Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CDK11B	984	broad.mit.edu	37	1	1650497	1650498	+	Intron	INS	-	AG	AG	rs111891151		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1650497_1650498insAG	uc001agv.1	-						CDK11B_uc001ags.1_5'Flank|CDK11B_uc001agt.1_5'Flank|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
PLEKHG5	57449	broad.mit.edu	37	1	6526203	6526210	+	3'UTR	DEL	CGTGCTCT	-	-	rs45616733		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6526203_6526210delCGTGCTCT	uc001ano.1	-	22					PLEKHG5_uc001ann.1_3'UTR|PLEKHG5_uc001anq.1_3'UTR|PLEKHG5_uc001anp.1_3'UTR|TNFRSF25_uc001ana.2_5'UTR|TNFRSF25_uc001anb.2_RNA|TNFRSF25_uc001anc.2_RNA|TNFRSF25_uc001and.2_5'UTR|TNFRSF25_uc009vlz.2_RNA|TNFRSF25_uc001ane.2_5'UTR|TNFRSF25_uc001anf.2_5'UTR|TNFRSF25_uc001ang.2_5'UTR|TNFRSF25_uc001anh.2_5'UTR|TNFRSF25_uc001ani.1_5'UTR|PLEKHG5_uc001anj.1_3'UTR|PLEKHG5_uc009vma.1_3'UTR|PLEKHG5_uc010nzr.1_3'UTR|PLEKHG5_uc001ank.1_3'UTR|PLEKHG5_uc009vmb.1_3'UTR|PLEKHG5_uc001anl.1_3'UTR|PLEKHG5_uc001anm.1_3'UTR	NM_001042663	NP_001036128			pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
SRM	6723	broad.mit.edu	37	1	11115324	11115324	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11115324delT	uc001arz.1	-						SRM_uc001ary.1_Intron	NM_003132	NP_003123			spermidine synthase						spermidine biosynthetic process	cytosol	protein homodimerization activity|spermidine synthase activity				0	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)|Spermine(DB00127)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	68708081	68708082	+	IGR	DEL	GT	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68708081_68708082delGT								WLS (9828 upstream) : RPE65 (186425 downstream)																																			---	---	---	---
RABGGTB	5876	broad.mit.edu	37	1	76253045	76253046	+	Intron	INS	-	A	A	rs148783014	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76253045_76253046insA	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|RABGGTB_uc001dha.1_5'Flank|SNORD45A_uc009wbu.1_5'Flank|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573			RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1																		---	---	---	---
DNTTIP2	30836	broad.mit.edu	37	1	94335643	94335644	+	Intron	INS	-	A	A	rs139700012	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94335643_94335644insA	uc001dqf.2	-						DNTTIP2_uc010otm.1_Intron	NM_014597	NP_055412			deoxynucleotidyltransferase, terminal,						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)														---	---	---	---
LRRC39	127495	broad.mit.edu	37	1	100625161	100625162	+	Intron	DEL	CC	-	-	rs7521791		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100625161_100625162delCC	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221			leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186024429	186024429	+	Intron	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186024429delA	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	-	-	rs35817759		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255569_240255571delGGC	uc010pyd.1	+	1	385_387	c.160_162delGGC	c.(160-162)GGCdel	p.G59del	FMN2_uc010pye.1_In_Frame_Del_p.G59del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	59					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
ZNF670	93474	broad.mit.edu	37	1	247202362	247202363	+	Intron	INS	-	T	T	rs66500189		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247202362_247202363insT	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990			zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)															---	---	---	---
CCT7	10574	broad.mit.edu	37	2	73474704	73474704	+	Intron	DEL	T	-	-	rs62149572		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73474704delT	uc002siz.2	+						CCT7_uc002sja.2_Intron|CCT7_uc010yrf.1_Intron|CCT7_uc010feu.2_Intron|CCT7_uc010yrg.1_Intron|CCT7_uc010yrh.1_Intron|CCT7_uc010yri.1_Intron	NM_006429	NP_006420			chaperonin containing TCP1, subunit 7 isoform a						'de novo' posttranslational protein folding		ATP binding|unfolded protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	108519282	108519283	+	IGR	INS	-	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108519282_108519283insA								RGPD4 (10283 upstream) : SLC5A7 (83712 downstream)																																			---	---	---	---
LRP2	4036	broad.mit.edu	37	2	169994159	169994159	+	Intron	DEL	C	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169994159delC	uc002ues.2	-							NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
MLPH	79083	broad.mit.edu	37	2	238419911	238419911	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238419911delT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron	NM_024101	NP_077006			melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)														---	---	---	---
DPPA4	55211	broad.mit.edu	37	3	109050390	109050391	+	Intron	INS	-	AAA	AAA	rs13085565		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109050390_109050391insAAA	uc003dxq.3	-						DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Intron	NM_018189	NP_060659			developmental pluripotency associated 4							nucleus	protein binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
FAM43A	131583	broad.mit.edu	37	3	194408839	194408844	+	3'UTR	DEL	CGTCGC	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194408839_194408844delCGTCGC	uc003fuj.2	+	1						NM_153690	NP_710157			hypothetical protein LOC131583											central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)														---	---	---	---
GBA3	57733	broad.mit.edu	37	4	22749784	22749785	+	Intron	DEL	TA	-	-	rs33941035		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749784_22749785delTA	uc003gqp.3	+						GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Intron	NM_020973	NP_066024			cytosolic beta-glucosidase isoform a						glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0																		---	---	---	---
PRMT10	90826	broad.mit.edu	37	4	148589491	148589492	+	Intron	DEL	TC	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148589491_148589492delTC	uc003ilc.2	-						PRMT10_uc003ild.2_Intron	NM_138364	NP_612373			protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
RXFP1	59350	broad.mit.edu	37	4	159538141	159538141	+	Intron	DEL	A	-	-	rs11329980		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159538141delA	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647			relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)														---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169432467	169432468	+	Intron	DEL	TT	-	-	rs144749749		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169432467_169432468delTT	uc011cjx.1	+						PALLD_uc003iru.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
SLCO4C1	353189	broad.mit.edu	37	5	101596033	101596036	+	Intron	DEL	AAAT	-	-	rs33944821		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101596033_101596036delAAAT	uc003knm.2	-							NM_180991	NP_851322			solute carrier organic anion transporter family,						cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)														---	---	---	---
PKD2L2	27039	broad.mit.edu	37	5	137226241	137226245	+	Frame_Shift_Del	DEL	TACTT	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137226241_137226245delTACTT	uc003lby.2	+	2	159_163	c.103_107delTACTT	c.(103-108)TACTTTfs	p.Y35fs	PKD2L2_uc010jep.1_5'UTR|PKD2L2_uc003lbw.1_Frame_Shift_Del_p.Y35fs|PKD2L2_uc003lbx.2_Frame_Shift_Del_p.Y35fs	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	35_36	Helical; (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
PPARGC1B	133522	broad.mit.edu	37	5	149227267	149227268	+	3'UTR	INS	-	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149227267_149227268insA	uc003lrc.2	+	12					PPARGC1B_uc003lrb.1_3'UTR|PPARGC1B_uc003lrd.2_3'UTR|PPARGC1B_uc003lrf.2_3'UTR|PPARGC1B_uc003lre.1_3'UTR	NM_133263	NP_573570			peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
HLA-DQA1	3117	broad.mit.edu	37	6	32610636	32610637	+	Intron	DEL	TG	-	-	rs34974787		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32610636_32610637delTG	uc003obr.2	+						HLA-DQA1_uc003obs.2_Intron|HLA-DQA1_uc003obt.1_3'UTR|HLA-DQA1_uc003obu.2_Intron	NM_002122	NP_002113			major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0																		---	---	---	---
ZNF451	26036	broad.mit.edu	37	6	57016929	57016930	+	Intron	INS	-	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57016929_57016930insG	uc003pdm.1	+						ZNF451_uc003pdl.2_Intron|ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron	NM_001031623	NP_001026794			zinc finger protein 451 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
PPP3CC	5533	broad.mit.edu	37	8	22368830	22368833	+	Intron	DEL	TCTC	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22368830_22368833delTCTC	uc003xbs.2	+						PPP3CC_uc003xbr.1_Intron|PPP3CC_uc011kzi.1_Intron|PPP3CC_uc003xbt.2_Intron	NM_005605	NP_005596			protein phosphatase 3, catalytic subunit, gamma						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	cytosol	calmodulin binding|metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32612095	32612095	+	Intron	DEL	A	-	-	rs76017751		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32612095delA	uc003xiv.2	+						NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc011lbg.1_Intron|NRG1_uc011lbh.1_Intron|NRG1_uc003xja.2_Intron	NM_013964	NP_039258			neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	68319333	68319333	+	IGR	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68319333delA								ARFGEF1 (63421 upstream) : CPA6 (15073 downstream)																																			---	---	---	---
FBXO43	286151	broad.mit.edu	37	8	101157158	101157158	+	Intron	DEL	A	-	-	rs74811222		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101157158delA	uc003yjd.2	-						FBXO43_uc003yje.2_Intron|FBXO43_uc010mbp.1_Intron	NM_001029860	NP_001025031			F-box protein 43 isoform b						meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	101438867	101438869	+	IGR	DEL	ATT	-	-	rs149654936	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101438867_101438869delATT								RNF19A (116540 upstream) : ANKRD46 (83118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44060286	44060286	+	IGR	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44060286delT								FAM75A6 (429556 upstream) : FAM27C (929950 downstream)																																			---	---	---	---
IARS	3376	broad.mit.edu	37	9	95019266	95019269	+	Intron	DEL	AATT	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95019266_95019269delAATT	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron	NM_013417	NP_038203			isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	97097144	97097144	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97097144delT	uc004auq.1	+											Homo sapiens cDNA FLJ37869 fis, clone BRSSN2017422.																														---	---	---	---
OBP2A	29991	broad.mit.edu	37	9	138438191	138438216	+	Intron	DEL	AGGCTGGCTTCTGACCCCGTGCTCCC	-	-	rs138953269		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138438191_138438216delAGGCTGGCTTCTGACCCCGTGCTCCC	uc004cgb.2	+						OBP2A_uc004cgc.2_Intron|OBP2A_uc010nau.2_Intron|OBP2A_uc010nav.2_Intron	NM_014582	NP_055397			odorant binding protein 2A precursor						response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)														---	---	---	---
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	AA	AA	rs144722232		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insAA	uc001kia.2	-							NM_004969	NP_004960			insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
PIPSL	266971	broad.mit.edu	37	10	95718422	95718422	+	3'UTR	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95718422delT	uc009xuj.2	-	1						NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	98510681	98510681	+	IGR	DEL	A	-	-	rs3179754		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98510681delA								PIK3AP1 (30402 upstream) : MIR607 (77745 downstream)																																			---	---	---	---
NHLRC2	374354	broad.mit.edu	37	10	115636166	115636167	+	Intron	INS	-	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115636166_115636167insT	uc001lax.1	+							NM_198514	NP_940916			NHL repeat containing 2						cell redox homeostasis					ovary(1)	1				Epithelial(162;0.017)|all cancers(201;0.0187)														---	---	---	---
ARHGEF17	9828	broad.mit.edu	37	11	73077164	73077165	+	Intron	INS	-	TG	TG	rs150743209	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077164_73077165insTG	uc001otu.2	+							NM_014786	NP_055601			Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21242746	21242746	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242746delT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron					SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
TFCP2	7024	broad.mit.edu	37	12	51493732	51493732	+	Intron	DEL	T	-	-	rs55976164		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51493732delT	uc001rxw.2	-						TFCP2_uc001rxv.1_Intron|TFCP2_uc009zlx.1_Intron|TFCP2_uc001rxx.2_Intron|TFCP2_uc009zly.1_Intron	NM_005653	NP_005644			transcription factor CP2						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
KRT7	3855	broad.mit.edu	37	12	52631510	52631511	+	Intron	INS	-	TGTGTG	TGTGTG	rs112794441		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52631510_52631511insTGTGTG	uc001saa.1	+						KRT7_uc009zmf.1_Intron	NM_005556	NP_005547			keratin 7						cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)														---	---	---	---
FAM48A	55578	broad.mit.edu	37	13	37607341	37607341	+	Intron	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37607341delA	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc010tes.1_Intron|FAM48A_uc001uwl.1_Intron	NM_001014286	NP_001014308			family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)														---	---	---	---
SECISBP2L	9728	broad.mit.edu	37	15	49285288	49285289	+	Intron	INS	-	AGAGAG	AGAGAG	rs140847057	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49285288_49285289insAGAGAG	uc001zxe.1	-						SECISBP2L_uc001zxd.1_Intron	NM_014701	NP_055516			SECIS binding protein 2-like											breast(1)|skin(1)	2																		---	---	---	---
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190			organic solute transporter beta							integral to membrane|plasma membrane					0																		---	---	---	---
ARRDC4	91947	broad.mit.edu	37	15	98508660	98508661	+	Intron	DEL	CG	-	-	rs28380454	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98508660_98508661delCG	uc010bom.2	+						ARRDC4_uc002bui.3_Intron	NM_183376	NP_899232			arrestin domain containing 4						signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)															---	---	---	---
MLST8	64223	broad.mit.edu	37	16	2255814	2255814	+	Intron	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2255814delA	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_5'UTR|MLST8_uc010uvy.1_5'UTR|MLST8_uc002cpg.2_5'UTR|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_5'UTR	NM_022372	NP_071767			G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0																		---	---	---	---
ILF3	3609	broad.mit.edu	37	19	10795448	10795448	+	Intron	DEL	C	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10795448delC	uc002mpn.2	+						ILF3_uc002mpm.2_3'UTR|ILF3_uc002mpl.2_3'UTR|ILF3_uc002mpk.2_Intron|ILF3_uc010xli.1_Intron|ILF3_uc002mpo.2_Intron|ILF3_uc002mpp.2_3'UTR|ILF3_uc002mpq.2_5'Flank	NM_012218	NP_036350			interleukin enhancer binding factor 3 isoform a						M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)															---	---	---	---
SMARCA4	6597	broad.mit.edu	37	19	11168782	11168783	+	Intron	INS	-	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11168782_11168783insA	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc002mqh.3_Intron	NM_003072	NP_003063			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)						F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				---	---	---	---
C19orf42	79086	broad.mit.edu	37	19	16758273	16758273	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16758273delT	uc002ner.2	-						C19orf42_uc002neo.1_Intron|C19orf42_uc002nep.1_Intron|C19orf42_uc002neq.2_5'Flank	NM_024104	NP_077009			hypothetical protein LOC79086 precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25899953	25899953	+	IGR	DEL	A	-	-	rs140359127		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25899953delA								FAM182B (51167 upstream) : LOC100134868 (90482 downstream)																																			---	---	---	---
ACSS2	55902	broad.mit.edu	37	20	33470426	33470426	+	Intron	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33470426delA	uc002xbd.2	+						ACSS2_uc002xbc.2_Intron|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Intron|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147			acyl-CoA synthetase short-chain family member 2						ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
LBP	3929	broad.mit.edu	37	20	37002386	37002393	+	Intron	DEL	GTTACTTG	-	-	rs11536995		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37002386_37002393delGTTACTTG	uc002xic.1	+							NM_004139	NP_004130			lipopolysaccharide-binding protein precursor						acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
C21orf57	54059	broad.mit.edu	37	21	47711111	47711112	+	Intron	INS	-	A	A	rs137903519		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47711111_47711112insA	uc002ziv.2	+						C21orf57_uc002zit.1_Intron|C21orf57_uc002ziu.1_Intron|C21orf57_uc002ziw.2_Intron|C21orf57_uc002zix.2_Intron|C21orf57_uc010gqh.2_Intron|C21orf57_uc002ziy.2_Intron|uc010gqi.1_5'Flank	NM_058181	NP_478061			hypothetical protein LOC54059 isoform 1								metal ion binding|metalloendopeptidase activity				0	Breast(49;0.112)			Colorectal(79;0.236)														---	---	---	---
ARHGEF9	23229	broad.mit.edu	37	X	62864048	62864048	+	Intron	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62864048delA	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000			Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	92643879	92643879	+	IGR	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92643879delT								PCDH11X (765653 upstream) : NAP1L3 (282050 downstream)																																			---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	105010791	105010791	+	Intron	DEL	T	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105010791delT	uc004elz.1	+							NM_017416	NP_059112			interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	141263084	141263084	+	IGR	DEL	A	-	-			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141263084delA								MAGEC1 (265902 upstream) : MAGEC2 (27046 downstream)																																			---	---	---	---
AGTRAP	57085	broad.mit.edu	37	1	11808641	11808641	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11808641G>A	uc001asv.2	+	4	462	c.338G>A	c.(337-339)CGC>CAC	p.R113H	AGTRAP_uc001ast.2_Silent_p.A145A|AGTRAP_uc001asu.2_Silent_p.A145A|AGTRAP_uc001asw.2_Missense_Mutation_p.R113H|AGTRAP_uc001asx.2_Silent_p.A101A	NM_020350	NP_065083	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein	113	Cytoplasmic (Potential).|Interaction with AGTR1.					cytoplasmic vesicle membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein binding		AGTRAP/BRAF(2)	stomach(2)	2	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14105854	14105854	+	Missense_Mutation	SNP	G	C	C	rs148030242	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14105854G>C	uc001avi.2	+	8	2420	c.1564G>C	c.(1564-1566)GAA>CAA	p.E522Q	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.E522Q|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.E279Q|PRDM2_uc001avk.2_Missense_Mutation_p.E321Q|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	522						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---
KLHDC7A	127707	broad.mit.edu	37	1	18809393	18809393	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18809393G>A	uc001bax.2	+	1	1970	c.1918G>A	c.(1918-1920)GGC>AGC	p.G640S	KLHDC7A_uc009vpg.2_Missense_Mutation_p.G422S	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	640	Kelch 5.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TAS1R2	80834	broad.mit.edu	37	1	19181079	19181079	+	Silent	SNP	G	A	A	rs148401055		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19181079G>A	uc001bba.1	-	3	886	c.885C>T	c.(883-885)GGC>GGT	p.G295G		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	295	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)													---	---	---	---
TAS1R2	80834	broad.mit.edu	37	1	19181261	19181261	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19181261C>T	uc001bba.1	-	3	704	c.703G>A	c.(703-705)GCC>ACC	p.A235T		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	235	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)													---	---	---	---
RUNX3	864	broad.mit.edu	37	1	25229132	25229132	+	Silent	SNP	G	A	A	rs144597350		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25229132G>A	uc001bjq.2	-	5	1140	c.729C>T	c.(727-729)TCC>TCT	p.S243S	RUNX3_uc010oen.1_Silent_p.S190S|RUNX3_uc009vrj.2_Silent_p.S257S|RUNX3_uc001bjr.2_Silent_p.S257S|RUNX3_uc001bjs.2_RNA	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	243	Pro/Ser/Thr-rich.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)														---	---	---	---
GNL2	29889	broad.mit.edu	37	1	38058379	38058379	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38058379G>C	uc001cbk.2	-	3	341	c.178C>G	c.(178-180)CTG>GTG	p.L60V	GNL2_uc010oif.1_5'UTR|GNL2_uc009vve.2_Missense_Mutation_p.L60V	NM_013285	NP_037417	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2	60					ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)																---	---	---	---
PTCH2	8643	broad.mit.edu	37	1	45292345	45292345	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45292345G>A	uc010olf.1	-	18	2803	c.2791C>T	c.(2791-2793)CGG>TGG	p.R931W	PTCH2_uc010olg.1_Missense_Mutation_p.R629W	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	931	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)													Basal_Cell_Nevus_syndrome				---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70482220	70482220	+	Intron	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70482220A>G	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76878075	76878075	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76878075T>A	uc001dhh.2	+	3	759	c.596T>A	c.(595-597)GTT>GAT	p.V199D	ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.V199D|ST6GALNAC3_uc010orh.1_Missense_Mutation_p.V134D	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	199	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
ODF2L	57489	broad.mit.edu	37	1	86826217	86826217	+	Silent	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86826217A>G	uc001dll.1	-	12	1486	c.1146T>C	c.(1144-1146)ACT>ACC	p.T382T	ODF2L_uc001dlm.1_Silent_p.T353T|ODF2L_uc001dln.2_Silent_p.T353T|ODF2L_uc001dlo.2_Silent_p.T222T|ODF2L_uc001dlp.2_Silent_p.T382T|ODF2L_uc010osg.1_Silent_p.T353T|ODF2L_uc001dlq.1_Silent_p.T183T|ODF2L_uc009wcr.1_Silent_p.T222T	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform	382	Potential.					centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120462932	120462932	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120462932C>T	uc001eik.2	-	30	5655	c.5399G>A	c.(5398-5400)CGT>CAT	p.R1800H		NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1800	Cytoplasmic (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
MLLT11	10962	broad.mit.edu	37	1	151039794	151039794	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151039794C>G	uc001ewq.2	+	2	979	c.94C>G	c.(94-96)CTG>GTG	p.L32V		NM_006818	NP_006809	Q13015	AF1Q_HUMAN	MLLT11 protein	32					positive regulation of apoptosis|positive regulation of mitochondrial depolarization|positive regulation of release of cytochrome c from mitochondria|positive regulation of transcription, DNA-dependent						0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152084947	152084947	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152084947C>T	uc001ezp.2	-	2	746	c.746G>A	c.(745-747)CGC>CAC	p.R249H	TCHH_uc009wne.1_Missense_Mutation_p.R249H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	249					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
PGLYRP3	114771	broad.mit.edu	37	1	153274943	153274943	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153274943C>T	uc001fbn.1	-	5	723	c.670G>A	c.(670-672)GTC>ATC	p.V224I		NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3 precursor	224					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
NPR1	4881	broad.mit.edu	37	1	153653765	153653765	+	Missense_Mutation	SNP	G	A	A	rs17855820		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153653765G>A	uc001fcs.3	+	3	1452	c.1031G>A	c.(1030-1032)GGC>GAC	p.G344D	NPR1_uc010pdz.1_Missense_Mutation_p.G90D	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	344	Extracellular (Potential).			G -> V (in Ref. 7; AAH63304).	body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)													---	---	---	---
MSTO1	55154	broad.mit.edu	37	1	155583270	155583270	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155583270C>A	uc001fky.2	+	12	1334	c.1301C>A	c.(1300-1302)ACA>AAA	p.T434K	MSTO1_uc001fkw.2_Missense_Mutation_p.T434K|MSTO1_uc001fkx.2_Missense_Mutation_p.T434K|MSTO1_uc001fla.2_Missense_Mutation_p.T253K|MSTO1_uc001fkz.2_Missense_Mutation_p.T365K|MSTO1_uc001fld.3_Missense_Mutation_p.T256K|MSTO1_uc009wqs.2_Missense_Mutation_p.T313K|MSTO1_uc010pgf.1_Missense_Mutation_p.T379K|MSTO1_uc001flb.2_Missense_Mutation_p.D315E|MSTO1_uc001flc.2_Missense_Mutation_p.T256K	NM_018116	NP_060586	Q9BUK6	MSTO1_HUMAN	misato	434					mitochondrion distribution|protein polymerization	mitochondrial outer membrane|protein complex					0	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158589972	158589972	+	Silent	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158589972A>G	uc001fst.1	-	44	6604	c.6405T>C	c.(6403-6405)TCT>TCC	p.S2135S		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2135	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158647617	158647617	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158647617T>C	uc001fst.1	-	7	1019	c.820A>G	c.(820-822)ACT>GCT	p.T274A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	274	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
CCDC19	25790	broad.mit.edu	37	1	159846399	159846399	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159846399G>A	uc001fui.2	-	10	1317	c.1299C>T	c.(1297-1299)CAC>CAT	p.H433H	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Silent_p.H348H|CCDC19_uc001ful.2_Silent_p.H348H|CCDC19_uc009wtc.1_3'UTR	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	433	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)															---	---	---	---
FMO1	2326	broad.mit.edu	37	1	171249946	171249946	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171249946G>A	uc009wvz.2	+	6	785	c.649G>A	c.(649-651)GGG>AGG	p.G217R	FMO1_uc010pme.1_Missense_Mutation_p.G154R|FMO1_uc001ghl.2_Missense_Mutation_p.G217R|FMO1_uc001ghm.2_Missense_Mutation_p.G217R|FMO1_uc001ghn.2_Missense_Mutation_p.G217R	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	217					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
RD3	343035	broad.mit.edu	37	1	211654555	211654555	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211654555C>T	uc001him.2	-	2	1367	c.203G>A	c.(202-204)CGG>CAG	p.R68Q	RD3_uc001hin.2_RNA|RD3_uc009xda.2_Intron	NM_183059	NP_898882	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	68			R -> W.		response to stimulus|visual perception					ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)														---	---	---	---
HLX	3142	broad.mit.edu	37	1	221057864	221057864	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221057864G>A	uc001hmv.3	+	4	1742	c.1285G>A	c.(1285-1287)GGC>AGC	p.G429S		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	429	Ser-rich.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)														---	---	---	---
HEATR1	55127	broad.mit.edu	37	1	236730096	236730096	+	Silent	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236730096C>G	uc001hyd.1	-	30	4283	c.4158G>C	c.(4156-4158)GCG>GCC	p.A1386A	HEATR1_uc009xgh.1_Silent_p.A548A	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	1386					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237753203	237753203	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237753203G>C	uc001hyl.1	+	30	3829	c.3709G>C	c.(3709-3711)GAA>CAA	p.E1237Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1237	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237777344	237777344	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777344T>C	uc001hyl.1	+	37	5036	c.4916T>C	c.(4915-4917)GTT>GCT	p.V1639A		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1639	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
TTC15	51112	broad.mit.edu	37	2	3391965	3391965	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3391965G>A	uc002qxm.1	+	2	777	c.571G>A	c.(571-573)GCC>ACC	p.A191T	TTC15_uc002qxn.1_Missense_Mutation_p.A191T|TTC15_uc010ewm.1_Missense_Mutation_p.A191T|TTC15_uc002qxl.1_Missense_Mutation_p.A191T	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	191							binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)														---	---	---	---
HNRPLL	92906	broad.mit.edu	37	2	38804623	38804623	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38804623G>A	uc002rqw.2	-	7	1264	c.854C>T	c.(853-855)TCG>TTG	p.S285L	HNRPLL_uc002rqv.2_5'UTR|HNRPLL_uc002rqx.2_Missense_Mutation_p.S280L	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	285					mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)																---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49217713	49217713	+	Missense_Mutation	SNP	T	G	G	rs1126715		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49217713T>G	uc002rww.2	-	5	512	c.438A>C	c.(436-438)AAA>AAC	p.K146N	FSHR_uc002rwx.2_Missense_Mutation_p.K146N|FSHR_uc010fbn.2_Missense_Mutation_p.K146N|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	146	LRR 5.|Extracellular (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
C2orf78	388960	broad.mit.edu	37	2	74042217	74042217	+	Silent	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74042217G>T	uc002sjr.1	+	3	988	c.867G>T	c.(865-867)GGG>GGT	p.G289G		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	289										ovary(2)	2																		---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144728242	144728242	+	Silent	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144728242T>A	uc002tvp.2	-	8	1242	c.963A>T	c.(961-963)GGA>GGT	p.G321G	GTDC1_uc002tvo.2_Silent_p.G321G|GTDC1_uc002tvq.2_Silent_p.G203G|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Silent_p.G321G|GTDC1_uc002tvs.2_Silent_p.G289G|GTDC1_uc010fno.2_Silent_p.G192G	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	321					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)														---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145156551	145156551	+	Missense_Mutation	SNP	G	A	A	rs144154908		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145156551G>A	uc002tvu.2	-	8	2683	c.2203C>T	c.(2203-2205)CCT>TCT	p.P735S	ZEB2_uc002tvv.2_Missense_Mutation_p.P729S|ZEB2_uc010zbm.1_Missense_Mutation_p.P706S|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.P764S	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	735						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
NEB	4703	broad.mit.edu	37	2	152397971	152397971	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152397971A>C	uc010fnx.2	-	108	15760	c.15569T>G	c.(15568-15570)CTT>CGT	p.L5190R	NEB_uc002txr.2_Missense_Mutation_p.L1613R	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	5190	Nebulin 141.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	167992437	167992437	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167992437A>C	uc002udx.2	+	2	445	c.427A>C	c.(427-429)AGT>CGT	p.S143R	XIRP2_uc010fpn.2_Missense_Mutation_p.S143R|XIRP2_uc010fpo.2_Missense_Mutation_p.S143R|XIRP2_uc010fpp.2_Missense_Mutation_p.S143R|XIRP2_uc002udy.2_5'UTR	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
NOSTRIN	115677	broad.mit.edu	37	2	169707670	169707670	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169707670T>C	uc002ueg.2	+	9	711	c.707T>C	c.(706-708)CTT>CCT	p.L236P	NOSTRIN_uc002uef.2_Missense_Mutation_p.L293P|NOSTRIN_uc002uei.2_Missense_Mutation_p.L119P|NOSTRIN_uc010fpu.2_Missense_Mutation_p.L208P|NOSTRIN_uc002ueh.2_Missense_Mutation_p.L158P|NOSTRIN_uc002uej.2_Missense_Mutation_p.L119P	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2	236					endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0																		---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185803164	185803164	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803164G>A	uc002uph.2	+	4	3635	c.3041G>A	c.(3040-3042)GGT>GAT	p.G1014D		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1014						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11																		---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198949309	198949309	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949309C>T	uc010fsp.2	+	2	1359	c.1068C>T	c.(1066-1068)ATC>ATT	p.I356I	PLCL1_uc002uuv.3_Silent_p.I277I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	356					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198949329	198949329	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949329C>G	uc010fsp.2	+	2	1379	c.1088C>G	c.(1087-1089)TCT>TGT	p.S363C	PLCL1_uc002uuv.3_Missense_Mutation_p.S284C	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	363					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210557512	210557512	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557512T>G	uc002vde.1	+	7	866	c.618T>G	c.(616-618)ACT>ACG	p.T206T	MAP2_uc002vdc.1_Silent_p.T206T|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.T202T	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	206					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215891609	215891609	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215891609C>A	uc002vew.2	-	10	1335	c.1115G>T	c.(1114-1116)AGT>ATT	p.S372I	ABCA12_uc002vev.2_Missense_Mutation_p.S54I|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	372					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
C2orf24	27013	broad.mit.edu	37	2	220041056	220041056	+	Intron	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220041056G>A	uc002vju.3	-						C2orf24_uc002vjv.2_Intron|FAM134A_uc002vjw.3_5'Flank|FAM134A_uc010fwc.2_5'Flank	NM_015680	NP_056495			hypothetical protein LOC27013						regulation of cyclin-dependent protein kinase activity	integral to membrane	protein kinase binding				0		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
RHBDD1	84236	broad.mit.edu	37	2	227729651	227729651	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227729651T>C	uc002voi.2	+	2	363	c.242T>C	c.(241-243)TTG>TCG	p.L81S	RHBDD1_uc010fxc.2_Missense_Mutation_p.L81S	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1	81						integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)														---	---	---	---
SPHKAP	80309	broad.mit.edu	37	2	228882341	228882341	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882341G>A	uc002vpq.2	-	7	3276	c.3229C>T	c.(3229-3231)CGG>TGG	p.R1077W	SPHKAP_uc002vpp.2_Missense_Mutation_p.R1077W|SPHKAP_uc010zlx.1_Missense_Mutation_p.R1077W	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1077						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)														---	---	---	---
LRRN1	57633	broad.mit.edu	37	3	3887829	3887829	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3887829C>G	uc003bpt.3	+	2	2265	c.1504C>G	c.(1504-1506)CAG>GAG	p.Q502E	SUMF1_uc003bps.1_Intron	NM_020873	NP_065924	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1 precursor	502	Ig-like C2-type.|Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)														---	---	---	---
ENTPD3	956	broad.mit.edu	37	3	40429568	40429568	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40429568G>A	uc003ckd.3	+	2	112	c.20G>A	c.(19-21)CGC>CAC	p.R7H	ENTPD3_uc010hhy.2_Missense_Mutation_p.R7H	NM_001248	NP_001239	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase	7	Cytoplasmic (Potential).					integral to membrane	ATP binding|hydrolase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)														---	---	---	---
MYL3	4634	broad.mit.edu	37	3	46899746	46899746	+	Silent	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46899746G>T	uc003cql.1	-	6	669	c.576C>A	c.(574-576)ATC>ATA	p.I192I		NM_000258	NP_000249	P08590	MYL3_HUMAN	slow skeletal ventricular myosin alkali light	192	EF-hand 3.				cardiac muscle contraction|muscle filament sliding|positive regulation of ATPase activity|regulation of striated muscle contraction|regulation of the force of heart contraction|ventricular cardiac muscle tissue morphogenesis	A band|cytosol|I band|muscle myosin complex	actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle				0				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56026192	56026192	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56026192G>A	uc003dhr.1	-	11	2404	c.2148C>T	c.(2146-2148)CGC>CGT	p.R716R	ERC2_uc003dht.1_Silent_p.R199R	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	716	Potential.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
GPR27	2850	broad.mit.edu	37	3	71803291	71803291	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71803291G>A	uc011bge.1	+	1	91	c.91G>A	c.(91-93)GTG>ATG	p.V31M	EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_Intron|EIF4E3_uc010hoc.2_Intron	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	31	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)														---	---	---	---
CNTN3	5067	broad.mit.edu	37	3	74349045	74349045	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74349045G>A	uc003dpm.1	-	16	2220	c.2140C>T	c.(2140-2142)CGG>TGG	p.R714W		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	714	Fibronectin type-III 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)														---	---	---	---
STX19	415117	broad.mit.edu	37	3	93733918	93733918	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93733918C>A	uc003drh.1	-	2	453	c.196G>T	c.(196-198)GAT>TAT	p.D66Y	ARL13B_uc003drc.2_Intron|ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_001001850	NP_001001850	Q8N4C7	STX19_HUMAN	syntaxin 19	66					intracellular protein transport|vesicle-mediated transport	membrane	SNAP receptor activity				0																		---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97124019	97124019	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97124019G>T	uc010how.1	+	6	1675	c.1632G>T	c.(1630-1632)AGG>AGT	p.R544S		NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	449	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
ST3GAL6	10402	broad.mit.edu	37	3	98507289	98507289	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98507289A>C	uc003dsz.2	+	8	974	c.738A>C	c.(736-738)AAA>AAC	p.K246N	ST3GAL6_uc003dsy.2_Missense_Mutation_p.K160N|ST3GAL6_uc003dta.2_Missense_Mutation_p.K128N|ST3GAL6_uc003dtb.2_Missense_Mutation_p.K102N|ST3GAL6_uc003dtc.2_Missense_Mutation_p.K246N|ST3GAL6_uc010hpd.2_Missense_Mutation_p.K299N	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI	246	Lumenal (Potential).				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1																		---	---	---	---
SLC9A10	285335	broad.mit.edu	37	3	111936286	111936286	+	Intron	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111936286T>G	uc003dyu.2	-						SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Intron	NM_183061	NP_898884			sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5																		---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	115571349	115571349	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115571349T>C	uc003ebt.2	-	4	1130	c.630A>G	c.(628-630)CAA>CAG	p.Q210Q	LSAMP_uc011bis.1_Silent_p.Q210Q	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	210	Ig-like C2-type 2.				cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123419605	123419605	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123419605T>G	uc003ego.2	-	18	2992	c.2710A>C	c.(2710-2712)AAG>CAG	p.K904Q	MYLK_uc011bjw.1_Missense_Mutation_p.K904Q|MYLK_uc003egp.2_Missense_Mutation_p.K835Q|MYLK_uc003egq.2_Missense_Mutation_p.K904Q|MYLK_uc003egr.2_Missense_Mutation_p.K835Q|MYLK_uc003egs.2_Missense_Mutation_p.K728Q|MYLK_uc003egt.2_Missense_Mutation_p.K95Q	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	904	1-2.|5 X 28 AA approximate tandem repeats.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
ATR	545	broad.mit.edu	37	3	142234270	142234270	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142234270C>A	uc003eux.3	-	25	4592	c.4470G>T	c.(4468-4470)TGG>TGT	p.W1490C		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1490					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20													Other_conserved_DNA_damage_response_genes					---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
LMLN	89782	broad.mit.edu	37	3	197710878	197710878	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197710878G>C	uc011buo.1	+	7	815	c.793G>C	c.(793-795)GGG>CGG	p.G265R	LMLN_uc003fyt.2_Missense_Mutation_p.G213R|LMLN_uc010iar.2_Missense_Mutation_p.G265R|LMLN_uc010ias.2_Missense_Mutation_p.G213R|LMLN_uc003fyu.2_Missense_Mutation_p.G25R	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	265					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)														---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6086631	6086631	+	Nonsense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6086631G>T	uc003giu.3	-	5	1172	c.896C>A	c.(895-897)TCA>TAA	p.S299*	JAKMIP1_uc010idb.1_Nonsense_Mutation_p.S299*|JAKMIP1_uc010idc.1_Nonsense_Mutation_p.S134*|JAKMIP1_uc010idd.1_Nonsense_Mutation_p.S299*|JAKMIP1_uc011bwc.1_Nonsense_Mutation_p.S134*|JAKMIP1_uc003giv.3_Nonsense_Mutation_p.S299*|JAKMIP1_uc010ide.2_Nonsense_Mutation_p.S299*	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	299	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	10023015	10023015	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10023015G>A	uc003gmc.2	-	1	100	c.39C>T	c.(37-39)GGC>GGT	p.G13G	SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	13	Cytoplasmic (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
YIPF7	285525	broad.mit.edu	37	4	44624465	44624465	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44624465A>T	uc010ifx.1	-	6	826	c.809T>A	c.(808-810)CTT>CAT	p.L270H		NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	270	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
TRAM1L1	133022	broad.mit.edu	37	4	118006001	118006001	+	Silent	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118006001G>C	uc003ibv.3	-	1	736	c.549C>G	c.(547-549)CTC>CTG	p.L183L		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	183	Helical; (Potential).|TLC.				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126239277	126239277	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126239277A>C	uc003ifj.3	+	1	1711	c.1711A>C	c.(1711-1713)ACT>CCT	p.T571P		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	571	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372259	126372259	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372259G>A	uc003ifj.3	+	9	10088	c.10088G>A	c.(10087-10089)CGA>CAA	p.R3363Q	FAT4_uc011cgp.1_Missense_Mutation_p.R1661Q|FAT4_uc003ifi.1_Missense_Mutation_p.R841Q	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3363	Cadherin 32.|Extracellular (Potential).			RE -> QK (in Ref. 3; BAE45762).	homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372585	126372585	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372585A>C	uc003ifj.3	+	9	10414	c.10414A>C	c.(10414-10416)ACC>CCC	p.T3472P	FAT4_uc011cgp.1_Missense_Mutation_p.T1770P|FAT4_uc003ifi.1_Missense_Mutation_p.T950P	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3472	Cadherin 33.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126411255	126411255	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126411255T>C	uc003ifj.3	+	17	13278	c.13278T>C	c.(13276-13278)CCT>CCC	p.P4426P	FAT4_uc011cgp.1_Silent_p.P2667P|FAT4_uc003ifi.1_Silent_p.P1903P	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4426	EGF-like 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
LARP1B	55132	broad.mit.edu	37	4	128996154	128996154	+	Intron	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128996154T>A	uc003iga.2	+						LARP1B_uc003ifw.1_Intron|LARP1B_uc003ifx.2_Intron|LARP1B_uc003ify.2_Intron|LARP1B_uc003ifz.1_Intron	NM_018078	NP_060548			La ribonucleoprotein domain family member 2								RNA binding				0																		---	---	---	---
NR3C2	4306	broad.mit.edu	37	4	149181165	149181165	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149181165C>T	uc003ilj.3	-	3	2196	c.1862G>A	c.(1861-1863)GGC>GAC	p.G621D	NR3C2_uc003ilk.3_Missense_Mutation_p.G621D|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	621	NR C4-type.|Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)													---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155254579	155254579	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155254579C>T	uc003inw.2	-	9	1284	c.1284G>A	c.(1282-1284)CCG>CCA	p.P428P	DCHS2_uc003inx.2_Silent_p.P927P	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	428	Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
RXFP1	59350	broad.mit.edu	37	4	159568065	159568065	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159568065T>G	uc003ipz.2	+	16	1550	c.1468T>G	c.(1468-1470)TCT>GCT	p.S490A	RXFP1_uc011cja.1_Missense_Mutation_p.S385A|RXFP1_uc010iqo.2_Missense_Mutation_p.S442A|RXFP1_uc011cjb.1_Missense_Mutation_p.S388A|RXFP1_uc010iqk.2_Missense_Mutation_p.S358A|RXFP1_uc011cjc.1_Missense_Mutation_p.S409A|RXFP1_uc011cjd.1_Missense_Mutation_p.S409A|RXFP1_uc010iql.2_Missense_Mutation_p.S334A|RXFP1_uc011cje.1_Missense_Mutation_p.S517A|RXFP1_uc010iqm.2_Missense_Mutation_p.S457A|RXFP1_uc011cjf.1_Missense_Mutation_p.S359A|RXFP1_uc010iqn.2_Missense_Mutation_p.S435A	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	490	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)														---	---	---	---
ADAM29	11086	broad.mit.edu	37	4	175896943	175896943	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175896943C>T	uc003iuc.2	+	5	937	c.267C>T	c.(265-267)ATC>ATT	p.I89I	ADAM29_uc003iud.2_Silent_p.I89I|ADAM29_uc010irr.2_Silent_p.I89I|ADAM29_uc011cki.1_Silent_p.I89I	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	89					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)														---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7707861	7707861	+	Silent	SNP	C	T	T	rs112493968	byFrequency;by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7707861C>T	uc003jdz.1	+	9	1378	c.1311C>T	c.(1309-1311)GGC>GGT	p.G437G	ADCY2_uc011cmo.1_Silent_p.G257G	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	437	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11236905	11236905	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11236905C>T	uc003jfa.1	-	10	1804	c.1659G>A	c.(1657-1659)CCG>CCA	p.P553P	CTNND2_uc010itt.2_Silent_p.P462P|CTNND2_uc011cmy.1_Silent_p.P216P|CTNND2_uc011cmz.1_Silent_p.P120P|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.P120P	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	553	ARM 2.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
GHR	2690	broad.mit.edu	37	5	42719406	42719406	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42719406T>C	uc003jmt.2	+	10	1840	c.1797T>C	c.(1795-1797)CAT>CAC	p.H599H	GHR_uc011cpq.1_Silent_p.H412H	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	599	Cytoplasmic (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
FAM169A	26049	broad.mit.edu	37	5	74135907	74135907	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74135907G>A	uc003kdm.2	-	3	267	c.224C>T	c.(223-225)TCA>TTA	p.S75L	FAM169A_uc010izm.2_Missense_Mutation_p.S75L|FAM169A_uc003kdl.2_5'UTR	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	75											0																		---	---	---	---
BHMT	635	broad.mit.edu	37	5	78417157	78417157	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78417157C>T	uc003kfu.3	+	5	699	c.594C>T	c.(592-594)CCC>CCT	p.P198P	BHMT_uc011cti.1_Intron	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	198	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)													---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79026957	79026957	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79026957G>A	uc003kgc.2	+	2	2441	c.2369G>A	c.(2368-2370)CGT>CAT	p.R790H		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	790						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79031339	79031339	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79031339G>A	uc003kgc.2	+	2	6823	c.6751G>A	c.(6751-6753)GGT>AGT	p.G2251S		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2251						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
EPB41L4A	64097	broad.mit.edu	37	5	111500702	111500702	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111500702G>A	uc003kpv.1	-	23	2320	c.2046C>T	c.(2044-2046)CTC>CTT	p.L682L	EPB41L4A_uc003kpp.1_Intron|EPB41L4A_uc003kpu.1_RNA	NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4	682						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)														---	---	---	---
APC	324	broad.mit.edu	37	5	112174378	112174378	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112174378T>G	uc010jby.2	+	16	3467	c.3087T>G	c.(3085-3087)CTT>CTG	p.L1029L	APC_uc011cvt.1_Silent_p.L1011L|APC_uc003kpz.3_Silent_p.L1029L|APC_uc003kpy.3_Silent_p.L1029L|APC_uc010jbz.2_Silent_p.L746L|APC_uc010jca.2_Silent_p.L329L	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1029	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
SRP19	6728	broad.mit.edu	37	5	112197085	112197085	+	Silent	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112197085T>A	uc003kqc.2	+	1	93	c.12T>A	c.(10-12)GCT>GCA	p.A4A	SRP19_uc003kqb.1_Silent_p.A4A|SRP19_uc011cvu.1_5'UTR|SRP19_uc011cvv.1_5'UTR	NM_003135	NP_003126	P09132	SRP19_HUMAN	signal recognition particle 19kDa	4					response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|mitochondrion|nucleolus|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding				0		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)														---	---	---	---
FBXL21	26223	broad.mit.edu	37	5	135276812	135276812	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135276812G>A	uc010jec.1	+	5	778	c.757G>A	c.(757-759)GAG>AAG	p.E253K	FBXL21_uc003lbc.2_RNA	NM_012159	NP_036291	Q9UKT6	FXL21_HUMAN	F-box and leucine-rich repeat protein 21	253	LRR 4.				rhythmic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
PCDHA3	56145	broad.mit.edu	37	5	140182291	140182291	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140182291G>A	uc003lhf.2	+	1	1509	c.1509G>A	c.(1507-1509)GCG>GCA	p.A503A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.A503A	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	503	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA10	56139	broad.mit.edu	37	5	140236909	140236909	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236909G>A	uc003lhx.2	+	1	1276	c.1276G>A	c.(1276-1278)GCG>ACG	p.A426T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.A426T|PCDHA10_uc011dad.1_Missense_Mutation_p.A426T	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	426	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA10	56139	broad.mit.edu	37	5	140237036	140237036	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140237036C>T	uc003lhx.2	+	1	1403	c.1403C>T	c.(1402-1404)CCG>CTG	p.P468L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.P468L|PCDHA10_uc011dad.1_Missense_Mutation_p.P468L	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	468	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB8	56128	broad.mit.edu	37	5	140559578	140559578	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559578G>C	uc011dai.1	+	1	2149	c.1963G>C	c.(1963-1965)GCC>CCC	p.A655P	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	655	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140594941	140594941	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594941G>C	uc003lja.1	+	1	1433	c.1246G>C	c.(1246-1248)GAA>CAA	p.E416Q		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	416	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHGA4	56111	broad.mit.edu	37	5	140734966	140734966	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140734966G>A	uc003ljq.1	+	1	199	c.199G>A	c.(199-201)GTC>ATC	p.V67I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.V67I	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	67	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
GALNT10	55568	broad.mit.edu	37	5	153795429	153795429	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153795429C>T	uc003lvh.2	+	11	1722	c.1590C>T	c.(1588-1590)ACC>ACT	p.T530T	GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Silent_p.T371T|uc003lvi.2_Intron|GALNT10_uc003lvj.2_Silent_p.T201T	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a	530	Lumenal (Potential).|Ricin B-type lectin.					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)															---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3273341	3273341	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3273341G>A	uc003mvm.3	-	10	2009	c.2009C>T	c.(2008-2010)GCG>GTG	p.A670V	uc003mvi.1_Intron|SLC22A23_uc003mvn.3_Missense_Mutation_p.A389V|SLC22A23_uc003mvo.3_Missense_Mutation_p.A389V|SLC22A23_uc003mvp.1_RNA	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a	670					ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15497183	15497183	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15497183C>T	uc003nbj.2	+	7	1971	c.1727C>T	c.(1726-1728)TCG>TTG	p.S576L	JARID2_uc011diu.1_Missense_Mutation_p.S440L|JARID2_uc011div.1_Missense_Mutation_p.S404L|JARID2_uc011diw.1_Missense_Mutation_p.S538L	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	576	JmjN.				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
HIST1H1E	3008	broad.mit.edu	37	6	26156642	26156642	+	Silent	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26156642G>T	uc003ngq.2	+	1	84	c.24G>T	c.(22-24)GCG>GCT	p.A8A	HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e	8					nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
ABCC10	89845	broad.mit.edu	37	6	43400000	43400000	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400000C>T	uc003ouy.1	+	3	497	c.282C>T	c.(280-282)GGC>GGT	p.G94G	ABCC10_uc003ouz.1_Silent_p.G51G	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	94						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)															---	---	---	---
BAI3	577	broad.mit.edu	37	6	69653817	69653817	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69653817C>G	uc003pev.3	+	6	1574	c.1126C>G	c.(1126-1128)CAG>GAG	p.Q376E	BAI3_uc010kak.2_Missense_Mutation_p.Q376E	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	376	Extracellular (Potential).|TSP type-1 2.				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
BAI3	577	broad.mit.edu	37	6	69666609	69666609	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69666609G>A	uc003pev.3	+	8	1881	c.1433G>A	c.(1432-1434)CGA>CAA	p.R478Q	BAI3_uc010kak.2_Missense_Mutation_p.R478Q	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	478	TSP type-1 4.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90371258	90371258	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90371258T>C	uc003pnn.1	-	88	14721	c.14605A>G	c.(14605-14607)AAT>GAT	p.N4869D		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4869					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90457135	90457135	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90457135G>A	uc003pnn.1	-	27	3933	c.3817C>T	c.(3817-3819)CGT>TGT	p.R1273C		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1273					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102069961	102069961	+	Missense_Mutation	SNP	C	A	A	rs143873289	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102069961C>A	uc003pqp.3	+	2	502	c.253C>A	c.(253-255)CTT>ATT	p.L85I	GRIK2_uc003pqn.2_Missense_Mutation_p.L85I|GRIK2_uc003pqo.3_Missense_Mutation_p.L85I|GRIK2_uc010kcw.2_Missense_Mutation_p.L85I	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	85	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123786070	123786070	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123786070C>T	uc003pzj.1	-	10	934	c.912G>A	c.(910-912)CCG>CCA	p.P304P	TRDN_uc003pzk.1_Silent_p.P304P|TRDN_uc003pzl.1_Silent_p.P304P|TRDN_uc010ken.2_Silent_p.P284P|uc003pzm.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	304	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
VNN2	8875	broad.mit.edu	37	6	133072431	133072431	+	Silent	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133072431A>G	uc003qdt.2	-	5	1064	c.1053T>C	c.(1051-1053)CTT>CTC	p.L351L	VNN2_uc003qds.2_Silent_p.L60L|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Silent_p.L298L	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	351					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)														---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143095201	143095201	+	Silent	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143095201A>C	uc003qjd.2	-	5	1418	c.675T>G	c.(673-675)TCT>TCG	p.S225S		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	225	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168351867	168351867	+	Missense_Mutation	SNP	G	A	A	rs151265223	byFrequency	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168351867G>A	uc003qwd.2	+	29	3951	c.3809G>A	c.(3808-3810)CGT>CAT	p.R1270H	MLLT4_uc003qwb.1_Missense_Mutation_p.R1255H|MLLT4_uc003qwc.1_Missense_Mutation_p.R1271H|MLLT4_uc003qwg.1_Missense_Mutation_p.R580H	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1271					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
GPR146	115330	broad.mit.edu	37	7	1097720	1097720	+	Missense_Mutation	SNP	C	T	T	rs142169372		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1097720C>T	uc003sjw.2	+	2	645	c.569C>T	c.(568-570)ACG>ATG	p.T190M	C7orf50_uc003sju.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron|GPR146_uc003sjx.3_Missense_Mutation_p.T190M|GPR146_uc003sjy.1_Missense_Mutation_p.T190M	NM_138445	NP_612454	Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	190	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)														---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18630090	18630090	+	Silent	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18630090C>A	uc003suh.2	+	3	428	c.387C>A	c.(385-387)GGC>GGA	p.G129G	HDAC9_uc003sue.2_Silent_p.G129G|HDAC9_uc011jyd.1_Silent_p.G129G|HDAC9_uc003sui.2_Silent_p.G132G|HDAC9_uc003suj.2_Silent_p.G132G|HDAC9_uc011jya.1_Silent_p.G170G|HDAC9_uc003sua.1_Silent_p.G151G|HDAC9_uc011jyb.1_Silent_p.G129G|HDAC9_uc003sud.1_Silent_p.G129G|HDAC9_uc011jyc.1_Silent_p.G132G|HDAC9_uc003suf.1_Silent_p.G160G|HDAC9_uc010kud.1_Silent_p.G132G|HDAC9_uc011jye.1_Silent_p.G101G|HDAC9_uc011jyf.1_Silent_p.G98G|HDAC9_uc010kue.1_5'UTR	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	129					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21639427	21639427	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21639427C>A	uc003svc.2	+	15	2721	c.2690C>A	c.(2689-2691)GCC>GAC	p.A897D		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	897	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
HEPACAM2	253012	broad.mit.edu	37	7	92826556	92826556	+	Nonsense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92826556G>T	uc003umm.2	-	7	1222	c.1199C>A	c.(1198-1200)TCA>TAA	p.S400*	HEPACAM2_uc003uml.2_Nonsense_Mutation_p.S388*|HEPACAM2_uc010lff.2_Missense_Mutation_p.Q380K|HEPACAM2_uc011khy.1_Nonsense_Mutation_p.S423*	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	400	Cytoplasmic (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5																		---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94052411	94052411	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94052411C>G	uc003ung.1	+	40	3017	c.2546C>G	c.(2545-2547)TCT>TGT	p.S849C	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	849			Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
LRRN3	54674	broad.mit.edu	37	7	110763771	110763771	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110763771G>A	uc003vft.3	+	4	1989	c.943G>A	c.(943-945)GAA>AAA	p.E315K	IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Missense_Mutation_p.E315K|LRRN3_uc003vfs.3_Missense_Mutation_p.E315K	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor	315	Extracellular (Potential).|LRR 11.					integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)														---	---	---	---
C7orf60	154743	broad.mit.edu	37	7	112462090	112462090	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112462090T>G	uc003vgo.1	-	5	1054	c.927A>C	c.(925-927)AAA>AAC	p.K309N	C7orf60_uc011kms.1_Missense_Mutation_p.K335N	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	309										ovary(2)|skin(1)	3																		---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136700588	136700588	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700588A>G	uc003vtf.1	+	4	1599	c.976A>G	c.(976-978)AGA>GGA	p.R326G	CHRM2_uc003vtg.1_Missense_Mutation_p.R326G|CHRM2_uc003vtj.1_Missense_Mutation_p.R326G|CHRM2_uc003vtk.1_Missense_Mutation_p.R326G|CHRM2_uc003vtl.1_Missense_Mutation_p.R326G|CHRM2_uc003vtm.1_Missense_Mutation_p.R326G|CHRM2_uc003vti.1_Missense_Mutation_p.R326G|CHRM2_uc003vto.1_Missense_Mutation_p.R326G|CHRM2_uc003vtn.1_Missense_Mutation_p.R326G|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	326	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151927115	151927115	+	Intron	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927115G>C	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3432554	3432554	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3432554G>A	uc011kwk.1	-	10	1650	c.1260C>T	c.(1258-1260)AGC>AGT	p.S420S		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	420	CUB 3.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
USP17L2	377630	broad.mit.edu	37	8	11994792	11994792	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11994792G>T	uc003wvc.1	-	1	1478	c.1478C>A	c.(1477-1479)ACC>AAC	p.T493N	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	493					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
TMEM66	51669	broad.mit.edu	37	8	29927339	29927339	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29927339C>T	uc003xhs.2	-	3	703	c.519G>A	c.(517-519)ATG>ATA	p.M173I	TMEM66_uc003xht.2_Missense_Mutation_p.M173I|TMEM66_uc003xhu.2_Missense_Mutation_p.M137I|TMEM66_uc003xhv.2_Missense_Mutation_p.M1I	NM_016127	NP_057211	Q96BY9	TMM66_HUMAN	transmembrane protein 66 precursor	173						integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)														---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52370214	52370214	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52370214A>C	uc003xqu.3	-	9	927	c.826T>G	c.(826-828)TTG>GTG	p.L276V		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	276	Ig-like C2-type 1.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52384802	52384802	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52384802A>C	uc003xqu.3	-	8	858	c.757T>G	c.(757-759)TTC>GTC	p.F253V		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	253	Ig-like C2-type 1.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
CYP7A1	1581	broad.mit.edu	37	8	59410883	59410883	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410883C>T	uc003xtm.3	-	2	289	c.226G>A	c.(226-228)GTC>ATC	p.V76I		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	76					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)												Neonatal_Giant_Cell_Hepatitis				---	---	---	---
RRS1	23212	broad.mit.edu	37	8	67341800	67341800	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67341800G>A	uc003xwa.2	+	1	538	c.434G>A	c.(433-435)GGC>GAC	p.G145D	ADHFE1_uc003xwb.3_5'Flank|ADHFE1_uc003xwd.3_5'Flank|ADHFE1_uc003xwc.3_5'Flank|ADHFE1_uc003xwe.3_5'Flank|ADHFE1_uc003xwf.3_5'Flank|ADHFE1_uc011les.1_5'Flank|ADHFE1_uc011leq.1_5'Flank|ADHFE1_uc011ler.1_5'Flank	NM_015169	NP_055984	Q15050	RRS1_HUMAN	homolog of yeast ribosome biogenesis regulatory	145					mitotic metaphase plate congression|ribosome biogenesis	condensed nuclear chromosome|nucleolus					0		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)															---	---	---	---
SULF1	23213	broad.mit.edu	37	8	70533427	70533427	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70533427G>A	uc010lza.1	+	14	2252	c.1535G>A	c.(1534-1536)CGT>CAT	p.R512H	SULF1_uc003xyd.2_Missense_Mutation_p.R512H|SULF1_uc003xye.2_Missense_Mutation_p.R512H|SULF1_uc003xyf.2_Missense_Mutation_p.R512H|SULF1_uc003xyg.2_Missense_Mutation_p.R512H|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	512					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)															---	---	---	---
NCOA2	10499	broad.mit.edu	37	8	71078867	71078867	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71078867G>A	uc003xyn.1	-	7	826	c.664C>T	c.(664-666)CAG>TAG	p.Q222*		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	222					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)					T	RUNXBP2	AML								---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101092395	101092395	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101092395T>C	uc003yjb.1	-	4	501	c.306A>G	c.(304-306)GAA>GAG	p.E102E	RGS22_uc003yja.1_Silent_p.E6E|RGS22_uc003yjc.1_Silent_p.E102E|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	102					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104898096	104898096	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898096T>G	uc003yls.2	+	2	844	c.603T>G	c.(601-603)TCT>TCG	p.S201S	RIMS2_uc003ylp.2_Silent_p.S423S|RIMS2_uc003ylw.2_Silent_p.S231S|RIMS2_uc003ylq.2_Silent_p.S231S|RIMS2_uc003ylr.2_Silent_p.S231S	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	p.S231S(1)		ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104898323	104898323	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898323A>T	uc003yls.2	+	2	1071	c.830A>T	c.(829-831)CAT>CTT	p.H277L	RIMS2_uc003ylp.2_Missense_Mutation_p.H499L|RIMS2_uc003ylw.2_Missense_Mutation_p.H307L|RIMS2_uc003ylq.2_Missense_Mutation_p.H307L|RIMS2_uc003ylr.2_Missense_Mutation_p.H307L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	530					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	105001521	105001521	+	Intron	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105001521T>C	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	105161047	105161047	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105161047G>T	uc003yls.2	+	23	3600	c.3359G>T	c.(3358-3360)AGT>ATT	p.S1120I	RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Missense_Mutation_p.S1109I|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121587425	121587425	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121587425A>C	uc010mdg.2	-	4	1263	c.1037T>G	c.(1036-1038)GTT>GGT	p.V346G	SNTB1_uc003ype.2_Missense_Mutation_p.V346G	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	346	PH 2.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141381153	141381153	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141381153C>T	uc003yvj.2	-	8	1395	c.1261G>A	c.(1261-1263)GCG>ACG	p.A421T	TRAPPC9_uc003yvh.2_Missense_Mutation_p.A519T|TRAPPC9_uc003yvi.1_Missense_Mutation_p.A412T	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	421					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8518071	8518071	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8518071T>G	uc003zkk.2	-	20	2031	c.1320A>C	c.(1318-1320)GAA>GAC	p.E440D	PTPRD_uc003zkp.2_Missense_Mutation_p.E440D|PTPRD_uc003zkq.2_Missense_Mutation_p.E440D|PTPRD_uc003zkr.2_Missense_Mutation_p.E434D|PTPRD_uc003zks.2_Missense_Mutation_p.E430D|PTPRD_uc003zkl.2_Missense_Mutation_p.E440D|PTPRD_uc003zkm.2_Missense_Mutation_p.E427D|PTPRD_uc003zkn.2_Missense_Mutation_p.E440D|PTPRD_uc003zko.2_Missense_Mutation_p.E437D	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	440	Fibronectin type-III 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
ANKRD20A3	441425	broad.mit.edu	37	9	67952005	67952005	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67952005G>C	uc004aeu.2	+	9	1080	c.968G>C	c.(967-969)GGA>GCA	p.G323A	ANKRD20A3_uc010mnn.2_Missense_Mutation_p.G322A	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	323											0																		---	---	---	---
WNK2	65268	broad.mit.edu	37	9	96051437	96051437	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96051437C>T	uc004ati.1	+	20	4512	c.4512C>T	c.(4510-4512)GAC>GAT	p.D1504D	WNK2_uc011lud.1_Silent_p.D1467D|WNK2_uc004atj.2_Silent_p.D1467D|WNK2_uc004atk.2_Silent_p.D1104D|WNK2_uc004atl.1_Silent_p.D62D	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1504					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113261413	113261413	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113261413C>T	uc010mtz.2	-	7	1926	c.1589G>A	c.(1588-1590)CGC>CAC	p.R530H	SVEP1_uc010mua.1_Missense_Mutation_p.R530H|SVEP1_uc004beu.2_Missense_Mutation_p.R530H	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	530	Sushi 3.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120476158	120476158	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120476158T>G	uc004bjz.2	+	3	2043	c.1752T>G	c.(1750-1752)ACT>ACG	p.T584T	TLR4_uc004bka.2_Silent_p.T544T|TLR4_uc004bkb.2_Silent_p.T384T	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	584	LRRCT.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
SLC25A25	114789	broad.mit.edu	37	9	130869718	130869718	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130869718C>T	uc004bte.2	+	10	1434	c.1405C>T	c.(1405-1407)CGG>TGG	p.R469W	SLC25A25_uc004btb.2_Missense_Mutation_p.R503W|SLC25A25_uc004btc.2_Missense_Mutation_p.R489W|SLC25A25_uc004btd.2_Missense_Mutation_p.R501W|SLC25A25_uc004btf.2_Missense_Mutation_p.R366W	NM_052901	NP_443133	Q6KCM7	SCMC2_HUMAN	solute carrier family 25, member 25 isoform a	469	Mitochondrial intermembrane (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding				0																		---	---	---	---
SETX	23064	broad.mit.edu	37	9	135205095	135205095	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135205095C>T	uc004cbk.2	-	10	2073	c.1890G>A	c.(1888-1890)ACG>ACA	p.T630T	SETX_uc004cbj.2_Silent_p.T249T|SETX_uc010mzt.2_Silent_p.T249T	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	630					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)														---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	140904511	140904511	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140904511C>T	uc004cog.2	+	17	2287	c.2142C>T	c.(2140-2142)AAC>AAT	p.N714N	CACNA1B_uc011mfd.1_Silent_p.N245N	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	714	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)													---	---	---	---
APBB1IP	54518	broad.mit.edu	37	10	26800822	26800822	+	Silent	SNP	G	A	A	rs142075664		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26800822G>A	uc001iss.2	+	7	999	c.678G>A	c.(676-678)CCG>CCA	p.P226P	APBB1IP_uc009xks.1_Silent_p.P226P	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	226	Ras-associating.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7																		---	---	---	---
NEUROG3	50674	broad.mit.edu	37	10	71332375	71332375	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71332375G>T	uc001jpp.2	-	2	583	c.425C>A	c.(424-426)GCG>GAG	p.A142E		NM_020999	NP_066279	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	142					central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity				0																		---	---	---	---
DUPD1	338599	broad.mit.edu	37	10	76803766	76803766	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76803766C>T	uc001jwq.1	-	2	210	c.210G>A	c.(208-210)GCG>GCA	p.A70A		NM_001003892	NP_001003892	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase	70	Tyrosine-protein phosphatase.					cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)	2	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)																	---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84711235	84711235	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84711235A>C	uc001kco.2	+	5	1092	c.1065A>C	c.(1063-1065)GAA>GAC	p.E355D	NRG3_uc010qlz.1_Missense_Mutation_p.E354D|NRG3_uc001kcp.2_Missense_Mutation_p.E134D|NRG3_uc001kcq.2_Missense_Mutation_p.E5D|NRG3_uc001kcr.2_Missense_Mutation_p.E5D	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	355	Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88259464	88259464	+	Intron	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88259464T>A	uc001kdo.2	-						WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
C10orf129	142827	broad.mit.edu	37	10	96972614	96972614	+	Splice_Site	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96972614G>C	uc001kke.2	+	7	1038	c.913_splice	c.e7-1	p.V305_splice	C10orf129_uc009xuu.1_Splice_Site_p.V215_splice	NM_207321	NP_997204			acyl-coenzyme A synthetase ACSM6, mitochondrial						fatty acid metabolic process	mitochondrion	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)														---	---	---	---
HPS6	79803	broad.mit.edu	37	10	103826688	103826688	+	Missense_Mutation	SNP	C	A	A	rs139679441	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103826688C>A	uc001kuj.2	+	1	1542	c.1457C>A	c.(1456-1458)GCG>GAG	p.A486E		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	486						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)										Hermansky-Pudlak_syndrome				---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127542584	127542584	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127542584C>A	uc001ljf.1	-	4	1529	c.1038G>T	c.(1036-1038)TTG>TTT	p.L346F	DHX32_uc001lje.1_5'UTR|DHX32_uc001ljg.1_Missense_Mutation_p.L346F|DHX32_uc009yam.1_Intron	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	346						mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
DPYSL4	10570	broad.mit.edu	37	10	134006169	134006169	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134006169G>A	uc009ybb.2	+	3	290	c.136G>A	c.(136-138)GGA>AGA	p.G46R		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	46					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3697502	3697502	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3697502G>A	uc001lyh.2	-	33	5581	c.5290C>T	c.(5290-5292)CGC>TGC	p.R1764C	NUP98_uc001lyi.2_Missense_Mutation_p.R1690C|NUP98_uc001lyg.2_Missense_Mutation_p.R729C	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1781					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14276115	14276115	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14276115G>A	uc001mle.2	+	9	1470	c.932G>A	c.(931-933)CGC>CAC	p.R311H		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	311	Spondin.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	30915786	30915786	+	Intron	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30915786A>C	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																														---	---	---	---
MADD	8567	broad.mit.edu	37	11	47350618	47350618	+	Missense_Mutation	SNP	G	A	A	rs140803760		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47350618G>A	uc001ner.1	+	36	5052	c.4861G>A	c.(4861-4863)GTA>ATA	p.V1621I	MADD_uc001neq.2_Missense_Mutation_p.V1562I|MADD_uc001nev.1_3'UTR|MADD_uc001nes.1_Missense_Mutation_p.V1539I|MADD_uc001net.1_Missense_Mutation_p.V1582I|MADD_uc009yln.1_Missense_Mutation_p.V1515I|MADD_uc001neu.1_Missense_Mutation_p.V1519I|MADD_uc001nex.2_3'UTR|MADD_uc001nez.2_Missense_Mutation_p.V1518I|MADD_uc001new.2_Missense_Mutation_p.V1561I	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	1621					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)														---	---	---	---
OR4A47	403253	broad.mit.edu	37	11	48510526	48510526	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48510526T>C	uc010rhx.1	+	1	182	c.182T>C	c.(181-183)CTT>CCT	p.L61P		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
OR4A5	81318	broad.mit.edu	37	11	51411522	51411522	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411522T>G	uc001nhi.1	-	1	874	c.874A>C	c.(874-876)AGA>CGA	p.R292R		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	292	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)																---	---	---	---
OR4C16	219428	broad.mit.edu	37	11	55340006	55340006	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55340006A>C	uc010rih.1	+	1	403	c.403A>C	c.(403-405)AGC>CGC	p.S135R		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)																---	---	---	---
OR4C6	219432	broad.mit.edu	37	11	55432670	55432670	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55432670T>A	uc001nht.3	+	3	293	c.28T>A	c.(28-30)TTC>ATC	p.F10I	OR4C6_uc010rik.1_Missense_Mutation_p.F10I	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---
OR8H3	390152	broad.mit.edu	37	11	55890015	55890015	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890015T>G	uc001nii.1	+	1	167	c.167T>G	c.(166-168)CTT>CGT	p.L56R		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	56	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)																	---	---	---	---
OR5T2	219464	broad.mit.edu	37	11	56000460	56000460	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56000460A>C	uc010rjc.1	-	1	202	c.202T>G	c.(202-204)TTC>GTC	p.F68V		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	68	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
OR5T1	390155	broad.mit.edu	37	11	56044028	56044028	+	Missense_Mutation	SNP	G	A	A	rs143790336		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56044028G>A	uc001nio.1	+	1	914	c.914G>A	c.(913-915)CGG>CAG	p.R305Q		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)																	---	---	---	---
OR5R1	219479	broad.mit.edu	37	11	56184767	56184767	+	Missense_Mutation	SNP	T	C	C	rs140012472		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184767T>C	uc010rji.1	-	1	942	c.942A>G	c.(940-942)ATA>ATG	p.I314M		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	314	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65650818	65650818	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65650818C>G	uc001ogc.1	+	9	985	c.943C>G	c.(943-945)CAG>GAG	p.Q315E	CTSW_uc001ogb.1_Missense_Mutation_p.Q315E	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	315					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
UNC93B1	81622	broad.mit.edu	37	11	67766770	67766770	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67766770G>A	uc001omw.1	-	5	640	c.560C>T	c.(559-561)GCG>GTG	p.A187V		NM_030930	NP_112192	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1	187					innate immune response|intracellular protein transport|response to virus|toll-like receptor 3 signaling pathway|toll-like receptor 7 signaling pathway|toll-like receptor 9 signaling pathway	early phagosome|endoplasmic reticulum membrane|endosome|integral to membrane|lysosome					0																		---	---	---	---
FOLR1	2348	broad.mit.edu	37	11	71907066	71907066	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71907066G>A	uc001orz.1	+	6	757	c.619G>A	c.(619-621)GGC>AGC	p.G207S	FOLR1_uc001osa.1_Missense_Mutation_p.G207S|FOLR1_uc001osb.1_Missense_Mutation_p.G207S|FOLR1_uc001osc.1_Missense_Mutation_p.G207S|FOLR1_uc001osd.1_Missense_Mutation_p.G207S	NM_016724	NP_057936	P15328	FOLR1_HUMAN	folate receptor 1 precursor	207					cell death|folic acid transport|receptor-mediated endocytosis	anchored to membrane|extracellular region|integral to plasma membrane|membrane fraction	folic acid binding|receptor activity			ovary(1)	1																		---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92087018	92087018	+	Silent	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087018A>G	uc001pdj.3	+	1	1757	c.1740A>G	c.(1738-1740)AAA>AAG	p.K580K		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	580	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
HEPHL1	341208	broad.mit.edu	37	11	93844120	93844120	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93844120C>T	uc001pep.2	+	18	3254	c.3097C>T	c.(3097-3099)CAA>TAA	p.Q1033*	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	1033	Extracellular (Potential).|Plastocyanin-like 6.				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)																---	---	---	---
TRPC6	7225	broad.mit.edu	37	11	101362341	101362341	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101362341G>A	uc001pgk.3	-	3	1499	c.1074C>T	c.(1072-1074)CAC>CAT	p.H358H	TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Silent_p.H358H	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	358	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)														---	---	---	---
DCUN1D5	84259	broad.mit.edu	37	11	102937031	102937031	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102937031C>T	uc001phm.2	-	6	790	c.522G>A	c.(520-522)TGG>TGA	p.W174*	DCUN1D5_uc010ruw.1_Nonsense_Mutation_p.W105*	NM_032299	NP_115675	Q9BTE7	DCNL5_HUMAN	DCN1, defective in cullin neddylation 1, domain	174	DCUN1.										0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.00032)|Epithelial(105;0.0689)|all cancers(92;0.186)														---	---	---	---
PRDM10	56980	broad.mit.edu	37	11	129775606	129775606	+	Missense_Mutation	SNP	G	T	T	rs140045693		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129775606G>T	uc001qfm.2	-	21	3438	c.3206C>A	c.(3205-3207)CCG>CAG	p.P1069Q	PRDM10_uc001qfj.2_Missense_Mutation_p.P970Q|PRDM10_uc001qfk.2_Missense_Mutation_p.P932Q|PRDM10_uc001qfl.2_Missense_Mutation_p.P983Q|PRDM10_uc010sbx.1_Missense_Mutation_p.P979Q|PRDM10_uc001qfn.2_Missense_Mutation_p.P1065Q	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1	1056					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)														---	---	---	---
TULP3	7289	broad.mit.edu	37	12	3047401	3047401	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3047401G>A	uc010seh.1	+	10	1226	c.1145G>A	c.(1144-1146)CGG>CAG	p.R382Q	TULP3_uc009zec.1_Missense_Mutation_p.R109Q|TULP3_uc010seg.1_RNA|TULP3_uc001qlj.2_Missense_Mutation_p.R382Q|TULP3_uc010sei.1_Missense_Mutation_p.R206Q	NM_003324	NP_003315	O75386	TULP3_HUMAN	tubby like protein 3 isoform 1	382					G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)															---	---	---	---
PRMT8	56341	broad.mit.edu	37	12	3649831	3649831	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3649831C>T	uc001qmf.2	+	2	502	c.135C>T	c.(133-135)TGC>TGT	p.C45C	PRMT8_uc009zed.2_Silent_p.C36C|PRMT8_uc009zee.1_RNA	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4	45					regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)															---	---	---	---
AKAP3	10566	broad.mit.edu	37	12	4735889	4735889	+	Nonsense_Mutation	SNP	C	A	A	rs74060068	byFrequency;by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4735889C>A	uc001qnb.3	-	4	2408	c.2179G>T	c.(2179-2181)GAA>TAA	p.E727*		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	727					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6																		---	---	---	---
NOP2	4839	broad.mit.edu	37	12	6670217	6670217	+	Silent	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6670217C>G	uc001qph.1	-	12	1395	c.1215G>C	c.(1213-1215)ACG>ACC	p.T405T	NOP2_uc009zeq.1_Silent_p.T121T|NOP2_uc001qpi.1_Silent_p.T405T|NOP2_uc001qpj.1_Intron	NM_001033714	NP_001028886	P46087	NOP2_HUMAN	nucleolar protein 1, 120kDa	409					positive regulation of cell proliferation|rRNA processing	nucleolus	protein binding|RNA binding|S-adenosylmethionine-dependent methyltransferase activity			ovary(2)	2																		---	---	---	---
PTPN6	5777	broad.mit.edu	37	12	7055884	7055884	+	5'UTR	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7055884G>C	uc001qsa.1	+	1					PTPN6_uc010sfr.1_5'UTR	NM_080548	NP_536858			protein tyrosine phosphatase, non-receptor type						apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity			breast(1)	1																		---	---	---	---
PHC1	1911	broad.mit.edu	37	12	9083026	9083026	+	Intron	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9083026T>C	uc001qvd.2	+						PHC1_uc001qvc.1_Intron|PHC1_uc010sgn.1_Intron|PHC1_uc001qve.2_Intron	NM_004426	NP_004417			polyhomeotic 1-like						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
WBP11	51729	broad.mit.edu	37	12	14949824	14949824	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14949824C>T	uc001rci.2	-	5	465	c.304G>A	c.(304-306)GAT>AAT	p.D102N		NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	102	Potential.				mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2																		---	---	---	---
PLEKHA5	54477	broad.mit.edu	37	12	19427792	19427792	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19427792T>C	uc001reb.2	+	10	1256	c.1170T>C	c.(1168-1170)AAT>AAC	p.N390N	PLEKHA5_uc010sie.1_Silent_p.N396N|PLEKHA5_uc001rea.2_Silent_p.N390N|PLEKHA5_uc009zin.2_Silent_p.N148N|PLEKHA5_uc010sif.1_Silent_p.N282N|PLEKHA5_uc010sig.1_Silent_p.N282N|PLEKHA5_uc010sih.1_Silent_p.N282N|PLEKHA5_uc001rec.1_Silent_p.N78N	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	390							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)																	---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20833192	20833192	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20833192A>C	uc001reh.1	+	16	3435	c.3413A>C	c.(3412-3414)AAG>ACG	p.K1138T		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	1138					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21036540	21036540	+	Intron	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21036540A>C	uc001rek.2	+						SLCO1B3_uc001rel.2_Intron|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Intron	NM_019844	NP_062818			solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
GYS2	2998	broad.mit.edu	37	12	21728967	21728967	+	Nonsense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21728967C>A	uc001rfb.2	-	3	583	c.328G>T	c.(328-330)GAA>TAA	p.E110*		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	110					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2																		---	---	---	---
PRPH	5630	broad.mit.edu	37	12	49689232	49689232	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49689232C>T	uc001rtu.2	+	1	324	c.249C>T	c.(247-249)GCC>GCT	p.A83A		NM_006262	NP_006253	P41219	PERI_HUMAN	peripherin	83	Head.						structural molecule activity				0																		---	---	---	---
KRT75	9119	broad.mit.edu	37	12	52818448	52818448	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52818448G>A	uc001saj.2	-	9	1531	c.1509C>T	c.(1507-1509)TCC>TCT	p.S503S		NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75	503	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)														---	---	---	---
EIF4B	1975	broad.mit.edu	37	12	53421886	53421886	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53421886A>G	uc001sbh.3	+	8	1099	c.893A>G	c.(892-894)TAT>TGT	p.Y298C	EIF4B_uc010snu.1_Missense_Mutation_p.Y298C|EIF4B_uc010snv.1_Missense_Mutation_p.Y259C|EIF4B_uc001sbi.2_Missense_Mutation_p.Y50C	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	298	Arg-rich.|Asp-rich.				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2																		---	---	---	---
NPFF	8620	broad.mit.edu	37	12	53900648	53900648	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53900648C>T	uc001sdw.1	-	3	418	c.254G>A	c.(253-255)AGG>AAG	p.R85K		NM_003717	NP_003708	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide preproprotein	85					neuropeptide signaling pathway|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0																		---	---	---	---
OR6C70	390327	broad.mit.edu	37	12	55862995	55862995	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55862995A>T	uc010spn.1	-	1	928	c.928T>A	c.(928-930)TCA>ACA	p.S310T		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	310	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
RDH5	5959	broad.mit.edu	37	12	56118266	56118266	+	Silent	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56118266A>C	uc001shk.2	+	5	1077	c.894A>C	c.(892-894)CCA>CCC	p.P298P	RDH5_uc001shl.2_Silent_p.P298P	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)	298					response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
RAB5B	5869	broad.mit.edu	37	12	56383868	56383868	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56383868G>A	uc001siv.2	+	3	418	c.301G>A	c.(301-303)GAC>AAC	p.D101N	RAB5B_uc001siw.2_Missense_Mutation_p.D101N|RAB5B_uc009zog.2_Intron|RAB5B_uc010spz.1_Missense_Mutation_p.D101N	NM_002868	NP_002859	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	101					protein transport|small GTPase mediated signal transduction	early endosome membrane|melanosome|membrane fraction|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)															---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78515734	78515734	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78515734A>T	uc001syp.2	+	16	3937	c.3764A>T	c.(3763-3765)AAG>ATG	p.K1255M	NAV3_uc001syo.2_Missense_Mutation_p.K1255M|NAV3_uc010sub.1_Missense_Mutation_p.K755M|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1255	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
PLEKHG7	440107	broad.mit.edu	37	12	93148040	93148040	+	Missense_Mutation	SNP	C	T	T	rs115752910	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93148040C>T	uc001tcj.2	+	6	720	c.490C>T	c.(490-492)CGG>TGG	p.R164W		NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G	164	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
FGD6	55785	broad.mit.edu	37	12	95604081	95604081	+	Missense_Mutation	SNP	G	A	A	rs138823345	byFrequency	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95604081G>A	uc001tdp.3	-	2	1203	c.979C>T	c.(979-981)CGC>TGC	p.R327C	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	327					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3																		---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104157271	104157271	+	Nonsense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104157271C>A	uc001tjw.2	+	68	7676	c.7490C>A	c.(7489-7491)TCG>TAG	p.S2497*	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	2497	Cytoplasmic (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118198882	118198882	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118198882G>A	uc001two.2	-	4	888	c.833C>T	c.(832-834)GCG>GTG	p.A278V		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	307					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122763599	122763599	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122763599G>A	uc001ucg.1	-	21	3847	c.3741C>T	c.(3739-3741)GCC>GCT	p.A1247A	CLIP1_uc001uch.1_Silent_p.A1236A|CLIP1_uc001uci.1_Silent_p.A1201A|CLIP1_uc001ucj.1_Silent_p.A822A	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1247	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
ZDHHC20	253832	broad.mit.edu	37	13	22033233	22033233	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22033233G>A	uc001uob.2	-	1	191	c.78C>T	c.(76-78)GTC>GTT	p.V26V	ZDHHC20_uc001uod.2_RNA|ZDHHC20_uc001uoc.2_RNA|ZDHHC20_uc001uoe.2_RNA|ZDHHC20_uc010tcs.1_5'UTR	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	26	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)														---	---	---	---
FAM123A	219287	broad.mit.edu	37	13	25744011	25744011	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25744011G>A	uc001uqb.2	-	1	1847	c.1747C>T	c.(1747-1749)CGG>TGG	p.R583W	FAM123A_uc001uqa.2_Missense_Mutation_p.R464W|FAM123A_uc001uqc.2_Missense_Mutation_p.R464W	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	583										ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35733293	35733293	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35733293A>C	uc001uvb.2	+	23	3191	c.2985A>C	c.(2983-2985)AAA>AAC	p.K995N	NBEA_uc010abi.2_5'Flank	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	995						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
MAB21L1	4081	broad.mit.edu	37	13	36049942	36049942	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049942G>C	uc001uvc.2	-	1	891	c.334C>G	c.(334-336)CTC>GTC	p.L112V	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	112					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)														---	---	---	---
CCNA1	8900	broad.mit.edu	37	13	37014128	37014128	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37014128G>A	uc001uvr.3	+	6	1256	c.906G>A	c.(904-906)GAG>GAA	p.E302E	CCNA1_uc010teo.1_Silent_p.E258E|CCNA1_uc010abq.2_Silent_p.E258E|CCNA1_uc010abp.2_Silent_p.E258E|CCNA1_uc001uvs.3_Silent_p.E301E|CCNA1_uc010abr.2_Intron	NM_003914	NP_003905	P78396	CCNA1_HUMAN	cyclin A1 isoform a	302					cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding			lung(2)|skin(2)|ovary(1)	5		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)														---	---	---	---
SLITRK6	84189	broad.mit.edu	37	13	86370524	86370524	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86370524T>G	uc001vll.1	-	2	579	c.120A>C	c.(118-120)AAA>AAC	p.K40N	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	40	LRRNT 1.|Extracellular (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)														---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102527574	102527574	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102527574C>A	uc001vpe.2	-	2	266	c.266G>T	c.(265-267)GGA>GTA	p.G89V	FGF14_uc001vpf.2_Missense_Mutation_p.G94V	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A	89					cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
F10	2159	broad.mit.edu	37	13	113803380	113803380	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113803380C>T	uc001vsx.2	+	8	1073	c.1016C>T	c.(1015-1017)GCG>GTG	p.A339V	F10_uc001vsy.2_3'UTR|F10_uc001vsz.2_3'UTR	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	339	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
OR4M1	441670	broad.mit.edu	37	14	20249095	20249095	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249095T>C	uc010tku.1	+	1	614	c.614T>C	c.(613-615)CTG>CCG	p.L205P		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
SALL2	6297	broad.mit.edu	37	14	21992247	21992247	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21992247C>T	uc001wbe.2	-	2	1897	c.1615G>A	c.(1615-1617)GTG>ATG	p.V539M	SALL2_uc010tly.1_Missense_Mutation_p.V537M|SALL2_uc010tlz.1_Missense_Mutation_p.V402M|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Missense_Mutation_p.V404M|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	539							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22217974	22217974	+	Intron	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22217974T>G	uc010tmf.1	+						uc010aip.1_Missense_Mutation_p.F105V|uc010aiq.1_Missense_Mutation_p.F109V					SubName: Full=Putative uncharacterized protein ENSP00000374943;																														---	---	---	---
MYH7	4625	broad.mit.edu	37	14	23887536	23887536	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23887536G>A	uc001wjx.2	-	30	4158	c.4052C>T	c.(4051-4053)ACG>ATG	p.T1351M	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1351	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)														---	---	---	---
SYT16	83851	broad.mit.edu	37	14	62550996	62550996	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62550996C>T	uc001xfu.1	+	5	1714	c.1517C>T	c.(1516-1518)GCG>GTG	p.A506V	SYT16_uc010tse.1_Missense_Mutation_p.A64V	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	506										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)														---	---	---	---
FNTB	2342	broad.mit.edu	37	14	65507516	65507516	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65507516A>G	uc001xia.2	+	8	866	c.701A>G	c.(700-702)AAC>AGC	p.N234S	FNTB_uc010tsl.1_Missense_Mutation_p.N268S|FNTB_uc010tsm.1_Missense_Mutation_p.N188S|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_5'UTR|FNTB_uc010tso.1_Missense_Mutation_p.N149S	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	234	PFTB 3.				protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)														---	---	---	---
ACTN1	87	broad.mit.edu	37	14	69347567	69347567	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69347567G>A	uc001xkl.2	-	17	2403	c.2093C>T	c.(2092-2094)GCG>GTG	p.A698V	ACTN1_uc001xkk.2_Missense_Mutation_p.A294V|ACTN1_uc010ttb.1_Missense_Mutation_p.A633V|ACTN1_uc001xkm.2_Missense_Mutation_p.A698V|ACTN1_uc001xkn.2_Missense_Mutation_p.A698V|ACTN1_uc010ttc.1_Missense_Mutation_p.A283V	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	698	Spectrin 4.|Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
FLRT2	23768	broad.mit.edu	37	14	86089096	86089096	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86089096G>A	uc001xvr.2	+	2	2005	c.1238G>A	c.(1237-1239)GGC>GAC	p.G413D	FLRT2_uc010atd.2_Missense_Mutation_p.G413D	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	413	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)														---	---	---	---
EML1	2009	broad.mit.edu	37	14	100381009	100381009	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100381009G>A	uc001ygs.2	+	15	1796	c.1727G>A	c.(1726-1728)CGT>CAT	p.R576H	EML1_uc010tww.1_Missense_Mutation_p.R564H|EML1_uc001ygr.2_Missense_Mutation_p.R595H	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	576	WD 6.					cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
ADSSL1	122622	broad.mit.edu	37	14	105211180	105211180	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105211180G>A	uc001ypd.2	+	11	1179	c.1105G>A	c.(1105-1107)GTA>ATA	p.V369I	INF2_uc010tyi.1_Intron|ADSSL1_uc001ype.2_Missense_Mutation_p.V412I|ADSSL1_uc001ypf.2_RNA	NM_152328	NP_689541	Q8N142	PURA1_HUMAN	adenylosuccinate synthase like 1 isoform 2	369					AMP biosynthetic process|immune system process|purine base metabolic process	cytosol	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(1)|central_nervous_system(1)	2		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)	L-Aspartic Acid(DB00128)													---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105408763	105408763	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105408763T>C	uc010axc.1	-	7	13145	c.13025A>G	c.(13024-13026)AAG>AGG	p.K4342R	AHNAK2_uc001ypx.2_Missense_Mutation_p.K4242R	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4342						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106321184	106321184	+	RNA	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106321184T>G	uc010tyt.1	-	3600		c.55967A>C			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
MKRN3	7681	broad.mit.edu	37	15	23811376	23811376	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811376C>T	uc001ywh.3	+	1	923	c.447C>T	c.(445-447)ATC>ATT	p.I149I	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.I149I	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	149						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)														---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	27184420	27184420	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27184420A>T	uc001zbb.2	-	1	267	c.164T>A	c.(163-165)TTC>TAC	p.F55Y	GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	Error:Variant_position_missing_in_P28472_after_alignment					synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
MYO5C	55930	broad.mit.edu	37	15	52534277	52534277	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52534277G>A	uc010bff.2	-	20	2661	c.2524C>T	c.(2524-2526)CGA>TGA	p.R842*	MYO5C_uc010uga.1_Intron|MYO5C_uc010ugb.1_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	842	IQ 4.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)														---	---	---	---
NEDD4	4734	broad.mit.edu	37	15	56208746	56208746	+	Missense_Mutation	SNP	C	T	T	rs146216406		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56208746C>T	uc002adj.2	-	1	584	c.284G>A	c.(283-285)AGG>AAG	p.R95K	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Missense_Mutation_p.R95K|NEDD4_uc010ugj.1_Missense_Mutation_p.R95K|NEDD4_uc010bfm.2_Missense_Mutation_p.R95K|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	95	Ser-rich.				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)														---	---	---	---
MEGF11	84465	broad.mit.edu	37	15	66209284	66209284	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66209284G>A	uc002apm.2	-	17	2238	c.2097C>T	c.(2095-2097)CCC>CCT	p.P699P	MEGF11_uc002apl.2_Silent_p.P624P|MEGF11_uc002apn.1_Silent_p.P699P	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor	699						basolateral plasma membrane|integral to membrane				pancreas(1)	1																OREG0023198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ARNT2	9915	broad.mit.edu	37	15	80743252	80743252	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80743252G>A	uc002bfr.2	+	2	229	c.63G>A	c.(61-63)ACG>ACA	p.T21T	ARNT2_uc002bfq.2_Silent_p.T21T|ARNT2_uc010unm.1_Silent_p.T10T|ARNT2_uc002bfs.2_Silent_p.T10T	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	21					central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)															---	---	---	---
MYH11	4629	broad.mit.edu	37	16	15797934	15797934	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15797934G>A	uc002ddy.2	-	41	5940	c.5833C>T	c.(5833-5835)CGT>TGT	p.R1945C	MYH11_uc002ddv.2_3'UTR|MYH11_uc002ddw.2_3'UTR|MYH11_uc002ddx.2_Missense_Mutation_p.R1952C|MYH11_uc010bvg.2_3'UTR|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1945	Carboxyl-terminal.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15								T	CBFB	AML								---	---	---	---
SCNN1B	6338	broad.mit.edu	37	16	23360100	23360100	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23360100C>T	uc002dln.2	+	2	356	c.180C>T	c.(178-180)GCC>GCT	p.A60A		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	60	Helical; (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
ATP2A1	487	broad.mit.edu	37	16	28890083	28890083	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28890083C>T	uc002dro.1	+	1	275	c.91C>T	c.(91-93)CGG>TGG	p.R31W	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.R31W|ATP2A1_uc002drp.1_5'Flank	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	31	Cytoplasmic (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
CBLN1	869	broad.mit.edu	37	16	49313471	49313471	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49313471G>A	uc002efq.2	-	3	765	c.426C>T	c.(424-426)TTC>TTT	p.F142F		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	142	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)																---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61851476	61851476	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61851476G>T	uc002eog.1	-	7	1436	c.1184C>A	c.(1183-1185)ACT>AAT	p.T395N	CDH8_uc002eoh.2_Missense_Mutation_p.T164N	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	395	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
CDH11	1009	broad.mit.edu	37	16	64981966	64981966	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64981966T>G	uc002eoi.2	-	13	2365	c.1931A>C	c.(1930-1932)AAG>ACG	p.K644T	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_3'UTR|CDH11_uc010vin.1_Missense_Mutation_p.K518T	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	644	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70986528	70986528	+	Silent	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70986528T>G	uc002ezr.2	-	41	6452	c.6324A>C	c.(6322-6324)GCA>GCC	p.A2108A		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2109										ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
NECAB2	54550	broad.mit.edu	37	16	84024157	84024157	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84024157C>T	uc002fhd.2	+	6	535	c.518C>T	c.(517-519)ACG>ATG	p.T173M	NECAB2_uc002fhe.2_Missense_Mutation_p.T90M	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2	173	Potential.				antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2																		---	---	---	---
HSDL1	83693	broad.mit.edu	37	16	84163759	84163759	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84163759G>A	uc002fhk.2	-	4	682	c.498C>T	c.(496-498)TCC>TCT	p.S166S	HSDL1_uc010vnv.1_Silent_p.S111S	NM_031463	NP_113651	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1 isoform a	166						mitochondrion	oxidoreductase activity|protein binding				0																		---	---	---	---
C17orf97	400566	broad.mit.edu	37	17	263226	263226	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263226C>T	uc002frh.2	+	2	608	c.592C>T	c.(592-594)CGG>TGG	p.R198W	C17orf97_uc010vpz.1_5'Flank	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	198										ovary(1)	1																		---	---	---	---
OR3A2	4995	broad.mit.edu	37	17	3181605	3181605	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3181605A>T	uc002fvg.2	-	1	664	c.625T>A	c.(625-627)TTT>ATT	p.F209I		NM_002551	NP_002542	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577127C>T	uc002gim.2	-	8	1005	c.811G>A	c.(811-813)GAG>AAG	p.E271K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E271K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E139K|TP53_uc010cng.1_Missense_Mutation_p.E139K|TP53_uc002gii.1_Missense_Mutation_p.E139K|TP53_uc010cnh.1_Missense_Mutation_p.E271K|TP53_uc010cni.1_Missense_Mutation_p.E271K|TP53_uc002gij.2_Missense_Mutation_p.E271K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	271	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> A (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E271K(22)|p.E271*(14)|p.0?(7)|p.E271V(5)|p.E271Q(3)|p.E271G(3)|p.E271D(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.E271E(2)|p.E271fs*73(1)|p.E258fs*71(1)|p.E271_R273delEVR(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.E271P(1)|p.E271del(1)|p.S269fs*34(1)|p.E271fs*34(1)|p.E271fs*35(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CCDC42	146849	broad.mit.edu	37	17	8645000	8645000	+	Intron	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8645000G>C	uc002gln.2	-						CCDC42_uc002glo.2_Intron	NM_144681	NP_653282			coiled-coil domain containing 42 isoform 1											ovary(1)	1																		---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16042436	16042436	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16042436C>T	uc002gpo.2	-	12	1478	c.1238G>A	c.(1237-1239)AGA>AAA	p.R413K	NCOR1_uc002gpn.2_Missense_Mutation_p.R413K|NCOR1_uc002gpp.1_Missense_Mutation_p.R304K|NCOR1_uc002gpr.2_Missense_Mutation_p.R304K|NCOR1_uc002gps.1_Missense_Mutation_p.R422K|NCOR1_uc010coz.1_Missense_Mutation_p.R229K|NCOR1_uc010cpb.1_Missense_Mutation_p.R422K|NCOR1_uc010cpa.1_Missense_Mutation_p.R413K	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	413					cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
TOP3A	7156	broad.mit.edu	37	17	18208465	18208465	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18208465C>T	uc002gsx.1	-	5	689	c.460G>A	c.(460-462)GAA>AAA	p.E154K	TOP3A_uc002gsw.1_5'UTR|TOP3A_uc010vxs.1_Missense_Mutation_p.E52K|TOP3A_uc010cqa.1_RNA	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	154	Toprim.				DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3																		---	---	---	---
NUFIP2	57532	broad.mit.edu	37	17	27613685	27613685	+	Missense_Mutation	SNP	G	C	C	rs140549572	by1000genomes	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27613685G>C	uc002hdy.3	-	2	1416	c.1327C>G	c.(1327-1329)CTA>GTA	p.L443V	NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	443						nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)															---	---	---	---
G6PC	2538	broad.mit.edu	37	17	41063341	41063341	+	Silent	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41063341C>A	uc002icb.1	+	5	1051	c.972C>A	c.(970-972)GTC>GTA	p.V324V	G6PC_uc010whf.1_3'UTR	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	324	Helical; (Potential).				gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)										Glycogen_Storage_Disease_type_Ia				---	---	---	---
CRHR1	1394	broad.mit.edu	37	17	43893951	43893951	+	Intron	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43893951A>T	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron|CRHR1_uc010das.1_Intron|CRHR1_uc002ijo.1_Intron	NM_001145146	NP_001138618			corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)														---	---	---	---
CACNG5	27091	broad.mit.edu	37	17	64880742	64880742	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64880742G>A	uc010wqi.1	+	5	771	c.534G>A	c.(532-534)TCG>TCA	p.S178S	CACNG5_uc002jfr.2_Silent_p.S178S|CACNG5_uc010wqj.1_Silent_p.S178S	NM_145811	NP_665810	Q9UF02	CCG5_HUMAN	voltage-dependent calcium channel gamma-5	178	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)															---	---	---	---
CASKIN2	57513	broad.mit.edu	37	17	73500726	73500726	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73500726C>A	uc002joc.2	-	12	1791	c.1241G>T	c.(1240-1242)CGC>CTC	p.R414L	CASKIN2_uc010wsc.1_Missense_Mutation_p.R332L	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	414						cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
BAIAP2	10458	broad.mit.edu	37	17	79077493	79077493	+	Silent	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79077493G>T	uc002jzg.2	+	8	942	c.834G>T	c.(832-834)CCG>CCT	p.P278P	BAIAP2_uc002jyz.3_Silent_p.P278P|BAIAP2_uc002jza.2_Silent_p.P278P|BAIAP2_uc002jzc.2_Silent_p.P278P|BAIAP2_uc002jzb.2_Silent_p.P35P|BAIAP2_uc002jzd.2_Silent_p.P278P|BAIAP2_uc002jzf.2_Silent_p.P278P|BAIAP2_uc002jze.2_Silent_p.P311P|BAIAP2_uc010wuh.1_Silent_p.P200P|BAIAP2_uc002jzh.2_Silent_p.P279P|BAIAP2_uc010wui.1_Silent_p.P141P	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	278					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
PCYT2	5833	broad.mit.edu	37	17	79864773	79864773	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79864773C>T	uc002kcf.1	-	7	602	c.539G>A	c.(538-540)TGC>TAC	p.C180Y	PCYT2_uc010wva.1_Missense_Mutation_p.C148Y|PCYT2_uc010wvb.1_Missense_Mutation_p.C148Y|PCYT2_uc002kce.1_Missense_Mutation_p.C102Y|PCYT2_uc002kcg.1_Missense_Mutation_p.C209Y|PCYT2_uc002kch.1_Missense_Mutation_p.C198Y|PCYT2_uc002kci.1_Missense_Mutation_p.C139Y|PCYT2_uc010dii.1_Missense_Mutation_p.C180Y|PCYT2_uc010wvc.1_Missense_Mutation_p.C102Y	NM_002861	NP_002852	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	180	Catalytic 1 (Potential).				phospholipid biosynthetic process		ethanolamine-phosphate cytidylyltransferase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)															---	---	---	---
RIT2	6014	broad.mit.edu	37	18	40323674	40323674	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40323674T>G	uc002lav.2	-	5	611	c.438A>C	c.(436-438)GAA>GAC	p.E146D	RIT2_uc010dnf.2_3'UTR	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	146					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
ATP5A1	498	broad.mit.edu	37	18	43667467	43667467	+	Intron	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43667467A>G	uc002lbr.1	-						ATP5A1_uc010dnl.1_Intron|ATP5A1_uc002lbs.1_Intron|ATP5A1_uc002lbt.1_Intron	NM_004046	NP_004037			ATP synthase, H+ transporting, mitochondrial F1						ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0																		---	---	---	---
OR2Z1	284383	broad.mit.edu	37	19	8841983	8841983	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8841983C>T	uc010xkg.1	+	1	593	c.593C>T	c.(592-594)GCG>GTG	p.A198V		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2																OREG0007662	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=OR2Z1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	---	---	---	---
FBXL12	54850	broad.mit.edu	37	19	9922149	9922149	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9922149T>C	uc002mme.2	-	3	646	c.404A>G	c.(403-405)GAG>GGG	p.E135G	FBXL12_uc002mmd.2_Missense_Mutation_p.E82G|FBXL12_uc002mmf.2_Missense_Mutation_p.E82G|FBXL12_uc002mmg.2_Missense_Mutation_p.E82G|FBXL12_uc002mmh.2_Missense_Mutation_p.E82G	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	135							protein binding			lung(1)|kidney(1)	2																		---	---	---	---
DDX39	10212	broad.mit.edu	37	19	14520008	14520008	+	Intron	SNP	C	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14520008C>G	uc010xnp.1	-						DDX39_uc002myo.2_Intron|DDX39_uc010dzl.2_Intron	NM_005804	NP_005795			DEAD (Asp-Glu-Ala-Asp) box polypeptide 39						mRNA export from nucleus|nuclear mRNA splicing, via spliceosome	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding				0																		---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15063786	15063786	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15063786A>T	uc002naa.1	-	8	1461	c.1453T>A	c.(1453-1455)TTG>ATG	p.L485M	SLC1A6_uc010dzu.1_Missense_Mutation_p.L407M|SLC1A6_uc010xod.1_Missense_Mutation_p.L421M	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	485	Helical; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
NOTCH3	4854	broad.mit.edu	37	19	15289981	15289981	+	Silent	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15289981G>A	uc002nan.2	-	22	3649	c.3573C>T	c.(3571-3573)TGC>TGT	p.C1191C	NOTCH3_uc002nao.1_Silent_p.C1139C	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1191	Extracellular (Potential).|EGF-like 30; calcium-binding (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)															---	---	---	---
SF4	57794	broad.mit.edu	37	19	19413155	19413155	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19413155T>C	uc002nmh.2	-	7	808	c.806A>G	c.(805-807)AAG>AGG	p.K269R	SF4_uc002nmf.2_5'UTR|SF4_uc002nmg.2_5'UTR|SF4_uc002nmi.2_Missense_Mutation_p.K59R|SF4_uc002nmj.2_Missense_Mutation_p.K59R|SF4_uc010xqr.1_RNA|SF4_uc010xqs.1_RNA	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4	269	SURP motif 2.				nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0																		---	---	---	---
ZNF493	284443	broad.mit.edu	37	19	21606405	21606405	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21606405A>G	uc002npx.2	+	2	840	c.560A>G	c.(559-561)CAT>CGT	p.H187R	ZNF493_uc002npw.2_Missense_Mutation_p.H315R|ZNF493_uc002npy.2_Missense_Mutation_p.H187R	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	187	C2H2-type 6; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZNF43	7594	broad.mit.edu	37	19	21992435	21992435	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21992435T>C	uc002nqj.2	-	4	534	c.404A>G	c.(403-405)AAC>AGC	p.N135S	ZNF43_uc010ecv.2_Missense_Mutation_p.N129S|ZNF43_uc002nql.2_Missense_Mutation_p.N129S|ZNF43_uc002nqm.2_Missense_Mutation_p.N129S|ZNF43_uc002nqk.2_Missense_Mutation_p.N65S	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)														---	---	---	---
ZNF257	113835	broad.mit.edu	37	19	22270892	22270892	+	Silent	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22270892A>C	uc010ecx.2	+	4	509	c.340A>C	c.(340-342)AGA>CGA	p.R114R	ZNF257_uc010ecy.2_Silent_p.R82R	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	114					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF681	148213	broad.mit.edu	37	19	23927705	23927705	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23927705T>G	uc002nrk.3	-	4	789	c.647A>C	c.(646-648)CAT>CCT	p.H216P	ZNF681_uc002nrl.3_Missense_Mutation_p.H147P|ZNF681_uc002nrj.3_Missense_Mutation_p.H147P	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	216	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)																---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	31040340	31040340	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31040340A>G	uc002nsu.1	+	4	3952	c.3814A>G	c.(3814-3816)AGT>GGT	p.S1272G	ZNF536_uc010edd.1_Missense_Mutation_p.S1272G	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
ZNF569	148266	broad.mit.edu	37	19	37904498	37904498	+	Nonsense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904498A>T	uc002ogi.2	-	6	1620	c.1062T>A	c.(1060-1062)TAT>TAA	p.Y354*	ZNF569_uc002ogh.2_Nonsense_Mutation_p.Y195*|ZNF569_uc002ogj.2_Nonsense_Mutation_p.Y378*	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	354	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
ZNF569	148266	broad.mit.edu	37	19	37904499	37904499	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904499T>A	uc002ogi.2	-	6	1619	c.1061A>T	c.(1060-1062)TAT>TTT	p.Y354F	ZNF569_uc002ogh.2_Missense_Mutation_p.Y195F|ZNF569_uc002ogj.2_Missense_Mutation_p.Y378F	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	354	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38945944	38945944	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38945944G>A	uc002oit.2	+	14	1640	c.1510G>A	c.(1510-1512)GAG>AAG	p.E504K	RYR1_uc002oiu.2_Missense_Mutation_p.E504K	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	504	Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40366024	40366024	+	Intron	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40366024T>C	uc002omp.3	-							NM_003890	NP_003881			Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50962167	50962167	+	Intron	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50962167G>A	uc002psf.2	+							NM_004533	NP_004524			myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)														---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50962571	50962571	+	Intron	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50962571C>T	uc002psf.2	+							NM_004533	NP_004524			myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)														---	---	---	---
ZNF137	7696	broad.mit.edu	37	19	53100365	53100365	+	RNA	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53100365T>G	uc002pzt.2	+	1		c.429T>G				NR_023311				Homo sapiens zinc finger protein 137, mRNA (cDNA clone IMAGE:40016639).												0				GBM - Glioblastoma multiforme(134;0.0212)|OV - Ovarian serous cystadenocarcinoma(262;0.0221)														---	---	---	---
ZNF329	79673	broad.mit.edu	37	19	58640356	58640356	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58640356T>G	uc002qrn.2	-	4	752	c.515A>C	c.(514-516)AAG>ACG	p.K172T	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	172					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)														---	---	---	---
NINL	22981	broad.mit.edu	37	20	25484648	25484648	+	Silent	SNP	G	A	A	rs146594321		TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25484648G>A	uc002wux.1	-	7	875	c.801C>T	c.(799-801)CCC>CCT	p.P267P	NINL_uc010gdn.1_Silent_p.P267P|NINL_uc010gdo.1_Silent_p.P107P|NINL_uc010ztf.1_Silent_p.P283P	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	267	EF-hand 4.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
MYH7B	57644	broad.mit.edu	37	20	33578612	33578612	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33578612C>T	uc002xbi.1	+	21	2267	c.2175C>T	c.(2173-2175)AAC>AAT	p.N725N		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	683	Myosin head-like.|Actin-binding (By similarity).					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)															---	---	---	---
ERGIC3	51614	broad.mit.edu	37	20	34136253	34136253	+	Intron	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34136253G>T	uc002xct.2	+						ERGIC3_uc002xcr.1_Intron|ERGIC3_uc010zvg.1_Intron|ERGIC3_uc002xcs.2_Intron|ERGIC3_uc002xcu.2_Intron|ERGIC3_uc002xcv.2_Intron	NM_015966	NP_057050			serologically defined breast cancer antigen 84						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane	protein binding			large_intestine(2)|ovary(1)	3	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)															---	---	---	---
SDC4	6385	broad.mit.edu	37	20	43955966	43955966	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43955966T>C	uc002xnu.2	-	5	575	c.535A>G	c.(535-537)AGC>GGC	p.S179G	SDC4_uc010zws.1_Missense_Mutation_p.S107G	NM_002999	NP_002990	P31431	SDC4_HUMAN	syndecan 4 precursor	179	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZNF831	128611	broad.mit.edu	37	20	57767362	57767362	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57767362C>T	uc002yan.2	+	1	1288	c.1288C>T	c.(1288-1290)CGG>TGG	p.R430W		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	430						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)																	---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62837128	62837128	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62837128G>C	uc002yii.2	+	6	736	c.372G>C	c.(370-372)GAG>GAC	p.E124D	MYT1_uc002yih.2_Missense_Mutation_p.E124D|MYT1_uc002yij.2_5'Flank	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	124					cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
ADAMTS1	9510	broad.mit.edu	37	21	28211920	28211920	+	Missense_Mutation	SNP	C	G	G	rs147119544	byFrequency	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28211920C>G	uc002ymf.2	-	7	2469	c.2014G>C	c.(2014-2016)GTT>CTT	p.V672L		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	672	Cys-rich.				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)														---	---	---	---
KRTAP27-1	643812	broad.mit.edu	37	21	31709567	31709567	+	Silent	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31709567A>G	uc002ynx.1	-	1	446	c.420T>C	c.(418-420)AGT>AGC	p.S140S		NM_001077711	NP_001071179	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	140						intermediate filament				ovary(2)	2																		---	---	---	---
ITGB2	3689	broad.mit.edu	37	21	46326905	46326905	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46326905C>T	uc002zgd.2	-	3	297	c.253G>A	c.(253-255)GCT>ACT	p.A85T	ITGB2_uc002zge.2_Missense_Mutation_p.A85T|ITGB2_uc002zgf.3_Missense_Mutation_p.A85T|ITGB2_uc011afl.1_Missense_Mutation_p.A7T|ITGB2_uc010gpw.2_Missense_Mutation_p.A85T|ITGB2_uc002zgg.2_Missense_Mutation_p.A85T	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	85	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)													---	---	---	---
ADARB1	104	broad.mit.edu	37	21	46603400	46603400	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46603400C>T	uc002zgy.2	+	7	1806	c.1371C>T	c.(1369-1371)TTC>TTT	p.F457F	ADARB1_uc002zgr.2_Silent_p.F457F|ADARB1_uc002zgs.2_RNA|ADARB1_uc002zgw.2_Silent_p.F457F|ADARB1_uc002zgv.2_RNA|ADARB1_uc002zgt.2_Silent_p.F457F|ADARB1_uc010gpx.2_RNA|ADARB1_uc002zgq.2_RNA|ADARB1_uc002zgu.2_RNA	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2	457	A to I editase.				adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)														---	---	---	---
COL6A2	1292	broad.mit.edu	37	21	47532203	47532203	+	Silent	SNP	G	A	A	rs149480738	byFrequency	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47532203G>A	uc002zia.1	+	3	508	c.426G>A	c.(424-426)ACG>ACA	p.T142T	COL6A2_uc002zhy.1_Silent_p.T142T|COL6A2_uc002zhz.1_Silent_p.T142T|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	142	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
LZTR1	8216	broad.mit.edu	37	22	21347143	21347143	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21347143G>A	uc002zto.2	+	11	1313	c.1210G>A	c.(1210-1212)GGG>AGG	p.G404R	LZTR1_uc002ztn.2_Missense_Mutation_p.G363R|LZTR1_uc011ahy.1_Missense_Mutation_p.G385R|LZTR1_uc010gsr.1_Missense_Mutation_p.G275R	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	404	Kelch 6.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)															---	---	---	---
MGAT3	4248	broad.mit.edu	37	22	39883517	39883517	+	Silent	SNP	G	A	A	rs143400156	byFrequency	TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39883517G>A	uc003axv.3	+	2	404	c.165G>A	c.(163-165)CCG>CCA	p.P55P	MGAT3_uc010gxy.2_Silent_p.P55P	NM_002409	NP_002400	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein	55	Lumenal (Potential).|Pro-rich.				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity				0	Melanoma(58;0.04)																	---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	40036887	40036887	+	Silent	SNP	C	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40036887C>T	uc003ayc.2	+	6	756	c.756C>T	c.(754-756)GCC>GCT	p.A252A	CACNA1I_uc003ayd.2_Silent_p.A252A|CACNA1I_uc003aye.2_Silent_p.A167A|CACNA1I_uc003ayf.2_Silent_p.A167A	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	252	I.|Extracellular (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
PDHA1	5160	broad.mit.edu	37	X	19372671	19372671	+	Silent	SNP	G	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19372671G>C	uc004czg.3	+	6	718	c.573G>C	c.(571-573)CTG>CTC	p.L191L	PDHA1_uc004czh.3_Silent_p.L226L|PDHA1_uc011mjc.1_Silent_p.L195L|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Silent_p.L188L|PDHA1_uc010nfl.2_5'Flank	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor	191					glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)													---	---	---	---
FAM123B	139285	broad.mit.edu	37	X	63409832	63409832	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63409832T>G	uc004dvo.2	-	2	3608	c.3335A>C	c.(3334-3336)GAG>GCG	p.E1112A		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	1112					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112																		---	---	---	---
AR	367	broad.mit.edu	37	X	66941796	66941796	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66941796T>G	uc004dwu.1	+	6	3555	c.2440T>G	c.(2440-2442)TTC>GTC	p.F814V	AR_uc004dwv.1_Missense_Mutation_p.F282V	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	813	Ligand-binding.|Interaction with MYST2.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)									Androgen_Insensitivity_Syndrome				---	---	---	---
HDAC8	55869	broad.mit.edu	37	X	71549911	71549911	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71549911A>G	uc004eau.2	-	11	1169	c.1127T>C	c.(1126-1128)GTG>GCG	p.V376A	HDAC8_uc011mqe.1_Missense_Mutation_p.V233A|HDAC8_uc011mqf.1_Missense_Mutation_p.V181A|HDAC8_uc011mqg.1_Missense_Mutation_p.V285A	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	376					chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)													---	---	---	---
ATRX	546	broad.mit.edu	37	X	76944359	76944359	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76944359T>C	uc004ecp.3	-	7	778	c.546A>G	c.(544-546)CAA>CAG	p.Q182Q	ATRX_uc004ecq.3_Silent_p.Q144Q|ATRX_uc004eco.3_5'UTR|ATRX_uc004ecr.2_Silent_p.Q143Q|ATRX_uc010nlx.1_Silent_p.Q182Q|ATRX_uc010nly.1_Silent_p.Q127Q	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	182	ADD.|GATA-type; atypical.		Missing (in ATRX).		DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						---	---	---	---
CYLC1	1538	broad.mit.edu	37	X	83124879	83124879	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83124879A>C	uc004eei.1	+	2	45	c.24A>C	c.(22-24)AAA>AAC	p.K8N	CYLC1_uc004eeh.1_Missense_Mutation_p.K7N	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	8					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5																		---	---	---	---
CYLC1	1538	broad.mit.edu	37	X	83129288	83129288	+	Silent	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83129288T>C	uc004eei.1	+	4	1593	c.1572T>C	c.(1570-1572)TTT>TTC	p.F524F	CYLC1_uc004eeh.1_Silent_p.F523F	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	524	7.				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5																		---	---	---	---
DACH2	117154	broad.mit.edu	37	X	85950165	85950165	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85950165A>T	uc004eew.2	+	5	1084	c.914A>T	c.(913-915)AAC>ATC	p.N305I	DACH2_uc004eex.2_Missense_Mutation_p.N292I|DACH2_uc010nmq.2_Missense_Mutation_p.N171I|DACH2_uc011mra.1_Missense_Mutation_p.N138I|DACH2_uc010nmr.2_Missense_Mutation_p.N86I	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	305					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5																		---	---	---	---
FAM133A	286499	broad.mit.edu	37	X	92965165	92965165	+	Nonstop_Mutation	SNP	A	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92965165A>T	uc004efr.1	+	4	1060	c.747A>T	c.(745-747)TAA>TAT	p.*249Y		NM_173698	NP_775969	Q8N9E0	F133A_HUMAN	hypothetical protein LOC286499	249											0																		---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	104512136	104512136	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104512136A>C	uc004elz.1	+	5	1365	c.609A>C	c.(607-609)GAA>GAC	p.E203D		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	203	Ig-like C2-type 2.|Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
MUM1L1	139221	broad.mit.edu	37	X	105450084	105450084	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105450084T>C	uc004emf.1	+	4	1308	c.659T>C	c.(658-660)GTG>GCG	p.V220A	MUM1L1_uc004emg.1_Missense_Mutation_p.V220A	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	220										ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
MAGEC3	139081	broad.mit.edu	37	X	140985099	140985099	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140985099G>T	uc011mwp.1	+	7	1555	c.1555G>T	c.(1555-1557)GAC>TAC	p.D519Y	MAGEC3_uc004fbs.2_Missense_Mutation_p.D221Y|MAGEC3_uc010nsj.2_Missense_Mutation_p.D221Y	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	519	MAGE 2.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
AFF2	2334	broad.mit.edu	37	X	148039901	148039901	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148039901A>C	uc004fcp.2	+	12	3082	c.2603A>C	c.(2602-2604)AAG>ACG	p.K868T	AFF2_uc004fcq.2_Missense_Mutation_p.K858T|AFF2_uc004fcr.2_Missense_Mutation_p.K829T|AFF2_uc011mxb.1_Missense_Mutation_p.K833T|AFF2_uc004fcs.2_Missense_Mutation_p.K835T|AFF2_uc011mxc.1_Missense_Mutation_p.K509T	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	868					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
GABRQ	55879	broad.mit.edu	37	X	151820193	151820193	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-5578-01	TCGA-D7-5578-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151820193G>A	uc004ffp.1	+	8	1126	c.1106G>A	c.(1105-1107)CGA>CAA	p.R369Q		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	369						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
