Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SAMD11	148398	broad.mit.edu	37	1	879552	879552	+	3'UTR	SNP	T	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:879552T>G	uc001abw.1	+	14					SAMD11_uc001abx.1_3'UTR	NM_152486	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11							nucleus					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		GGGGTAGGGGTGGGGCCACAC	0.547													4	28	---	---	---	---	PASS
PLCH2	9651	broad.mit.edu	37	1	2415902	2415902	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2415902G>A	uc001aji.1	+	5	935	c.661G>A	c.(661-663)GAC>AAC	p.D221N	PLCH2_uc010nyz.1_Missense_Mutation_p.D9N|PLCH2_uc009vle.1_Missense_Mutation_p.D9N|PLCH2_uc001ajj.1_Missense_Mutation_p.D9N|PLCH2_uc001ajk.1_Missense_Mutation_p.D9N	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	221	EF-hand 2.				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GGACACGGATGACCACCAAGG	0.597													20	32	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24408098	24408098	+	Intron	SNP	G	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24408098G>T	uc001bin.3	-						MYOM3_uc001bim.3_Intron|MYOM3_uc001bio.2_Intron|MYOM3_uc001bip.1_3'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		tgtcacccaggctggagtgca	0.164													2	2	---	---	---	---	PASS
AKNAD1	254268	broad.mit.edu	37	1	109369914	109369914	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109369914C>T	uc001dwa.2	-	11	2118	c.1849G>A	c.(1849-1851)GTG>ATG	p.V617M	AKNAD1_uc010ovb.1_Missense_Mutation_p.V324M|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	617										ovary(3)	3						TTTTTCTCCACGTTTTGCTTC	0.383													21	230	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803319	142803319	+	Intron	SNP	A	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803319A>C	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		GATGTAAAGCATACACACAAG	0.169													4	21	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152284212	152284212	+	Silent	SNP	C	T	T	rs149376159		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284212C>T	uc001ezu.1	-	3	3186	c.3150G>A	c.(3148-3150)CCG>CCA	p.P1050P	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1050	Filaggrin 6.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGTCTGCGCGGAATGCCTG	0.562									Ichthyosis				33	672	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220383726	220383726	+	Intron	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220383726C>T	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron|RAB3GAP2_uc010pum.1_Missense_Mutation_p.V206M	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ATTTTTTACACTACCTGCTCA	0.408													20	340	---	---	---	---	PASS
TMEM214	54867	broad.mit.edu	37	2	27258872	27258872	+	Silent	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27258872G>A	uc002ria.3	+	5	782	c.672G>A	c.(670-672)CAG>CAA	p.Q224Q	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Silent_p.Q179Q	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	224						integral to membrane	protein binding				0						TCTGTATCCAGGCCATCCTGC	0.517													18	44	---	---	---	---	PASS
CGREF1	10669	broad.mit.edu	37	2	27324422	27324422	+	Missense_Mutation	SNP	T	C	C	rs74360681	byFrequency	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27324422T>C	uc010eys.1	-	6	819	c.677A>G	c.(676-678)GAG>GGG	p.E226G	CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_Intron|CGREF1_uc002riq.2_Missense_Mutation_p.E226G|CGREF1_uc010eyr.1_Missense_Mutation_p.E348G|CGREF1_uc002rir.1_Missense_Mutation_p.E226G|CGREF1_uc002ris.2_Intron	NM_006569	NP_006560	Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	226					cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCTGGCCCTCAGCTTCCCC	0.667													20	378	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90229249	90229249	+	Intron	SNP	C	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90229249C>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TCAGATTTGACATCCAGATGA	0.438													39	16	---	---	---	---	PASS
IRAK2	3656	broad.mit.edu	37	3	10251301	10251301	+	Silent	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10251301G>A	uc003bve.1	+	4	529	c.453G>A	c.(451-453)CCG>CCA	p.P151P		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	151					activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						CCCACCAGCCGGCCTTTCTCC	0.597													7	275	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48624753	48624753	+	Silent	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48624753C>T	uc003ctz.2	-	23	3010	c.3009G>A	c.(3007-3009)CCG>CCA	p.P1003P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1003	Nonhelical region (NC1).|Fibronectin type-III 9.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAAGTGTCTGCGGGGACCCAG	0.602													3	31	---	---	---	---	PASS
GRM2	2912	broad.mit.edu	37	3	51746689	51746689	+	Silent	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51746689C>T	uc010hlv.2	+	3	890	c.651C>T	c.(649-651)GGC>GGT	p.G217G	GRM2_uc003dbo.3_Intron|GRM2_uc010hlu.2_RNA	NM_000839	NP_000830	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2 isoform a	217	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)	GCGACTATGGCGAGACAGGCA	0.597													5	122	---	---	---	---	PASS
SLC41A3	54946	broad.mit.edu	37	3	125725559	125725559	+	Intron	SNP	C	G	G	rs1044215	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125725559C>G	uc003eij.2	-						SLC41A3_uc003eii.2_3'UTR|SLC41A3_uc003eil.2_3'UTR|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_3'UTR	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		CTCTTCTTTACCTTCTCAGGC	0.502													5	9	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48507685	48507685	+	Intron	SNP	A	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48507685A>C	uc003gyh.1	-						FRYL_uc003gye.1_5'UTR|FRYL_uc003gyf.1_Intron|FRYL_uc003gyg.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GGGTAGTGTAACAGCCTGTCC	0.348													14	53	---	---	---	---	PASS
VEGFC	7424	broad.mit.edu	37	4	177650866	177650866	+	Missense_Mutation	SNP	C	G	G	rs41278571	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177650866C>G	uc003ius.1	-	2	612	c.182G>C	c.(181-183)CGG>CCG	p.R61P		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	61					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GGACACAGACCGTAACTGCTC	0.408													42	69	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109202765	109202765	+	3'UTR	SNP	A	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109202765A>G	uc003kou.1	+	22						NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GACGTGCAATAAAGAAGCACA	0.353													4	103	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118469852	118469852	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118469852C>G	uc003ksd.2	+	12	2414	c.2233C>G	c.(2233-2235)CTT>GTT	p.L745V	DMXL1_uc010jcl.1_Missense_Mutation_p.L745V|DMXL1_uc003ksc.1_Missense_Mutation_p.L745V	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	745										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCTGCCCACTCTTATACCCAG	0.383													8	242	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29910986	29910986	+	Intron	SNP	G	A	A	rs112756023	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29910986G>A	uc003nol.2	+						HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'UTR|HLA-A_uc003nok.2_5'UTR|HLA-A_uc003non.2_Intron|HLA-A_uc003noo.2_Intron|HLA-A_uc010jrr.2_Intron|HLA-A_uc003nom.2_5'UTR|HLA-A_uc010klp.2_Intron|HLA-A_uc011dmc.1_5'UTR|HLA-A_uc011dmd.1_5'Flank	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						AAATCCCCCCGGGTTGGTCGG	0.662									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			2	3	---	---	---	---	PASS
HLA-B	3106	broad.mit.edu	37	6	31323443	31323443	+	Intron	SNP	G	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31323443G>T	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_Intron|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_Intron|HLA-B_uc010jso.2_3'UTR	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						CATGTGACCAGCCTGAGAATG	0.557									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	59	---	---	---	---	PASS
MSH5	4439	broad.mit.edu	37	6	31730338	31730338	+	3'UTR	SNP	T	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31730338T>G	uc003nwv.1	+	25					MSH5_uc003nwt.1_3'UTR|MSH5_uc003nwu.1_3'UTR|MSH5_uc003nww.1_3'UTR|MSH5_uc003nwx.1_3'UTR|MSH5_uc011dof.1_3'UTR|MSH5_uc003nwy.1_3'UTR|MSH5_uc003nwz.3_RNA|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c						chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						CCCAGCCTCCTGAGACTCCGG	0.488								Direct_reversal_of_damage|MMR					4	48	---	---	---	---	PASS
SNX14	57231	broad.mit.edu	37	6	86303491	86303491	+	5'UTR	SNP	A	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86303491A>C	uc003pkr.2	-	1					SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_5'UTR|SNX14_uc003pkt.2_5'UTR	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		GGTCAAGGCGACCCCCCATCC	0.701													6	10	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146480672	146480672	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146480672C>T	uc010khw.1	+	3	1359	c.889C>T	c.(889-891)CGA>TGA	p.R297*	GRM1_uc010khu.1_Nonsense_Mutation_p.R297*|GRM1_uc010khv.1_Nonsense_Mutation_p.R297*|GRM1_uc003qll.2_Nonsense_Mutation_p.R297*|GRM1_uc011edz.1_Nonsense_Mutation_p.R297*|GRM1_uc011eea.1_Nonsense_Mutation_p.R297*	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	297	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CATGACAGTGCGAGGACTCCT	0.488													4	61	---	---	---	---	PASS
AKAP12	9590	broad.mit.edu	37	6	151672372	151672372	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151672372C>T	uc011eep.1	+	4	3086	c.2846C>T	c.(2845-2847)ACG>ATG	p.T949M	AKAP12_uc003qoe.2_Missense_Mutation_p.T949M|AKAP12_uc003qof.2_Missense_Mutation_p.T851M|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Missense_Mutation_p.T844M	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1	949					G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAACCCCCCACGGTTACTGAA	0.527													5	136	---	---	---	---	PASS
TOMM7	54543	broad.mit.edu	37	7	22862413	22862413	+	5'UTR	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22862413G>A	uc003svk.2	-	1						NM_019059	NP_061932	Q9P0U1	TOM7_HUMAN	translocase of outer mitochondrial membrane 7						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity				0						ACGGCCGTGTGGCGCAGGGAG	0.612													4	71	---	---	---	---	PASS
SPDYE7P	441251	broad.mit.edu	37	7	72336988	72336988	+	RNA	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72336988G>A	uc010lal.1	-	1		c.2668C>T				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						AGGCCGGCCCGGCTGAAATAC	0.522													7	300	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142021350	142021350	+	Intron	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142021350C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Silent_p.C110C|uc011krq.1_Silent_p.C110C					SubName: Full=V_segment translation product; Flags: Fragment;																		TTTATCTTTGCGCCAGCAGCT	0.547													20	49	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142458719	142458719	+	Intron	SNP	G	A	A	rs146805541	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458719G>A	uc003wak.2	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Missense_Mutation_p.V94M|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein						digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			AGAGCAGAGAGTGAACACAAG	0.527									Hereditary_Pancreatitis				3	18	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189402	11189402	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189402G>A	uc003wtp.1	+	1	908	c.787G>A	c.(787-789)GCC>ACC	p.A263T		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	263	Helical; (Potential).					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		GGGGATCCTCGCCTTGGTCTC	0.627													7	184	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73848458	73848458	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73848458G>A	uc003xzb.2	+	3	1456	c.868G>A	c.(868-870)GTG>ATG	p.V290M		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	290					regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CAACAAGAGCGTGCTGCAGTT	0.502													9	124	---	---	---	---	PASS
SNTB1	6641	broad.mit.edu	37	8	121823678	121823678	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823678G>A	uc010mdg.2	-	1	632	c.406C>T	c.(406-408)CCC>TCC	p.P136S	SNTB1_uc003ype.2_Missense_Mutation_p.P136S	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	136	PH 1.|PDZ.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			ATGAGGATGGGCATCTTGTTC	0.637													4	69	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139278045	139278045	+	Silent	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139278045G>A	uc003yuy.2	-	4	369	c.198C>T	c.(196-198)ACC>ACT	p.T66T	FAM135B_uc003yux.2_5'UTR|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	66										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGCTGTGCACGGTGCTGTCAT	0.502										HNSCC(54;0.14)			3	78	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145693004	145693004	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145693004C>G	uc003zcz.2	+	5	671	c.606C>G	c.(604-606)ATC>ATG	p.I202M	CYHR1_uc003zcv.2_5'Flank|CYHR1_uc003zcw.2_5'Flank|CYHR1_uc003zcx.2_5'Flank|CYHR1_uc003zcy.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	202	Potential.|Gln-rich.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGCAGCTCATCCTGGGACAGG	0.647											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	61	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385452	33385452	+	Intron	SNP	C	G	G	rs75281638	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385452C>G	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TCAGGGACAGCGTTGACACTC	0.612													4	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68414506	68414506	+	RNA	SNP	C	A	A	rs75347819		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414506C>A	uc004aex.2	+	1		c.1061C>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		aaaatctattctttctgtgct	0.000													6	10	---	---	---	---	PASS
SUSD1	64420	broad.mit.edu	37	9	114840901	114840901	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114840901C>T	uc004bfu.2	-	12	1711	c.1670G>A	c.(1669-1671)CGT>CAT	p.R557H	SUSD1_uc010mui.2_Missense_Mutation_p.R557H|SUSD1_uc010muj.2_Missense_Mutation_p.R557H	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor	557	Extracellular (Potential).					integral to membrane	calcium ion binding				0						GGTACCCGGACGTAGGTCCAA	0.493													13	122	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32337438	32337438	+	Silent	SNP	T	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32337438T>C	uc001iwe.3	-	2	638	c.168A>G	c.(166-168)ACA>ACG	p.T56T		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	56	Kinesin-motor.				stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				GCTCTTGAGATGTGCTTGACT	0.338													5	134	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105922136	105922136	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105922136G>A	uc001kxw.2	-	25	3388	c.3272C>T	c.(3271-3273)CCG>CTG	p.P1091L	C10orf79_uc009xxq.2_Missense_Mutation_p.P399L	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1091											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TTTGTGCCACGGCTTAATGTG	0.403													5	182	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1092926	1092926	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1092926C>G	uc001lsx.1	+	31	11858	c.11831C>G	c.(11830-11832)ACC>AGC	p.T3944S		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	3944						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.199													3	22	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093368	1093368	+	Silent	SNP	G	A	A	rs111440994		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093368G>A	uc001lsx.1	+	31	12300	c.12273G>A	c.(12271-12273)ACG>ACA	p.T4091T		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4091						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccactacggtgaccccaa	0.000													3	24	---	---	---	---	PASS
OR10A4	283297	broad.mit.edu	37	11	6898608	6898608	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6898608G>A	uc010rat.1	+	1	730	c.730G>A	c.(730-732)GCC>ACC	p.A244T		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACCTGTTCCGCCCACCTCTT	0.527													15	157	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20119232	20119232	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20119232A>G	uc001mpr.3	+	31	6492	c.6131A>G	c.(6130-6132)GAG>GGG	p.E2044G	NAV2_uc001mpp.2_Missense_Mutation_p.E1977G|NAV2_uc009yhx.2_Missense_Mutation_p.E1105G|NAV2_uc009yhz.2_Missense_Mutation_p.E686G|NAV2_uc001mpu.2_Missense_Mutation_p.E479G	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	2100						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GAAACACCGGAGCTGCTTCCT	0.493													8	135	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401517	46401517	+	3'UTR	SNP	A	G	G	rs61882687	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401517A>G	uc001ncn.1	+	32					DGKZ_uc001nch.1_3'UTR|DGKZ_uc001ncj.1_3'UTR|DGKZ_uc010rgr.1_3'UTR|DGKZ_uc001nck.1_3'UTR|DGKZ_uc001ncl.2_3'UTR|DGKZ_uc001ncm.2_3'UTR|DGKZ_uc009yky.1_3'UTR|DGKZ_uc010rgs.1_3'UTR|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CACGGGCAGCAGGAGGGACAA	0.682													4	8	---	---	---	---	PASS
CASP1	834	broad.mit.edu	37	11	104897573	104897573	+	Missense_Mutation	SNP	C	T	T	rs148018877		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104897573C>T	uc010rve.1	-	8	1129	c.1112G>A	c.(1111-1113)CGC>CAC	p.R371H	CASP1_uc001pig.2_Missense_Mutation_p.R278H|CASP1_uc001pik.2_Missense_Mutation_p.R334H|CASP1_uc010rvf.1_Missense_Mutation_p.R278H|CASP1_uc010rvg.1_Missense_Mutation_p.R350H|CASP1_uc010rvh.1_Missense_Mutation_p.R230H|CASP1_uc010rvi.1_Missense_Mutation_p.R55H|CASP1_uc001pim.3_Missense_Mutation_p.R371H|CASP1_uc009yxi.2_Missense_Mutation_p.R350H|CASP1_uc010rvj.1_Missense_Mutation_p.R371H|CASP1_uc009yxj.2_Missense_Mutation_p.R216H|CASP1_uc010rvk.1_3'UTR	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor	371					cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	TCTTACCTTGCGGAAAATTTC	0.408													8	118	---	---	---	---	PASS
CHEK1	1111	broad.mit.edu	37	11	125525250	125525250	+	3'UTR	SNP	T	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125525250T>C	uc009zbo.2	+	13					CHEK1_uc010sbh.1_3'UTR|CHEK1_uc010sbi.1_3'UTR|CHEK1_uc001qcf.3_Intron|CHEK1_uc009zbp.2_3'UTR|CHEK1_uc001qcg.3_3'UTR|CHEK1_uc009zbq.2_3'UTR|CHEK1_uc001qci.1_Intron|CHEK1_uc001qcj.2_Intron	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1						cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		CTGGTGAATATAGTGCTGCTA	0.433								Other_conserved_DNA_damage_response_genes					3	27	---	---	---	---	PASS
GNB3	2784	broad.mit.edu	37	12	6950751	6950751	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6950751A>G	uc001qrd.2	+	4	464	c.59A>G	c.(58-60)GAT>GGT	p.D20G	GNB3_uc001qrc.2_5'UTR|GNB3_uc009zfe.2_Missense_Mutation_p.D20G	NM_002075	NP_002066	P16520	GBB3_HUMAN	guanine nucleotide-binding protein, beta-3	20					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of blood pressure|synaptic transmission	plasma membrane	GTPase activity|GTPase binding|signal transducer activity				0						TCCCTGCAGGATGCCAGGAAA	0.667													12	28	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384596	8384596	+	RNA	SNP	T	G	G	rs55877873	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384596T>G	uc010sgk.1	-	5		c.1192A>C				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CCCATGCCCCTGCTAGCGTAT	0.527													3	8	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14587301	14587301	+	Missense_Mutation	SNP	A	G	G	rs3213764	byFrequency	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14587301A>G	uc001rbw.2	+	3	1747	c.1589A>G	c.(1588-1590)AAA>AGA	p.K530R	ATF7IP_uc010shs.1_Missense_Mutation_p.K529R|ATF7IP_uc001rbu.2_Missense_Mutation_p.K530R|ATF7IP_uc001rbv.1_Missense_Mutation_p.K529R|ATF7IP_uc001rbx.2_Missense_Mutation_p.K529R|ATF7IP_uc010sht.1_Missense_Mutation_p.K530R|ATF7IP_uc001rby.3_Missense_Mutation_p.K530R|ATF7IP_uc001rca.2_Missense_Mutation_p.K530R	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	530	Glu-rich.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						AAGGACAACAAACCTGAGGAA	0.294													3	73	---	---	---	---	PASS
SLC38A1	81539	broad.mit.edu	37	12	46594935	46594935	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46594935C>T	uc001rpa.2	-	13	1207	c.949G>A	c.(949-951)GCC>ACC	p.A317T	SLC38A1_uc001rpb.2_Missense_Mutation_p.A317T|SLC38A1_uc001rpc.2_Missense_Mutation_p.A317T|SLC38A1_uc001rpd.2_Missense_Mutation_p.A317T|SLC38A1_uc001rpe.2_Missense_Mutation_p.A317T|SLC38A1_uc010slh.1_Missense_Mutation_p.A290T|SLC38A1_uc009zkj.1_Missense_Mutation_p.A317T	NM_030674	NP_109599	Q9H2H9	S38A1_HUMAN	amino acid transporter system A1	317	Helical; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ACAAACATGGCGAAAAAGGAG	0.289													14	29	---	---	---	---	PASS
PCK2	5106	broad.mit.edu	37	14	24572967	24572967	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24572967A>G	uc001wlt.2	+	10	1849	c.1717A>G	c.(1717-1719)ATT>GTT	p.I573V	NRL_uc001wlq.2_Intron|PCK2_uc001wlr.1_Intron|PCK2_uc010tnw.1_Missense_Mutation_p.I439V|PCK2_uc010tnx.1_Missense_Mutation_p.I439V|PCK2_uc001wlu.3_Missense_Mutation_p.I407V	NM_004563	NP_004554	Q16822	PCKGM_HUMAN	mitochondrial phosphoenolpyruvate carboxykinase	573					gluconeogenesis	mitochondrial matrix	GTP binding|metal ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0184)		AGAGACACCCATTGGGCTGGT	0.607													41	65	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75515946	75515946	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75515946G>C	uc001xrd.1	-	2	629	c.413C>G	c.(412-414)ACT>AGT	p.T138S	MLH3_uc001xre.1_Missense_Mutation_p.T138S|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	138					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GCTTGCTCTAGTCACATCAGC	0.428								MMR					10	186	---	---	---	---	PASS
ASB2	51676	broad.mit.edu	37	14	94420665	94420665	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94420665C>T	uc001ycc.1	-	2	821	c.332G>A	c.(331-333)CGA>CAA	p.R111Q	ASB2_uc001ycd.2_Missense_Mutation_p.R159Q|ASB2_uc001yce.1_Missense_Mutation_p.R57Q	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	111	ANK 2.				intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GCCCTCACCTCGCTGCAGGAC	0.612													4	76	---	---	---	---	PASS
ALDH1A2	8854	broad.mit.edu	37	15	58306075	58306075	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58306075C>G	uc002aex.2	-	3	402	c.344G>C	c.(343-345)CGG>CCG	p.R115P	ALDH1A2_uc002aey.2_Missense_Mutation_p.R115P|ALDH1A2_uc010ugv.1_Missense_Mutation_p.R94P|ALDH1A2_uc010ugw.1_Missense_Mutation_p.R86P|ALDH1A2_uc002aew.2_Missense_Mutation_p.R19P	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	115					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TGCCCTGTCCCGTTCCACCAA	0.458													19	532	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	62535030	62535030	+	RNA	SNP	G	A	A	rs1996469	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62535030G>A	uc002ain.1	-	11		c.2617C>T			uc002air.1_5'Flank|uc002ais.2_5'Flank|uc002ait.2_5'Flank|uc002aiu.2_5'Flank|uc002aiv.2_5'Flank|uc002aix.1_5'Flank|uc002aiy.2_5'Flank|uc002aiz.1_5'Flank|uc002aja.2_5'Flank|uc002ajb.2_5'Flank|uc002ajc.2_5'Flank|uc002ajd.2_5'Flank|uc002aje.2_5'Flank|uc002ajf.2_5'Flank|uc010uhn.1_5'Flank|uc002ajg.1_5'Flank|uc002aji.2_5'Flank					Homo sapiens cDNA FLJ38723 fis, clone KIDNE2010137, weakly similar to GOLGIN-95.																		AAGCCTGGGCGCTCCTGGGGG	0.562													5	4	---	---	---	---	PASS
ARIH1	25820	broad.mit.edu	37	15	72873082	72873082	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72873082C>A	uc002aut.3	+	12	1540	c.1226C>A	c.(1225-1227)GCA>GAA	p.A409E		NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding	409					ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						CGATCTAGGGCAGCCCTGCAG	0.353													8	66	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4016225	4016225	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4016225G>A	uc002cvx.2	-	11	4152	c.3613C>T	c.(3613-3615)CGC>TGC	p.R1205C		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	1205	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						ACCTGGATGCGGCACTCCACG	0.597													7	176	---	---	---	---	PASS
GDE1	51573	broad.mit.edu	37	16	19514780	19514780	+	3'UTR	SNP	C	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19514780C>T	uc002dgh.2	-	6					GDE1_uc002dgi.2_3'UTR	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						CGTTTCGTCCCACCGTGAAAG	0.488											OREG0023659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	94	---	---	---	---	PASS
IRF8	3394	broad.mit.edu	37	16	85936702	85936702	+	Silent	SNP	T	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85936702T>C	uc002fjh.2	+	2	138	c.81T>C	c.(79-81)ATT>ATC	p.I27I	IRF8_uc002fji.2_Silent_p.I27I	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	27	IRF tryptophan pentad repeat.				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				CAGGACTGATTTGGGAGAATG	0.478													3	74	---	---	---	---	PASS
ENO3	2027	broad.mit.edu	37	17	4859123	4859123	+	Intron	SNP	T	C	C	rs111645512	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4859123T>C	uc002gab.3	+						ENO3_uc010vsr.1_3'UTR|ENO3_uc002gac.3_Intron|ENO3_uc010vss.1_Intron|ENO3_uc010vst.1_Intron	NM_053013	NP_443739	P13929	ENOB_HUMAN	enolase 3						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex	magnesium ion binding|phosphopyruvate hydratase activity			ovary(1)	1						ctgtctctgctctgtctctgc	0.169													5	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	41382237	41382237	+	Intron	SNP	C	A	A	rs1060934	byFrequency	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41382237C>A	uc002ido.2	-						uc010wia.1_RNA					Homo sapiens cDNA clone IMAGE:5169062, partial cds.																		TGGCTCTATGCGGTACTAAAG	0.090													6	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	41382262	41382262	+	Intron	SNP	G	C	C	rs2003781		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41382262G>C	uc002ido.2	-						uc010wia.1_RNA					Homo sapiens cDNA clone IMAGE:5169062, partial cds.																		GAAGACAGAAGAtacaaaaac	0.090													4	34	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8113637	8113637	+	Silent	SNP	C	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113637C>A	uc002knn.3	+	12	2513	c.2010C>A	c.(2008-2010)CTC>CTA	p.L670L	PTPRM_uc010dkv.2_Silent_p.L670L|PTPRM_uc010wzl.1_Silent_p.L457L	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	670	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CAGACAGCCTCCAAGCTGCGC	0.423													93	114	---	---	---	---	PASS
ADAMTSL5	339366	broad.mit.edu	37	19	1507384	1507384	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1507384G>A	uc002ltd.2	-	9	1153	c.709C>T	c.(709-711)CGC>TGC	p.R237C	ADAMTSL5_uc010dsl.2_Missense_Mutation_p.R6C|ADAMTSL5_uc010xgq.1_Missense_Mutation_p.R247C	NM_213604	NP_998769	Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5 precursor	237						proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACGTAGCGCCCATCGCCC	0.592													11	82	---	---	---	---	PASS
MKNK2	2872	broad.mit.edu	37	19	2039536	2039536	+	3'UTR	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2039536G>A	uc002lus.2	-	14					MKNK2_uc002luq.1_Intron|MKNK2_uc010xgu.1_3'UTR|MKNK2_uc010xgv.1_3'UTR|MKNK2_uc002lur.2_Intron|MKNK2_uc002lut.1_3'UTR	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGACACCGGCTGGCGATA	0.537													9	7	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33584366	33584366	+	Silent	SNP	C	T	T	rs139698891		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33584366C>T	uc002nug.1	+	4	710	c.396C>T	c.(394-396)GCC>GCT	p.A132A		NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	132						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					GGCAGTTGGCCGCTGCTACTG	0.488													56	99	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40392347	40392347	+	Missense_Mutation	SNP	C	G	G	rs139175656	byFrequency	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40392347C>G	uc002omp.3	-	16	8165	c.8157G>C	c.(8155-8157)CAG>CAC	p.Q2719H		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2719				Q -> H (in Ref. 1; BAA19526).		extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGGCTCCACCTGGCCTCCAG	0.592													8	16	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42259586	42259586	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42259586C>A	uc002orm.2	+	1	189	c.40C>A	c.(40-42)CCC>ACC	p.P14T		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	14					cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		ATTGCATGTCCCCTGGAAGGA	0.607													5	97	---	---	---	---	PASS
MAPRE1	22919	broad.mit.edu	37	20	31427559	31427559	+	Nonsense_Mutation	SNP	C	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31427559C>G	uc002wyh.2	+	5	633	c.494C>G	c.(493-495)TCA>TGA	p.S165*		NM_012325	NP_036457	Q15691	MARE1_HUMAN	microtubule-associated protein, RP/EB family,	165	Interaction with MTUS2/TIP150.				cell division|cell proliferation|G2/M transition of mitotic cell cycle|mitotic prometaphase|negative regulation of microtubule polymerization|protein localization to microtubule	centrosome|cortical microtubule cytoskeleton|cytosol	microtubule plus-end binding|protein C-terminus binding				0						AGGCCCATCTCAACACAGAGA	0.527													12	457	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	16150968	16150968	+	Intron	SNP	C	T	T	rs138311033	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16150968C>T	uc002zkr.3	-						uc002zks.3_RNA					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		CAAATTTGGACTCTTGACTCT	0.403													5	15	---	---	---	---	PASS
HDAC8	55869	broad.mit.edu	37	X	71787745	71787745	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71787745G>C	uc004eau.2	-	4	473	c.431C>G	c.(430-432)GCA>GGA	p.A144G	HDAC8_uc011mqe.1_Missense_Mutation_p.Q2E|HDAC8_uc011mqf.1_Intron|HDAC8_uc011mqg.1_Intron|HDAC8_uc011mqh.1_Intron|HDAC8_uc010nlk.1_Missense_Mutation_p.A15G|HDAC8_uc004eav.2_Missense_Mutation_p.A144G|HDAC8_uc004eaw.2_RNA	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	144	Histone deacetylase.				chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)	TTACTTCTTTGCATGATGCCA	0.418													11	122	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142718073	142718073	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142718073G>T	uc004fbx.2	-	2	1228	c.852C>A	c.(850-852)TAC>TAA	p.Y284*	SLITRK4_uc004fby.2_Nonsense_Mutation_p.Y284*	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	284	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGGAGTGGTGTAGCCATTTT	0.453													10	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2916	2916	+	5'Flank	SNP	G	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2916G>A	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AACTTGACCAACGGAACAAGT	0.478													5	211	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11991	11991	+	RNA	SNP	T	C	C			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11991T>C	uc004cov.3	+	1		c.1414T>C			uc004cow.1_5'Flank|uc004cox.3_5'Flank|uc004coy.2_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		CCTCTACATATTTACCACAAC	0.438													194	38	---	---	---	---	PASS
C1orf159	54991	broad.mit.edu	37	1	1034774	1034775	+	Intron	DEL	TT	-	-	rs77715563	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1034774_1034775delTT	uc001act.2	-						C1orf159_uc001acu.2_Intron|C1orf159_uc001acr.2_Intron|C1orf159_uc001acs.2_Intron|C1orf159_uc001acp.2_Intron	NM_017891	NP_060361	Q96HA4	CA159_HUMAN	hypothetical protein LOC54991							integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		ATTCTAAGAATTGGAGAGAGAG	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4204647	4204649	+	IGR	DEL	ACT	-	-	rs61768843		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4204647_4204649delACT								LOC100133612 (370770 upstream) : LOC284661 (267462 downstream)																							caccaccaccactaccacaccac	0.034													7	4	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186960	26186960	+	5'Flank	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186960delT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AATTTTGTAATTTTTTTTTTT	0.274													4	2	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	62960335	62960336	+	Intron	INS	-	G	G	rs148090484	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62960335_62960336insG	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TATCAGTTGGTGGGGGGGGCAG	0.371													4	3	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142804489	142804490	+	Intron	INS	-	TT	TT			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142804489_142804490insTT	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gattaggaagctttttttttta	0.149													3	3	---	---	---	---	
TRAF3IP3	80342	broad.mit.edu	37	1	209935222	209935223	+	Intron	INS	-	A	A	rs144296350	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209935222_209935223insA	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GGTAGAGAGAGAAAAAAAAACA	0.302													5	3	---	---	---	---	
CABC1	56997	broad.mit.edu	37	1	227148206	227148208	+	Intron	DEL	TGG	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227148206_227148208delTGG	uc001hqm.1	+						CABC1_uc010pvp.1_Intron|CABC1_uc001hqn.1_Intron|CABC1_uc009xeq.1_Intron|CABC1_uc010pvq.1_Intron	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like						cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				tggtggtgcttggtggtggtggt	0.000													6	6	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246805436	246805437	+	Intron	DEL	TT	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246805436_246805437delTT	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						AAGGATCTGGtttttttttttt	0.322													6	3	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11725179	11725180	+	Intron	INS	-	A	A	rs78338846		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11725179_11725180insA	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTGTGATTAGAAAAAAAAAAA	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12607549	12607550	+	Intron	INS	-	CTTC	CTTC	rs7571135		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12607549_12607550insCTTC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ttccttcctatcttccttcctt	0.094													3	3	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36776050	36776050	+	3'UTR	DEL	T	-	-	rs11309348		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36776050delT	uc002rpd.2	+	17						NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor						nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TGACCAAGTGTTTTCTTAGAA	0.418													3	3	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70070122	70070123	+	Intron	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70070122_70070123insA	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						TTGGACTTGTTAAAAAAAAAAA	0.243													4	3	---	---	---	---	
SMYD5	10322	broad.mit.edu	37	2	73448560	73448561	+	Intron	INS	-	T	T	rs112717194		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73448560_73448561insT	uc002siw.2	+						SMYD5_uc010yre.1_Intron|SMYD5_uc002six.1_5'Flank	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5								metal ion binding				0						TGCCTGTAGTCTTTTTTTTTTT	0.401													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92307360	92307360	+	IGR	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92307360delT								FKSG73 (176866 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													73	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92320948	92320948	+	IGR	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92320948delT								FKSG73 (190454 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													57	8	---	---	---	---	
KYNU	8942	broad.mit.edu	37	2	143685028	143685032	+	Intron	DEL	AAAAG	-	-	rs3835780		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143685028_143685032delAAAAG	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	AAAAGAAAATAAAAGAAATTTAAAA	0.249													4	5	---	---	---	---	
RIF1	55183	broad.mit.edu	37	2	152325094	152325095	+	Intron	DEL	TT	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152325094_152325095delTT	uc002txm.2	+						RIF1_uc002txl.2_Intron|RIF1_uc002txn.2_Intron|RIF1_uc002txo.2_Intron|RIF1_uc002txp.2_Intron	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TTCATGTCACTTTATATTTTCA	0.381													125	84	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	213287225	213287226	+	Intron	DEL	AC	-	-	rs66466958		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213287225_213287226delAC	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		tggactcaaaacacacacacac	0.129										TSP Lung(8;0.080)			4	2	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													4	3	---	---	---	---	
WNT7A	7476	broad.mit.edu	37	3	13874869	13874870	+	Intron	DEL	CA	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13874869_13874870delCA	uc003bye.1	-							NM_004625	NP_004616	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3						CACACAAGCGCACACACACACA	0.554													4	2	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14509843	14509844	+	Intron	INS	-	C	C	rs142706263	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14509843_14509844insC	uc010heg.2	+						SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						TCTAAAATGGACCCCCCCCCCG	0.520											OREG0015421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	97926080	97926080	+	IGR	DEL	T	-	-	rs5851109		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97926080delT								OR5H15 (37597 upstream) : OR5H6 (57049 downstream)																							AAATATATGATTTTTTTCCAT	0.308													1	5	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130367861	130367861	+	Intron	DEL	T	-	-	rs72391450		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130367861delT	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TCTATGTATCTTTTTTTTTTT	0.299													5	3	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180372412	180372413	+	Intron	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180372412_180372413insA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAAGAGACATTaaaaaaaaaaa	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185843689	185843690	+	IGR	DEL	GT	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185843689_185843690delGT								ETV5 (16788 upstream) : DGKG (21301 downstream)																							tggttgtgtggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189675489	189675490	+	3'UTR	INS	-	AGAGAG	AGAGAG	rs144524097	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189675489_189675490insAGAGAG	uc011bsk.1	-	15					LEPREL1_uc003fsg.2_3'UTR	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	tgtctcTAAGAagagagagaga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29711745	29711748	+	IGR	DEL	AGGA	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29711745_29711748delAGGA								None (None upstream) : None (None downstream)																							TGAGGGAGGGaggaaggaaggaag	0.108													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	44458600	44458601	+	IGR	DEL	TC	-	-	rs5857962		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44458600_44458601delTC								KCTD8 (7776 upstream) : YIPF7 (165753 downstream)																							tgtctgtgtgtctgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49156524	49156524	+	IGR	DEL	A	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49156524delA								CWH43 (92431 upstream) : None (None downstream)																							attcgggttgattccattcca	0.000													294	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84938760	84938761	+	Intron	DEL	AC	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84938760_84938761delAC	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		CCCAGAGCAAacacacacacac	0.292													5	3	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85658147	85658148	+	Intron	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85658147_85658148insA	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTCAGATGCtaaaaaaaaaaa	0.282													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99995851	99995852	+	Intron	INS	-	AGG	AGG	rs148777339	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99995851_99995852insAGG	uc003hui.2	-						ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	TCCTATGTTTCAGGTGAGCACC	0.411													5	6	---	---	---	---	
FBXW7	55294	broad.mit.edu	37	4	153339280	153339281	+	Intron	DEL	CA	-	-	rs71656537		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153339280_153339281delCA	uc003ims.2	-						FBXW7_uc011cii.1_Intron|FBXW7_uc003imt.2_Intron|FBXW7_uc003imu.2_Intron	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform						interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				cagctcttaccacacacacaca	0.000			Mis|N|D|F		colorectal|endometrial|T-ALL								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	32116038	32116039	+	IGR	INS	-	AC	AC	rs139540545	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32116038_32116039insAC								PDZD2 (5001 upstream) : GOLPH3 (8785 downstream)																							GGAAacacacaacacacacaca	0.351													3	3	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137909330	137909331	+	Intron	INS	-	AAA	AAA	rs55663873		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137909330_137909331insAAA	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			agactgtctccaaaaaaaaaaa	0.149													5	3	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140028326	140028327	+	Intron	INS	-	T	T	rs113938710		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140028326_140028327insT	uc003lgq.2	+						NDUFA2_uc003lgp.2_5'Flank|IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGTGTTAAGTTTTTTTTTTT	0.337													4	2	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154270615	154270616	+	Intron	INS	-	T	T	rs147642619		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154270615_154270616insT	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			tgtgcccggGCTTTTTTTtttt	0.010													8	4	---	---	---	---	
TUBB	203068	broad.mit.edu	37	6	30692293	30692294	+	3'UTR	INS	-	G	G	rs150645240	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30692293_30692294insG	uc003nrl.2	+	4					TUBB_uc003nrk.1_3'UTR|TUBB_uc011dmq.1_3'UTR	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta						cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	ttttttcttctggggggggtct	0.277													5	5	---	---	---	---	
CD2AP	23607	broad.mit.edu	37	6	47577250	47577252	+	Intron	DEL	AAA	-	-	rs141520082		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47577250_47577252delAAA	uc003oyw.2	+							NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			ccatctttgcaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109962553	109962554	+	Intron	DEL	TT	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109962553_109962554delTT	uc003ptn.2	-						AKD1_uc003ptr.3_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						tctttctttctttttttttttt	0.000													3	3	---	---	---	---	
ORC5L	5001	broad.mit.edu	37	7	103820591	103820592	+	Intron	DEL	AT	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103820591_103820592delAT	uc003vcb.2	-						ORC5L_uc011klp.1_Intron|ORC5L_uc003vcc.2_Intron	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						gtttacactcatagtgtgttct	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2388663	2388664	+	IGR	INS	-	GT	GT	rs139110582	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2388663_2388664insGT								MYOM2 (295284 upstream) : CSMD1 (404212 downstream)																							TCACTTTCAGAgtgtgtgtgtg	0.297													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48495430	48495433	+	Intron	DEL	ACAT	-	-	rs58837046		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48495430_48495433delACAT	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				acacacacacacaTATTTTTAAAA	0.196													3	3	---	---	---	---	
MYBL1	4603	broad.mit.edu	37	8	67479762	67479763	+	Intron	DEL	GT	-	-	rs111413499		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67479762_67479763delGT	uc003xwj.2	-						MYBL1_uc003xwl.2_Intron|MYBL1_uc003xwk.2_Intron	NM_001080416	NP_001073885	P10243	MYBA_HUMAN	v-myb myeloblastosis viral oncogene homolog						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GAGAGAgtgagtgtgtgtgtgt	0.173													4	2	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72965200	72965201	+	Intron	INS	-	TG	TG	rs146534418	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72965200_72965201insTG	uc003xza.2	-						uc011lff.1_RNA|uc003xyy.2_RNA	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	ggaagtggatctgtgtgtgtgt	0.149													3	3	---	---	---	---	
REXO1L1	254958	broad.mit.edu	37	8	86783723	86783723	+	Intron	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86783723delT	uc011lfx.1	-						REXO1L1_uc010mah.2_Intron	NM_172239	NP_758439	Q8IX06	GOR_HUMAN	exonuclease GOR							cytoplasm|nucleus	exonuclease activity|nucleic acid binding				0						gtttcctgacttttttattga	0.000													4	3	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104709774	104709775	+	Intron	INS	-	A	A	rs148555337		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104709774_104709775insA	uc003ylp.2	+							NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ctgtctctacgaaaaaaaaaaa	0.000										HNSCC(12;0.0054)			4	2	---	---	---	---	
FAM166B	730112	broad.mit.edu	37	9	35562329	35562332	+	Intron	DEL	ACAA	-	-	rs148268907		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35562329_35562332delACAA	uc010mkr.2	-						FAM166B_uc011lov.1_Intron|FAM166B_uc011low.1_Intron|FAM166B_uc003zwy.2_Intron	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1												0						CCATACCCATACAAACAAACATTC	0.505													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68419453	68419454	+	IGR	DEL	AA	-	-	rs62545511		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68419453_68419454delAA								FAM27B (625264 upstream) : MIR1299 (582785 downstream)																							catacacaccaaacacacatac	0.000													40	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68428787	68428787	+	IGR	DEL	T	-	-	rs78281943		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68428787delT								FAM27B (634598 upstream) : MIR1299 (573452 downstream)																							TTTCTAACTCTGGTTCTAATA	0.254													4	3	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107555755	107555756	+	Intron	INS	-	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107555755_107555756insT	uc004bcl.2	-							NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TCCAAGTCTGATTTGGGAAAAC	0.332													4	2	---	---	---	---	
PMPCA	23203	broad.mit.edu	37	9	139312224	139312224	+	Intron	DEL	T	-	-	rs112295054		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139312224delT	uc004chl.2	+						PMPCA_uc010nbl.2_Intron|PMPCA_uc011mdz.1_Intron|PMPCA_uc004chm.1_Intron|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha						proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TATACATATGTTTTTTTTttt	0.015													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42384991	42384992	+	IGR	DEL	CG	-	-	rs66774255		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42384991_42384992delCG								None (None upstream) : LOC441666 (442323 downstream)																							cgaatggattcgaatggaatca	0.000													909	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385606	42385606	+	IGR	DEL	G	-	-	rs67827809		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385606delG								None (None upstream) : LOC441666 (441709 downstream)																							ggaattcaaaggaatcatcat	0.000													2072	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42395556	42395556	+	IGR	DEL	G	-	-	rs149806640		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42395556delG								None (None upstream) : LOC441666 (431759 downstream)																							AAcatcgaatggaatcgaatg	0.035													14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42408305	42408306	+	IGR	INS	-	T	T			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42408305_42408306insT								None (None upstream) : LOC441666 (419009 downstream)																							ttgaaacactctttttgcagaa	0.000													1047	10	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634779	45634780	+	Intron	DEL	AC	-	-	rs71659798		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634779_45634780delAC	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						AAAAAAAAAAACAAAATTTGTA	0.163													10	5	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47059016	47059019	+	Intron	DEL	ACAA	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47059016_47059019delACAA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						acacccccacacaaacacacaacc	0.000													4	2	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73405973	73405974	+	Intron	INS	-	A	A	rs143606744	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73405973_73405974insA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jry.2_Intron|CDH23_uc001jrz.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTCCCATCAGGAGCCTCTGCAA	0.564													2	6	---	---	---	---	
MIR606	693191	broad.mit.edu	37	10	77312183	77312184	+	5'Flank	DEL	TC	-	-	rs1367290		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77312183_77312184delTC	hsa-mir-606|MI0003619	+																							0						tttttttttttcccccccctct	0.000													4	2	---	---	---	---	
C10orf119	79892	broad.mit.edu	37	10	121602280	121602280	+	Intron	DEL	T	-	-	rs71935400		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121602280delT	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		TGCATCCTCCttttttttttt	0.199													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	128409976	128409977	+	IGR	INS	-	GAAG	GAAG	rs10901678	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128409976_128409977insGAAG								C10orf90 (50897 upstream) : DOCK1 (184046 downstream)																							aaagaaagaaagaaggaaggaa	0.074													4	3	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31541376	31541377	+	Intron	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31541376_31541377insA	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					gactccatctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
MS4A13	503497	broad.mit.edu	37	11	60297090	60297091	+	Intron	INS	-	AGAA	AGAA	rs145927089	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60297090_60297091insAGAA	uc001nps.2	+						MS4A13_uc009ync.2_Intron|MS4A13_uc009ynd.2_Intron	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane					0						attttataaataGCATAAAATT	0.233													4	3	---	---	---	---	
PAFAH1B2	5049	broad.mit.edu	37	11	117030453	117030453	+	Intron	DEL	A	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117030453delA	uc001pqe.1	+						PAFAH1B2_uc009yzk.1_Intron|PAFAH1B2_uc009yzl.1_Intron|PAFAH1B2_uc009yzm.2_Intron|PAFAH1B2_uc009yzn.2_Intron|PAFAH1B2_uc009yzj.1_Intron	NM_002572	NP_002563	P68402	PA1B2_HUMAN	platelet-activating factor acetylhydrolase,						lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)		gctgtcttagaaaaaaaaaaa	0.010			T	IGH@	MLCLS								4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2656822	2656823	+	Intron	DEL	TG	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2656822_2656823delTG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	gtatatatgttgtgtgtgtgtg	0.366													4	3	---	---	---	---	
PPFIBP1	8496	broad.mit.edu	37	12	27827355	27827364	+	Intron	DEL	ATCGGTGGTT	-	-	rs150455469		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27827355_27827364delATCGGTGGTT	uc001ric.1	+						PPFIBP1_uc010sjr.1_Intron|PPFIBP1_uc001rib.1_Intron|PPFIBP1_uc001ria.2_Intron|PPFIBP1_uc001rid.1_Intron|PPFIBP1_uc001rif.1_5'Flank	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					tagaatgcagatcggtggttaccagtggta	0.000													3	4	---	---	---	---	
MIR1293	100302220	broad.mit.edu	37	12	50627995	50627995	+	RNA	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50627995delT	hsa-mir-1293|MI0006355	-			c.1delT			LIMA1_uc001rwj.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron																	0						CAGAACAACCttttttttttt	0.229													2	4	---	---	---	---	
HOXC12	3228	broad.mit.edu	37	12	54348555	54348559	+	5'Flank	DEL	GGGAT	-	-	rs72049639		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348555_54348559delGGGAT	uc010soq.1	+							NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GTTAGAGTGCGGGATGGGATGGTGG	0.585													2	4	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66957859	66957860	+	Intron	INS	-	TT	TT	rs146009716	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66957859_66957860insTT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GGTTTCTTCTCTGTCTTTTTCA	0.277													4	2	---	---	---	---	
CCDC64	92558	broad.mit.edu	37	12	120527110	120527111	+	Intron	INS	-	GTGT	GTGT	rs149598115	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120527110_120527111insGTGT	uc001txl.1	+						CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Intron	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					gtgtgtgtgGGGTGTGACGGAG	0.327													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125675655	125675656	+	IGR	INS	-	GGT	GGT	rs140237385	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125675655_125675656insGGT								AACS (47783 upstream) : TMEM132B (135506 downstream)																							gatggggaaggggtggtggtga	0.000													4	3	---	---	---	---	
PRMT5	10419	broad.mit.edu	37	14	23396470	23396475	+	Intron	DEL	TTTTTG	-	-	rs149917964		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23396470_23396475delTTTTTG	uc001whm.1	-						PRMT5_uc001whl.1_Intron|PRMT5_uc010akd.1_Intron|PRMT5_uc010tnf.1_Intron|PRMT5_uc010tng.1_Intron|PRMT5_uc010tnh.1_Intron|PRMT5_uc001whn.1_Intron	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a						cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		aatttgtgtttttttgtttttgtttt	0.000													2	4	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123118	100123118	+	Intron	DEL	G	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123118delG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				tctgcaaaaagaaaagaaaag	0.000													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106133055	106133056	+	Intron	INS	-	G	G			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106133055_106133056insG	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron					Parts of antibodies, mostly variable regions.												0						GGACAGTTTGTGAGAGCGTGGG	0.609													6	3	---	---	---	---	
NF1P1	440225	broad.mit.edu	37	15	22142823	22142824	+	Intron	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22142823_22142824insA	uc010tzs.1	-											Human NF1-related locus DNA in A9 mouse DNA background.												0						GCAGTGTTAGCAAAAAAAAAAA	0.317													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26212944	26212945	+	IGR	DEL	TG	-	-	rs71418074		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26212944_26212945delTG								ATP10A (102627 upstream) : GABRB3 (575750 downstream)																							tcagctaatttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60167135	60167135	+	IGR	DEL	C	-	-	rs58967271		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60167135delC								BNIP2 (185493 upstream) : FOXB1 (129286 downstream)																							ttccttccttccttccttccc	0.159													4	2	---	---	---	---	
TMEM8A	58986	broad.mit.edu	37	16	426005	426006	+	Intron	DEL	CT	-	-	rs141906733		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:426005_426006delCT	uc002cgu.3	-						TMEM8A_uc002cgv.3_Intron	NM_021259	NP_067082	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8 (five membrane-spanning						cell adhesion	integral to plasma membrane				central_nervous_system(2)|pancreas(1)	3						ACATGGGCCCCTGTCTTGGCCC	0.703													2	4	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20986308	20986311	+	Intron	DEL	TTTT	-	-	rs35783206		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20986308_20986311delTTTT	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		acctggctagtttttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33973793	33973794	+	IGR	INS	-	T	T	rs71245726		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33973793_33973794insT								MIR1826 (8201 upstream) : UBE2MP1 (430008 downstream)																							tggaaacattctttttgtagaa	0.000													119	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46405754	46405754	+	IGR	DEL	T	-	-	rs11488991		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46405754delT								None (None upstream) : ANKRD26P1 (97495 downstream)																							tccattcttgtccattcgatg	0.000													82	11	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10431365	10431365	+	Intron	DEL	T	-	-	rs72036645		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10431365delT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						tctttctttcttttttttttt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22253249	22253249	+	IGR	DEL	C	-	-	rs140540869		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22253249delC								FLJ36000 (340179 upstream) : None (None downstream)																							ttgaacctttctttgatagtt	0.000													1707	8	---	---	---	---	
HEATR6	63897	broad.mit.edu	37	17	58137627	58137628	+	Intron	INS	-	A	A	rs146546774	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58137627_58137628insA	uc002iyk.1	-						HEATR6_uc010ddk.1_Intron|HEATR6_uc010wos.1_Intron	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GTCCCACACCTAAAAAAAAATC	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	110406	110406	+	Intron	DEL	C	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:110406delC	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		gcactgatcacccaggtgatg	0.000													171	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18517211	18517211	+	IGR	DEL	C	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18517211delC								None (None upstream) : ROCK1 (12494 downstream)																							gaaatgtcttcccataaaaac	0.000													876	10	---	---	---	---	
KATNAL2	83473	broad.mit.edu	37	18	44547442	44547443	+	Intron	DEL	GT	-	-	rs72266255		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44547442_44547443delGT	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TTACTTAATGgtgtgtgtgtgt	0.233													6	3	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4668862	4668862	+	Intron	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668862delT	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		acccgactaattttttttttt	0.000													4	2	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153106	7153109	+	Intron	DEL	ACAC	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153106_7153109delACAC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	caccacacatacacacaccacaaa	0.000													4	4	---	---	---	---	
KCTD15	79047	broad.mit.edu	37	19	34288185	34288194	+	Intron	DEL	GTGTGCGCGC	-	-	rs459494		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34288185_34288194delGTGTGCGCGC	uc002nuy.3	+						KCTD15_uc002nuv.2_Intron|KCTD15_uc002nuw.3_Intron|KCTD15_uc010xrt.1_Intron|KCTD15_uc002nux.3_5'Flank	NM_001129994	NP_001123466	Q96SI1	KCD15_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	Esophageal squamous(110;0.162)					gtgtgtgtgtgtgtgcgcgcgcgcgcgcgc	0.529													4	2	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40715308	40715308	+	Intron	DEL	C	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40715308delC	uc002ona.2	+						MAP3K10_uc002onb.2_Intron	NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						aggataatttctttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26113740	26113740	+	IGR	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26113740delT								C20orf191 (19063 upstream) : MIR663 (75082 downstream)																							CCAGAAAAAATATGTGAGAGA	0.328													4	6	---	---	---	---	
ADA	100	broad.mit.edu	37	20	43258059	43258060	+	Intron	DEL	GT	-	-	rs71825229		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43258059_43258060delGT	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	ACAGGTTGAAgtgtgtgtgtgt	0.356									Adenosine_Deaminase_Deficiency				3	3	---	---	---	---	
WFDC5	149708	broad.mit.edu	37	20	43743531	43743532	+	Intron	DEL	CG	-	-	rs11700134		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43743531_43743532delCG	uc002xne.1	-							NM_145652	NP_663627	Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5 precursor							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				cacacacacacgcgcacacaca	0.396													5	5	---	---	---	---	
WFDC11	259239	broad.mit.edu	37	20	44278887	44278888	+	Intron	DEL	AG	-	-	rs6032408		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44278887_44278888delAG	uc002xpa.2	-							NM_147197	NP_671730	Q8NEX6	WFD11_HUMAN	WAP four-disulfide core domain 11 precursor							extracellular region					0		Myeloproliferative disorder(115;0.0122)				GTATATATATagagagagagag	0.262													4	2	---	---	---	---	
EYA2	2139	broad.mit.edu	37	20	45706958	45706959	+	Intron	DEL	GC	-	-	rs73123774		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45706958_45706959delGC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				ATGTGCACGTGCGCGCGCGCGC	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9590549	9590550	+	IGR	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9590549_9590550insA								None (None upstream) : None (None downstream)																							CCCTCaaatttaaaaaattata	0.322													2	4	---	---	---	---	
PIGP	51227	broad.mit.edu	37	21	38439271	38439272	+	Intron	INS	-	GT	GT	rs140750974	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38439271_38439272insGT	uc002yvw.1	-						PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				TTTTACTGTCCgtgtgtgtgtg	0.139													7	4	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39762982	39762983	+	Intron	DEL	AA	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39762982_39762983delAA	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				AAAAAGAAACAAAGTCAAATCC	0.371													179	25	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46920116	46920117	+	Intron	INS	-	TA	TA	rs140242824	by1000genomes	TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46920116_46920117insTA	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron|SLC19A1_uc010gpy.1_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		tgtggagtgtgtgtggctgggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29263225	29263232	+	IGR	DEL	GAAAGAAA	-	-	rs59295229		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29263225_29263232delGAAAGAAA								XBP1 (66665 upstream) : ZNRF3 (16658 downstream)																							aggaaggaaggaaagaaagaaagaaaga	0.091													3	3	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43614037	43614039	+	Intron	DEL	CCT	-	-	rs79792173		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43614037_43614039delCCT	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				actccttgtccctcctcagactg	0.256													2	5	---	---	---	---	
TSIX	9383	broad.mit.edu	37	X	73043145	73043145	+	RNA	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73043145delT	uc004ebn.2	+	1		c.31106delT			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						tttttctttcttttttttttt	0.338													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10042486	10042486	+	IGR	DEL	T	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10042486delT								TTTY22 (391632 upstream) : None (None downstream)																							ttcttttgaatgagaagtttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10043126	10043126	+	IGR	DEL	A	-	-	rs111966768		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10043126delA								TTTY22 (392272 upstream) : None (None downstream)																							aagatttctgagaaacttctt	0.000													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13451341	13451341	+	IGR	DEL	C	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13451341delC								None (None upstream) : None (None downstream)																							ccatttctttctttcaacagc	0.010													31	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13486799	13486800	+	IGR	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13486799_13486800insA								None (None upstream) : None (None downstream)																							agagcctagacaaagtcccatc	0.000													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13538862	13538863	+	IGR	INS	-	A	A			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13538862_13538863insA								None (None upstream) : None (None downstream)																							aacaatacaccaaaatggggtt	0.089													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13690084	13690088	+	IGR	DEL	GGAAT	-	-	rs143838237		TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13690084_13690088delGGAAT								None (None upstream) : None (None downstream)																							ggcatcaaaaggaatggaatggaat	0.000													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28814770	28814770	+	IGR	DEL	G	-	-			TCGA-CH-5790-01	TCGA-CH-5790-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28814770delG								None (None upstream) : None (None downstream)																							gaatcaaatcgaattgaatag	0.040													5	3	---	---	---	---	
