Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PTPRU	10076	broad.mit.edu	37	1	29631194	29631194	+	Intron	DEL	C	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29631194delC	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695			protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
F11R	50848	broad.mit.edu	37	1	160968962	160968969	+	Intron	DEL	GCGAGAAT	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160968962_160968969delGCGAGAAT	uc009wtt.2	-						F11R_uc010pjv.1_Intron|F11R_uc001fxe.3_Intron|F11R_uc009wtu.2_Intron|F11R_uc010pjw.1_Intron|F11R_uc001fxf.3_Intron	NM_016946	NP_058642			F11 receptor precursor						blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction				ovary(2)	2	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)															---	---	---	---
GFPT1	2673	broad.mit.edu	37	2	69555227	69555227	+	Intron	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69555227delA	uc002sfh.2	-							NM_002056	NP_002047			glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1																		---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91843055	91843056	+	Intron	INS	-	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91843055_91843056insA	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
NCK2	8440	broad.mit.edu	37	2	106509302	106509302	+	Intron	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106509302delA	uc002tdg.2	+						NCK2_uc002tdh.2_Intron|NCK2_uc002tdi.2_Intron	NM_003581	NP_003572			NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
C3orf37	56941	broad.mit.edu	37	3	129007680	129007682	+	Intron	DEL	TCT	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129007680_129007682delTCT	uc003elt.2	+						C3orf37_uc003elu.2_Intron|C3orf37_uc003elv.2_Intron|C3orf37_uc003elw.2_Intron	NM_020187	NP_064572			hypothetical protein LOC56941											ovary(1)	1																		---	---	---	---
PARL	55486	broad.mit.edu	37	3	183585488	183585488	+	Intron	DEL	A	-	-	rs111387397		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183585488delA	uc003fmd.2	-						PARL_uc003fme.2_Intron	NM_018622	NP_061092			presenilin associated, rhomboid-like isoform 1						proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193180773	193180774	+	Intron	INS	-	A	A	rs9882995	by1000genomes	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193180773_193180774insA	uc003ftd.2	-						ATP13A4_uc003fte.1_Intron|ATP13A4_uc011bsr.1_Intron|ATP13A4_uc010hzi.2_Intron|ATP13A4_uc003ftf.3_Intron	NM_032279	NP_115655			ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54325444	54325445	+	Intron	INS	-	T	T	rs34707349		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54325444_54325445insT	uc003haa.2	+						FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron|FIP1L1_uc010ign.2_Intron|FIP1L1_uc003had.2_Intron|FIP1L1_uc003hae.2_Intron	NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103826510	103826511	+	Intron	DEL	CA	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103826510_103826511delCA	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
BRD8	10902	broad.mit.edu	37	5	137495056	137495057	+	Intron	DEL	CA	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137495056_137495057delCA	uc003lcf.1	-						BRD8_uc003lcc.1_Intron|BRD8_uc011cyl.1_Intron|BRD8_uc003lcg.2_Intron|BRD8_uc003lci.2_Intron|BRD8_uc003lch.2_Intron|BRD8_uc011cym.1_Intron|BRD8_uc010jer.1_Intron|BRD8_uc011cyn.1_Intron	NM_139199	NP_631938			bromodomain containing 8 isoform 2						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142273722	142273722	+	Intron	DEL	T	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142273722delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
CSF1R	1436	broad.mit.edu	37	5	149437078	149437078	+	Frame_Shift_Del	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149437078delA	uc003lrl.2	-	15	2405	c.2210delT	c.(2209-2211)TTCfs	p.F737fs	CSF1R_uc011dcd.1_Intron|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Frame_Shift_Del_p.F737fs	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	737	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)													---	---	---	---
SMAP1	60682	broad.mit.edu	37	6	71567990	71567990	+	Intron	DEL	C	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71567990delC	uc003pfr.2	+						SMAP1_uc003pfs.2_Intron|SMAP1_uc010kao.2_Intron|SMAP1_uc010kap.2_Intron	NM_001044305	NP_001037770			stromal membrane-associated GTPase-activating						regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0																		---	---	---	---
ANLN	54443	broad.mit.edu	37	7	36466798	36466799	+	Intron	INS	-	T	T	rs34986676		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36466798_36466799insT	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155			anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3																		---	---	---	---
CALD1	800	broad.mit.edu	37	7	134643159	134643159	+	Intron	DEL	T	-	-	rs34562702		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134643159delT	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron|CALD1_uc011kpu.1_Intron|CALD1_uc011kpv.1_Intron|CALD1_uc003vse.2_Intron|CALD1_uc010lmn.2_5'Flank	NM_033138	NP_149129			caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	142032162	142032163	+	Intron	DEL	GA	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142032162_142032163delGA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krs.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
ASAH1	427	broad.mit.edu	37	8	17924613	17924642	+	Intron	DEL	CCTGTGCTGTATATCTAAGACATACAGCAC	-	-	rs146985683		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17924613_17924642delCCTGTGCTGTATATCTAAGACATACAGCAC	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592			N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)														---	---	---	---
ADAM28	10863	broad.mit.edu	37	8	24187383	24187386	+	Intron	DEL	TGTG	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24187383_24187386delTGTG	uc003xdy.2	+						ADAM28_uc003xdx.2_Intron|ADAM28_uc011kzz.1_Intron|ADAM28_uc011laa.1_Intron|ADAM28_uc010lua.2_Intron	NM_014265	NP_055080			ADAM metallopeptidase domain 28 isoform 1						proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	130209777	130209778	+	IGR	INS	-	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130209777_130209778insA								ZNF79 (2127 upstream) : RPL12 (177 downstream)																																			---	---	---	---
MED27	9442	broad.mit.edu	37	9	134953129	134953129	+	Intron	DEL	A	-	-	rs76460072		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134953129delA	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron|MED27_uc004cbg.3_Intron	NM_004269	NP_004260			mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)														---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12870642	12870643	+	Intron	INS	-	A	A	rs72066238		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12870642_12870643insA	uc001ilo.2	+							NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
USP54	159195	broad.mit.edu	37	10	75290191	75290194	+	Frame_Shift_Del	DEL	CTGA	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75290191_75290194delCTGA	uc001juo.2	-	12	1552_1555	c.1535_1538delTCAG	c.(1534-1539)GTCAGCfs	p.V512fs	USP54_uc001juk.2_5'UTR|USP54_uc001jul.2_5'UTR|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA|USP54_uc001jup.2_Frame_Shift_Del_p.V512fs|USP54_uc010qkl.1_Frame_Shift_Del_p.V512fs	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	512_513					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)																	---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93170292	93170292	+	Frame_Shift_Del	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93170292delA	uc001khl.2	+	1	197	c.97delA	c.(97-99)AAGfs	p.K33fs	LOC100188947_uc010qnl.1_Intron|HECTD2_uc001khk.2_Frame_Shift_Del_p.K33fs|HECTD2_uc010qnm.1_Frame_Shift_Del_p.K33fs|HECTD2_uc001khm.2_RNA	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	33					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1																		---	---	---	---
CYP26C1	340665	broad.mit.edu	37	10	94826082	94826088	+	Intron	DEL	CCTGCCG	-	-	rs61863115	by1000genomes	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94826082_94826088delCCTGCCG	uc010qns.1	+						CYP26C1_uc009xud.2_Intron	NM_183374	NP_899230			cytochrome P450, family 26, subfamily C,						anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	117907821	117907821	+	Intron	DEL	C	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117907821delC	uc001prx.1	-						uc001pry.1_Intron|uc001prz.1_Intron|uc009yzs.1_Intron|uc001psa.1_Intron					Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit26-03-15-R.																														---	---	---	---
PDZD3	79849	broad.mit.edu	37	11	119057868	119057868	+	Intron	DEL	G	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119057868delG	uc001pwb.2	+						PDZD3_uc001pvy.2_Intron|PDZD3_uc001pvz.2_Intron|PDZD3_uc010rzd.1_Intron|PDZD3_uc001pwa.2_Intron					RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;						cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)														---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112657407	112657407	+	Intron	DEL	T	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112657407delT	uc009zwc.2	-						C12orf51_uc001ttr.1_Intron	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
NID2	22795	broad.mit.edu	37	14	52527098	52527098	+	Intron	DEL	G	-	-	rs975026		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52527098delG	uc001wzo.2	-						NID2_uc010tqs.1_Intron|NID2_uc010tqt.1_Intron|NID2_uc001wzp.2_Intron	NM_007361	NP_031387			nidogen 2 precursor							basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)																	---	---	---	---
Unknown	0	broad.mit.edu	37	15	45902861	45902861	+	IGR	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45902861delA								PLDN (953 upstream) : SQRDL (20485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86155500	86155505	+	IGR	DEL	CCTCCT	-	-	rs112904319		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86155500_86155505delCCTCCT								IRF8 (199291 upstream) : LOC732275 (209951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	8102780	8102781	+	IGR	DEL	TT	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8102780_8102781delTT								C17orf59 (9216 upstream) : AURKB (5269 downstream)																																			---	---	---	---
TADA2A	6871	broad.mit.edu	37	17	35800791	35800792	+	Intron	INS	-	TAC	TAC			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35800791_35800792insTAC	uc002hnt.2	+						TADA2A_uc002hnu.1_Intron|TADA2A_uc002hnv.2_Intron|TADA2A_uc010wdd.1_Intron|TADA2A_uc002hnw.2_Intron|TADA2A_uc010cvb.2_Intron	NM_001488	NP_001479			transcriptional adaptor 2A isoform a						histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4																		---	---	---	---
SLC16A6	9120	broad.mit.edu	37	17	66265043	66265043	+	3'UTR	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66265043delA	uc002jgz.1	-	6					ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_3'UTR	NM_004694	NP_004685			solute carrier family 16, member 6							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																																			---	---	---	---
KIAA1543	57662	broad.mit.edu	37	19	7675204	7675204	+	Intron	DEL	A	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7675204delA	uc002mgv.3	+						KIAA1543_uc002mgu.3_Intron	NM_020902	NP_065953			NEZHA isoform 2						epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1																		---	---	---	---
FPR3	2359	broad.mit.edu	37	19	52327718	52327734	+	Frame_Shift_Del	DEL	CTTACGTGTCTTCGCTG	-	-	rs116930736	by1000genomes	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52327718_52327734delCTTACGTGTCTTCGCTG	uc002pxt.1	+	2	901_917	c.717_733delCTTACGTGTCTTCGCTG	c.(715-735)CCCTTACGTGTCTTCGCTGCTfs	p.P239fs		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	239_245	Helical; Name=6; (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6																		---	---	---	---
ZNF460	10794	broad.mit.edu	37	19	57796182	57796182	+	Intron	DEL	T	-	-	rs72263734		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57796182delT	uc002qog.2	+						ZNF460_uc010ygv.1_Intron	NM_006635	NP_006626			zinc finger protein 460						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	49153144	49153145	+	IGR	INS	-	AGG	AGG			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49153144_49153145insAGG								FAM19A5 (5402 upstream) : C22orf34 (655031 downstream)																																			---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41089604	41089604	+	Intron	DEL	G	-	-	rs113167827		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41089604delG	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679			ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
USP11	8237	broad.mit.edu	37	X	47100548	47100549	+	Intron	DEL	CT	-	-			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47100548_47100549delCT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642			ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
CLCN5	1184	broad.mit.edu	37	X	49850800	49850801	+	Intron	INS	-	TTA	TTA			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49850800_49850801insTTA	uc004dos.1	+						CLCN5_uc004dor.1_Intron|CLCN5_uc004doq.1_Intron|CLCN5_uc004dot.1_Intron	NM_000084	NP_000075			chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)																	---	---	---	---
MATN1	4146	broad.mit.edu	37	1	31188944	31188944	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31188944G>A	uc001brz.2	-	5	1053	c.1019C>T	c.(1018-1020)GCG>GTG	p.A340V	uc001bsb.1_5'Flank|MATN1_uc001bsa.1_Missense_Mutation_p.A258V	NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein precursor	340	VWFA 2.				protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PABPC4	8761	broad.mit.edu	37	1	40033125	40033125	+	Intron	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40033125C>A	uc010oiv.1	-						PABPC4_uc001cdl.2_Intron|PABPC4_uc001cdm.2_Intron|SNORA55_uc001cdo.1_RNA	NM_003819	NP_003810			poly A binding protein, cytoplasmic 4 isoform 2						blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152192589	152192589	+	Nonsense_Mutation	SNP	G	A	A	rs115929005		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192589G>A	uc001ezt.1	-	3	1592	c.1516C>T	c.(1516-1518)CGA>TGA	p.R506*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	506	5.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ARHGEF11	9826	broad.mit.edu	37	1	156909511	156909511	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156909511C>T	uc001fqo.2	-	36	4845	c.3805G>A	c.(3805-3807)GGG>AGG	p.G1269R	ARHGEF11_uc010phu.1_Missense_Mutation_p.G685R|ARHGEF11_uc001fqn.2_Missense_Mutation_p.G1309R	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1269					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)																	---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161018192	161018192	+	Silent	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018192G>A	uc001fxl.2	-	12	2965	c.2619C>T	c.(2617-2619)GAC>GAT	p.D873D	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Intron|ARHGAP30_uc001fxm.2_Silent_p.D719D|ARHGAP30_uc009wtx.2_Silent_p.D546D	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	873	Glu-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
FMO2	2327	broad.mit.edu	37	1	171162660	171162660	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171162660C>A	uc001ghk.1	+	3	436	c.319C>A	c.(319-321)CAG>AAG	p.Q107K	FMO2_uc010pmd.1_5'UTR	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	107					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186057138	186057138	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186057138T>A	uc001grq.1	+	61	9667	c.9438T>A	c.(9436-9438)AAT>AAA	p.N3146K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3146	Ig-like C2-type 29.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
CACNA1S	779	broad.mit.edu	37	1	201023635	201023635	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201023635C>T	uc001gvv.2	-	29	3891	c.3664G>A	c.(3664-3666)GTT>ATT	p.V1222I		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1222	IV.|Extracellular (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204429064	204429064	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204429064G>C	uc001haw.2	-	9	1987	c.1508C>G	c.(1507-1509)GCC>GGC	p.A503G	PIK3C2B_uc010pqv.1_Missense_Mutation_p.A503G|PIK3C2B_uc001hax.1_Missense_Mutation_p.A503G|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	503					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166802093	166802093	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166802093G>A	uc002udk.2	-	4	503	c.370C>T	c.(370-372)CAT>TAT	p.H124Y	TTC21B_uc002udl.2_Missense_Mutation_p.H124Y|uc002udm.1_Intron	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	124	TPR 1.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
C2orf60	129450	broad.mit.edu	37	2	200797977	200797977	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200797977G>A	uc002uvi.3	-	8	1027	c.761C>T	c.(760-762)CCA>CTA	p.P254L	C2orf60_uc002uvj.3_Missense_Mutation_p.P91L|C2orf60_uc002uvk.3_RNA|C2orf60_uc010fss.2_Missense_Mutation_p.P91L	NM_001039693	NP_001034782	A2RUC4	TYW5_HUMAN	hypothetical protein LOC129450	254	JmjC.				wybutosine biosynthetic process		iron ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein homodimerization activity|tRNA binding				0																		---	---	---	---
MDH1B	130752	broad.mit.edu	37	2	207619947	207619947	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207619947C>T	uc002vbs.2	-	5	751	c.696G>A	c.(694-696)AGG>AGA	p.R232R	MDH1B_uc010ziw.1_Intron|MDH1B_uc010fui.2_Silent_p.R232R|MDH1B_uc010fuj.2_Silent_p.R134R|MDH1B_uc002vbt.2_Intron	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	232					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1443106	1443106	+	Intron	SNP	T	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1443106T>C	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56468846	56468846	+	Silent	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56468846G>A	uc003dhr.1	-	2	446	c.190C>T	c.(190-192)CTG>TTG	p.L64L		NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	64						cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
MRPL3	11222	broad.mit.edu	37	3	131197966	131197966	+	Intron	SNP	C	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131197966C>G	uc003eoh.2	-						MRPL3_uc011blo.1_Intron|MRPL3_uc011blp.1_Intron|SNORA58_uc003eoi.1_RNA	NM_007208	NP_009139			mitochondrial ribosomal protein L3						translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0																		---	---	---	---
SERPINI1	5274	broad.mit.edu	37	3	167543114	167543114	+	3'UTR	SNP	T	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167543114T>A	uc003ffa.3	+	9					SERPINI1_uc003ffb.3_3'UTR	NM_001122752	NP_001116224			neuroserpin precursor						central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1																		---	---	---	---
CPZ	8532	broad.mit.edu	37	4	8620263	8620263	+	Intron	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8620263C>T	uc003glm.2	+						CPZ_uc003gll.2_Intron|CPZ_uc003gln.2_Intron|CPZ_uc003glo.2_Intron|CPZ_uc003glp.2_Intron	NM_001014447	NP_001014447			carboxypeptidase Z isoform 1						proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
RPS3A	6189	broad.mit.edu	37	4	152023242	152023242	+	Intron	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152023242G>A	uc003ilz.2	+						RPS3A_uc011cie.1_Intron|SNORD73A_uc003ima.1_5'Flank	NM_001006	NP_000997			ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)																	---	---	---	---
KIF4B	285643	broad.mit.edu	37	5	154394974	154394974	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154394974C>A	uc010jih.1	+	1	1715	c.1555C>A	c.(1555-1557)CAA>AAA	p.Q519K		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	519	Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)															---	---	---	---
NKX2-5	1482	broad.mit.edu	37	5	172661792	172661792	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172661792C>T	uc003mcm.1	-	1	471	c.295G>A	c.(295-297)GAC>AAC	p.D99N	NKX2-5_uc011dfe.1_Missense_Mutation_p.D99N|NKX2-5_uc010jjt.1_Missense_Mutation_p.D99N	NM_004387	NP_004378	P52952	NKX25_HUMAN	NK2 transcription factor related, locus 5	99	Ala/Pro-rich.				adult heart development|atrial cardiac muscle cell development|atrial septum morphogenesis|heart looping|hemopoiesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell apoptosis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|outflow tract septum morphogenesis|pharyngeal system development|positive regulation of calcium ion transport via voltage-gated calcium channel activity|positive regulation of cardioblast differentiation|positive regulation of cell proliferation|positive regulation of heart contraction|positive regulation of neuron differentiation|positive regulation of sodium ion transport|positive regulation of survival gene product expression|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of cardiac muscle contraction|right ventricular cardiac muscle tissue morphogenesis|septum secundum development|spleen development|thyroid gland development|vasculogenesis|ventricular septum morphogenesis		chromatin binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
HIST1H3E	8353	broad.mit.edu	37	6	26225435	26225435	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26225435G>T	uc003nhb.2	+	2	413	c.53G>T	c.(52-54)CGC>CTC	p.R18L	HIST1H3E_uc003nhc.3_Missense_Mutation_p.R18L	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	18					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)																---	---	---	---
CCHCR1	54535	broad.mit.edu	37	6	31124558	31124558	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31124558C>T	uc003nsr.3	-	3	303	c.180G>A	c.(178-180)ATG>ATA	p.M60I	CCHCR1_uc011dne.1_Missense_Mutation_p.M60I|CCHCR1_uc003nsq.3_Missense_Mutation_p.M113I|CCHCR1_uc003nsp.3_Missense_Mutation_p.M149I|CCHCR1_uc010jsk.1_Missense_Mutation_p.M60I|TCF19_uc003nss.2_5'Flank|TCF19_uc003nst.2_5'Flank	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	60					cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1																		---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76623819	76623819	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76623819G>A	uc003pih.1	+	34	3758	c.3479G>A	c.(3478-3480)CGG>CAG	p.R1160Q	MYO6_uc003pii.1_Missense_Mutation_p.R1137Q|MYO6_uc003pij.1_Missense_Mutation_p.R108Q	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	1169					actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)														---	---	---	---
CASP8AP2	9994	broad.mit.edu	37	6	90576103	90576103	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90576103C>T	uc003pnr.2	+	8	3290	c.3094C>T	c.(3094-3096)CCC>TCC	p.P1032S	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.P1032S|CASP8AP2_uc011dzz.1_Missense_Mutation_p.P1032S	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1032					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)														---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37890317	37890317	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37890317G>A	uc003tfn.2	+	5	550	c.178G>A	c.(178-180)GAA>AAA	p.E60K		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	60	Thioredoxin.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42005045	42005045	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42005045G>T	uc011kbh.1	-	15	3717	c.3626C>A	c.(3625-3627)CCT>CAT	p.P1209H	GLI3_uc011kbg.1_Missense_Mutation_p.P1150H	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1209					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
COG5	10466	broad.mit.edu	37	7	107053002	107053002	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107053002C>T	uc003ved.2	-	7	1232	c.707G>A	c.(706-708)CGA>CAA	p.R236Q	COG5_uc003vec.2_Missense_Mutation_p.R236Q|COG5_uc003vee.2_Missense_Mutation_p.R236Q	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform	236					intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69002905	69002905	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002905C>T	uc003xxv.1	+	20	2232	c.2205C>T	c.(2203-2205)GTC>GTT	p.V735V	PREX2_uc003xxu.1_Silent_p.V735V|PREX2_uc011lez.1_Silent_p.V670V	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	735	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87567070	87567070	+	Intron	SNP	T	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87567070T>C	uc003ydv.2	+						CPNE3_uc003ydw.1_Intron	NM_003909	NP_003900			copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	87917328	87917328	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87917328T>G	uc003ydy.2	+	3	226	c.178T>G	c.(178-180)TTA>GTA	p.L60V		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	60										ovary(3)	3																		---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2039809	2039809	+	Silent	SNP	G	A	A	rs34035317		TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2039809G>A	uc003zhc.2	+	4	798	c.699G>A	c.(697-699)CAG>CAA	p.Q233Q	SMARCA2_uc003zhd.2_Silent_p.Q233Q|SMARCA2_uc010mha.2_Silent_p.Q224Q	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	233	Poly-Gln.				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
MLLT3	4300	broad.mit.edu	37	9	20414379	20414379	+	Silent	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414379G>A	uc003zoe.2	-	5	724	c.465C>T	c.(463-465)AGC>AGT	p.S155S	MLLT3_uc011lne.1_Silent_p.S123S|MLLT3_uc011lnf.1_Silent_p.S152S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Silent_p.S123S	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	155	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)				T	MLL	ALL								---	---	---	---
TMEM8B	51754	broad.mit.edu	37	9	35853551	35853551	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35853551G>A	uc003zym.2	+	14	2148	c.1133G>A	c.(1132-1134)CGC>CAC	p.R378H	TMEM8B_uc003zyo.2_Missense_Mutation_p.R378H	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a	378	Cytoplasmic (Potential).				cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37431066	37431066	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431066C>A	uc001iza.1	+	7	1172	c.1073C>A	c.(1072-1074)CCT>CAT	p.P358H		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	414						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---
CHUK	1147	broad.mit.edu	37	10	101979084	101979084	+	Silent	SNP	G	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101979084G>C	uc001kqp.2	-	6	562	c.507C>G	c.(505-507)GCC>GCG	p.A169A		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	169	Protein kinase.				I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)														---	---	---	---
OR5W2	390148	broad.mit.edu	37	11	55681260	55681260	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681260A>T	uc010rir.1	-	1	799	c.799T>A	c.(799-801)TCT>ACT	p.S267T		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	267	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
OR5M1	390168	broad.mit.edu	37	11	56380308	56380308	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56380308G>A	uc001nja.1	-	1	671	c.671C>T	c.(670-672)GCG>GTG	p.A224V		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1																		---	---	---	---
ZP1	22917	broad.mit.edu	37	11	60641001	60641001	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60641001C>A	uc001nqd.2	+	8	1414	c.1394C>A	c.(1393-1395)CCC>CAC	p.P465H	ZP1_uc001nqe.2_Missense_Mutation_p.P172H	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 precursor	465	Extracellular (Potential).|ZP.				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64375009	64375009	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64375009C>T	uc001oap.2	-	8	2171	c.1660G>A	c.(1660-1662)GTG>ATG	p.V554M	NRXN2_uc001oar.2_Missense_Mutation_p.V1600M|NRXN2_uc001oas.2_Missense_Mutation_p.V1530M|NRXN2_uc001oao.2_Missense_Mutation_p.V240M|NRXN2_uc001oaq.2_Missense_Mutation_p.V1267M	NM_138734	NP_620063	P58401	NRX2B_HUMAN	neurexin 2 isoform beta precursor	554	Extracellular (Potential).				cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99872816	99872816	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99872816G>T	uc001pga.2	+	9	1267	c.928G>T	c.(928-930)GTT>TTT	p.V310F	CNTN5_uc009ywv.1_Missense_Mutation_p.V310F|CNTN5_uc001pfz.2_Missense_Mutation_p.V310F|CNTN5_uc001pgb.2_Missense_Mutation_p.V236F	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	310	Ig-like C2-type 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
PIK3C2G	5288	broad.mit.edu	37	12	18658217	18658217	+	Intron	SNP	A	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18658217A>G	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561			phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)																---	---	---	---
UNG	7374	broad.mit.edu	37	12	109536126	109536126	+	Intron	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109536126C>T	uc001tnz.1	+						UNG_uc001toa.1_5'UTR	NM_080911	NP_550433			uracil-DNA glycosylase isoform UNG2						base-excision repair|interspecies interaction between organisms	mitochondrion|nucleus	protein binding|uracil DNA N-glycosylase activity			lung(1)|central_nervous_system(1)	2													BER_DNA_glycosylases	Immune_Deficiency_with_Hyper-IgM				---	---	---	---
PIWIL1	9271	broad.mit.edu	37	12	130841471	130841471	+	Nonsense_Mutation	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130841471C>A	uc001uik.2	+	13	1503	c.1413C>A	c.(1411-1413)TAC>TAA	p.Y471*	PIWIL1_uc001uij.1_Nonsense_Mutation_p.Y471*	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	471					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)														---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72440210	72440210	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72440210G>T	uc010thn.1	-	2	1115	c.692C>A	c.(691-693)ACC>AAC	p.T231N	DACH1_uc010tho.1_Missense_Mutation_p.T231N|DACH1_uc010thp.1_Missense_Mutation_p.T231N	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	231	Interaction with SIX6 and HDAC3 (By similarity).|DACHbox-N.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
RTN1	6252	broad.mit.edu	37	14	60194301	60194301	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60194301C>T	uc001xen.1	-	3	1310	c.1101G>A	c.(1099-1101)TCG>TCA	p.S367S	RTN1_uc001xem.1_5'UTR	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	367					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)														---	---	---	---
HIF1A	3091	broad.mit.edu	37	14	62207881	62207881	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62207881G>A	uc001xfq.2	+	12	2472	c.2068G>A	c.(2068-2070)GTG>ATG	p.V690M	HIF1A_uc001xfr.2_Missense_Mutation_p.V690M|HIF1A_uc001xfs.2_Missense_Mutation_p.V691M	NM_001530	NP_001521	Q16665	HIF1A_HUMAN	hypoxia-inducible factor 1, alpha subunit	690	ID.				cellular response to hypoxia|collagen metabolic process|connective tissue replacement involved in inflammatory response wound healing|elastin metabolic process|epithelial to mesenchymal transition|oxygen homeostasis|positive regulation of chemokine production|positive regulation of epithelial cell migration|positive regulation of hormone biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|regulation of transforming growth factor-beta2 production	cytoplasm|nucleolus|transcription factor complex	histone acetyltransferase binding|Hsp90 protein binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			kidney(3)|lung(1)	4				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)														---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45444704	45444704	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45444704C>T	uc001zus.1	+	26	3760	c.3414C>T	c.(3412-3414)ATC>ATT	p.I1138I	DUOX1_uc001zut.1_Silent_p.I1138I|DUOX1_uc010bee.1_Silent_p.I518I|DUOX1_uc001zuu.2_Silent_p.I280I	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor	1138	Ferric oxidoreductase.|Interaction with TXNDC11 (By similarity).|Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)														---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88576112	88576112	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88576112G>T	uc002bme.1	-	13	1723	c.1561C>A	c.(1561-1563)CAC>AAC	p.H521N	NTRK3_uc002bmh.2_Missense_Mutation_p.H513N|NTRK3_uc002bmf.1_Missense_Mutation_p.H521N|NTRK3_uc010upl.1_Missense_Mutation_p.H423N|NTRK3_uc010bnh.1_Missense_Mutation_p.H513N|NTRK3_uc002bmg.2_Missense_Mutation_p.H521N|NTRK3_uc010bni.2_RNA	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	521	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
ZNF500	26048	broad.mit.edu	37	16	4802555	4802555	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4802555G>A	uc002cxp.1	-	6	1512	c.1265C>T	c.(1264-1266)TCG>TTG	p.S422L	ZNF500_uc002cxo.1_Missense_Mutation_p.S214L|ZNF500_uc010uxt.1_Missense_Mutation_p.S422L	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	422	C2H2-type 4.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7629790	7629790	+	Silent	SNP	C	T	T	rs145861898	byFrequency	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7629790C>T	uc002cys.2	+	6	1270	c.282C>T	c.(280-282)GAC>GAT	p.D94D	A2BP1_uc010buf.1_Silent_p.D94D|A2BP1_uc002cyr.1_Silent_p.D93D|A2BP1_uc002cyt.2_Silent_p.D94D|A2BP1_uc010uxz.1_Silent_p.D137D|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Silent_p.D94D|A2BP1_uc010uyb.1_Silent_p.D94D|A2BP1_uc002cyw.2_Silent_p.D114D|A2BP1_uc002cyy.2_Silent_p.D114D|A2BP1_uc002cyx.2_Silent_p.D114D|A2BP1_uc010uyc.1_Silent_p.D114D	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	94					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
SLC12A3	6559	broad.mit.edu	37	16	56916303	56916303	+	Intron	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56916303C>T	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580			solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)													---	---	---	---
ZNF821	55565	broad.mit.edu	37	16	71894501	71894501	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71894501C>T	uc010vmj.1	-	7	1035	c.659G>A	c.(658-660)GGG>GAG	p.G220E	ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_Missense_Mutation_p.G70E|ZNF821_uc002fbf.2_Missense_Mutation_p.G178E|ZNF821_uc002fbg.3_Missense_Mutation_p.G70E|ZNF821_uc002fbh.3_Missense_Mutation_p.G178E|ZNF821_uc002fbi.3_Missense_Mutation_p.G17E	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
MYO1C	4641	broad.mit.edu	37	17	1383891	1383891	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1383891T>C	uc002fsp.2	-	7	1056	c.836A>G	c.(835-837)AAC>AGC	p.N279S	MYO1C_uc002fsn.2_Missense_Mutation_p.N260S|MYO1C_uc002fso.2_Missense_Mutation_p.N244S|MYO1C_uc010vqj.1_Missense_Mutation_p.N244S|MYO1C_uc010vqk.1_Missense_Mutation_p.N255S	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a	279	Myosin head-like.				mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
INPP5K	51763	broad.mit.edu	37	17	1400109	1400109	+	Intron	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1400109G>A	uc002fsr.2	-						INPP5K_uc002fss.2_Intron|INPP5K_uc002fsq.2_Intron|INPP5K_uc010cjr.2_Intron|INPP5K_uc010vql.1_Intron|INPP5K_uc010vqm.1_Intron	NM_016532	NP_057616			inositol polyphosphate-5-phosphatase K isoform						actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0																		---	---	---	---
PLD2	5338	broad.mit.edu	37	17	4721623	4721623	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4721623G>T	uc002fzc.2	+	19	2053	c.1952G>T	c.(1951-1953)CGG>CTG	p.R651L	PLD2_uc010vsj.1_3'UTR|PLD2_uc002fzd.2_Missense_Mutation_p.R651L	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	651	Catalytic.				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)													---	---	---	---
HS3ST3B1	9953	broad.mit.edu	37	17	14204920	14204920	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14204920G>A	uc002goh.1	+	1	415	c.85G>A	c.(85-87)GTG>ATG	p.V29M	MGC12916_uc010vvv.1_5'Flank	NM_006041	NP_006032	Q9Y662	HS3SB_HUMAN	heparan sulfate D-glucosaminyl	29	Cytoplasmic (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	Golgi membrane|integral to plasma membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)														---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61497864	61497864	+	Silent	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61497864G>A	uc002jal.3	+	25	4544	c.4521G>A	c.(4519-4521)CCG>CCA	p.P1507P	TANC2_uc010wpe.1_3'UTR|TANC2_uc002jao.3_Silent_p.P618P	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1507							binding			ovary(2)	2																		---	---	---	---
SPHK1	8877	broad.mit.edu	37	17	74382134	74382134	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74382134A>G	uc002jrf.1	+	5	888	c.79A>G	c.(79-81)AAG>GAG	p.K27E	SPHK1_uc002jrg.1_5'UTR|SPHK1_uc010wtc.1_Missense_Mutation_p.K113E|SPHK1_uc002jrh.2_Missense_Mutation_p.K41E|SPHK1_uc002jrj.2_Missense_Mutation_p.K113E|SPHK1_uc002jri.2_Missense_Mutation_p.K27E|SPHK1_uc002jrk.3_Missense_Mutation_p.K27E	NM_001142602	NP_001136074	Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1 isoform 3	27	DAGKc.				'de novo' posttranslational protein folding|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|calcium-mediated signaling|positive regulation of angiogenesis|positive regulation of cell growth|positive regulation of cell migration|positive regulation of fibroblast proliferation|positive regulation of mitotic cell cycle|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|positive regulation of smooth muscle contraction|regulation of tumor necrosis factor-mediated signaling pathway|sphingoid catabolic process|sphingosine metabolic process	cytosol|membrane fraction|nucleus|plasma membrane|soluble fraction	ATP binding|calmodulin binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|DNA binding|magnesium ion binding|protein phosphatase 2A binding|sphinganine kinase activity			kidney(1)	1																OREG0024750	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MYO9B	4650	broad.mit.edu	37	19	17305578	17305578	+	Silent	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17305578C>A	uc010eak.2	+	22	3494	c.3342C>A	c.(3340-3342)TCC>TCA	p.S1114S	MYO9B_uc002nfi.2_Silent_p.S1114S|MYO9B_uc002nfj.1_Silent_p.S1114S	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1114	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1																		---	---	---	---
UPF1	5976	broad.mit.edu	37	19	18966037	18966037	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18966037C>T	uc002nkg.2	+	11	1838	c.1563C>T	c.(1561-1563)GCC>GCT	p.A521A	UPF1_uc002nkf.2_Silent_p.A510A	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	521					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PLEKHG2	64857	broad.mit.edu	37	19	39912813	39912813	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39912813C>G	uc010xuz.1	+	17	1887	c.1562C>G	c.(1561-1563)TCT>TGT	p.S521C	PLEKHG2_uc010xuy.1_Missense_Mutation_p.S462C|PLEKHG2_uc002olj.2_Missense_Mutation_p.S521C|PLEKHG2_uc010xva.1_Missense_Mutation_p.S299C	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	521					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)															---	---	---	---
TGFB1	7040	broad.mit.edu	37	19	41847896	41847896	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41847896T>G	uc002oqh.1	-	5	1619	c.752A>C	c.(751-753)CAT>CCT	p.H251P	CYP2F1_uc010xvw.1_Intron	NM_000660	NP_000651	P01137	TGFB1_HUMAN	transforming growth factor, beta 1 precursor	251					active induction of host immune response by virus|ATP biosynthetic process|cell cycle arrest|cell growth|cell-cell junction organization|chondrocyte differentiation|connective tissue replacement involved in inflammatory response wound healing|epidermal growth factor receptor signaling pathway|evasion of host defenses by virus|hemopoietic progenitor cell differentiation|induction of apoptosis|lymph node development|mitotic cell cycle G1/S transition checkpoint|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of cell-cell adhesion|negative regulation of DNA replication|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|negative regulation of macrophage cytokine production|negative regulation of mitotic cell cycle|negative regulation of protein phosphorylation|ossification involved in bone remodeling|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of blood vessel endothelial cell migration|positive regulation of bone mineralization|positive regulation of cell division|positive regulation of chemotaxis|positive regulation of collagen biosynthetic process|positive regulation of epithelial to mesenchymal transition|positive regulation of fibroblast migration|positive regulation of interleukin-17 production|positive regulation of isotype switching to IgA isotypes|positive regulation of MAP kinase activity|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of protein dephosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein secretion|positive regulation of SMAD protein import into nucleus|protein export from nucleus|protein import into nucleus, translocation|receptor catabolic process|regulation of DNA binding|regulation of striated muscle tissue development|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|response to estradiol stimulus|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway|viral infectious cycle	extracellular space|Golgi lumen|nucleus|platelet alpha granule lumen|proteinaceous extracellular matrix	growth factor activity|type II transforming growth factor beta receptor binding				0					Hyaluronidase(DB00070)													---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43528893	43528893	+	Missense_Mutation	SNP	C	A	A	rs150813903	byFrequency	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43528893C>A	uc002ovh.1	-	2	487	c.398G>T	c.(397-399)CGA>CTA	p.R133L	PSG11_uc002ouw.2_Missense_Mutation_p.R133L|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.R133L|PSG11_uc002ovm.1_Missense_Mutation_p.R127L|PSG11_uc002ovn.1_Missense_Mutation_p.R133L|PSG11_uc002ovo.1_Intron|PSG11_uc002ovp.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	126	Cell attachment site (Potential).|Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
PPFIA3	8541	broad.mit.edu	37	19	49637939	49637939	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49637939A>G	uc002pmr.2	+	12	1753	c.1421A>G	c.(1420-1422)GAT>GGT	p.D474G	PPFIA3_uc010yai.1_RNA|PPFIA3_uc010emt.2_Missense_Mutation_p.D398G|PPFIA3_uc010yaj.1_RNA|PPFIA3_uc002pms.2_Missense_Mutation_p.D342G	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	474	Potential.					cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)														---	---	---	---
PTH2	113091	broad.mit.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49926533G>C	uc002pnn.1	-	1	166	c.64C>G	c.(64-66)CTG>GTG	p.L22V		NM_178449	NP_848544	Q96A98	TIP39_HUMAN	parathyroid hormone 2 preproprotein	22					neuropeptide signaling pathway	extracellular region					0				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)														---	---	---	---
SIGLEC7	27036	broad.mit.edu	37	19	51656357	51656357	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51656357G>A	uc002pvv.1	+	7	1328	c.1259G>A	c.(1258-1260)CGA>CAA	p.R420Q	SIGLEC7_uc002pvw.1_Missense_Mutation_p.R327Q|SIGLEC7_uc010eoq.1_RNA|SIGLEC7_uc010eor.1_3'UTR	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	420	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)														---	---	---	---
LILRA2	11027	broad.mit.edu	37	19	55086410	55086410	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086410C>T	uc002qgg.3	+	4	654	c.565C>T	c.(565-567)CGC>TGC	p.R189C	LILRA2_uc010ern.2_Missense_Mutation_p.R189C|LILRA2_uc002qgf.2_Missense_Mutation_p.R189C|LILRA2_uc010yfe.1_Missense_Mutation_p.R189C|LILRA2_uc010yff.1_Missense_Mutation_p.R177C|LILRA2_uc010ero.2_Missense_Mutation_p.R177C|LILRA2_uc010yfg.1_Missense_Mutation_p.R189C	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	189	Extracellular (Potential).|Ig-like C2-type 2.				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)														---	---	---	---
NLRP8	126205	broad.mit.edu	37	19	56467135	56467135	+	Missense_Mutation	SNP	G	A	A	rs147105419	byFrequency	TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56467135G>A	uc002qmh.2	+	3	1782	c.1711G>A	c.(1711-1713)GTG>ATG	p.V571M	NLRP8_uc010etg.2_Missense_Mutation_p.V571M	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	571						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)														---	---	---	---
ADRM1	11047	broad.mit.edu	37	20	60883474	60883474	+	Silent	SNP	C	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60883474C>T	uc002ycn.2	+	9	1145	c.1065C>T	c.(1063-1065)CTC>CTT	p.L355L	ADRM1_uc002yco.2_Silent_p.L355L	NM_007002	NP_008933	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1 precursor	355					proteasome assembly|transcription elongation from RNA polymerase II promoter	cytoplasm|integral to plasma membrane|membrane fraction|nucleus|proteasome complex	endopeptidase activator activity|protease binding|proteasome binding				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)															---	---	---	---
USP25	29761	broad.mit.edu	37	21	17205874	17205874	+	Intron	SNP	C	G	G			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17205874C>G	uc002yjy.1	+						USP25_uc011aby.1_Intron|USP25_uc002yjz.1_Intron|USP25_uc010gla.1_Intron	NM_013396	NP_037528			ubiquitin specific peptidase 25						protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)														---	---	---	---
VCX3A	51481	broad.mit.edu	37	X	6451825	6451825	+	Silent	SNP	C	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451825C>A	uc004crs.2	-	3	829	c.522G>T	c.(520-522)CTG>CTT	p.L174L	VCX3A_uc010ndk.1_Intron	NM_016379	NP_057463	Q9NNX9	VCX3_HUMAN	variable charge, X-linked 3A	174	8 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|8.|Glu-rich.				brain development	nucleolus					0																		---	---	---	---
VCX	26609	broad.mit.edu	37	X	7812018	7812018	+	Silent	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7812018G>T	uc004crz.2	+	3	801	c.582G>T	c.(580-582)CCG>CCT	p.P194P		NM_013452	NP_038480	Q9H320	VCX1_HUMAN	variable charge, X chromosome	194	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|10.|Glu-rich.				chromatin organization|ribosome assembly|spermatogenesis	nucleolus	chromatin binding				0		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)																---	---	---	---
CCNB3	85417	broad.mit.edu	37	X	50056925	50056925	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50056925G>T	uc004dox.3	+	8	3791	c.3493G>T	c.(3493-3495)GTG>TTG	p.V1165L	CCNB3_uc004doy.2_Missense_Mutation_p.V1165L|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Missense_Mutation_p.V57L	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1165					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)																	---	---	---	---
ITIH5L	347365	broad.mit.edu	37	X	54817436	54817436	+	Silent	SNP	T	C	C			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54817436T>C	uc004dtj.2	-	4	480	c.450A>G	c.(448-450)GAA>GAG	p.E150E		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	150	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6																		---	---	---	---
ZCCHC13	389874	broad.mit.edu	37	X	73524418	73524418	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73524418G>A	uc004ebs.3	+	1	394	c.317G>A	c.(316-318)CGT>CAT	p.R106H		NM_203303	NP_976048	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	106	CCHC-type 4.						nucleic acid binding|zinc ion binding				0																		---	---	---	---
RPS6KA6	27330	broad.mit.edu	37	X	83319320	83319320	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6519-01	TCGA-D7-6519-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83319320G>A	uc004eej.1	-	22	2280	c.2203C>T	c.(2203-2205)CGG>TGG	p.R735W	RPS6KA6_uc011mqt.1_Missense_Mutation_p.R735W|RPS6KA6_uc011mqu.1_Missense_Mutation_p.R632W	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	735					axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
