAATCttttttttttt	0.149													3	3	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41648508	41648509	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41648508_41648509delGA	uc003gvu.3	+	12	1317_1318	c.1263_1264delGA	c.(1261-1266)CGGAGAfs	p.R421fs	LIMCH1_uc003gvv.3_Frame_Shift_Del_p.R421fs|LIMCH1_uc003gvw.3_Frame_Shift_Del_p.R421fs|LIMCH1_uc003gvx.3_Frame_Shift_Del_p.R409fs|LIMCH1_uc003gwe.3_Frame_Shift_Del_p.R421fs|LIMCH1_uc003gvy.3_Frame_Shift_Del_p.R250fs|LIMCH1_uc003gwa.3_Frame_Shift_Del_p.R262fs|LIMCH1_uc003gvz.3_Frame_Shift_Del_p.R806fs|LIMCH1_uc011byu.1_Frame_Shift_Del_p.R255fs|LIMCH1_uc003gwc.3_Frame_Shift_Del_p.R267fs|LIMCH1_uc003gwd.3_Frame_Shift_Del_p.R255fs|LIMCH1_uc011byv.1_Frame_Shift_Del_p.R172fs	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	421_422	Potential.				actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						TTAGAGAGCGGAGAGAGAGAGA	0.465													254	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49107447	49107447	+	IGR	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49107447delT								CWH43 (43354 upstream) : None (None downstream)																							ttccattccattccattgcac	0.000													95	10	---	---	---	---	
CEP135	9662	broad.mit.edu	37	4	56890991	56890992	+	Intron	INS	-	T	T	rs113118558		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56890991_56890992insT	uc003hbi.2	+						CEP135_uc003hbj.2_Intron	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4						centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					acagtgtatgcttttttttttt	0.000													4	2	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243419	120243420	+	5'Flank	INS	-	TT	TT	rs151066719	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243419_120243420insTT	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						AATTCTTATTAATTAATTCTTA	0.287													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187396516	187396517	+	Intron	INS	-	AA	AA	rs75413796	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187396516_187396517insAA	uc003izb.1	-						uc003izc.2_Intron					Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		aagaaagaaagaaagaaagaaa	0.000													2	6	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127713774	127713774	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127713774delA	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTGGGAAAGGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134017932	134017933	+	Intron	INS	-	A	A	rs74591727		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134017932_134017933insA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			aactctgtctcaaaaaaaaaaa	0.109													5	3	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169461229	169461230	+	Intron	INS	-	A	A	rs138978757	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169461229_169461230insA	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tctgatgttagaaaaaaaatTG	0.183													5	5	---	---	---	---	
ATP6V0E1	8992	broad.mit.edu	37	5	172414286	172414286	+	Intron	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172414286delT	uc003mcd.1	+							NM_003945	NP_003936	O15342	VA0E1_HUMAN	ATPase, H+ transporting, lysosomal 9kDa, V0						ATP hydrolysis coupled proton transport|cell growth|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport|vacuolar acidification	endosome membrane|integral to membrane|membrane fraction|proton-transporting V-type ATPase, V0 domain|vacuole	proton-transporting ATPase activity, rotational mechanism				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGCTATAACttttttttttt	0.204													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58776848	58776848	+	IGR	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58776848delT								GUSBL2 (489124 upstream) : None (None downstream)																							tgagacaccgtttttgtagaa	0.000													572	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58779082	58779083	+	IGR	INS	-	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58779082_58779083insT								GUSBL2 (491358 upstream) : None (None downstream)																							ccaagcggatattagagcgcct	0.000													513	8	---	---	---	---	
LPA	4018	broad.mit.edu	37	6	161036384	161036385	+	Intron	INS	-	TGTG	TGTG	rs62441719		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161036384_161036385insTGTG	uc003qtl.2	-							NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	tgttttcagtttgtgtgtgtgt	0.178													6	4	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	31876560	31876560	+	Intron	DEL	T	-	-	rs34163039		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31876560delT	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			AAGGAAATACTTTTTTTCCCC	0.338													4	6	---	---	---	---	
DDC	1644	broad.mit.edu	37	7	50560728	50560729	+	Intron	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50560728_50560729insA	uc003tpf.3	-						DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Intron	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid						cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	CCGCATTCATTACACTCCTTCT	0.391													40	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57992549	57992550	+	IGR	INS	-	T	T	rs145704334		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57992549_57992550insT								ZNF716 (459284 upstream) : None (None downstream)																							cttctgtgtagtttttatgtga	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62609193	62609194	+	IGR	INS	-	T	T	rs78233785		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62609193_62609194insT								None (None upstream) : LOC643955 (142478 downstream)																							TTATCTTACTCTTTTTTTTTTT	0.213													4	6	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66767610	66767611	+	5'Flank	INS	-	G	G	rs71293166	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66767610_66767611insG	uc003tvt.3	+						PMS2L4_uc003tvo.2_5'Flank|PMS2L4_uc003tvq.2_5'Flank|PMS2L4_uc003tvr.3_5'Flank|PMS2L4_uc003tvs.3_5'Flank|STAG3L4_uc010laj.2_5'Flank	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				CACCGGACTGCTTTTTTTTTTT	0.545													4	2	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89929478	89929479	+	Intron	INS	-	T	T	rs35447757		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89929478_89929479insT	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						TTTGTCTAAAGTTTTTTTTTTT	0.252													4	2	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104681592	104681592	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104681592delA	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						TTTTTAAAGTAAAAAAAAAAA	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122391316	122391331	+	5'Flank	DEL	TGTGTGTGTGTGTGTA	-	-	rs72515099	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122391316_122391331delTGTGTGTGTGTGTGTA	uc003ypg.1	-											DQ589334																		aaaggttgtgtgtgtgtgtgtgtgtatgtgtgtgtg	0.093													3	3	---	---	---	---	
ATAD2	29028	broad.mit.edu	37	8	124350061	124350065	+	Splice_Site	DEL	ACTTC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124350061_124350065delACTTC	uc003yqh.3	-	21	2963	c.2855_splice	c.e21-1	p.V952_splice	ATAD2_uc011lii.1_Splice_Site_p.V743_splice|ATAD2_uc003yqi.3_Splice_Site	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AGCCTGCAAAACTTCACATGAATGG	0.410													130	18	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139728460	139728460	+	Intron	DEL	C	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139728460delC	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AAGGAAGCTGCCACACTTACC	0.567										HNSCC(7;0.00092)			24	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	31645187	31645188	+	IGR	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31645187_31645188insA								None (None upstream) : ACO1 (739413 downstream)																							TAGTCTCTATTAAAAAAAAAAA	0.233													4	2	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32492607	32492607	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32492607delA	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TTTACTGAAGAAATGTCAGTC	0.358													62	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34918405	34918406	+	IGR	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34918405_34918406insA								C9orf144 (79822 upstream) : KIAA1045 (39115 downstream)																							CCAAGGTCTTTAAAAAAAAAAA	0.361													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68416444	68416445	+	IGR	DEL	TA	-	-	rs71796053		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68416444_68416445delTA								FAM27B (622255 upstream) : MIR1299 (585794 downstream)																							tatttttttttaaatacttttt	0.000													6	3	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	95964607	95964608	+	Intron	INS	-	GTGT	GTGT			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95964607_95964608insGTGT	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc010mrc.1_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						TCCgtgtgcacgtgtgtgtgtg	0.490													3	3	---	---	---	---	
C9orf125	84302	broad.mit.edu	37	9	104239493	104239494	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs67389871	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239493_104239494insAAACAAAC	uc004bbm.2	-						uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				GTAACTTaaaaaaacaaacaaa	0.351													6	5	---	---	---	---	
KIAA0368	23392	broad.mit.edu	37	9	114185542	114185550	+	Intron	DEL	AAAGAAAAG	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114185542_114185550delAAAGAAAAG	uc004bfe.1	-						KIAA0368_uc010muc.1_Intron	NM_001080398	NP_001073867			KIAA0368 protein												0						GAAATTaaaaaaagaaaagaaagaaaaga	0.268													4	4	---	---	---	---	
NDUFA8	4702	broad.mit.edu	37	9	124914834	124914835	+	Intron	INS	-	T	T	rs10659040		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124914834_124914835insT	uc004blv.2	-							NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)	CATAATAATAAttttttttttt	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42391470	42391470	+	IGR	DEL	T	-	-	rs28839468		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42391470delT								None (None upstream) : LOC441666 (435845 downstream)																							tcaaacggaatcaaacggaat	0.000													390	7	---	---	---	---	
FAM190B	54462	broad.mit.edu	37	10	86148860	86148861	+	Intron	INS	-	T	T			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86148860_86148861insT	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14											ovary(3)|skin(1)	4						ccaataataacttttTTTTTTT	0.158													3	3	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	680002	680003	+	Intron	INS	-	ACCAGGATG	ACCAGGATG	rs138147673	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:680002_680003insACCAGGATG	uc001lqq.1	-						DEAF1_uc009ycf.1_Intron	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CACAGGAGAAAACCAGGATGGC	0.520													5	3	---	---	---	---	
RNASEH2C	84153	broad.mit.edu	37	11	65487262	65487273	+	In_Frame_Del	DEL	CGGGCACCTGTG	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65487262_65487273delCGGGCACCTGTG	uc001ofn.2	-	4	656_667	c.476_487delCACAGGTGCCCG	c.(475-489)GCACAGGTGCCCGAG>GAG	p.AQVP159del	RNASEH2C_uc001ofm.2_RNA	NM_032193	NP_115569	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	159_162					RNA catabolic process	nucleus|ribonuclease H2 complex					0						TCTCAGTCCTCGGGCACCTGTGCGTGAATCTG	0.528													81	15	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72296159	72296160	+	Intron	DEL	TT	-	-	rs5792596		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72296159_72296160delTT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AAGTGTTTTGTTTTTTTTTttt	0.282											OREG0021196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077165	73077166	+	Intron	DEL	TG	-	-	rs112101560		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077165_73077166delTG	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						CTAGGATAGTtgtgtgtgtgtg	0.386													6	3	---	---	---	---	
DCP1B	196513	broad.mit.edu	37	12	2102823	2102824	+	Intron	DEL	TA	-	-	rs11062047	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2102823_2102824delTA	uc001qjx.1	-						DCP1B_uc010sdy.1_Intron|DCP1B_uc010sdz.1_Intron	NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			tgtgtgtgtgtATACAGATGTT	0.243													3	3	---	---	---	---	
MLF2	8079	broad.mit.edu	37	12	6857816	6857817	+	Intron	DEL	TC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6857816_6857817delTC	uc010sfi.1	-						MLF2_uc001qqp.2_Intron	NM_005439	NP_005430	Q15773	MLF2_HUMAN	myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1						AGAACATTGTTCTCTTTCCATG	0.530													35	13	---	---	---	---	
C12orf57	113246	broad.mit.edu	37	12	7053872	7053877	+	Intron	DEL	GAGGGC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7053872_7053877delGAGGGC	uc001qrz.2	+						C12orf57_uc009zfj.1_In_Frame_Del_p.EG120del|PTPN6_uc001qsa.1_5'Flank|PTPN6_uc010sfr.1_5'Flank	NM_138425	NP_612434	Q99622	C10_HUMAN	C10 protein												0						TGGGTCGGGAGAGGGCGCCGGATCTG	0.636											OREG0011073|OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model	62	13	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	22041045	22041056	+	Intron	DEL	GACAGAGGGGTT	-	-	rs145112683		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22041045_22041056delGACAGAGGGGTT	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	aattgctgaggacagaggggtttccaggacat	0.175													3	4	---	---	---	---	
SCN8A	6334	broad.mit.edu	37	12	52174389	52174393	+	Intron	DEL	GGTTA	-	-	rs11169917		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52174389_52174393delGGTTA	uc001ryw.2	+						SCN8A_uc010snl.1_Intron|SCN8A_uc001rza.1_Intron	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha						axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	ttttttttttggttaccttttttgt	0.098													4	3	---	---	---	---	
AGAP2	116986	broad.mit.edu	37	12	58129302	58129303	+	Intron	INS	-	C	C	rs149789274	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58129302_58129303insC	uc001spq.2	-						AGAP2_uc001spp.2_Intron|AGAP2_uc001spr.2_Intron	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L						axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						CAGCTTTCCAACCCCCCCCCAA	0.634													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31417771	31417772	+	IGR	DEL	GT	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31417771_31417772delGT								ALOX5AP (79215 upstream) : C13orf33 (62540 downstream)																							tgtgtgtgtggtgtgtgtgtat	0.000													4	2	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32906912	32906912	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32906912delA	uc001uub.1	+	10	1524	c.1297delA	c.(1297-1299)AACfs	p.N433fs	BRCA2_uc001uua.1_Frame_Shift_Del_p.N310fs	NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	433					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGACACAGAGAACAAAAGAAA	0.358			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			149	82	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95673939	95673939	+	Intron	DEL	A	-	-	rs9524765	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95673939delA	uc001vmd.3	-						ABCC4_uc010afj.2_Intron|ABCC4_uc010afk.2_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	AAGTATACCTAGAAAAAAAAA	0.358													115	8	---	---	---	---	
MYH7	4625	broad.mit.edu	37	14	23902035	23902048	+	Intron	DEL	AGTTGCGAAGGGGG	-	-	rs3729806	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23902035_23902048delAGTTGCGAAGGGGG	uc001wjx.2	-							NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTGACTTGCCAGTTGCGAAGGGGGAGGGCTGGTG	0.528													67	13	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64682283	64682284	+	Intron	INS	-	C	C	rs138806575	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64682283_64682284insC	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron|SYNE2_uc001xgr.2_Intron|SYNE2_uc010tsi.1_Intron|SYNE2_uc001xgs.2_Intron|SYNE2_uc001xgt.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTCGATGCCAACCCCCTCTCCT	0.505													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69037590	69037591	+	Intron	INS	-	CA	CA	rs138540642	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69037590_69037591insCA	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		GGCTGGAGCGCcacacacacac	0.287			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					3	3	---	---	---	---	
AK7	122481	broad.mit.edu	37	14	96953557	96953557	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96953557delA	uc001yfn.2	+							NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		ctaaaaatacaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20512082	20512083	+	IGR	INS	-	CCCTGGCCCTGG	CCCTGGCCCTGG	rs148823774	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20512082_20512083insCCCTGGCCCTGG								None (None upstream) : GOLGA6L6 (225011 downstream)																							cccagtcttgaccctggccctg	0.059													4	3	---	---	---	---	
NF1P1	440225	broad.mit.edu	37	15	21135196	21135199	+	5'Flank	DEL	GTGT	-	-	rs141414536		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21135196_21135199delGTGT	uc001ytv.1	-											Human NF1-related locus DNA in A9 mouse DNA background.												0						gtcttTGAGAgtgtgtgtgtgtgt	0.235													4	4	---	---	---	---	
RTF1	23168	broad.mit.edu	37	15	41757131	41757132	+	Intron	INS	-	GT	GT	rs147115092	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41757131_41757132insGT	uc001zny.2	+							NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component						histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		ACCTGTTTTGAgtgtgtgtgtg	0.243													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21513145	21513153	+	Intron	DEL	GCCGCCGCC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21513145_21513153delGCCGCCGCC	uc002diq.3	+						LOC100271836_uc002dja.2_Intron|LOC100271836_uc002djb.2_Intron					Homo sapiens cDNA FLJ59829 complete cds.																		TGCCGTTGGTgccgccgccgccgccgccg	0.593													4	2	---	---	---	---	
UQCRC2	7385	broad.mit.edu	37	16	21994285	21994285	+	Intron	DEL	A	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21994285delA	uc002djx.2	+						UQCRC2_uc002djy.2_Intron|UQCRC2_uc010bxa.2_Intron	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II						aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		actccacctcaaaaaaaaaaa	0.095													6	3	---	---	---	---	
SEZ6L2	26470	broad.mit.edu	37	16	29908948	29908951	+	Intron	DEL	CTGA	-	-	rs79142080		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29908948_29908951delCTGA	uc002duq.3	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Intron|SEZ6L2_uc002dur.3_Intron|SEZ6L2_uc002dus.3_Intron|SEZ6L2_uc010vec.1_Intron|SEZ6L2_uc010ved.1_Intron	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						gtttttctgtctgactgtcaccta	0.147													8	12	---	---	---	---	
BBS2	583	broad.mit.edu	37	16	56531052	56531054	+	Intron	DEL	ATG	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56531052_56531054delATG	uc002ejd.2	-							NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2 protein						adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1						ACCCAGACAAATGAAAAGACACT	0.424									Bardet-Biedl_syndrome				110	9	---	---	---	---	
CDH3	1001	broad.mit.edu	37	16	68684840	68684841	+	Intron	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68684840_68684841insA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding			ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TTGAACAGGTTAAAAAAAAAAA	0.485													6	3	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15508388	15508389	+	Intron	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15508388_15508389insA	uc002gor.1	-						CDRT1_uc002gov.3_Intron|CDRT1_uc002gou.2_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TTTTCCTTGCCAAAAAAAAAAT	0.317													9	6	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16594083	16594098	+	Intron	DEL	CGTCCTGTCGGGGACA	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16594083_16594098delCGTCCTGTCGGGGACA	uc002gqk.1	+							NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						AAGGATGCGCCGTCCTGTCGGGGACACTGGCTTTCT	0.620													97	38	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21549457	21549457	+	IGR	DEL	C	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21549457delC								C17orf51 (71726 upstream) : FAM27L (275913 downstream)																							TTGCCTGGGGCCCAGCCCCTG	0.567													5	5	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34930247	34930247	+	Intron	DEL	T	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34930247delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron|GGNBP2_uc002hnc.1_5'Flank	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		gactgtagtcttttttttttt	0.159													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	64194106	64194107	+	IGR	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64194106_64194107insA								CCDC46 (5894 upstream) : APOH (14041 downstream)																							ACACAGGCCTGAAAATACACAA	0.376													60	26	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67563417	67563418	+	Intron	INS	-	TT	TT	rs33943534		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563417_67563418insTT	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CTTTATACTACttttttttttt	0.173													6	3	---	---	---	---	
ZNF585B	92285	broad.mit.edu	37	19	37678269	37678270	+	Intron	DEL	TT	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37678269_37678270delTT	uc002ofq.2	-						ZNF585B_uc002ofr.1_Intron	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTCAAGCCATTTCCAAATAAG	0.327													8	4	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	38938908	38938909	+	Intron	INS	-	A	A			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38938908_38938909insA	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ctggtttctgtaaaaaaaagaa	0.248													100	23	---	---	---	---	
NTN5	126147	broad.mit.edu	37	19	49173241	49173241	+	Intron	DEL	T	-	-	rs71179032		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173241delT	uc002pkb.2	-						SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Intron	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor							extracellular region				large_intestine(1)|pancreas(1)	2						atcaccatcatcaccaccacc	0.000													3	4	---	---	---	---	
KLK1	3816	broad.mit.edu	37	19	51322517	51322527	+	Frame_Shift_Del	DEL	GGCTTATTGGG	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51322517_51322527delGGCTTATTGGG	uc002ptk.1	-	5	751_761	c.712_722delCCCAATAAGCC	c.(712-723)CCCAATAAGCCTfs	p.P238fs	KLK1_uc010ycg.1_RNA	NM_002257	NP_002248	P06870	KLK1_HUMAN	kallikrein 1 preproprotein	238_241	Peptidase S1.				proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGCGACAGAAGGCTTATTGGGGGTGCCACAA	0.583													147	13	---	---	---	---	
U2AF2	11338	broad.mit.edu	37	19	56181832	56181832	+	Intron	DEL	C	-	-	rs66835098		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56181832delC	uc002qlu.2	+						U2AF2_uc002qlt.2_Intron	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		ACCCTGCTGTCCCGTGCACCC	0.373													7	4	---	---	---	---	
MYH7B	57644	broad.mit.edu	37	20	33567646	33567652	+	Intron	DEL	GTATGTG	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33567646_33567652delGTATGTG	uc010gfa.1	+						MYH7B_uc002xbi.1_Intron			A7E2Y1	MYH7B_HUMAN	RecName: Full=Myosin-7B; AltName: Full=Myosin heavy chain 7B, cardiac muscle beta isoform; AltName: Full=Myosin cardiac muscle beta chain; AltName: Full=Antigen MLAA-21; AltName: Full=Slow A MYH14;							membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			ggtggggcttgtatgtggggcggggct	0.261													31	11	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62191130	62191133	+	Intron	DEL	AGTC	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62191130_62191133delAGTC	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			gtcagatgggagtcagtcagagtc	0.103													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10723998	10723998	+	IGR	DEL	A	-	-	rs138027040		TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10723998delA								None (None upstream) : TPTE (182745 downstream)																							ccaaatattcacttgcagatt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16920274	16920275	+	IGR	DEL	AT	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16920274_16920275delAT								OR11H1 (470470 upstream) : CCT8L2 (151373 downstream)																							TTATAGTGACATGTATGAAAAC	0.267													4	3	---	---	---	---	
SGSM1	129049	broad.mit.edu	37	22	25246361	25246381	+	In_Frame_Del	DEL	CCTGGACAAAATTGTGCATTA	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25246361_25246381delCCTGGACAAAATTGTGCATTA	uc003abg.2	+	5	574_594	c.417_437delCCTGGACAAAATTGTGCATTA	c.(415-438)GTCCTGGACAAAATTGTGCATTAC>GTC	p.LDKIVHY140del	SGSM1_uc003abh.2_In_Frame_Del_p.LDKIVHY140del|SGSM1_uc010guu.1_In_Frame_Del_p.LDKIVHY140del|SGSM1_uc003abj.2_In_Frame_Del_p.LDKIVHY140del|SGSM1_uc003abi.1_In_Frame_Del_p.LDKIVHY115del|SGSM1_uc003abf.2_In_Frame_Del_p.LDKIVHY140del	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	140_146	RUN.					Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						TTGAGAAGGTCCTGGACAAAATTGTGCATTACCTTGTGGAA	0.557											OREG0026418	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42719972	42719974	+	IGR	DEL	TGA	-	-	rs10615698	by1000genomes	TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42719972_42719974delTGA								TCF20 (108527 upstream) : NFAM1 (56441 downstream)																							gtggtggtggtgatggtggtggt	0.000													4	3	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70609385	70609403	+	Intron	DEL	CTTTGTGTTTTTTAACTGA	-	-			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70609385_70609403delCTTTGTGTTTTTTAACTGA	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AAAACTTGTGCTTTGTGTTTTTTAACTGACTGATTTATG	0.365													28	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	1900	1901	+	5'Flank	INS	-	C	C			TCGA-CH-5754-01	TCGA-CH-5754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1900_1901insC	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		GCCAAAGCTAAGACCCCCGAAA	0.396													26	73	---	---	---	---	
