Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCC	9696	broad.mit.edu	37	1	17264920	17264920	+	Missense_Mutation	SNP	C	T	T	rs4463721	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264920C>T	uc001azt.2	+	11	1385	c.1316C>T	c.(1315-1317)GCG>GTG	p.A439V	CROCC_uc009voy.1_Missense_Mutation_p.A142V|CROCC_uc009voz.1_Missense_Mutation_p.A202V|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	439	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGGAGCAGGCGGCCCTGGAG	0.617													5	4	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34102104	34102104	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34102104G>A	uc001bxn.1	-	30	4734	c.4705C>T	c.(4705-4707)CGG>TGG	p.R1569W	CSMD2_uc001bxm.1_Missense_Mutation_p.R1609W|CSMD2_uc001bxo.1_Missense_Mutation_p.R482W	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1569	Extracellular (Potential).|Sushi 9.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GACCCCACCCGTGTGCCGTTC	0.582													8	80	---	---	---	---	PASS
NFYC	4802	broad.mit.edu	37	1	41218877	41218877	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41218877G>A	uc001cge.2	+	4	354	c.346G>A	c.(346-348)GAT>AAT	p.D116N	NFYC_uc010ojm.1_Intron|NFYC_uc001cfx.3_Missense_Mutation_p.D116N|NFYC_uc009vwd.2_Missense_Mutation_p.D116N|NFYC_uc001cfz.2_Missense_Mutation_p.D116N|NFYC_uc010ojn.1_Missense_Mutation_p.D78N|NFYC_uc001cfy.3_Missense_Mutation_p.D116N|NFYC_uc001cgc.2_Missense_Mutation_p.D116N|NFYC_uc001cgb.2_Missense_Mutation_p.D116N|NFYC_uc001cgd.3_Missense_Mutation_p.D116N|MIR30E_hsa-mir-30e|MI0000749_5'Flank|uc001cgf.1_5'Flank	NM_001142588	NP_001136060	Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma isoform 1	116					protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)|kidney(1)	3	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			TTTTCTCATCGATATTGTTCC	0.423													19	69	---	---	---	---	PASS
TMEM167B	56900	broad.mit.edu	37	1	109637041	109637041	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109637041G>T	uc001dwn.2	+	3	237	c.145G>T	c.(145-147)GCT>TCT	p.A49S	TMEM167B_uc009weu.2_RNA	NM_020141	NP_064526	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B precursor	49	Extracellular (Potential).					Golgi membrane|integral to membrane					0						CCTGCTAGCCGCTGTGATTGG	0.448													16	114	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004280	148004280	+	3'UTR	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004280G>A	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TAGCTACCCAGAGATACGTGG	0.453													3	10	---	---	---	---	PASS
TP53BP2	7159	broad.mit.edu	37	1	223971997	223971997	+	Silent	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223971997G>T	uc010pvb.1	-	17	3475	c.3183C>A	c.(3181-3183)GGC>GGA	p.G1061G	TP53BP2_uc001hod.2_Silent_p.G932G|TP53BP2_uc010puz.1_Silent_p.G294G|TP53BP2_uc010pva.1_Silent_p.G700G	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1	1055	Mediates interaction with APC2.				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		TATTCATTATGCCCATCTTCT	0.378													14	139	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235954944	235954944	+	Intron	SNP	A	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235954944A>C	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron|LYST_uc001hxl.1_3'UTR	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GCTCAAGGAAAATTATAGTCT	0.343									Chediak-Higashi_syndrome				30	73	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245849237	245849237	+	Silent	SNP	C	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245849237C>A	uc001ibf.1	+	12	3392	c.2952C>A	c.(2950-2952)TCC>TCA	p.S984S	KIF26B_uc001ibg.1_Silent_p.S602S|KIF26B_uc001ibh.1_Silent_p.S226S	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	984					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ATAATGGGTCCGAAGGTCAGC	0.622													4	25	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65296798	65296798	+	Missense_Mutation	SNP	G	A	A	rs7572857	byFrequency	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65296798G>A	uc002sdl.3	+	2	434	c.220G>A	c.(220-222)GGC>AGC	p.G74S	CEP68_uc002sdj.2_Missense_Mutation_p.G74S|CEP68_uc010yqb.1_Missense_Mutation_p.G74S|CEP68_uc002sdk.3_Missense_Mutation_p.G74S|CEP68_uc010yqc.1_Missense_Mutation_p.G74S|CEP68_uc010yqd.1_Missense_Mutation_p.G74S	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	74					centrosome organization	centrosome				skin(1)	1						TGACCCTGGCGGCCCCTCTAG	0.647													7	60	---	---	---	---	PASS
LOC150776	150776	broad.mit.edu	37	2	132276530	132276530	+	Translation_Start_Site	SNP	C	T	T	rs12052334	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132276530C>T	uc002tsz.3	+	1	238	c.-209C>T	c.(-211--207)GACGC>GATGC		LOC150776_uc002tsy.3_Intron					Homo sapiens cDNA FLJ41352 fis, clone BRAWH2014645.												0						CTCCTCCTGACGCTCAGCAGT	0.532													9	4	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167262940	167262940	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167262940T>C	uc002udu.1	-	25	4326	c.4199A>G	c.(4198-4200)TAT>TGT	p.Y1400C		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1400	Helical; Name=S5 of repeat IV; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						GGCAAAATTATACATTCCAAA	0.353													22	151	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179406214	179406214	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179406214T>A	uc010zfg.1	-	299	90110	c.89886A>T	c.(89884-89886)CAA>CAT	p.Q29962H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q23657H|TTN_uc010zfi.1_Missense_Mutation_p.Q23590H|TTN_uc010zfj.1_Missense_Mutation_p.Q23465H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30889							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCCAGTCACTTGGGAGCCAC	0.498													11	30	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604912	179604912	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604912C>G	uc010zfh.1	-	46	12759	c.12535G>C	c.(12535-12537)GTG>CTG	p.V4179L	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.V4112L|TTN_uc010zfj.1_Missense_Mutation_p.V3987L|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGGCATCACCACGTTGTCA	0.458													16	137	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207425911	207425911	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207425911G>A	uc002vbq.2	+	12	1452	c.1229G>A	c.(1228-1230)CGC>CAC	p.R410H	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	410	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GTCTGTTCTCGCACAAGAGGA	0.413													25	65	---	---	---	---	PASS
HDAC11	79885	broad.mit.edu	37	3	13542247	13542247	+	Silent	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13542247C>T	uc003bxy.2	+	6	580	c.447C>T	c.(445-447)GGC>GGT	p.G149G	HDAC11_uc010heb.2_Missense_Mutation_p.A107V|HDAC11_uc011aux.1_Intron|HDAC11_uc003bxz.2_Silent_p.G121G|HDAC11_uc011auy.1_Silent_p.G98G	NM_024827	NP_079103	Q96DB2	HDA11_HUMAN	histone deacetylase 11 isoform 1	149	Histone deacetylase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex|plasma membrane	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding			ovary(2)	2						GCGACCGTGGCGGGGGCTTCT	0.647											OREG0015412	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	7	---	---	---	---	PASS
DLEC1	9940	broad.mit.edu	37	3	38135139	38135139	+	Silent	SNP	T	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38135139T>C	uc003cho.1	+	12	1821	c.1800T>C	c.(1798-1800)GGT>GGC	p.G600G	DLEC1_uc003chp.1_Silent_p.G600G|DLEC1_uc010hgv.1_Silent_p.G600G|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_5'Flank|DLEC1_uc003chq.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	600					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ATATTTCTGGTGAAAAAAGCC	0.493													28	93	---	---	---	---	PASS
PSMD6	9861	broad.mit.edu	37	3	63996409	63996409	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63996409T>G	uc003dma.1	-	8	1130	c.1105A>C	c.(1105-1107)ACT>CCT	p.T369P	uc003dly.1_Intron|PSMD6_uc003dlz.1_Missense_Mutation_p.T320P|PSMD6_uc003dmb.1_Missense_Mutation_p.T422P|PSMD6_uc003dmc.1_Missense_Mutation_p.T330P|PSMD6_uc003dmd.1_Missense_Mutation_p.T331P	NM_014814	NP_055629	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit,	369					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	ATPase activity|protein binding			central_nervous_system(1)|skin(1)	2		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		TTCTTGATAGTTTCTTGGTAC	0.318													12	84	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146058804	146058804	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146058804C>A	uc003ika.3	-	21	3066	c.2928G>T	c.(2926-2928)CAG>CAT	p.Q976H	OTUD4_uc003ijz.3_Missense_Mutation_p.Q975H	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	1040							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					GATTATAGAACTGCTTGGATC	0.413													47	384	---	---	---	---	PASS
SLC4A9	83697	broad.mit.edu	37	5	139744179	139744179	+	Silent	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139744179C>T	uc003lfm.2	+	11	1727	c.1692C>T	c.(1690-1692)TAC>TAT	p.Y564Y	SLC4A9_uc003lfj.2_Silent_p.Y540Y|SLC4A9_uc011czg.1_Silent_p.Y540Y|SLC4A9_uc003lfl.2_Silent_p.Y540Y|SLC4A9_uc003lfk.2_Silent_p.Y529Y	NM_031467	NP_113655	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate	564	Extracellular (Potential).|Membrane (anion exchange).					integral to membrane|plasma membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCTGCCTACGGGTGCCTCT	0.562													5	15	---	---	---	---	PASS
SLC36A2	153201	broad.mit.edu	37	5	150696323	150696323	+	3'UTR	SNP	A	G	G	rs146147608		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150696323A>G	uc003lty.2	-	10					GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_3'UTR	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2						cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aaaaaaaaaaaaGAGATCCAT	0.244													8	22	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152558076	152558076	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152558076G>A	uc010kiw.2	-	109	20677	c.20075C>T	c.(20074-20076)TCC>TTC	p.S6692F	SYNE1_uc010kiv.2_Missense_Mutation_p.S1216F|SYNE1_uc003qos.3_Missense_Mutation_p.S1216F|SYNE1_uc003qot.3_Missense_Mutation_p.S6621F|SYNE1_uc003qou.3_Missense_Mutation_p.S6692F	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6692	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATCCAGATGGGACCACGTCTA	0.522										HNSCC(10;0.0054)			6	70	---	---	---	---	PASS
OR2AE1	81392	broad.mit.edu	37	7	99474292	99474292	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474292C>T	uc003usc.1	-	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GGCAACATAGCGGTCATAGGA	0.488													30	82	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100348486	100348486	+	Silent	SNP	C	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100348486C>A	uc003uwj.2	+	12	1653	c.1488C>A	c.(1486-1488)GTC>GTA	p.V496V	ZAN_uc003uwk.2_Silent_p.V496V|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	496	MAM 3.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACACCTCCGTCACCGTCCCCT	0.642													7	41	---	---	---	---	PASS
RPL23AP53	644128	broad.mit.edu	37	8	163215	163215	+	RNA	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:163215G>A	uc010lra.2	-	4		c.918C>T			RPL23AP53_uc003woq.3_RNA|RPL23AP53_uc010lrb.2_RNA	NR_003572				Homo sapiens cDNA FLJ45055 fis, clone BRAWH3022900.												0						AGATACACATGTATTTAGAGT	0.274													4	39	---	---	---	---	PASS
CENPP	401541	broad.mit.edu	37	9	95108042	95108042	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95108042G>T	uc004arz.2	+	4	980	c.440G>T	c.(439-441)TGC>TTC	p.C147F	CENPP_uc010mqx.2_Missense_Mutation_p.C35F|CENPP_uc004ary.1_Missense_Mutation_p.C147F	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P	147					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						CCCACAGAATGCTCAGAATTA	0.289													16	56	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131768990	131768990	+	3'UTR	SNP	A	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131768990A>C	uc004bws.1	+	44						NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						ACCCCTCTCCACCAGCCTACA	0.622											OREG0019528	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	67	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138651633	138651633	+	Silent	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138651633G>A	uc011mdq.1	+	11	1037	c.963G>A	c.(961-963)ACG>ACA	p.T321T	KCNT1_uc011mdr.1_Silent_p.T148T|KCNT1_uc010nbf.2_Silent_p.T276T|KCNT1_uc004cgo.1_Silent_p.T70T	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	321						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GTGACGTCACGCCCAAGATCT	0.642													26	63	---	---	---	---	PASS
DNLZ	728489	broad.mit.edu	37	9	139256535	139256535	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139256535T>G	uc004chf.1	-	3	541	c.466A>C	c.(466-468)ACA>CCA	p.T156P	DNLZ_uc011mdv.1_RNA	NM_001080849	NP_001074318	Q5SXM8	DNLZ_HUMAN	DNL-type zinc finger	156	DNL-type.						metal ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.42e-06)|Epithelial(140;3.3e-06)		GCAGTGGATGTGGGGGCCCCT	0.672													7	9	---	---	---	---	PASS
FBXW5	54461	broad.mit.edu	37	9	139835320	139835320	+	3'UTR	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139835320G>A	uc004cjx.2	-	9					uc004cjw.2_5'Flank|FBXW5_uc010nbx.2_RNA|FBXW5_uc004cjy.2_3'UTR|FBXW5_uc004cjz.2_3'UTR	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5								catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TCGGGAAAAAGCCACAGAGCC	0.622													6	7	---	---	---	---	PASS
CDK1	983	broad.mit.edu	37	10	62551885	62551885	+	Intron	SNP	T	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62551885T>C	uc001jld.2	+						CDK1_uc001jle.2_RNA|CDK1_uc001jlf.2_Intron|CDK1_uc001jlg.2_Intron	NM_001786	NP_001777	P06493	CDK1_HUMAN	cell division cycle 2 isoform 1						activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity			ovary(1)	1						TTTAAGAAATTTTTAATTTCC	0.313													7	71	---	---	---	---	PASS
LSP1	4046	broad.mit.edu	37	11	1904667	1904667	+	Silent	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1904667C>T	uc001lui.2	+	4	550	c.375C>T	c.(373-375)TAC>TAT	p.Y125Y	LSP1_uc001luj.2_Silent_p.Y253Y|LSP1_uc001luk.2_Silent_p.Y63Y|LSP1_uc001lul.2_Silent_p.Y63Y|LSP1_uc001lum.2_Silent_p.Y63Y	NM_002339	NP_002330	P33241	LSP1_HUMAN	lymphocyte-specific protein 1 isoform 1	125					cellular component movement|cellular defense response	actin cytoskeleton|Golgi apparatus|plasma membrane	actin binding|signal transducer activity			large_intestine(1)	1		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		TGCATGCCTACGAAAAGGAGG	0.537													19	70	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60714292	60714292	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60714292A>C	uc001nqn.2	-	2	794	c.560T>G	c.(559-561)GTG>GGG	p.V187G	SLC15A3_uc001nqo.2_Missense_Mutation_p.V187G	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	187					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						GAGATCCATCACCTGCCATTC	0.592													17	69	---	---	---	---	PASS
CTSC	1075	broad.mit.edu	37	11	88068245	88068245	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88068245G>C	uc001pck.3	-	2	279	c.178C>G	c.(178-180)CAA>GAA	p.Q60E	CTSC_uc001pcl.3_5'UTR|CTSC_uc001pcm.3_Missense_Mutation_p.Q60E|CTSC_uc001pcn.3_Missense_Mutation_p.Q60E	NM_001814	NP_001805	P53634	CATC_HUMAN	cathepsin C isoform a preproprotein	60					immune response	lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTTTTTTCTTGTGGTCCTAAA	0.353													10	81	---	---	---	---	PASS
TSPAN9	10867	broad.mit.edu	37	12	3390977	3390977	+	Silent	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3390977C>T	uc001qlp.2	+	8	789	c.642C>T	c.(640-642)ATC>ATT	p.I214I		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	214	Helical; (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			GCATCCTCATCATGCAGGTAA	0.587													16	24	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97137249	97137249	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97137249C>T	uc001tet.1	+	20	2642	c.2564C>T	c.(2563-2565)ACG>ATG	p.T855M		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	855										skin(6)|ovary(1)	7						GCAGGGGACACGGAACTGCAG	0.413													10	106	---	---	---	---	PASS
CARS2	79587	broad.mit.edu	37	13	111294811	111294811	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111294811G>A	uc001vrd.2	-	14	1514	c.1474C>T	c.(1474-1476)CGG>TGG	p.R492W		NM_024537	NP_078813	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial	492					cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TGCCGGAACCGCACCAGCTCG	0.672													3	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22471681	22471681	+	Intron	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22471681G>A	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wct.3_Missense_Mutation_p.R35K					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTCCCTGAGAGGGCAGCTCTG	0.453													9	134	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64580250	64580250	+	Silent	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64580250C>T	uc001xgm.2	+	66	13031	c.12801C>T	c.(12799-12801)GAC>GAT	p.D4267D	SYNE2_uc001xgl.2_Silent_p.D4267D|SYNE2_uc010apy.2_Silent_p.D652D|SYNE2_uc010apz.1_Silent_p.D159D	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4267	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAAACGCAGACATGCAGCAGG	0.557													11	19	---	---	---	---	PASS
VASH1	22846	broad.mit.edu	37	14	77236395	77236395	+	Splice_Site	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77236395G>T	uc001xst.2	+	2	1328	c.398_splice	c.e2+1	p.Q133_splice	VASH1_uc001xss.2_Splice_Site_p.Q133_splice	NM_014909	NP_055724	Q7L8A9	VASH1_HUMAN	vasohibin 1						cell cycle arrest|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of endothelial cell proliferation	endoplasmic reticulum|extracellular space					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		GAGAGCTGCAGTATCCTCTCT	0.597													8	54	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79746628	79746628	+	Intron	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79746628G>T	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_5'UTR|NRXN3_uc010asw.2_5'UTR|NRXN3_uc001xur.3_5'UTR	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGTCCCGTGCGTTGACCATGC	0.577													31	214	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102304772	102304772	+	5'Flank	SNP	T	C	C			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102304772T>C	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccf.3_RNA|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		CACAGCGGCGTGACGAGACTC	0.587													4	8	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21320025	21320025	+	3'UTR	SNP	C	T	T	rs5021702	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21320025C>T	uc002gyv.1	+	3						NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCAGGGGCCCCGGGTTTGAGC	0.617										Prostate(3;0.18)			5	9	---	---	---	---	PASS
CCL7	6354	broad.mit.edu	37	17	32598844	32598844	+	3'UTR	SNP	C	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32598844C>A	uc002hhz.2	+	3					CCL7_uc010ctf.2_RNA	NM_006273	NP_006264	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7 precursor						cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding			ovary(1)	1	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GAACTGAAAACAAGCCATGAC	0.388													6	12	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9221994	9221994	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9221994A>G	uc002knv.2	+	8	1197	c.940A>G	c.(940-942)ACA>GCA	p.T314A	ANKRD12_uc010wzn.1_Missense_Mutation_p.T314A|ANKRD12_uc002knw.2_Missense_Mutation_p.T291A|ANKRD12_uc002knx.2_Missense_Mutation_p.T291A|ANKRD12_uc010dkx.1_5'UTR	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	314						nucleus				ovary(2)|central_nervous_system(1)	3						TGAAAGTTACACAGGTTTGTT	0.348													10	113	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33836994	33836994	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33836994A>T	uc002kzq.3	+	12	2251	c.2228A>T	c.(2227-2229)AAC>ATC	p.N743I		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	743	MOSC.				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CTGCTGATCAACACATCCAGT	0.453													57	179	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15132676	15132676	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15132676G>A	uc002nae.2	+	6	1295	c.1196G>A	c.(1195-1197)CGC>CAC	p.R399H		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	399					microtubule cytoskeleton organization	microtubule				ovary(1)	1						CCCCTGGTTCGCATGTACCAG	0.642													35	88	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41062020	41062020	+	Silent	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41062020G>A	uc002ony.2	+	25	5201	c.5115G>A	c.(5113-5115)GTG>GTA	p.V1705V	SPTBN4_uc002onx.2_Silent_p.V1705V|SPTBN4_uc002onz.2_Silent_p.V1705V|SPTBN4_uc010egx.2_Silent_p.V448V|SPTBN4_uc002ooa.2_Silent_p.V381V	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1705	Spectrin 14.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTCTCAGGTGGACCGCCTGT	0.662													6	53	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51022639	51022639	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51022639G>T	uc002pss.2	-	3	468	c.331C>A	c.(331-333)CAC>AAC	p.H111N		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	111	Extracellular (Potential).|LRR 2.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		ATCTCCAGGTGCCGCAGGTGC	0.607													8	37	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37586800	37586800	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37586800G>A	uc002yvg.2	+	9	1154	c.1075G>A	c.(1075-1077)GCA>ACA	p.A359T	DOPEY2_uc011aeb.1_Missense_Mutation_p.A359T	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	359					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						ACGCCATCATGCATACCTGAA	0.393													9	70	---	---	---	---	PASS
COL6A1	1291	broad.mit.edu	37	21	47421898	47421898	+	Silent	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47421898G>A	uc002zhu.1	+	31	2082	c.1980G>A	c.(1978-1980)GCG>GCA	p.A660A	COL6A1_uc010gqd.1_5'UTR|COL6A1_uc002zhv.1_5'UTR|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	660	VWFA 2.|C-terminal globular domain.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	AGTCGTACGCGGGTGTGGTGC	0.652													5	19	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54359994	54359994	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54359994C>T	uc004dtd.1	-	2	552	c.113G>A	c.(112-114)AGA>AAA	p.R38K	WNK3_uc004dtc.1_Missense_Mutation_p.R38K	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	38					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						CTCCTTTAGTCTAGCTTCTAC	0.428													8	125	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100364926	100364926	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100364926G>A	uc004egx.2	+	5	800	c.530G>A	c.(529-531)CGT>CAT	p.R177H	CENPI_uc011mrg.1_Missense_Mutation_p.R177H|CENPI_uc004egy.2_Missense_Mutation_p.R177H	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	177					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						TTCATTGATCGTAAGGAGCAA	0.338													33	26	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131219961	131219961	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131219961G>A	uc004ewn.2	-	6	662	c.484C>T	c.(484-486)CAT>TAT	p.H162Y	FRMD7_uc011muy.1_Missense_Mutation_p.H147Y	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	162	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TGCTTCTGATGAAAGTGCATG	0.443													73	88	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24671748	24671748	+	Intron	DEL	C	-	-	rs68002622		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671748delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CACACCTGTGCCCCCTCCACA	0.657													4	3	---	---	---	---	
WDTC1	23038	broad.mit.edu	37	1	27609630	27609630	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27609630delA	uc009vst.2	+						WDTC1_uc001bno.2_Intron|WDTC1_uc001bnp.1_Intron	NM_015023	NP_055838	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1								protein binding			ovary(1)|central_nervous_system(1)	2		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		actccatttcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
AKIRIN1	79647	broad.mit.edu	37	1	39466956	39466957	+	Intron	DEL	TT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39466956_39466957delTT	uc001ccw.2	+						AKIRIN1_uc010oip.1_Intron|AKIRIN1_uc010oiq.1_Intron	NM_024595	NP_078871	Q9H9L7	AKIR1_HUMAN	akirin 1 isoform 1							nucleus					0						ATGGAAGGACtttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94871896	94871896	+	IGR	DEL	G	-	-	rs12091363		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94871896delG								ARHGAP29 (131272 upstream) : ABCD3 (12037 downstream)																							aTTTTGTTTTGTTTTTTTTTT	0.184													5	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CAGGAACTTTGCTAAAGATCTA	0.386													7	6	---	---	---	---	
NBPF16	728936	broad.mit.edu	37	1	148756337	148756337	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148756337delT	uc010pba.1	+						NBPF16_uc009wkt.1_Intron	NM_001102663	NP_001096133			hypothetical protein LOC728936												0	all_hematologic(923;0.032)					GAATCTATCCTTTTTCTTTTC	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208428858	208428859	+	IGR	DEL	TT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208428858_208428859delTT								PLXNA2 (11193 upstream) : None (None downstream)																							tttctttttctttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246675118	246675119	+	IGR	INS	-	GTGCC	GTGCC	rs144976585	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246675118_246675119insGTGCC								SMYD3 (4504 upstream) : TFB2M (28749 downstream)																							TTGGTGTCACTGTGCCCTGCCC	0.639													9	4	---	---	---	---	
DDX1	1653	broad.mit.edu	37	2	15761027	15761027	+	Intron	DEL	C	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15761027delC	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AAAGGTTTTTCTGAATCTGAA	0.229													4	2	---	---	---	---	
GFPT1	2673	broad.mit.edu	37	2	69555227	69555227	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69555227delA	uc002sfh.2	-							NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						actccatctcaaaaaaaaaaa	0.139													4	3	---	---	---	---	
C2orf7	84279	broad.mit.edu	37	2	73460294	73460298	+	5'UTR	DEL	GGGCC	-	-	rs3832032		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73460294_73460298delGGGCC	uc002siy.2	-	1					CCT7_uc002siz.2_5'Flank|CCT7_uc002sja.2_5'Flank|CCT7_uc010yrf.1_5'Flank|CCT7_uc010feu.2_5'Flank|CCT7_uc010yrg.1_5'Flank|CCT7_uc010yrh.1_5'Flank|CCT7_uc010yri.1_5'Flank	NM_032319	NP_115695	Q9BSG0	PADC1_HUMAN	chromosome 2 open reading frame 7 precursor							extracellular region					0						ACCATCTCCAgggccgggcccggcc	0.639													7	6	---	---	---	---	
CCT7	10574	broad.mit.edu	37	2	73474706	73474707	+	Intron	INS	-	A	A	rs57500214	byFrequency	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73474706_73474707insA	uc002siz.2	+						CCT7_uc002sja.2_Intron|CCT7_uc010yrf.1_Intron|CCT7_uc010feu.2_Intron|CCT7_uc010yrg.1_Intron|CCT7_uc010yrh.1_Intron|CCT7_uc010yri.1_Intron	NM_006429	NP_006420	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 isoform a						'de novo' posttranslational protein folding		ATP binding|unfolded protein binding				0						TTGTGTTATTTAAAAAAAAAAA	0.371													4	2	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174131512	174131512	+	3'UTR	DEL	A	-	-	rs72218266		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174131512delA	uc002uhz.2	+	20					uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			TAAGCAGGTTAAAAAAAAAAA	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196974004	196974007	+	IGR	DEL	GTGT	-	-	rs113040233		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196974004_196974007delGTGT								DNAH7 (40468 upstream) : STK17B (24301 downstream)																							TCCTAGACTGgtgtgtgtgtgtgt	0.279													4	3	---	---	---	---	
C2orf60	129450	broad.mit.edu	37	2	200800443	200800458	+	Intron	DEL	ACACACACACACACAC	-	-	rs10603476		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200800443_200800458delACACACACACACACAC	uc002uvi.3	-						C2orf60_uc002uvj.3_Intron|C2orf60_uc002uvk.3_Intron|C2orf60_uc010fss.2_Intron	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450						wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0						CCTGCTTTAAacacacacacacacacacacacacac	0.250													6	4	---	---	---	---	
BOC	91653	broad.mit.edu	37	3	113005752	113005753	+	3'UTR	INS	-	A	A	rs76380714		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113005752_113005753insA	uc003dzx.2	+	20					BOC_uc003dzy.2_3'UTR|BOC_uc003dzz.2_3'UTR|BOC_uc003eab.2_3'UTR|BOC_uc003eac.2_Intron	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor						cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			tgttttttttttaaaaaaaaaa	0.312													45	7	---	---	---	---	
RABL3	285282	broad.mit.edu	37	3	120428430	120428431	+	Intron	INS	-	AGACAAAGCAC	AGACAAAGCAC	rs141684205	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120428430_120428431insAGACAAAGCAC	uc003edx.2	-							NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AGAAACACTTAATGTTTAATGT	0.272													4	3	---	---	---	---	
SLC12A8	84561	broad.mit.edu	37	3	124929863	124929866	+	Intron	DEL	CTGT	-	-	rs139576798		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124929863_124929866delCTGT	uc003ehv.3	-						SLC12A8_uc003ehw.3_Intron|SLC12A8_uc010hrz.1_Intron	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8						potassium ion transport	integral to membrane	symporter activity				0						CTCACTGTGACTGTCTGTGGAAGA	0.373													5	4	---	---	---	---	
GMPS	8833	broad.mit.edu	37	3	155632554	155632554	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155632554delT	uc003faq.2	+						GMPS_uc011bom.1_Intron	NM_003875	NP_003866	P49915	GUAA_HUMAN	guanine monophosphate synthetase						glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity			ovary(2)|lung(1)	3			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TGTTGTTTGGttttttttttg	0.134			T	MLL	AML								4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185960131	185960131	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185960131delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTTCTGACACTTTTTTTTTTC	0.557											OREG0015965	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
TEC	7006	broad.mit.edu	37	4	48148598	48148599	+	Intron	DEL	AC	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48148598_48148599delAC	uc003gxz.2	-							NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						tttaaatactacagtgtttaac	0.213													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													200	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49644696	49644697	+	IGR	INS	-	AACGA	AACGA			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644696_49644697insAACGA								CWH43 (580603 upstream) : None (None downstream)																							gaatggaatggaatggaatgga	0.000													46	29	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1342154	1342155	+	Intron	INS	-	GTGC	GTGC	rs55901723	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1342154_1342155insGTGC	uc003jch.2	-						CLPTM1L_uc003jcg.2_5'Flank	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		tgtgtgtgtgtgCACGCGCACG	0.470													6	5	---	---	---	---	
HEXB	3074	broad.mit.edu	37	5	74016258	74016259	+	In_Frame_Ins	INS	-	AGA	AGA			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74016258_74016259insAGA	uc003kdf.3	+	12	1540_1541	c.1423_1424insAGA	c.(1423-1425)CAG>CAGAAG	p.476_477insK	HEXB_uc003kdd.2_In_Frame_Ins_p.251_252insK|HEXB_uc010izh.2_RNA|HEXB_uc010izi.1_RNA	NM_000521	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B preproprotein	476_477					cell death	lysosome	cation binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		TTTAGGTACTCAGAAACAGAAA	0.361													74	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	83045743	83045744	+	IGR	INS	-	TTCC	TTCC			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83045743_83045744insTTCC								HAPLN1 (28847 upstream) : EDIL3 (192382 downstream)																							ccttccttcctttccttccttc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122821709	122821709	+	IGR	DEL	C	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122821709delC								CEP120 (62457 upstream) : CSNK1G3 (26084 downstream)																							CCTGCACCCTCCTCCTCCTCT	0.333													4	2	---	---	---	---	
PCDHGA1	56114	broad.mit.edu	37	5	140710038	140710038	+	5'Flank	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140710038delA	uc003lji.1	+						PCDHGA1_uc011dan.1_5'Flank	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGAGGAGGaaaaaaaaaaa	0.418													4	4	---	---	---	---	
GFPT2	9945	broad.mit.edu	37	5	179755072	179755072	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179755072delT	uc003mlw.1	-							NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	ttctggtttcttttttttttt	0.035													4	3	---	---	---	---	
HCG4	54435	broad.mit.edu	37	6	29760353	29760373	+	RNA	DEL	GCGGGCGCCGTGGATGGAGCA	-	-	rs146714150		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29760353_29760373delGCGGGCGCCGTGGATGGAGCA	uc003nns.2	-	1		c.478_498delTGCTCCATCCACGGCGCCCGC			uc010jrm.1_In_Frame_Del_p.AGAVDGA111del|uc003nnt.2_In_Frame_Del_p.RAPWMEQ147del|uc011dma.1_5'Flank	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0						GGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGCCG	0.674													6	3	---	---	---	---	
C6orf134	79969	broad.mit.edu	37	6	30608890	30608893	+	Intron	DEL	ACAT	-	-	rs3130038		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30608890_30608893delACAT	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0						Ccatatacacacatacacacacac	0.363													3	3	---	---	---	---	
IYD	389434	broad.mit.edu	37	6	150690517	150690519	+	Intron	DEL	TGA	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150690517_150690519delTGA	uc003qnu.1	+						IYD_uc003qnv.1_Intron|IYD_uc003qnw.1_Intron|IYD_uc003qnx.1_Intron|IYD_uc010kik.1_Intron	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2						cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		CTCTCTCCAGTGATGAGCTTGTC	0.463													5	7	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152555448	152555448	+	Intron	DEL	G	-	-	rs66580176		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152555448delG	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		tttctttttagatggagtcgc	0.109										HNSCC(10;0.0054)			7	4	---	---	---	---	
QKI	9444	broad.mit.edu	37	6	163991477	163991477	+	Intron	DEL	T	-	-	rs67007203		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163991477delT	uc003qui.2	+						QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TGTTAACCAGTTTTTTTTTTT	0.284													4	4	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8192427	8192429	+	Intron	DEL	CCA	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8192427_8192429delCCA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		accatcacctccaccaccaccac	0.000													5	5	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99032217	99032218	+	Intron	INS	-	A	A	rs149310419		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032217_99032218insA	uc003uqh.2	-						PTCD1_uc011kiw.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			tccgtctcTACaaaaaaaaaaa	0.208													6	3	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122033119	122033120	+	Intron	INS	-	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122033119_122033120insA	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						AAAACTCAAATAAAAAAAAAAA	0.347													4	2	---	---	---	---	
HMBOX1	79618	broad.mit.edu	37	8	28905081	28905081	+	Intron	DEL	C	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28905081delC	uc003xhd.3	+						HMBOX1_uc010lvd.2_Intron|HMBOX1_uc003xhc.3_Intron|HMBOX1_uc010lve.2_Intron|HMBOX1_uc003xhe.2_Intron|HMBOX1_uc011lay.1_Intron|HMBOX1_uc003xhf.2_Intron|HMBOX1_uc003xhg.2_Intron	NM_001135726	NP_001129198	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CCTAACttctctttttttttt	0.179													4	2	---	---	---	---	
ZNF704	619279	broad.mit.edu	37	8	81742984	81742988	+	Intron	DEL	CTTTC	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81742984_81742988delCTTTC	uc003yby.1	-							NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GGGTGTGtttctttctttttttttt	0.117													4	2	---	---	---	---	
UBR5	51366	broad.mit.edu	37	8	103374068	103374069	+	Intron	DEL	GT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103374068_103374069delGT	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TGCAACCTCAGTAACAATGATA	0.243													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139774852	139774853	+	Intron	INS	-	A	A	rs149851445	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139774852_139774853insA	uc003yvd.2	-						COL22A1_uc011ljo.1_5'Flank	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			cacacacacacaACAGCCCTag	0.267										HNSCC(7;0.00092)			9	6	---	---	---	---	
CYC1	1537	broad.mit.edu	37	8	145151666	145151692	+	Intron	DEL	GGCAGTGGGCATGTGGAATACTTCTCC	-	-	rs75325545		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151666_145151692delGGCAGTGGGCATGTGGAATACTTCTCC	uc003zaz.3	+						CYC1_uc003zay.2_Intron	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1						respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTCCAGTCTGGCAGTGGGCATGTGGAATACTTCTCCACTACCCCCA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15362229	15362230	+	IGR	INS	-	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15362229_15362230insT								TTC39B (54985 upstream) : SNAPC3 (60552 downstream)																							TTTCCCCTGTAttttttttttt	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	30774793	30774794	+	IGR	INS	-	A	A			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30774793_30774794insA								None (None upstream) : None (None downstream)																							GTTCAAAGGTCAAAAAAAAAAA	0.371													4	2	---	---	---	---	
AQP7P1	375719	broad.mit.edu	37	9	67273773	67273774	+	Intron	INS	-	A	A	rs149463181	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67273773_67273774insA	uc004aem.1	-						AQP7P1_uc004aen.1_Intron|AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens aquaporin 7 pseudogene 1, mRNA (cDNA clone IMAGE:6191443).												0						gaggaacacagaggcgatggct	0.153													5	3	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77418972	77418973	+	Intron	INS	-	A	A	rs138585311	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77418972_77418973insA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_5'Flank	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CTCTGTTTCTCTCCATGATTAG	0.337													6	6	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7217721	7217722	+	Intron	INS	-	A	A	rs140257360	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7217721_7217722insA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTCCAAGGCCTACCAATGAAAA	0.401													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24387654	24387655	+	Intron	DEL	GT	-	-	rs112809120		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24387654_24387655delGT	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GAAGGGGAGCgtgtgtgtgtgt	0.337													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383716	42383717	+	IGR	INS	-	G	G	rs145968937		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383716_42383717insG								None (None upstream) : LOC441666 (443598 downstream)																							tggaatcaaaataaccatcatc	0.000													140	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42384716	42384716	+	IGR	DEL	G	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42384716delG								None (None upstream) : LOC441666 (442599 downstream)																							ggaatcgaatggaatcatcat	0.000													850	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													278	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42390479	42390479	+	IGR	DEL	G	-	-	rs72505278		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42390479delG								None (None upstream) : LOC441666 (436836 downstream)																							AAcatcgaatggaatcgaatg	0.040													248	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396450	42396450	+	IGR	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396450delT								None (None upstream) : LOC441666 (430865 downstream)																							tggtctcgaatggaatcacct	0.000													656	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42529391	42529391	+	IGR	DEL	G	-	-	rs71210893		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42529391delG								None (None upstream) : LOC441666 (297924 downstream)																							attatatgaagaaatcccgtt	0.000													549	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42596908	42596910	+	IGR	DEL	TCA	-	-	rs74210869		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42596908_42596910delTCA								None (None upstream) : LOC441666 (230405 downstream)																							ggaatcatcttcaaatggaaagg	0.000													1550	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42596957	42596966	+	IGR	DEL	TTGAATGGAC	-	-	rs74211168		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42596957_42596966delTTGAATGGAC								None (None upstream) : LOC441666 (230349 downstream)																							ggaattatcattgaatggactcgaatggaa	0.029													2186	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42597159	42597159	+	IGR	DEL	T	-	-	rs149908177		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42597159delT								None (None upstream) : LOC441666 (230156 downstream)																							ttgaacggaatcgaatggaat	0.035													2198	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44909855	44909856	+	IGR	INS	-	T	T			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44909855_44909856insT								CXCL12 (29313 upstream) : TMEM72 (496908 downstream)																							TTCTGTTGCTGTTTTTTTTCCA	0.297													4	2	---	---	---	---	
SLC25A16	8034	broad.mit.edu	37	10	70266207	70266207	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70266207delA	uc001joi.2	-						SLC25A16_uc010qix.1_Intron|SLC25A16_uc010qiy.1_Intron|SLC25A16_uc001joj.2_Intron	NM_152707	NP_689920	P16260	GDC_HUMAN	solute carrier family 25, member 16						coenzyme biosynthetic process|pantothenate metabolic process	integral to membrane|mitochondrial inner membrane	binding|solute:solute antiporter activity				0						ctcaaaaattaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													8	4	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													5	5	---	---	---	---	
OVCH2	341277	broad.mit.edu	37	11	7720159	7720160	+	Intron	INS	-	T	T	rs140781651	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7720159_7720160insT	uc010rbf.1	-							NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		GGCATAATGGCTGTAGGTGCTC	0.475													6	5	---	---	---	---	
DHCR7	1717	broad.mit.edu	37	11	71146249	71146260	+	3'UTR	DEL	AGCAAGGAACAG	-	-	rs72112762		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71146249_71146260delAGCAAGGAACAG	uc001oqk.2	-	9					DHCR7_uc001oql.2_3'UTR	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase						cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	TGAAGGCAAAAGCAAGGAACAGAGCGTGATTA	0.443									Smith-Lemli-Opitz_syndrome				7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71605479	71605480	+	IGR	INS	-	GTGA	GTGA			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71605479_71605480insGTGA								DEFB108B (56872 upstream) : RNF121 (34288 downstream)																							TTCTTGTGTGGGTAAGGGCAAC	0.441													5	4	---	---	---	---	
DNAJB13	374407	broad.mit.edu	37	11	73680791	73680794	+	Intron	DEL	AAAC	-	-	rs34820619		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73680791_73680794delAAAC	uc001ouo.2	+							NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					CCCATGTCTTAAACAAAGTTTCTG	0.529													8	8	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199650	120199655	+	Intron	DEL	TGTGTT	-	-	rs72412112		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199650_120199655delTGTGTT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		tgtgtgtgtgtgtgtttgtgtatgtT	0.049													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9725801	9725801	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9725801delT	uc001qwb.1	+											Homo sapiens mRNA; cDNA DKFZp686A1124 (from clone DKFZp686A1124).																		AGAATTCTTCTTCAACATTCA	0.323													4	2	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50528077	50528078	+	Intron	INS	-	CTT	CTT	rs72518097		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528077_50528078insCTT	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						tgggagaatccaagcccaggtg	0.025													6	4	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	70929002	70929004	+	Intron	DEL	GAG	-	-	rs33985321		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70929002_70929004delGAG	uc001swb.3	-						uc001svz.2_Intron|PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TATATGGCTTGAGtttttttttt	0.389													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88530707	88530707	+	Intron	DEL	T	-	-	rs112841615		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88530707delT	uc001tar.2	-						CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GCTTAAGAACTTTTTTTTTTT	0.284													4	2	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123036453	123036453	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123036453delT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGGTCAGGTCttttttttttc	0.204													4	2	---	---	---	---	
RILPL2	196383	broad.mit.edu	37	12	123900706	123900707	+	Intron	INS	-	A	A	rs144225262		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123900706_123900707insA	uc001uey.1	-							NM_145058	NP_659495	Q969X0	RIPL2_HUMAN	Rab interacting lysosomal protein-like 2							cytosol|plasma membrane	identical protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000546)|Epithelial(86;0.00179)|all cancers(50;0.0168)		accccatctctaaaaaaaaaaa	0.000													6	3	---	---	---	---	
STK24	8428	broad.mit.edu	37	13	99134321	99134321	+	Intron	DEL	A	-	-	rs34520150		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99134321delA	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			actctatctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
CARKD	55739	broad.mit.edu	37	13	111274384	111274385	+	Intron	DEL	AA	-	-	rs140560266		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111274384_111274385delAA	uc001vrb.2	+						CARKD_uc010tji.1_Intron|CARKD_uc010tjj.1_Intron|CARKD_uc001vqz.2_Intron|CARKD_uc001vra.2_Intron|CARKD_uc010tjk.1_Intron|CARKD_uc010tjl.1_Intron|CARKD_uc001vrc.2_Intron			Q8IW45	CARKD_HUMAN	RecName: Full=Carbohydrate kinase domain-containing protein; Flags: Precursor;											skin(1)	1						ctcaaaaaagaaaaaaaaaaTT	0.144													2	4	---	---	---	---	
ACIN1	22985	broad.mit.edu	37	14	23531181	23531181	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23531181delA	uc001wit.3	-						ACIN1_uc001wio.3_Intron|ACIN1_uc001wip.3_Intron|ACIN1_uc001wiq.3_Intron|ACIN1_uc001wir.3_Intron|ACIN1_uc001wis.3_Intron|ACIN1_uc010akg.2_Intron	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		actctgtctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
KIAA0586	9786	broad.mit.edu	37	14	58915352	58915353	+	Intron	INS	-	G	G	rs3825623		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58915352_58915353insG	uc001xdv.3	+						KIAA0586_uc010trr.1_Intron|KIAA0586_uc001xdt.3_Intron|KIAA0586_uc001xdu.3_Intron|KIAA0586_uc010trs.1_Intron|KIAA0586_uc010trt.1_Intron|KIAA0586_uc010tru.1_Intron	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein											ovary(1)	1						ttttataaaacaatttttttaa	0.203													3	3	---	---	---	---	
C15orf29	79768	broad.mit.edu	37	15	34456098	34456098	+	Intron	DEL	T	-	-	rs5811822		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34456098delT	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989	Q9H079	CO029_HUMAN	hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)		GTCCTCAttcttttttttttt	0.169													4	2	---	---	---	---	
MYEF2	50804	broad.mit.edu	37	15	48451631	48451632	+	Intron	DEL	GT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48451631_48451632delGT	uc001zwi.3	-						MYEF2_uc001zwj.3_Intron|MYEF2_uc001zwl.2_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		AACCTtgtgcgtgtgtgtgtgt	0.203													6	4	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881051	96881052	+	3'UTR	DEL	AA	-	-	rs140647786		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881051_96881052delAA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AGAATGCATTAAAAAAAAAAAA	0.267													2	4	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8869124	8869125	+	Intron	INS	-	TTTTCCTG	TTTTCCTG	rs141501013	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8869124_8869125insTTTTCCTG	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	CACCATCAGCCTTTTCCTGTTT	0.391													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33371342	33371342	+	IGR	DEL	G	-	-	rs28624695		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33371342delG								SLC6A10P (474879 upstream) : MIR1826 (594166 downstream)																							acttgaacccggggggcagag	0.020													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													95	11	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7680447	7680447	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7680447delA	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				actctgtctcaaaaaaaaaaa	0.174													6	4	---	---	---	---	
C17orf48	56985	broad.mit.edu	37	17	10609586	10609587	+	Intron	DEL	AT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10609586_10609587delAT	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron|C17orf48_uc010vvg.1_Intron	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATGCAGTGTGATATATATATAT	0.337													5	3	---	---	---	---	
KRT39	390792	broad.mit.edu	37	17	39122319	39122320	+	Intron	INS	-	TG	TG	rs34892583		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39122319_39122320insTG	uc002hvo.1	-						KRT39_uc010wfm.1_Intron	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35							intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				ttgtgtgtgtatgtgtgtgtgt	0.000													3	3	---	---	---	---	
KAT2A	2648	broad.mit.edu	37	17	40270053	40270054	+	Intron	INS	-	AA	AA	rs71157607		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40270053_40270054insAA	uc002hyx.2	-							NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like						chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						GAGAGAGAGACGTCAGGGATGG	0.619													55	7	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49231520	49231521	+	Intron	INS	-	T	T	rs60023424	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49231520_49231521insT	uc002itk.2	+						NME1_uc010dbx.1_Intron|NME1_uc002ith.1_Intron|NME1_uc002iti.1_Intron|NME1-NME2_uc002itj.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GTCTCTCTCTCTTTTTTTTTTT	0.302													4	2	---	---	---	---	
TMEM49	81671	broad.mit.edu	37	17	57915462	57915463	+	Intron	DEL	TT	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57915462_57915463delTT	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron|TMEM49_uc002ixv.2_5'Flank	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			GTAAAttttctttttttttttt	0.347													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18517211	18517211	+	IGR	DEL	C	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18517211delC								None (None upstream) : ROCK1 (12494 downstream)																							gaaatgtcttcccataaaaac	0.000													461	7	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	37091893	37091895	+	Intron	DEL	AAG	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37091893_37091895delAAG	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						gaagaggaacaagaagaagaaga	0.005													4	2	---	---	---	---	
ARRDC5	645432	broad.mit.edu	37	19	4903031	4903032	+	5'Flank	INS	-	TCACTGGTTCTTTT	TCACTGGTTCTTTT	rs144459964	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4903031_4903032insTCACTGGTTCTTTT	uc002mbm.2	-							NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5						signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		ACCTGTAGTCCTCACTGGttct	0.302													11	6	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10080733	10080734	+	Intron	INS	-	TG	TG			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10080733_10080734insTG	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TGAATGAGGTCtgggtgagtgg	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736453	27736453	+	IGR	DEL	T	-	-	rs4567863		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736453delT								None (None upstream) : LOC148189 (544949 downstream)																							tggaaacgggtttttttcttg	0.000													559	9	---	---	---	---	
NLRP7	199713	broad.mit.edu	37	19	55452576	55452576	+	Intron	DEL	A	-	-	rs111382825		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55452576delA	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		ctaaaaatacaaaaaaaaaaa	0.000													4	4	---	---	---	---	
ERGIC3	51614	broad.mit.edu	37	20	34143584	34143584	+	Intron	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34143584delA	uc002xct.2	+						ERGIC3_uc010zvg.1_Intron|ERGIC3_uc002xcs.2_Intron|ERGIC3_uc002xcu.2_Intron|ERGIC3_uc002xcv.2_Intron	NM_015966	NP_057050	Q9Y282	ERGI3_HUMAN	serologically defined breast cancer antigen 84						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane	protein binding			large_intestine(2)|ovary(1)	3	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			accttgtctcaaaaaaaaaaa	0.214													5	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11042391	11042393	+	Intron	DEL	CAA	-	-	rs76695243		TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11042391_11042393delCAA	uc002yit.1	-						TPTE_uc002yis.1_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		acacacaccccaaaaaaaaaaaa	0.000													4	3	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666581	45666581	+	Intron	DEL	A	-	-	rs141091443	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666581delA	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GGTGCCTAAGACCCCCCCCCC	0.672													3	5	---	---	---	---	
ASPHD2	57168	broad.mit.edu	37	22	26838162	26838163	+	Intron	INS	-	ATTT	ATTT	rs142256476	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26838162_26838163insATTT	uc003acg.2	+							NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2						peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						atgctgctcccattaggacccc	0.000													3	5	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32269504	32269504	+	Intron	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32269504delT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ttgttttttgttttttttttt	0.020													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39962180	39962181	+	IGR	INS	-	CTA	CTA			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39962180_39962181insCTA								RPS19BP1 (33320 upstream) : CACNA1I (4577 downstream)																							tggtgatgatggtgttggtatt	0.035													4	2	---	---	---	---	
PARVG	64098	broad.mit.edu	37	22	44592486	44592487	+	Intron	INS	-	G	G	rs141538521	by1000genomes	TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44592486_44592487insG	uc011aqe.1	+						PARVG_uc003bep.2_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				GGTGGGATCCCGGGGGTGGAGG	0.540													6	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467585	1467586	+	Intron	INS	-	TC	TC			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467585_1467586insTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctttttctttcttt	0.045													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61731065	61731065	+	IGR	DEL	G	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61731065delG								None (None upstream) : SPIN4 (836043 downstream)																							actacaaaaagactgtttcaa	0.000													101	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128542666	128542666	+	IGR	DEL	A	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128542666delA								None (None upstream) : SMARCA1 (37814 downstream)																							AATTCTACTTaaaaaaaaaaa	0.353													5	4	---	---	---	---	
CXorf66	347487	broad.mit.edu	37	X	139047824	139047824	+	5'Flank	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139047824delT	uc004fbb.2	-							NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor							integral to membrane					0						ACCAAATGACttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13483364	13483364	+	IGR	DEL	T	-	-			TCGA-CH-5766-01	TCGA-CH-5766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13483364delT								None (None upstream) : None (None downstream)																							tctgtcacaattcccctttag	0.000													78	20	---	---	---	---	
