Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CDCA8	55143	broad.mit.edu	37	1	38164439	38164439	+	Intron	DEL	C	-	-	rs3842536		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38164439delC	uc001cbr.2	+						CDCA8_uc001cbs.2_Intron|CDCA8_uc010oih.1_Intron	NM_018101	NP_060571			cell division cycle associated 8						cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
ATP6V1C2	245973	broad.mit.edu	37	2	10922664	10922664	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10922664delA	uc002ras.2	+						ATP6V1C2_uc002rat.2_Intron	NM_001039362	NP_001034451			vacuolar H+ ATPase C2 isoform a						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)														---	---	---	---
CORIN	10699	broad.mit.edu	37	4	47625086	47625087	+	Intron	INS	-	CTCTCTCT	CTCTCTCT	rs35531403		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47625086_47625087insCTCTCTCT	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron	NM_006587	NP_006578			corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TRIM2	23321	broad.mit.edu	37	4	154215279	154215280	+	Intron	INS	-	A	A	rs148467106	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154215279_154215280insA	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539			tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)														---	---	---	---
GALNT7	51809	broad.mit.edu	37	4	174235080	174235081	+	Intron	DEL	AT	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174235080_174235081delAT	uc003isz.3	+						GALNT7_uc011ckb.1_Intron	NM_017423	NP_059119			polypeptide N-acetylgalactosaminyltransferase 7						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)														---	---	---	---
HPGD	3248	broad.mit.edu	37	4	175443424	175443425	+	Intron	INS	-	T	T	rs146881598	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175443424_175443425insT	uc003itu.2	-						HPGD_uc003itv.2_Intron|HPGD_uc011ckf.1_Intron|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Intron|HPGD_uc011ckg.1_Intron|HPGD_uc011ckh.1_Intron|HPGD_uc003itw.2_Intron|HPGD_uc003itx.2_Intron	NM_000860	NP_000851			hydroxyprostaglandin dehydrogenase 15-(NAD)						female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)													---	---	---	---
ISL1	3670	broad.mit.edu	37	5	50680238	50680238	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50680238delA	uc003jor.2	+						uc003joq.1_5'Flank	NM_002202	NP_002193			islet-1						generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)																---	---	---	---
C5orf4	10826	broad.mit.edu	37	5	154217841	154217841	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154217841delA	uc003lvs.3	-						C5orf4_uc011dde.1_Intron	NM_032385	NP_115761			hypothetical protein LOC10826						fatty acid biosynthetic process	integral to membrane	iron ion binding|oxidoreductase activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)															---	---	---	---
GPX6	257202	broad.mit.edu	37	6	28474356	28474356	+	Intron	DEL	A	-	-	rs78915427		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28474356delA	uc011dlj.1	-						GPX6_uc010jrg.1_Intron	NM_182701	NP_874360			glutathione peroxidase 6 precursor						response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)													---	---	---	---
SYNGAP1	8831	broad.mit.edu	37	6	33408466	33408467	+	Intron	DEL	TC	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33408466_33408467delTC	uc011dri.1	+						SYNGAP1_uc010juy.2_Intron|SYNGAP1_uc010juz.2_Intron	NM_006772	NP_006763			synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4																		---	---	---	---
HCRTR2	3062	broad.mit.edu	37	6	55147362	55147362	+	3'UTR	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55147362delT	uc003pcl.2	+	7					HCRTR2_uc010jzv.2_RNA	NM_001526	NP_001517			orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123786155	123786155	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123786155delA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|uc003pzm.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	57008181	57008182	+	IGR	INS	-	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57008181_57008182insG								DKFZp434L192 (443204 upstream) : ZNF479 (179146 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157363894	157363895	+	Intron	INS	-	TA	TA	rs56184271		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157363894_157363895insTA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_5'Flank	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
CSPP1	79848	broad.mit.edu	37	8	68024051	68024053	+	Intron	DEL	GAA	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68024051_68024053delGAA	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672			centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78506448	78506453	+	Intron	DEL	CACACA	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78506448_78506453delCACACA	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
OLFML2A	169611	broad.mit.edu	37	9	127571880	127571880	+	Intron	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127571880delT	uc004bov.2	+						OLFML2A_uc004bow.2_Intron	NM_182487	NP_872293			olfactomedin-like 2A precursor												0																		---	---	---	---
FAM190B	54462	broad.mit.edu	37	10	86215040	86215040	+	Intron	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86215040delT	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872			granule cell antiserum positive 14											ovary(3)|skin(1)	4																		---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73795753	73795753	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73795753delA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346			C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
CDON	50937	broad.mit.edu	37	11	125871963	125871963	+	Intron	DEL	A	-	-	rs149758891		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125871963delA	uc009zbw.2	-						CDON_uc001qdb.3_Intron|CDON_uc001qdc.3_Intron	NM_016952	NP_058648			surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)														---	---	---	---
NCAPD3	23310	broad.mit.edu	37	11	134037240	134037241	+	Intron	INS	-	ACTT	ACTT	rs72311832		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037240_134037241insACTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076			non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)														---	---	---	---
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs66529359		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	9	1715_1735	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2																		---	---	---	---
WIF1	11197	broad.mit.edu	37	12	65450048	65450048	+	Intron	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65450048delT	uc001ssk.2	-							NM_007191	NP_009122			WNT inhibitory factor 1 precursor						multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)				T	HMGA2	pleomorphic salivary gland adenoma								---	---	---	---
NR1H4	9971	broad.mit.edu	37	12	100887051	100887051	+	5'UTR	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100887051delT	uc001thq.1	+	4					NR1H4_uc001thp.1_5'UTR|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_5'UTR|NR1H4_uc010svk.1_5'UTR	NM_005123	NP_005114			nuclear receptor subfamily 1, group H, member 4						bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
PARP4	143	broad.mit.edu	37	13	25049929	25049930	+	Intron	INS	-	T	T	rs34628702		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25049929_25049930insT	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428			poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---
C13orf18	80183	broad.mit.edu	37	13	46937481	46937482	+	Intron	INS	-	A	A	rs144203424	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46937481_46937482insA	uc010acl.2	-						C13orf18_uc001vbf.3_Intron|C13orf18_uc001vbg.3_Intron|C13orf18_uc010tfz.1_Intron|C13orf18_uc010acm.2_Intron|C13orf18_uc010acn.2_Intron|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Intron|C13orf18_uc001vbi.3_Intron|C13orf18_uc010aco.1_Intron	NM_025113	NP_079389			hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)														---	---	---	---
NEK5	341676	broad.mit.edu	37	13	52663609	52663613	+	Intron	DEL	GAAAA	-	-	rs142078223		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52663609_52663613delGAAAA	uc001vge.2	-							NM_199289	NP_954983			NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)														---	---	---	---
TMTC4	84899	broad.mit.edu	37	13	101264909	101264914	+	Intron	DEL	ACACAC	-	-	rs74114800		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101264909_101264914delACACAC	uc001vou.2	-						TMTC4_uc001vot.2_Intron|TMTC4_uc010tja.1_Intron	NM_001079669	NP_001073137			transmembrane and tetratricopeptide repeat							integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	20138372	20138372	+	IGR	DEL	G	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20138372delG								P704P (118100 upstream) : OR4Q3 (77215 downstream)																																			---	---	---	---
EIF2AK4	440275	broad.mit.edu	37	15	40314942	40314943	+	Intron	INS	-	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40314942_40314943insT	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725			eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)														---	---	---	---
CLEC16A	23274	broad.mit.edu	37	16	11071363	11071363	+	Intron	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11071363delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041			C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LPCAT2	54947	broad.mit.edu	37	16	55571300	55571300	+	Intron	DEL	C	-	-	rs111668979		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55571300delC	uc002eie.3	+						LPCAT2_uc002eic.2_Intron	NM_017839	NP_060309			lysophosphatidylcholine acyltransferase 2						cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0																		---	---	---	---
FAM18B2	201158	broad.mit.edu	37	17	15406062	15406064	+	3'UTR	DEL	CCG	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15406062_15406064delCCG	uc002goq.2	-	6					CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344			hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21518737	21518737	+	IGR	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518737delA								C17orf51 (41006 upstream) : FAM27L (306633 downstream)																																			---	---	---	---
CRLF3	51379	broad.mit.edu	37	17	29120270	29120271	+	Intron	INS	-	T	T	rs142556034	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29120270_29120271insT	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070			cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
FMNL1	752	broad.mit.edu	37	17	43314485	43314486	+	Intron	INS	-	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43314485_43314486insA	uc002iin.2	+							NM_005892	NP_005883			formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1																		---	---	---	---
NCLN	56926	broad.mit.edu	37	19	3192359	3192364	+	Intron	DEL	GGGCTG	-	-	rs11278022		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3192359_3192364delGGGCTG	uc002lxi.2	+						NCLN_uc002lxh.1_Intron	NM_020170	NP_064555			nicalin precursor						proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ELAVL3	1995	broad.mit.edu	37	19	11565285	11565286	+	3'UTR	DEL	TC	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565285_11565286delTC	uc002mry.1	-	7					ELAVL3_uc002mrx.1_3'UTR	NM_001420	NP_001411			ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
ZNF829	374899	broad.mit.edu	37	19	37393072	37393072	+	Intron	DEL	A	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37393072delA	uc002ofa.1	-						ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309			zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
EMILIN3	90187	broad.mit.edu	37	20	39991783	39991783	+	Intron	DEL	C	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39991783delC	uc002xjy.1	-							NM_052846	NP_443078			elastin microfibril interfacer 3							proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)																---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45666581	45666581	+	Intron	DEL	A	-	-	rs141091443	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666581delA	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063			cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)														---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12728253	12728260	+	Intron	DEL	AGATAGAC	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12728253_12728260delAGATAGAC	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
USP11	8237	broad.mit.edu	37	X	47101151	47101151	+	Intron	DEL	C	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47101151delC	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642			ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
PIN4	5303	broad.mit.edu	37	X	71416383	71416384	+	Intron	INS	-	A	A	rs11284819		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71416383_71416384insA	uc004eam.2	+						PIN4_uc004eao.1_Intron	NM_006223	NP_006214			protein (peptidyl-prolyl cis/trans isomerase)						protein folding|rRNA processing	cytoplasm|mitochondrial matrix|mitochondrial matrix|nucleolus|nucleolus|preribosome|spindle|spindle	bent DNA binding|DNA binding|double-stranded DNA binding|peptidyl-prolyl cis-trans isomerase activity				0	Renal(35;0.156)																	---	---	---	---
NCRNA00182	100302692	broad.mit.edu	37	X	73393541	73393542	+	Intron	DEL	TG	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73393541_73393542delTG	uc010nlq.1	-											Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0																		---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877			PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
MAMLD1	10046	broad.mit.edu	37	X	149623204	149623204	+	Intron	DEL	C	-	-			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149623204delC	uc004fee.1	+						MAMLD1_uc011mxt.1_Intron|MAMLD1_uc011mxu.1_Intron|MAMLD1_uc011mxv.1_Intron	NM_005491	NP_005482			mastermind-like domain containing 1						male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
PRRG3	79057	broad.mit.edu	37	X	150869083	150869084	+	Frame_Shift_Ins	INS	-	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150869083_150869084insT	uc004few.1	+	4	664_665	c.274_275insT	c.(274-276)CTGfs	p.L92fs		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	92	Helical; (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
CA6	765	broad.mit.edu	37	1	9009453	9009453	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9009453T>A	uc001apm.2	+	2	235	c.211T>A	c.(211-213)TAT>AAT	p.Y71N	CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	71					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PADI3	51702	broad.mit.edu	37	1	17601163	17601163	+	Missense_Mutation	SNP	C	T	T	rs139324096	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17601163C>T	uc001bai.2	+	11	1229	c.1189C>T	c.(1189-1191)CGC>TGC	p.R397C		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	397					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)											OREG0013148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22178378	22178378	+	Silent	SNP	G	A	A	rs145299929		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22178378G>A	uc001bfj.2	-	54	6952	c.6912C>T	c.(6910-6912)GCC>GCT	p.A2304A	HSPG2_uc009vqd.2_Silent_p.A2305A	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2304	Ig-like C2-type 8.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
MAN1C1	57134	broad.mit.edu	37	1	26104716	26104716	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26104716G>A	uc001bkm.2	+	9	1708	c.1378G>A	c.(1378-1380)GCC>ACC	p.A460T	MAN1C1_uc009vry.1_Missense_Mutation_p.A280T|MAN1C1_uc001bkn.2_5'Flank	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	460	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27101054	27101054	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27101054C>T	uc001bmv.1	+	18	4709	c.4336C>T	c.(4336-4338)CGA>TGA	p.R1446*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.R1445*|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Nonsense_Mutation_p.R1063*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.R292*|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1446					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
KIAA0754	643314	broad.mit.edu	37	1	39876123	39876123	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39876123G>A	uc009vvt.1	+	1	948	c.186G>A	c.(184-186)ATG>ATA	p.M62I	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	Error:Variant_position_missing_in_O94854_after_alignment											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
PLK3	1263	broad.mit.edu	37	1	45270311	45270311	+	Intron	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45270311C>A	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064			polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
TGFBR3	7049	broad.mit.edu	37	1	92184966	92184966	+	Missense_Mutation	SNP	T	G	G	rs138396794		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92184966T>G	uc001doh.2	-	10	1935	c.1469A>C	c.(1468-1470)AAG>ACG	p.K490T	TGFBR3_uc009wde.2_Missense_Mutation_p.K267T|TGFBR3_uc010osy.1_Missense_Mutation_p.K448T|TGFBR3_uc001doi.2_Missense_Mutation_p.K489T|TGFBR3_uc001doj.2_Missense_Mutation_p.K489T	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	490	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)														---	---	---	---
PALMD	54873	broad.mit.edu	37	1	100152261	100152261	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100152261A>C	uc001dsg.2	+	4	724	c.281A>C	c.(280-282)AAA>ACA	p.K94T	PALMD_uc001dsf.2_Missense_Mutation_p.K94T	NM_017734	NP_060204	Q9NP74	PALMD_HUMAN	palmdelphin	94	Potential.				regulation of cell shape	cytoplasm|membrane				ovary(2)|pancreas(1)	3		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)														---	---	---	---
FRRS1	391059	broad.mit.edu	37	1	100203814	100203814	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100203814G>A	uc001dsh.1	-	7	1189	c.587C>T	c.(586-588)TCA>TTA	p.S196L		NM_001013660	NP_001013682	Q6ZNA5	FRRS1_HUMAN	stromal cell derived factor receptor 2 homolog	196					electron transport chain|transport	integral to membrane	ferric-chelate reductase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)														---	---	---	---
CDC14A	8556	broad.mit.edu	37	1	100949859	100949859	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100949859C>T	uc001dtg.3	+	11	1477	c.989C>T	c.(988-990)TCG>TTG	p.S330L	CDC14A_uc009web.2_RNA|CDC14A_uc010oui.1_Missense_Mutation_p.S272L|CDC14A_uc001dte.3_Missense_Mutation_p.S330L|CDC14A_uc001dtf.2_Missense_Mutation_p.S330L|CDC14A_uc009wed.1_Missense_Mutation_p.S37L|CDC14A_uc009wee.2_Missense_Mutation_p.S330L	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1	330	B.				cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)														---	---	---	---
TBX15	6913	broad.mit.edu	37	1	119428075	119428075	+	Silent	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119428075A>G	uc001ehl.1	-	8	1086	c.771T>C	c.(769-771)TCT>TCC	p.S257S	TBX15_uc009whj.1_Silent_p.S81S	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15	363						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)														---	---	---	---
PRCC	5546	broad.mit.edu	37	1	156756800	156756800	+	Missense_Mutation	SNP	C	T	T	rs139572885		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156756800C>T	uc001fqa.2	+	3	1207	c.917C>T	c.(916-918)ACG>ATG	p.T306M	PRCC_uc001fqb.2_Missense_Mutation_p.T306M	NM_005973	NP_005964	Q92733	PRCC_HUMAN	papillary renal cell carcinoma	306					cell cycle|mitotic cell cycle checkpoint	nucleus	protein binding		PRCC/TFE3(25)	kidney(25)|central_nervous_system(2)	27	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)							T	TFE3	papillary renal 								---	---	---	---
DUSP27	92235	broad.mit.edu	37	1	167095276	167095276	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095276G>A	uc001geb.1	+	5	908	c.908G>A	c.(907-909)AGC>AAC	p.S303N		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	303					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3																		---	---	---	---
ADCY10	55811	broad.mit.edu	37	1	167805735	167805735	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167805735C>T	uc001ger.2	-	23	3419	c.3121G>A	c.(3121-3123)GTT>ATT	p.V1041I	ADCY10_uc009wvj.2_5'Flank|ADCY10_uc009wvk.2_Missense_Mutation_p.V949I|ADCY10_uc010plj.1_Missense_Mutation_p.V888I	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	1041					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
NAV1	89796	broad.mit.edu	37	1	201618005	201618005	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201618005G>T	uc001gwu.2	+	1	556	c.209G>T	c.(208-210)GGC>GTC	p.G70V		NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	70					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
TSNAX	7257	broad.mit.edu	37	1	231678314	231678314	+	Silent	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231678314A>T	uc001huw.2	+	4	482	c.324A>T	c.(322-324)CTA>CTT	p.L108L	TSNAX-DISC1_uc010pwe.1_5'UTR|TSNAX-DISC1_uc010pwf.1_5'UTR|TSNAX-DISC1_uc010pwg.1_5'UTR|TSNAX-DISC1_uc010pwh.1_5'UTR|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_5'UTR|TSNAX-DISC1_uc010pwk.1_5'UTR|TSNAX-DISC1_uc010pwl.1_RNA	NM_005999	NP_005990	Q99598	TSNAX_HUMAN	translin-associated factor X	108	Interaction with C1D.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding				0		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)																---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234367425	234367425	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234367425G>A	uc001hwa.1	+	2	567	c.339G>A	c.(337-339)CCG>CCA	p.P113P	SLC35F3_uc001hvy.1_Silent_p.P182P	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	113	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
APOB	338	broad.mit.edu	37	2	21252873	21252873	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21252873T>C	uc002red.2	-	11	1495	c.1367A>G	c.(1366-1368)AAC>AGC	p.N456S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	456	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---
MAT2A	4144	broad.mit.edu	37	2	85770889	85770889	+	Silent	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85770889A>G	uc002spr.2	+	9	1305	c.1182A>G	c.(1180-1182)AAA>AAG	p.K394K	MAT2A_uc010fgk.2_Silent_p.K368K	NM_005911	NP_005902	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	394					methylation|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)													---	---	---	---
C2orf55	343990	broad.mit.edu	37	2	99443575	99443575	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99443575C>T	uc002szf.1	-	6	892	c.598G>A	c.(598-600)GAC>AAC	p.D200N		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	200											0																		---	---	---	---
IL1RL2	8808	broad.mit.edu	37	2	102808381	102808381	+	Intron	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102808381A>G	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845			interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2																		---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125547588	125547588	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125547588G>A	uc002tno.2	+	18	3223	c.2859G>A	c.(2857-2859)AGG>AGA	p.R953R	CNTNAP5_uc010flu.2_Silent_p.R954R	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	953	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
POTEF	728378	broad.mit.edu	37	2	130832580	130832580	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832580A>C	uc010fmh.2	-	17	2865	c.2465T>G	c.(2464-2466)ATC>AGC	p.I822S		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	822	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5																		---	---	---	---
RAB3GAP1	22930	broad.mit.edu	37	2	135926202	135926202	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135926202C>A	uc002tuj.2	+	24	2822	c.2797C>A	c.(2797-2799)CCC>ACC	p.P933T	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.P940T|RAB3GAP1_uc010fng.2_Missense_Mutation_p.P758T|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	933						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179553493	179553493	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179553493T>G	uc010zfg.1	-	123	28600	c.28376A>C	c.(28375-28377)AAG>ACG	p.K9459T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.K6120T|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10386							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179590293	179590293	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590293C>T	uc010zfg.1	-	68	17130	c.16906G>A	c.(16906-16908)GCC>ACC	p.A5636T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A2297T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6563							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
GLS	2744	broad.mit.edu	37	2	191827548	191827548	+	Intron	SNP	G	A	A	rs143643056	by1000genomes	TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191827548G>A	uc002usf.2	+						GLS_uc002ush.2_Intron|GLS_uc010zgi.1_Intron|GLS_uc010zgj.1_Intron	NM_014905	NP_055720			glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---
FBLN2	2199	broad.mit.edu	37	3	13679190	13679190	+	Missense_Mutation	SNP	C	T	T	rs112412824		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13679190C>T	uc011avb.1	+	17	3451	c.3326C>T	c.(3325-3327)GCG>GTG	p.A1109V	FBLN2_uc011auz.1_Missense_Mutation_p.A1135V|FBLN2_uc011ava.1_Missense_Mutation_p.A1156V|FBLN2_uc011avc.1_Missense_Mutation_p.A1156V	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	1109	Domain III.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)															---	---	---	---
ZNF660	285349	broad.mit.edu	37	3	44636501	44636501	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44636501A>C	uc003cnl.1	+	3	1149	c.816A>C	c.(814-816)AAA>AAC	p.K272N		NM_173658	NP_775929	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)														---	---	---	---
GTF2E1	2960	broad.mit.edu	37	3	120495484	120495484	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120495484G>A	uc003edz.3	+	4	979	c.865G>A	c.(865-867)GCA>ACA	p.A289T		NM_005513	NP_005504	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1,	289					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.159)														---	---	---	---
MME	4311	broad.mit.edu	37	3	154866382	154866382	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154866382A>T	uc010hvr.1	+	16	1752	c.1541A>T	c.(1540-1542)AAT>ATT	p.N514I	MME_uc003fab.1_Missense_Mutation_p.N514I|MME_uc003fac.1_Missense_Mutation_p.N514I|MME_uc003fad.1_Missense_Mutation_p.N514I|MME_uc003fae.1_Missense_Mutation_p.N514I	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	514	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)													---	---	---	---
TIPARP	25976	broad.mit.edu	37	3	156395626	156395626	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156395626G>A	uc003fav.2	+	2	388	c.140G>A	c.(139-141)AGA>AAA	p.R47K	LOC100287227_uc011boq.1_5'Flank|TIPARP_uc003faw.2_Missense_Mutation_p.R47K	NM_015508	NP_056323	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	47							NAD+ ADP-ribosyltransferase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|breast(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
SKIL	6498	broad.mit.edu	37	3	170102413	170102413	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170102413C>T	uc003fgu.2	+	4	2001	c.1289C>T	c.(1288-1290)GCA>GTA	p.A430V	SKIL_uc011bps.1_Missense_Mutation_p.A410V|SKIL_uc003fgv.2_Missense_Mutation_p.A430V|SKIL_uc003fgw.2_Missense_Mutation_p.A430V	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	430					cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	A	A	rs121913287		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178916876G>A	uc003fjk.2	+	2	420	c.263G>A	c.(262-264)CGA>CAA	p.R88Q		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	88	PI3K-ABD.		R -> Q (in cancer; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R88Q(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			R88Q(SKUT1_SOFT_TISSUE)|R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SNGM_ENDOMETRIUM)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178952074	178952074	+	Missense_Mutation	SNP	G	T	T	rs121913283		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952074G>T	uc003fjk.2	+	21	3286	c.3129G>T	c.(3127-3129)ATG>ATT	p.M1043I		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1043	PI3K/PI4K.		M -> I (in cancer; shows an increase in lipid kinase activity).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.M1043I(33)|p.M1043V(14)|p.M1043T(3)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)				57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
MUC20	200958	broad.mit.edu	37	3	195453120	195453120	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195453120C>A	uc010hzo.2	+	3	1259	c.1133C>A	c.(1132-1134)GCA>GAA	p.A378E	MUC20_uc010hzp.2_Missense_Mutation_p.A343E|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	549	Involved in oligomerization.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)														---	---	---	---
PDE6B	5158	broad.mit.edu	37	4	657555	657555	+	Intron	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:657555G>A	uc003gap.2	+						PDE6B_uc003gao.3_Intron|PDE6B_uc011buy.1_Intron|PDE6B_uc011buz.1_Intron	NM_000283	NP_000274			phosphodiesterase 6B isoform 1						cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0																		---	---	---	---
MSX1	4487	broad.mit.edu	37	4	4864504	4864504	+	Silent	SNP	G	A	A	rs140353960		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4864504G>A	uc003gif.2	+	2	781	c.546G>A	c.(544-546)GCG>GCA	p.A182A		NM_002448	NP_002439	P28360	MSX1_HUMAN	msh homeobox 1	176	Homeobox.				apoptotic nuclear change|face morphogenesis|negative regulation of cell growth|odontogenesis of dentine-containing tooth|positive regulation of apoptosis|protein localization to nucleus|protein stabilization	nucleus	p53 binding|sequence-specific DNA binding transcription factor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)														---	---	---	---
MAN2B2	23324	broad.mit.edu	37	4	6602463	6602463	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6602463G>A	uc003gjf.1	+	10	1555	c.1519G>A	c.(1519-1521)GGC>AGC	p.G507S	MAN2B2_uc003gje.1_Missense_Mutation_p.G507S|MAN2B2_uc011bwf.1_Missense_Mutation_p.G456S	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	507					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2																		---	---	---	---
ATP8A1	10396	broad.mit.edu	37	4	42414995	42414995	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42414995C>T	uc003gwr.2	-	37	3665	c.3433G>A	c.(3433-3435)GTT>ATT	p.V1145I	ATP8A1_uc003gwq.2_Missense_Mutation_p.V371I|ATP8A1_uc003gws.2_Missense_Mutation_p.V1130I	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	1145	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)													---	---	---	---
SYNPO2	171024	broad.mit.edu	37	4	119978661	119978661	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119978661G>A	uc010inb.2	+	5	3554	c.3358G>A	c.(3358-3360)GAT>AAT	p.D1120N	SYNPO2_uc011cgh.1_Silent_p.P121P|SYNPO2_uc010inc.2_Missense_Mutation_p.D990N	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2																		---	---	---	---
FHDC1	85462	broad.mit.edu	37	4	153897817	153897817	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153897817G>A	uc003inf.2	+	11	3449	c.3374G>A	c.(3373-3375)CGT>CAT	p.R1125H		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	1125					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)																	---	---	---	---
AGA	175	broad.mit.edu	37	4	178358635	178358635	+	Nonsense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178358635G>T	uc003iuu.1	-	5	608	c.546C>A	c.(544-546)TAC>TAA	p.Y182*	AGA_uc010irt.1_5'Flank|AGA_uc003iuv.1_Nonsense_Mutation_p.Y86*|AGA_uc003iuw.2_Nonsense_Mutation_p.Y86*	NM_000027	NP_000018	P20933	ASPG_HUMAN	aspartylglucosaminidase precursor	182					asparagine catabolic process via L-aspartate|protein deglycosylation|protein maturation	endoplasmic reticulum|intermediate filament cytoskeleton|lysosome|microtubule cytoskeleton	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)														---	---	---	---
KIAA0947	23379	broad.mit.edu	37	5	5463516	5463516	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5463516G>T	uc003jdm.3	+	13	4291	c.4069G>T	c.(4069-4071)GAT>TAT	p.D1357Y		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1357										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11199625	11199625	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11199625C>A	uc003jfa.1	-	11	2055	c.1910G>T	c.(1909-1911)GGC>GTC	p.G637V	CTNND2_uc010itt.2_Missense_Mutation_p.G546V|CTNND2_uc011cmy.1_Missense_Mutation_p.G300V|CTNND2_uc011cmz.1_Missense_Mutation_p.G204V|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.G204V	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	637	ARM 4.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21755818	21755818	+	Silent	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21755818G>T	uc010iuc.2	-	11	2225	c.1767C>A	c.(1765-1767)GTC>GTA	p.V589V	CDH12_uc011cno.1_Silent_p.V549V|CDH12_uc003jgk.2_Silent_p.V589V|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	589	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
NNT	23530	broad.mit.edu	37	5	43656015	43656015	+	Silent	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43656015T>G	uc003joe.2	+	15	2388	c.2133T>G	c.(2131-2133)GGT>GGG	p.G711G	NNT_uc003jof.2_Silent_p.G711G	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	711	Helical; (Potential).				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)													---	---	---	---
TMEM171	134285	broad.mit.edu	37	5	72424237	72424237	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72424237C>T	uc003kcm.2	+	3	865	c.661C>T	c.(661-663)CCA>TCA	p.P221S	TMEM171_uc003kcn.3_Missense_Mutation_p.P221S	NM_173490	NP_775761	Q8WVE6	TM171_HUMAN	transmembrane protein 171 isoform 1	221						integral to membrane					0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)														---	---	---	---
PCDHA2	56146	broad.mit.edu	37	5	140175138	140175138	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140175138G>A	uc003lhd.2	+	1	695	c.589G>A	c.(589-591)GGG>AGG	p.G197R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.G197R|PCDHA2_uc011czy.1_Missense_Mutation_p.G197R	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	197	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA4	56144	broad.mit.edu	37	5	140188221	140188221	+	Silent	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188221C>T	uc003lhi.2	+	1	1550	c.1449C>T	c.(1447-1449)GAC>GAT	p.D483D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.D483D|PCDHA4_uc011daa.1_Silent_p.D483D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	483	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
ITK	3702	broad.mit.edu	37	5	156667170	156667170	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156667170C>G	uc003lwo.1	+	10	1032	c.950C>G	c.(949-951)CCT>CGT	p.P317R		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	317	SH2.				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)					T	SYK	peripheral T-cell lymphoma								---	---	---	---
GABRG2	2566	broad.mit.edu	37	5	161522503	161522503	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161522503A>C	uc003lyz.3	+	3	620	c.262A>C	c.(262-264)AAG>CAG	p.K88Q	GABRG2_uc010jjc.2_Missense_Mutation_p.K88Q|GABRG2_uc003lyy.3_Missense_Mutation_p.K88Q|GABRG2_uc011dej.1_5'UTR	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	88	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)														---	---	---	---
NCR2	9436	broad.mit.edu	37	6	41304116	41304116	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41304116C>A	uc003oqh.2	+	2	431	c.344C>A	c.(343-345)TCT>TAT	p.S115Y	NCR2_uc003oqi.2_Missense_Mutation_p.S115Y|NCR2_uc003oqj.2_Missense_Mutation_p.S115Y	NM_004828	NP_004819	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	115	Extracellular (Potential).|Ig-like.				cellular defense response	integral to plasma membrane	transmembrane receptor activity			ovary(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)																	---	---	---	---
HSP90AB1	3326	broad.mit.edu	37	6	44219805	44219805	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44219805T>C	uc003oxa.1	+	10	1616	c.1532T>C	c.(1531-1533)GTA>GCA	p.V511A	HSP90AB1_uc011dvr.1_Missense_Mutation_p.V501A|HSP90AB1_uc003oxb.1_Missense_Mutation_p.V511A|HSP90AB1_uc011dvs.1_Missense_Mutation_p.V331A|HSP90AB1_uc003oxc.1_Missense_Mutation_p.V149A	NM_007355	NP_031381	P08238	HS90B_HUMAN	heat shock 90kDa protein 1, beta	511					axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding			lung(3)|breast(1)	4	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
ZNF292	23036	broad.mit.edu	37	6	87971005	87971005	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87971005C>T	uc003plm.3	+	8	7699	c.7658C>T	c.(7657-7659)GCA>GTA	p.A2553V		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2553					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)														---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90459388	90459388	+	Silent	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90459388C>T	uc003pnn.1	-	25	3605	c.3489G>A	c.(3487-3489)GCG>GCA	p.A1163A		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1163					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
C6orf204	387119	broad.mit.edu	37	6	118887330	118887330	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118887330T>G	uc003pxz.1	-	3	970	c.382A>C	c.(382-384)AGC>CGC	p.S128R	C6orf204_uc003pya.1_Missense_Mutation_p.S131R|C6orf204_uc003pyb.2_Missense_Mutation_p.S128R|C6orf204_uc011ebj.1_Missense_Mutation_p.S26R|C6orf204_uc003pyc.2_Missense_Mutation_p.S131R|C6orf204_uc011ebl.1_Missense_Mutation_p.S26R	NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a	128						centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)														---	---	---	---
RNF217	154214	broad.mit.edu	37	6	125397843	125397843	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125397843G>T	uc003pzs.2	+	6	784	c.446G>T	c.(445-447)TGC>TTC	p.C149F	RNF217_uc003pzr.2_Missense_Mutation_p.C206F|RNF217_uc003pzt.2_RNA	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217	149	RING-type.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)														---	---	---	---
NCOA7	135112	broad.mit.edu	37	6	126243818	126243818	+	Intron	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126243818G>A	uc010kes.2	+						NCOA7_uc003qae.3_Intron|NCOA7_uc003qah.2_Intron|NCOA7_uc003qai.2_Intron|NCOA7_uc010ket.2_Intron|NCOA7_uc003qak.2_Intron	NM_181782	NP_861447			nuclear receptor coactivator 7 isoform 1						cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)														---	---	---	---
MPP6	51678	broad.mit.edu	37	7	24681385	24681385	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24681385C>G	uc003swx.2	+	4	467	c.168C>G	c.(166-168)AAC>AAG	p.N56K	MPP6_uc003swy.2_Missense_Mutation_p.N56K	NM_016447	NP_057531	Q9NZW5	MPP6_HUMAN	membrane protein, palmitoylated 6	56	L27 2.				protein complex assembly		protein binding				0																		---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104377336	104377336	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104377336G>T	uc003vce.2	+	2	784	c.660G>T	c.(658-660)GAG>GAT	p.E220D	LHFPL3_uc003vcf.2_Missense_Mutation_p.E220D	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	206						integral to membrane					0																		---	---	---	---
ASB15	142685	broad.mit.edu	37	7	123276952	123276952	+	Nonsense_Mutation	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123276952A>T	uc003vku.1	+	12	1976	c.1684A>T	c.(1684-1686)AAG>TAG	p.K562*	ASB15_uc003vkw.1_Nonsense_Mutation_p.K562*	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	562	SOCS box.				intracellular signal transduction					skin(2)|lung(1)	3																		---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2820858	2820858	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2820858G>A	uc011kwk.1	-	60	9733	c.9343C>T	c.(9343-9345)CGC>TGC	p.R3115C	CSMD1_uc011kwj.1_Missense_Mutation_p.R2444C|CSMD1_uc010lrg.2_Missense_Mutation_p.R1006C	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	3115	Sushi 25.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
BLK	640	broad.mit.edu	37	8	11403589	11403589	+	Missense_Mutation	SNP	C	T	T	rs140188373		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11403589C>T	uc003wty.2	+	3	733	c.152C>T	c.(151-153)CCG>CTG	p.P51L	BLK_uc003wtz.2_5'UTR	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	51					intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---
C8orf58	541565	broad.mit.edu	37	8	22459490	22459490	+	Silent	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22459490C>T	uc003xce.2	+	4	775	c.663C>T	c.(661-663)CCC>CCT	p.P221P	C8orf58_uc011kzl.1_Silent_p.P221P|C8orf58_uc003xcf.2_Silent_p.P221P|KIAA1967_uc003xch.2_5'Flank	NM_001013842	NP_001013864	Q8NAV2	CH058_HUMAN	hypothetical protein LOC541565	221										skin(1)	1		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38704287	38704287	+	Missense_Mutation	SNP	C	T	T	rs149836912		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38704287C>T	uc010lwp.2	+	12	2678	c.2299C>T	c.(2299-2301)CGC>TGC	p.R767C	TACC1_uc003xma.2_Missense_Mutation_p.R205C|TACC1_uc003xlz.2_Missense_Mutation_p.R572C|TACC1_uc003xmc.3_Missense_Mutation_p.R571C|TACC1_uc011lbz.1_Missense_Mutation_p.R754C|TACC1_uc003xmb.3_Missense_Mutation_p.R693C|TACC1_uc003xmf.3_Missense_Mutation_p.R357C|TACC1_uc011lca.1_Missense_Mutation_p.R750C|TACC1_uc011lcb.1_Missense_Mutation_p.R543C|TACC1_uc011lcd.1_RNA|TACC1_uc003xmh.3_Missense_Mutation_p.R584C|TACC1_uc010lwq.2_Missense_Mutation_p.R583C	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing	767	|Interaction with CH-TOG.				cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
IMPAD1	54928	broad.mit.edu	37	8	57905926	57905926	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57905926G>A	uc003xte.3	-	1	502	c.219C>T	c.(217-219)GCC>GCT	p.A73A		NM_017813	NP_060283	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	73						Golgi apparatus|integral to membrane	inositol-1(or 4)-monophosphatase activity|metal ion binding			ovary(1)	1		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)																---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69046341	69046341	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69046341G>T	uc003xxv.1	+	32	3841	c.3814G>T	c.(3814-3816)GTG>TTG	p.V1272L		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1272					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PDP1	54704	broad.mit.edu	37	8	94935067	94935067	+	Silent	SNP	C	T	T	rs140224111		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94935067C>T	uc003yge.2	+	2	1049	c.780C>T	c.(778-780)CTC>CTT	p.L260L	PDP1_uc003ygf.2_Silent_p.L285L|PDP1_uc010max.2_Silent_p.L285L|PDP1_uc011lgm.1_Silent_p.L260L|PDP1_uc011lgn.1_Silent_p.L319L	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic	260					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
DCAF13	25879	broad.mit.edu	37	8	104427608	104427608	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104427608G>A	uc003yln.2	+	1	667	c.390G>A	c.(388-390)GGG>GGA	p.G130G	SLC25A32_uc003yll.2_5'Flank|SLC25A32_uc011lhr.1_5'Flank|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	Error:Variant_position_missing_in_Q9NV06_after_alignment					rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1																		---	---	---	---
TRPS1	7227	broad.mit.edu	37	8	116617160	116617160	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116617160A>C	uc003ynz.2	-	3	1456	c.997T>G	c.(997-999)TTC>GTC	p.F333V	TRPS1_uc011lhy.1_Missense_Mutation_p.F337V|TRPS1_uc003yny.2_Missense_Mutation_p.F346V|TRPS1_uc010mcy.2_Missense_Mutation_p.F333V	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	333	C2H2-type 2; atypical.				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)											Langer-Giedion_syndrome				---	---	---	---
VPS13A	23230	broad.mit.edu	37	9	79933352	79933352	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79933352G>A	uc004akr.2	+	41	5418	c.5158G>A	c.(5158-5160)GAG>AAG	p.E1720K	VPS13A_uc004akp.3_Missense_Mutation_p.E1720K|VPS13A_uc004akq.3_Missense_Mutation_p.E1720K|VPS13A_uc004aks.2_Missense_Mutation_p.E1681K|VPS13A_uc004akt.2_Missense_Mutation_p.E60K|VPS13A_uc010mpo.1_Missense_Mutation_p.E316K	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	1720					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10																		---	---	---	---
NR4A3	8013	broad.mit.edu	37	9	102590479	102590479	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102590479C>A	uc004baf.1	+	3	884	c.155C>A	c.(154-156)ACC>AAC	p.T52N	NR4A3_uc004bae.2_Missense_Mutation_p.T52N|NR4A3_uc004bag.1_Missense_Mutation_p.T52N|NR4A3_uc004bai.2_Missense_Mutation_p.T63N	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	52					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)						T	EWSR1	extraskeletal myxoid chondrosarcoma								---	---	---	---
ZBTB26	57684	broad.mit.edu	37	9	125681219	125681219	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125681219C>T	uc004bnj.2	-	2	1207	c.995G>A	c.(994-996)GGG>GAG	p.G332E	ZBTB26_uc004bnk.2_Missense_Mutation_p.G332E	NM_020924	NP_065975	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	332	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
STAM	8027	broad.mit.edu	37	10	17735260	17735260	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17735260A>C	uc001ipj.1	+	6	700	c.484A>C	c.(484-486)AAG>CAG	p.K162Q	STAM_uc010qcf.1_Missense_Mutation_p.K51Q|STAM_uc009xjw.1_5'Flank	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	162					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2																		---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26482178	26482178	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26482178C>T	uc001isn.2	+	32	4843	c.4483C>T	c.(4483-4485)CGA>TGA	p.R1495*	MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1495					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---
KIAA0913	23053	broad.mit.edu	37	10	75556659	75556659	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75556659C>T	uc009xrl.2	+	16	3178	c.3146C>T	c.(3145-3147)GCC>GTC	p.A1049V	KIAA0913_uc001jve.2_Missense_Mutation_p.A1054V|KIAA0913_uc001jvf.2_Missense_Mutation_p.A1049V|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.A484V|KIAA0913_uc010qkr.1_Missense_Mutation_p.A472V|KIAA0913_uc001jvj.2_Missense_Mutation_p.A472V|KIAA0913_uc009xrn.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	1049							zinc ion binding			breast(1)	1	Prostate(51;0.0112)																	---	---	---	---
PTEN	5728	broad.mit.edu	37	10	89692893	89692893	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89692893C>A	uc001kfb.2	+	6	1408	c.377C>A	c.(376-378)GCT>GAT	p.A126D		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	126	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.A126T(5)|p.R55fs*1(4)|p.A126D(3)|p.?(2)|p.Y27fs*1(2)|p.A126P(2)|p.Y27_N212>Y(2)|p.A121_F145del(1)|p.A126V(1)|p.A126S(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)			31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			---	---	---	---
PPRC1	23082	broad.mit.edu	37	10	103909733	103909733	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909733T>C	uc001kum.2	+	14	4981	c.4942T>C	c.(4942-4944)TCT>CCT	p.S1648P	PPRC1_uc001kun.2_Missense_Mutation_p.S1526P|PPRC1_uc010qqj.1_Missense_Mutation_p.S1384P|PPRC1_uc009xxa.2_RNA|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	1648					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)														---	---	---	---
LRDD	55367	broad.mit.edu	37	11	799981	799981	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:799981C>G	uc001lro.1	-	15	2450	c.2308G>C	c.(2308-2310)GCT>CCT	p.A770P	SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Missense_Mutation_p.A753P|LRDD_uc001lrl.1_Missense_Mutation_p.A613P|LRDD_uc001lrm.1_Missense_Mutation_p.A457P|LRDD_uc001lrn.1_Missense_Mutation_p.A613P|LRDD_uc001lrp.1_Silent_p.G453G	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	770					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1279575	1279575	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1279575C>T	uc009ycr.1	+	65	17708	c.17582C>T	c.(17581-17583)TCG>TTG	p.S5861L	MUC5B_uc001ltb.2_Missense_Mutation_p.S5527L	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5524	VWFC 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
CTSD	1509	broad.mit.edu	37	11	1776147	1776147	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1776147G>A	uc001luc.1	-	6	949	c.816C>T	c.(814-816)GTC>GTT	p.V272V	CTSD_uc009yda.1_RNA	NM_001909	NP_001900	P07339	CATD_HUMAN	cathepsin D preproprotein	272					cell death|proteolysis	extracellular space|lysosome|melanosome	aspartic-type endopeptidase activity				0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
MRPL23	6150	broad.mit.edu	37	11	1973350	1973350	+	Intron	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1973350C>T	uc001lux.2	+							NM_021134	NP_066957			mitochondrial ribosomal protein L23						translation	mitochondrial large ribosomal subunit	nucleotide binding|RNA binding|structural constituent of ribosome			large_intestine(2)|ovary(1)	3		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)														---	---	---	---
C11orf94	143678	broad.mit.edu	37	11	45928464	45928464	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45928464G>T	uc001nbs.3	-	2	168	c.131C>A	c.(130-132)TCC>TAC	p.S44Y		NM_001080446	NP_001073915	C9JXX5	CK094_HUMAN	hypothetical protein LOC143678	44						extracellular region					0																		---	---	---	---
APLNR	187	broad.mit.edu	37	11	57003375	57003375	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57003375T>A	uc001njo.2	-	1	1553	c.1104A>T	c.(1102-1104)AAA>AAT	p.K368N	APLNR_uc001njn.3_RNA	NM_005161	NP_005152	P35414	APJ_HUMAN	apelin receptor	368	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6																		---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26818914	26818914	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26818914G>T	uc001rhg.2	-	14	1897	c.1480C>A	c.(1480-1482)CTG>ATG	p.L494M		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	494	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117665383	117665383	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117665383C>T	uc001twm.1	-	23	4155	c.3469G>A	c.(3469-3471)GAG>AAG	p.E1157K		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1157	FAD-binding FR-type.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36124666	36124666	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36124666G>A	uc001uvb.2	+	42	6844	c.6638G>A	c.(6637-6639)CGA>CAA	p.R2213Q	NBEA_uc010abi.2_Missense_Mutation_p.R869Q|NBEA_uc010tee.1_Missense_Mutation_p.R6Q|NBEA_uc010tef.1_Missense_Mutation_p.R6Q|NBEA_uc010teg.1_Missense_Mutation_p.R6Q	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2213						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70275859	70275859	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70275859C>T	uc001vip.2	-	11	3016	c.2222G>A	c.(2221-2223)TGT>TAT	p.C741Y	KLHL1_uc010thm.1_Missense_Mutation_p.C680Y	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	741	Kelch 6.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)														---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101747983	101747983	+	Silent	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101747983A>G	uc001vox.1	-	28	3400	c.3211T>C	c.(3211-3213)TTA>CTA	p.L1071L		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1071	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
BAG5	9529	broad.mit.edu	37	14	104027227	104027227	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104027227A>G	uc001yni.1	-	2	509	c.275T>C	c.(274-276)ATT>ACT	p.I92T	KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Missense_Mutation_p.I133T|BAG5_uc001ynj.1_Missense_Mutation_p.I92T|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	NM_004873	NP_004864	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5 isoform b	92					apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding			ovary(2)	2		Melanoma(154;0.155)	Epithelial(46;0.144)															---	---	---	---
INF2	64423	broad.mit.edu	37	14	105207057	105207057	+	Intron	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105207057G>A	uc010tyi.1	+						ADSSL1_uc001ypd.2_Intron|ADSSL1_uc001ype.2_Intron|ADSSL1_uc001ypf.2_Intron	NM_022489	NP_071934			inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)														---	---	---	---
BUB1B	701	broad.mit.edu	37	15	40462775	40462775	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40462775G>A	uc001zkx.3	+	4	489	c.277G>A	c.(277-279)GGG>AGG	p.G93R		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	93	BUB1 N-terminal.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)				Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
ATP8B4	79895	broad.mit.edu	37	15	50152452	50152452	+	Nonsense_Mutation	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50152452A>T	uc001zxu.2	-	28	3660	c.3518T>A	c.(3517-3519)TTA>TAA	p.L1173*	ATP8B4_uc010ber.2_Nonsense_Mutation_p.L1046*|ATP8B4_uc010ufd.1_Nonsense_Mutation_p.L983*|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Nonsense_Mutation_p.L176*	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	1173	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)														---	---	---	---
MAP2K1	5604	broad.mit.edu	37	15	66774131	66774131	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66774131G>A	uc010bhq.2	+	6	1082	c.607G>A	c.(607-609)GAG>AAG	p.E203K	MAP2K1_uc010ujp.1_Missense_Mutation_p.E181K	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	203	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0														Cardiofaciocutaneous_syndrome				---	---	---	---
MEX3B	84206	broad.mit.edu	37	15	82335987	82335987	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82335987G>A	uc002bgq.1	-	2	1539	c.1224C>T	c.(1222-1224)TCC>TCT	p.S408S		NM_032246	NP_115622	Q6ZN04	MEX3B_HUMAN	mex-3 homolog B	408					protein autophosphorylation	cytoplasmic mRNA processing body|nucleus	calcium ion binding|RNA binding|zinc ion binding			breast(1)|kidney(1)	2																		---	---	---	---
SSTR5	6755	broad.mit.edu	37	16	1129558	1129558	+	Silent	SNP	G	A	A	rs150799381		TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1129558G>A	uc002ckq.2	+	1	778	c.690G>A	c.(688-690)GCG>GCA	p.A230A	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	230	Cytoplasmic (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)													---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2350053	2350053	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2350053C>T	uc002cpy.1	-	13	2276	c.1564G>A	c.(1564-1566)GAG>AAG	p.E522K	ABCA3_uc010bsk.1_Missense_Mutation_p.E464K|ABCA3_uc010bsl.1_Missense_Mutation_p.E522K	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	522					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
PRPF8	10594	broad.mit.edu	37	17	1577953	1577953	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1577953A>T	uc002fte.2	-	21	3196	c.3082T>A	c.(3082-3084)TAT>AAT	p.Y1028N		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1028						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)														---	---	---	---
MYH1	4619	broad.mit.edu	37	17	10397924	10397924	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10397924G>A	uc002gmo.2	-	38	5627	c.5533C>T	c.(5533-5535)CGC>TGC	p.R1845C	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1845	Potential.			R -> H (in Ref. 4; CAA27380).		muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---
CDRT1	374286	broad.mit.edu	37	17	15522558	15522558	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15522558G>A	uc002gov.3	-	1	461	c.269C>T	c.(268-270)TCC>TTC	p.S90F	TRIM16_uc002gor.1_Intron	NM_006382	NP_006373	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	90											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)														---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26101464	26101464	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26101464G>A	uc002gzu.2	-	12	1559	c.1295C>T	c.(1294-1296)ACC>ATC	p.T432I	NOS2_uc010crh.1_Missense_Mutation_p.T432I|NOS2_uc010wab.1_Missense_Mutation_p.T432I	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	432					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
HOXB9	3219	broad.mit.edu	37	17	46700468	46700468	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46700468G>A	uc002inx.2	-	2	751	c.547C>T	c.(547-549)CGC>TGC	p.R183C		NM_024017	NP_076922	P17482	HXB9_HUMAN	homeobox B9	183					canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
MRC2	9902	broad.mit.edu	37	17	60769610	60769610	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60769610C>T	uc002jad.2	+	30	4640	c.4238C>T	c.(4237-4239)GCG>GTG	p.A1413V	MRC2_uc002jae.2_Missense_Mutation_p.A484V|MRC2_uc002jaf.2_Missense_Mutation_p.A279V	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1413	Extracellular (Potential).				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	480756	480756	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:480756G>A	uc002kkm.2	-	2	224	c.9C>T	c.(7-9)GAC>GAT	p.D3D		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	3	Cytoplasmic (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8076563	8076563	+	Splice_Site	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8076563G>T	uc002knn.3	+	9	2054	c.1551_splice	c.e9+1	p.E517_splice	PTPRM_uc010dkv.2_Splice_Site_p.E517_splice|PTPRM_uc010wzl.1_Splice_Site_p.E304_splice	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
MIB1	57534	broad.mit.edu	37	18	19383901	19383901	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19383901C>T	uc002ktq.2	+	10	1405	c.1405C>T	c.(1405-1407)CAA>TAA	p.Q469*	MIB1_uc002ktp.2_Nonsense_Mutation_p.Q108*	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	469	ANK 2.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)															---	---	---	---
ASXL3	80816	broad.mit.edu	37	18	31325922	31325922	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31325922C>T	uc010dmg.1	+	12	6165	c.6110C>T	c.(6109-6111)CCA>CTA	p.P2037L	ASXL3_uc002kxq.2_Missense_Mutation_p.P1744L	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	2037	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
TCEB3C	162699	broad.mit.edu	37	18	44555102	44555102	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44555102G>A	uc010xdb.1	-	1	1348	c.1112C>T	c.(1111-1113)ACG>ATG	p.T371M	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	371	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0																		---	---	---	---
POLI	11201	broad.mit.edu	37	18	51813768	51813768	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51813768G>A	uc002lfj.3	+	8	1253	c.1185G>A	c.(1183-1185)CAG>CAA	p.Q395Q	POLI_uc010xds.1_Silent_p.Q316Q|POLI_uc002lfk.3_Silent_p.Q292Q|POLI_uc010dpg.2_5'UTR	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	395					DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
ELAVL3	1995	broad.mit.edu	37	19	11565632	11565632	+	Silent	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565632C>T	uc002mry.1	-	7	1193	c.813G>A	c.(811-813)GCG>GCA	p.A271A	ELAVL3_uc002mrx.1_Silent_p.A264A	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	271					cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
C19orf57	79173	broad.mit.edu	37	19	14015710	14015710	+	5'UTR	SNP	T	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14015710T>C	uc002mxl.1	-	2					CC2D1A_uc002mxn.2_5'Flank|CC2D1A_uc002mxo.2_5'Flank|CC2D1A_uc002mxp.2_5'Flank|C19orf57_uc002mxm.1_5'UTR	NM_024323	NP_077299			hypothetical protein LOC79173						multicellular organismal development		protein binding			ovary(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(19;2e-21)															---	---	---	---
GTPBP3	84705	broad.mit.edu	37	19	17450345	17450345	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17450345C>T	uc010eas.2	+	7	976	c.911C>T	c.(910-912)ACG>ATG	p.T304M	GTPBP3_uc010xpo.1_Missense_Mutation_p.T326M|GTPBP3_uc010ear.1_RNA|GTPBP3_uc002ngh.3_Missense_Mutation_p.T304M|GTPBP3_uc002ngg.3_Missense_Mutation_p.T336M|GTPBP3_uc002ngi.3_Translation_Start_Site	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V	304	GTP (Potential).				tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
ANKRD27	84079	broad.mit.edu	37	19	33090904	33090904	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33090904G>A	uc002ntn.1	-	27	2976	c.2820C>T	c.(2818-2820)TAC>TAT	p.Y940Y		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	940					early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)																	---	---	---	---
CD22	933	broad.mit.edu	37	19	35823667	35823667	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35823667G>A	uc010edt.2	+	3	329	c.252G>A	c.(250-252)AAG>AAA	p.K84K	CD22_uc010xst.1_5'UTR|CD22_uc010edu.2_Silent_p.K84K|CD22_uc010edv.2_Silent_p.K84K|CD22_uc002nzb.3_Silent_p.K84K	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	84	Extracellular (Potential).|Ig-like V-type.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)													---	---	---	---
KIR3DL1	3811	broad.mit.edu	37	19	55330051	55330051	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55330051A>C	uc002qhk.3	+	3	415	c.352A>C	c.(352-354)ACA>CCA	p.T118P	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.T60P|KIR3DL1_uc010esf.2_Intron|KIR3DL1_uc010yfo.1_Missense_Mutation_p.T60P|KIR3DL1_uc002qhl.3_Missense_Mutation_p.T118P	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	118	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)														---	---	---	---
ZFP28	140612	broad.mit.edu	37	19	57058966	57058966	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57058966G>C	uc002qnj.2	+	3	461	c.390G>C	c.(388-390)AAG>AAC	p.K130N	ZFP28_uc002qni.2_Missense_Mutation_p.K130N|uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	130	KRAB 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)														---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57328826	57328826	+	Silent	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328826C>T	uc002qnu.2	-	7	1335	c.984G>A	c.(982-984)TCG>TCA	p.S328S	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.S299S|PEG3_uc002qnv.2_Silent_p.S328S|PEG3_uc002qnw.2_Silent_p.S204S|PEG3_uc002qnx.2_Silent_p.S202S|PEG3_uc010etr.2_Silent_p.S328S	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	328					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57335782	57335782	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57335782G>A	uc002qnu.2	-	1	593	c.242C>T	c.(241-243)ACC>ATC	p.T81I	ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnr.2_5'UTR|ZIM2_uc002qnq.2_5'UTR|ZIM2_uc010etp.2_5'UTR|ZIM2_uc010ygs.1_5'UTR|PEG3_uc002qnt.2_Missense_Mutation_p.T81I|PEG3_uc002qnv.2_Missense_Mutation_p.T81I|PEG3_uc002qnw.2_5'UTR|PEG3_uc002qnx.2_5'UTR|PEG3_uc010etr.2_Missense_Mutation_p.T81I	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	81	SCAN box.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
ZNF324	25799	broad.mit.edu	37	19	58982663	58982663	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58982663G>C	uc002qsw.1	+	4	898	c.804G>C	c.(802-804)AAG>AAC	p.K268N	ZNF324_uc002qsx.1_Missense_Mutation_p.K45N	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	268	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1902326	1902326	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902326G>A	uc002wfq.2	+	4	1082	c.722G>A	c.(721-723)CGT>CAT	p.R241H	SIRPA_uc010zps.1_Missense_Mutation_p.R221H|SIRPA_uc002wfr.2_Missense_Mutation_p.R241H|SIRPA_uc002wfs.2_Missense_Mutation_p.R241H|SIRPA_uc002wft.2_Missense_Mutation_p.R241H	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	241	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
ZHX3	23051	broad.mit.edu	37	20	39832021	39832021	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39832021G>A	uc002xjs.1	-	3	1914	c.1536C>T	c.(1534-1536)AGC>AGT	p.S512S	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Silent_p.S512S|ZHX3_uc002xjt.1_Silent_p.S512S|ZHX3_uc002xju.1_Silent_p.S512S|ZHX3_uc002xjv.1_Silent_p.S512S|ZHX3_uc002xjw.1_Silent_p.S512S|ZHX3_uc010ggg.1_Silent_p.S512S	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	512	Required for nuclear localization.|Homeobox 2.				negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)																---	---	---	---
DNTTIP1	116092	broad.mit.edu	37	20	44430674	44430674	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44430674G>A	uc002xpk.2	+	7	603	c.535G>A	c.(535-537)GAC>AAC	p.D179N		NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting	179						nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45852980	45852980	+	Nonsense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45852980G>T	uc002xta.1	-	19	3440	c.3186C>A	c.(3184-3186)TGC>TGA	p.C1062*	ZMYND8_uc010ghq.1_Nonsense_Mutation_p.C693*|ZMYND8_uc010ghr.1_Nonsense_Mutation_p.C964*|ZMYND8_uc002xst.1_Nonsense_Mutation_p.C944*|ZMYND8_uc002xsu.1_Nonsense_Mutation_p.C935*|ZMYND8_uc002xsv.1_Nonsense_Mutation_p.C990*|ZMYND8_uc002xsw.1_Nonsense_Mutation_p.C768*|ZMYND8_uc002xsx.1_Nonsense_Mutation_p.C768*|ZMYND8_uc002xsy.1_Nonsense_Mutation_p.C991*|ZMYND8_uc002xsz.1_Nonsense_Mutation_p.C953*|ZMYND8_uc010zxy.1_Nonsense_Mutation_p.C1089*|ZMYND8_uc002xtb.1_Nonsense_Mutation_p.C1036*|ZMYND8_uc002xss.2_Nonsense_Mutation_p.C1062*|ZMYND8_uc010zxz.1_Nonsense_Mutation_p.C930*|ZMYND8_uc002xtc.1_Nonsense_Mutation_p.C1036*|ZMYND8_uc002xtd.1_Nonsense_Mutation_p.C1011*|ZMYND8_uc002xte.1_Nonsense_Mutation_p.C1016*|ZMYND8_uc010zya.1_Nonsense_Mutation_p.C1062*|ZMYND8_uc002xtf.1_Nonsense_Mutation_p.C1082*|ZMYND8_uc002xsr.1_Nonsense_Mutation_p.C161*	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b	1062	MYND-type.						protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62654204	62654204	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62654204C>T	uc002yho.2	+	13	1910	c.1742C>T	c.(1741-1743)GCG>GTG	p.A581V	PRPF6_uc002yhp.2_Missense_Mutation_p.A581V	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	581	HAT 4.				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45670802	45670802	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45670802A>G	uc002zeg.1	-	10	1284	c.800T>C	c.(799-801)CTG>CCG	p.L267P	DNMT3L_uc002zeh.1_Missense_Mutation_p.L267P	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein	267					DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)														---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47414152	47414152	+	Intron	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47414152C>T	uc002zhu.1	+							NM_001848	NP_001839			collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23029496	23029496	+	RNA	SNP	C	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23029496C>A	uc011aim.1	+	128		c.8135C>A								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30416326	30416326	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30416326C>T	uc003agv.3	+	17	3006	c.2678C>T	c.(2677-2679)CCC>CTC	p.P893L	MTMR3_uc003agu.3_Missense_Mutation_p.P893L|MTMR3_uc003agw.3_Missense_Mutation_p.P893L	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	893					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)															---	---	---	---
PNPLA3	80339	broad.mit.edu	37	22	44335951	44335951	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44335951A>G	uc003bei.1	+	7	1231	c.1058A>G	c.(1057-1059)TAT>TGT	p.Y353C	PNPLA3_uc010gzm.1_RNA	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	353	Lumenal (Potential).				triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)																---	---	---	---
NLGN4X	57502	broad.mit.edu	37	X	5810979	5810979	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5810979T>A	uc010ndh.2	-	6	2831	c.2330A>T	c.(2329-2331)AAC>ATC	p.N777I	NLGN4X_uc004crp.2_Missense_Mutation_p.N797I|NLGN4X_uc004crq.2_Missense_Mutation_p.N777I|NLGN4X_uc010ndi.2_Missense_Mutation_p.N814I|NLGN4X_uc004crr.2_Missense_Mutation_p.N777I|NLGN4X_uc010ndj.2_Missense_Mutation_p.N777I	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	777	Cytoplasmic (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4																		---	---	---	---
SHROOM2	357	broad.mit.edu	37	X	9905737	9905737	+	Intron	SNP	T	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9905737T>C	uc004csu.1	+						SHROOM2_uc004csv.2_Intron|SHROOM2_uc011mic.1_Intron|SHROOM2_uc004csw.1_Intron	NM_001649	NP_001640			apical protein of Xenopus-like						apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)																---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10093130	10093130	+	Silent	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10093130G>A	uc004csx.3	+	14	2091	c.1893G>A	c.(1891-1893)GCG>GCA	p.A631A	WWC3_uc010nds.2_Silent_p.A295A|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	631	C2.									ovary(4)	4																		---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11308531	11308531	+	Intron	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11308531A>C	uc004cup.1	-						ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc010neb.1_Missense_Mutation_p.F9C|ARHGAP6_uc011mif.1_Intron	NM_013427	NP_038286			Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
CLCN5	1184	broad.mit.edu	37	X	49846487	49846487	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49846487G>A	uc004dos.1	+	6	954	c.706G>A	c.(706-708)GAA>AAA	p.E236K	CLCN5_uc004dor.1_Missense_Mutation_p.E306K|CLCN5_uc004doq.1_Missense_Mutation_p.E306K|CLCN5_uc004dot.1_Missense_Mutation_p.E236K	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	236					excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)																	---	---	---	---
ITIH5L	347365	broad.mit.edu	37	X	54823454	54823454	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54823454A>T	uc004dtj.2	-	2	208	c.178T>A	c.(178-180)TTT>ATT	p.F60I		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	60	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6																		---	---	---	---
VSIG4	11326	broad.mit.edu	37	X	65242139	65242139	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65242139T>G	uc004dwh.2	-	8	1293	c.1166A>C	c.(1165-1167)GAG>GCG	p.E389A	VSIG4_uc004dwi.2_Missense_Mutation_p.E295A|VSIG4_uc010nkq.1_3'UTR|VSIG4_uc004dwj.2_3'UTR|VSIG4_uc011moy.1_3'UTR|VSIG4_uc004dwk.2_3'UTR|VSIG4_uc004dwl.2_Intron	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	389	Cytoplasmic (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0																		---	---	---	---
PCDH11X	27328	broad.mit.edu	37	X	91132785	91132785	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91132785G>T	uc004efk.1	+	2	2391	c.1546G>T	c.(1546-1548)GAT>TAT	p.D516Y	PCDH11X_uc004efl.1_Missense_Mutation_p.D516Y|PCDH11X_uc004efo.1_Missense_Mutation_p.D516Y|PCDH11X_uc010nmv.1_Missense_Mutation_p.D516Y|PCDH11X_uc004efm.1_Missense_Mutation_p.D516Y|PCDH11X_uc004efn.1_Missense_Mutation_p.D516Y|PCDH11X_uc004efh.1_Missense_Mutation_p.D516Y|PCDH11X_uc004efj.1_Missense_Mutation_p.D516Y	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	516	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2																		---	---	---	---
SEPT6	23157	broad.mit.edu	37	X	118797643	118797643	+	Intron	SNP	G	A	A			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118797643G>A	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944			septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4																		---	---	---	---
BCORL1	63035	broad.mit.edu	37	X	129185952	129185952	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129185952T>G	uc004evb.1	+	12	4928	c.4814T>G	c.(4813-4815)CTT>CGT	p.L1605R	BCORL1_uc004evc.1_Missense_Mutation_p.L441R	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1605					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7																		---	---	---	---
ELF4	2000	broad.mit.edu	37	X	129205004	129205004	+	Intron	SNP	A	C	C			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129205004A>C	uc004evd.3	-						ELF4_uc004eve.3_Intron	NM_001421	NP_001412			E74-like factor 4						natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1								T	ERG	AML								---	---	---	---
F8	2157	broad.mit.edu	37	X	154088774	154088774	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5577-01	TCGA-D7-5577-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154088774T>G	uc004fmt.2	-	25	7004	c.6833A>C	c.(6832-6834)GAG>GCG	p.E2278A	F8_uc004fms.2_Missense_Mutation_p.E143A	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	2278	F5/8 type C 2.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)													---	---	---	---
