Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
GATAD2B	57459	broad.mit.edu	37	1	153790791	153790791	+	Intron	DEL	T	-	-	rs144812255		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790791delT	uc001fdb.3	-							NM_020699	NP_065750			GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156499845	156499846	+	Intron	DEL	CA	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156499845_156499846delCA	uc001fpf.2	-							NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170			Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)															---	---	---	---
SCN1A	6323	broad.mit.edu	37	2	166894166	166894166	+	Intron	DEL	T	-	-	rs67819222		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166894166delT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851			sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210325311	210325311	+	Intron	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210325311delT	uc002vdc.1	+						MAP2_uc002vdd.1_Intron	NM_002374	NP_002365			microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
IFT122	55764	broad.mit.edu	37	3	129195788	129195789	+	Intron	INS	-	T	T	rs73204212	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129195788_129195789insT	uc003emm.2	+						IFT122_uc003eml.2_Intron|IFT122_uc003emn.2_Intron|IFT122_uc003emo.2_Intron|IFT122_uc003emp.2_Intron|IFT122_uc010htc.2_Intron|IFT122_uc011bky.1_Intron|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_Intron|IFT122_uc011bla.1_Intron|IFT122_uc011bkx.1_Intron|IFT122_uc011bkz.1_Intron	NM_052989	NP_443715			WD repeat domain 10 isoform 2						camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2																		---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195538502	195538503	+	Intron	DEL	TC	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195538502_195538503delTC	uc011bto.1	-						MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzv.2_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	196263664	196263664	+	IGR	DEL	A	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196263664delA								C3orf43 (21427 upstream) : WDR53 (17397 downstream)																																			---	---	---	---
AKAP9	10142	broad.mit.edu	37	7	91570197	91570198	+	Translation_Start_Site	INS	-	GGC	GGC			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91570197_91570198insGGC	uc003ulg.2	+	1	9_10	c.-216_-215insGGC	c.(-218--213)GATGGC>GATGGCGGC		AKAP9_uc003uld.3_Translation_Start_Site|AKAP9_uc003ule.2_Translation_Start_Site|AKAP9_uc003ulf.2_Translation_Start_Site	NM_005751	NP_005742			A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)					T	BRAF	papillary thyroid								---	---	---	---
CYP3A43	64816	broad.mit.edu	37	7	99436596	99436596	+	Intron	DEL	A	-	-	rs4646470		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99436596delA	uc003urx.1	+						CYP3A43_uc003ury.1_Intron|CYP3A43_uc003urz.1_Intron|CYP3A43_uc003usa.1_Intron|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_Intron	NM_057095	NP_476436			cytochrome P450, family 3, subfamily A,						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Cetirizine(DB00341)|Doxycycline(DB00254)													---	---	---	---
CADPS2	93664	broad.mit.edu	37	7	122033120	122033120	+	Intron	DEL	A	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122033120delA	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424			Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
EPHX2	2053	broad.mit.edu	37	8	27369617	27369618	+	Intron	INS	-	A	A	rs78320281		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27369617_27369618insA	uc003xfu.2	+						EPHX2_uc010lut.1_Intron|EPHX2_uc010luu.2_Intron|EPHX2_uc010luv.2_Intron|EPHX2_uc003xfv.2_Intron|EPHX2_uc010luw.2_Intron|EPHX2_uc011lam.1_Intron	NM_001979	NP_001970			epoxide hydrolase 2, cytoplasmic						aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)													---	---	---	---
CYP7A1	1581	broad.mit.edu	37	8	59412826	59412826	+	5'Flank	DEL	A	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59412826delA	uc003xtm.3	-							NM_000780	NP_000771			cytochrome P450, family 7, subfamily A,						bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)												Neonatal_Giant_Cell_Hepatitis				---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143361386	143361386	+	Intron	DEL	C	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143361386delC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440			t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
OPLAH	26873	broad.mit.edu	37	8	145109874	145109874	+	Intron	DEL	G	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145109874delG	uc003zar.3	-						OPLAH_uc003zas.1_Intron	NM_017570	NP_060040			5-oxoprolinase (ATP-hydrolysing)								5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)													---	---	---	---
MAPK8	5599	broad.mit.edu	37	10	49634258	49634259	+	Intron	INS	-	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49634258_49634259insT	uc009xnz.2	+						MAPK8_uc001jgl.2_Intron|MAPK8_uc001jgm.2_Intron|MAPK8_uc001jgo.2_Intron|MAPK8_uc009xoa.2_Intron|MAPK8_uc001jgn.2_Intron|MAPK8_uc010qgk.1_Intron|MAPK8_uc001jgp.2_Intron|MAPK8_uc001jgq.2_Intron	NM_139047	NP_620635			mitogen-activated protein kinase 8 isoform JNK1						activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)														---	---	---	---
C10orf137	26098	broad.mit.edu	37	10	127437816	127437817	+	Intron	INS	-	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127437816_127437817insA	uc001liq.1	+						C10orf137_uc001lio.1_Intron|C10orf137_uc001lip.1_Intron|C10orf137_uc001lis.1_Intron|C10orf137_uc001lit.1_5'Flank	NM_015608	NP_056423			erythroid differentiation-related factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	119145754	119145756	+	IGR	DEL	TGG	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145754_119145756delTGG								SUDS3 (289915 upstream) : SRRM4 (273640 downstream)																																			---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124205737	124205738	+	Intron	INS	-	TGTTT	TGTTT	rs142454152	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124205737_124205738insTGTTT	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133258000	133258004	+	Intron	DEL	GCTCA	-	-	rs5744732		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133258000_133258004delGCTCA	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222			DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
PGAM5	192111	broad.mit.edu	37	12	133294826	133294827	+	Intron	INS	-	C	C	rs149250932	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133294826_133294827insC	uc009zyv.2	+						PGAM5_uc010tbr.1_Intron|PGAM5_uc001uku.2_Intron	NM_138575	NP_612642			phosphoglycerate mutase family member 5							integral to membrane|mitochondrial outer membrane	phosphoprotein phosphatase activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	77402068	77402071	+	IGR	DEL	GGAA	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77402068_77402071delGGAA								LMO7 (968064 upstream) : KCTD12 (52233 downstream)																																			---	---	---	---
SOX1	6656	broad.mit.edu	37	13	112722081	112722083	+	In_Frame_Del	DEL	GGC	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112722081_112722083delGGC	uc001vsb.1	+	1	169_171	c.109_111delGGC	c.(109-111)GGCdel	p.G43del		NM_005986	NP_005977	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	43	Poly-Gly.				chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	85795448	85795448	+	IGR	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85795448delT								PDE8A (113078 upstream) : AKAP13 (128423 downstream)																																			---	---	---	---
LONP2	83752	broad.mit.edu	37	16	48292799	48292799	+	Intron	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48292799delT	uc002efi.1	+						LONP2_uc010vgm.1_Intron|LONP2_uc002efj.1_Intron	NM_031490	NP_113678			peroxisomal LON protease-like						misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity				0																		---	---	---	---
ZZEF1	23140	broad.mit.edu	37	17	3967494	3967494	+	Intron	DEL	A	-	-	rs112787658		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3967494delA	uc002fxe.2	-						ZZEF1_uc002fxh.2_5'Flank|ZZEF1_uc002fxi.2_Intron|ZZEF1_uc002fxj.1_Intron	NM_015113	NP_055928			zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
MYBBP1A	10514	broad.mit.edu	37	17	4443460	4443470	+	Intron	DEL	GAGGGTCCTGT	-	-	rs3833100	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4443460_4443470delGAGGGTCCTGT	uc002fyb.3	-						MYBBP1A_uc002fxz.3_Intron|MYBBP1A_uc002fya.3_Intron|MYBBP1A_uc010vsa.1_Intron	NM_014520	NP_055335			MYB binding protein 1a isoform 2						nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2																		---	---	---	---
ADAP2	55803	broad.mit.edu	37	17	29250283	29250283	+	Intron	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29250283delT	uc002hfx.2	+						ADAP2_uc010csk.2_Intron|ADAP2_uc002hfy.2_Intron|ADAP2_uc010csl.2_Intron	NM_018404	NP_060874			centaurin-alpha 2 protein						heart development|regulation of ARF GTPase activity	mitochondrial envelope|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding, bridging|zinc ion binding	p.?(1)		ovary(1)	1																		---	---	---	---
ZNF57	126295	broad.mit.edu	37	19	2901115	2901124	+	Intron	DEL	GCCGAAGTCT	-	-	rs11279103		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2901115_2901124delGCCGAAGTCT	uc002lwr.2	+							NM_173480	NP_775751			zinc finger protein 57						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ANKRD24	170961	broad.mit.edu	37	19	4199809	4199810	+	Intron	INS	-	A	A	rs140961038	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4199809_4199810insA	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732			ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)														---	---	---	---
ZNF358	140467	broad.mit.edu	37	19	7583974	7583974	+	Intron	DEL	G	-	-	rs118043255		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7583974delG	uc002mgn.2	+							NM_018083	NP_060553			zinc finger protein 358						embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40368049	40368050	+	Intron	DEL	AG	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40368049_40368050delAG	uc002omp.3	-							NM_003890	NP_003881			Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
SERTAD3	29946	broad.mit.edu	37	19	40947233	40947234	+	3'UTR	DEL	AC	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40947233_40947234delAC	uc002onu.3	-	2					SERTAD3_uc002onv.3_3'UTR	NM_013368	NP_037500			RPA-binding trans-activator						negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
C20orf27	54976	broad.mit.edu	37	20	3735948	3735948	+	Intron	DEL	A	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3735948delA	uc002wji.1	-						C20orf27_uc002wjf.1_3'UTR|C20orf27_uc002wjh.1_Intron	NM_001039140	NP_001034229			hypothetical protein LOC54976												0																		---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30348150	30348150	+	Intron	DEL	A	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30348150delA	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
WFDC3	140686	broad.mit.edu	37	20	44417845	44417845	+	Intron	DEL	A	-	-	rs11478994		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44417845delA	uc002xpf.1	-						DNTTIP1_uc002xpk.2_5'Flank|WFDC3_uc002xpj.1_Intron|WFDC3_uc002xph.1_Intron|WFDC3_uc010ghh.1_Intron	NM_080614	NP_542181			WAP four-disulfide core domain 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	11114453	11114454	+	IGR	INS	-	A	A	rs55649022		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114453_11114454insA								BAGE (15516 upstream) : None (None downstream)																																			---	---	---	---
MED15	51586	broad.mit.edu	37	22	20929656	20929656	+	Intron	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929656delT	uc002zsp.2	+						MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Intron|MED15_uc002zst.2_Intron	NM_001003891	NP_001003891			mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)															---	---	---	---
C22orf28	51493	broad.mit.edu	37	22	32790101	32790102	+	Intron	INS	-	TT	TT	rs11396073		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32790101_32790102insTT	uc003amm.2	-							NM_014306	NP_055121			hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0																		---	---	---	---
CDR1	1038	broad.mit.edu	37	X	139865890	139865927	+	Frame_Shift_Del	DEL	CAATCCACATCTTCCGGAAAAAATCCAGGTCTTCCAGC	-	-	rs143948461	byFrequency	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139865890_139865927delCAATCCACATCTTCCGGAAAAAATCCAGGTCTTCCAGC	uc004fbg.1	-	1	797_834	c.605_642delGCTGGAAGACCTGGATTTTTTCCGGAAGATGTGGATTG	c.(604-642)GGCTGGAAGACCTGGATTTTTTCCGGAAGATGTGGATTGfs	p.G202fs	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	202_214											0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)																---	---	---	---
FMR1	2332	broad.mit.edu	37	X	147007212	147007212	+	Intron	DEL	T	-	-			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147007212delT	uc010nst.2	+						FMR1_uc011mwz.1_Intron|FMR1_uc004fcj.2_Intron|FMR1_uc004fck.3_Intron|FMR1_uc004fcl.3_5'Flank	NM_002024	NP_002015			fragile X mental retardation 1						mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													Fragile_X_syndrome				---	---	---	---
TMLHE	55217	broad.mit.edu	37	X	154721340	154721341	+	Intron	INS	-	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154721340_154721341insA	uc004fnn.2	-						uc004fnl.2_Intron	NM_018196	NP_060666			trimethyllysine hydroxylase, epsilon						carnitine biosynthetic process	mitochondrial matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|trimethyllysine dioxygenase activity			ovary(1)	1	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
CDCA8	55143	broad.mit.edu	37	1	38169012	38169012	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38169012G>C	uc001cbr.2	+	8	684	c.577G>C	c.(577-579)GAC>CAC	p.D193H	CDCA8_uc001cbs.2_Missense_Mutation_p.D193H|CDCA8_uc010oih.1_Missense_Mutation_p.D126H	NM_018101	NP_060571	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	193					cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
SGIP1	84251	broad.mit.edu	37	1	67109391	67109391	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67109391C>A	uc001dcr.2	+	7	665	c.448C>A	c.(448-450)CCA>ACA	p.P150T	SGIP1_uc010opd.1_5'UTR|SGIP1_uc001dcs.2_5'UTR|SGIP1_uc001dct.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	150					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3																		---	---	---	---
S100A8	6279	broad.mit.edu	37	1	153362862	153362862	+	Intron	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153362862C>G	uc001fbs.2	-							NM_002964	NP_002955			S100 calcium-binding protein A8						chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155340643	155340643	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155340643C>T	uc009wqq.2	-	11	6959	c.6479G>A	c.(6478-6480)AGA>AAA	p.R2160K	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.R2155K	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2160	SET.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
HNRNPU	3192	broad.mit.edu	37	1	245022628	245022628	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245022628T>C	uc001iaz.1	-	5	1284	c.1066A>G	c.(1066-1068)ATA>GTA	p.I356V	HNRNPU_uc001iaw.1_5'Flank|HNRNPU_uc001iax.1_RNA|HNRNPU_uc001iay.1_Missense_Mutation_p.I80V|HNRNPU_uc001iba.1_Missense_Mutation_p.I337V|HNRNPU_uc001ibb.1_Missense_Mutation_p.I44V	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	356	B30.2/SPRY.				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)															---	---	---	---
OR14I1	401994	broad.mit.edu	37	1	248844940	248844940	+	Silent	SNP	C	T	T	rs112867044		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248844940C>T	uc001ieu.1	-	1	666	c.666G>A	c.(664-666)ACG>ACA	p.T222T		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11727567	11727567	+	Intron	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11727567C>T	uc002rbk.1	+						GREB1_uc002rbl.2_Missense_Mutation_p.R407W|GREB1_uc002rbn.1_Intron|GREB1_uc002rbo.1_5'Flank	NM_014668	NP_055483			growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
RASGRP3	25780	broad.mit.edu	37	2	33747139	33747139	+	Silent	SNP	T	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33747139T>C	uc002rox.2	+	8	1113	c.486T>C	c.(484-486)TTT>TTC	p.F162F	RASGRP3_uc010ync.1_Silent_p.F162F|RASGRP3_uc002roy.2_Silent_p.F162F	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	162	Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)																	---	---	---	---
LHCGR	3973	broad.mit.edu	37	2	48915510	48915510	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915510G>C	uc002rwu.3	-	11	1496	c.1426C>G	c.(1426-1428)CAA>GAA	p.Q476E	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	476	Cytoplasmic (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)									Familial_Male-Limited_Precocious_Puberty				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50149136	50149136	+	Silent	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149136A>G	uc010fbp.2	-	6	2082	c.1275T>C	c.(1273-1275)AGT>AGC	p.S425S	NRXN1_uc002rxb.3_Silent_p.S1159S|NRXN1_uc010fbq.2_Silent_p.S1530S|NRXN1_uc002rxe.3_Silent_p.S1460S|NRXN1_uc010yon.1_Silent_p.S125S|NRXN1_uc002rxa.3_Silent_p.S122S	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	425	Cytoplasmic (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51254917	51254917	+	Silent	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51254917C>A	uc010fbq.2	-	2	1972	c.495G>T	c.(493-495)GCG>GCT	p.A165A	NRXN1_uc002rxe.3_Silent_p.A165A|NRXN1_uc002rxd.1_Silent_p.A165A	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
ATOH8	84913	broad.mit.edu	37	2	85981419	85981419	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85981419G>C	uc002sqn.2	+	1	511	c.107G>C	c.(106-108)CGC>CCC	p.R36P	ATOH8_uc002sqm.3_Missense_Mutation_p.R36P	NM_032827	NP_116216	Q96SQ7	ATOH8_HUMAN	atonal homolog 8	36					cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
THNSL2	55258	broad.mit.edu	37	2	88478290	88478290	+	Intron	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88478290C>T	uc002ssz.3	+						THNSL2_uc002ssv.2_Intron|THNSL2_uc002ssw.3_Intron|THNSL2_uc002ssx.3_Intron|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Intron|THNSL2_uc010fhe.2_Intron	NM_018271	NP_060741			threonine synthase-like 2						threonine biosynthetic process		threonine synthase activity			ovary(1)	1																		---	---	---	---
KCNIP3	30818	broad.mit.edu	37	2	96047430	96047430	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96047430G>T	uc002sup.2	+	6	649	c.534G>T	c.(532-534)AAG>AAT	p.K178N	KCNIP3_uc002suq.2_Missense_Mutation_p.K152N	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1	178	EF-hand 3.|1 (By similarity).				apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)														---	---	---	---
MFSD9	84804	broad.mit.edu	37	2	103334867	103334867	+	3'UTR	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103334867G>C	uc002tcb.2	-	6					MFSD9_uc010fja.2_RNA	NM_032718	NP_116107			major facilitator superfamily domain containing						transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4																		---	---	---	---
LCT	3938	broad.mit.edu	37	2	136594316	136594316	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136594316G>A	uc002tuu.1	-	1	435	c.424C>T	c.(424-426)CGG>TGG	p.R142W		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	142	Extracellular (Potential).|4 X approximate repeats.|1.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)														---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138030105	138030105	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138030105A>C	uc002tva.1	+	10	2176	c.2176A>C	c.(2176-2178)AAT>CAT	p.N726H	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.N616H	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
MBD5	55777	broad.mit.edu	37	2	149227248	149227248	+	Nonsense_Mutation	SNP	T	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149227248T>G	uc002twm.3	+	9	2724	c.1736T>G	c.(1735-1737)TTA>TGA	p.L579*	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Nonsense_Mutation_p.L579*|MBD5_uc002twn.1_Nonsense_Mutation_p.L20*	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	579						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)														---	---	---	---
SCN1A	6323	broad.mit.edu	37	2	166848778	166848778	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848778C>T	uc010zcz.1	-	26	4992	c.4974G>A	c.(4972-4974)GCG>GCA	p.A1658A		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1669	IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---
KLHL23	151230	broad.mit.edu	37	2	170591630	170591630	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170591630A>T	uc002ufh.1	+	4	444	c.106A>T	c.(106-108)ACT>TCT	p.T36S	KLHL23_uc002ufi.1_Missense_Mutation_p.T36S	NM_144711	NP_653312	Q8NBE8	KLH23_HUMAN	kelch-like 23	36	BTB.										0																		---	---	---	---
WIPF1	7456	broad.mit.edu	37	2	175436475	175436475	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175436475C>T	uc002uiy.2	-	6	1390	c.1058G>A	c.(1057-1059)CGT>CAT	p.R353H	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.R353H|WIPF1_uc010fqt.1_Missense_Mutation_p.R353H|WIPF1_uc002ujc.1_Missense_Mutation_p.R353H|WIPF1_uc002uiz.2_Missense_Mutation_p.R353H|WIPF1_uc002ujb.1_Missense_Mutation_p.R353H|WIPF1_uc010zep.1_Missense_Mutation_p.R353H	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	353	XRSGPXPPXP motif 1.|Pro-rich.				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179433173	179433173	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179433173C>T	uc010zfg.1	-	275	70206	c.69982G>A	c.(69982-69984)GGA>AGA	p.G23328R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G17023R|TTN_uc010zfi.1_Missense_Mutation_p.G16956R|TTN_uc010zfj.1_Missense_Mutation_p.G16831R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24255							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197298041	197298041	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197298041G>C	uc002utm.1	-	2	290	c.107C>G	c.(106-108)TCC>TGC	p.S36C		NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	36					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
PID1	55022	broad.mit.edu	37	2	229890556	229890556	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229890556C>G	uc002vpr.3	-	3	583	c.545G>C	c.(544-546)TGG>TCG	p.W182S	PID1_uc002vps.3_Missense_Mutation_p.W180S|PID1_uc002vpt.3_Missense_Mutation_p.W149S|PID1_uc002vpu.3_Missense_Mutation_p.W100S	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	182	PID.					cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35778692	35778692	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35778692T>A	uc003cgb.2	+	16	1746	c.1482T>A	c.(1480-1482)GAT>GAA	p.D494E	ARPP21_uc003cga.2_Missense_Mutation_p.D440E|ARPP21_uc011axy.1_Missense_Mutation_p.D460E|ARPP21_uc003cgf.2_Missense_Mutation_p.D295E|ARPP21_uc003cgg.2_5'UTR	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	494						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3																		---	---	---	---
BSN	8927	broad.mit.edu	37	3	49689341	49689341	+	Silent	SNP	C	T	T	rs147936824		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49689341C>T	uc003cxe.3	+	5	2466	c.2352C>T	c.(2350-2352)GAC>GAT	p.D784D		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	784					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100348472	100348472	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100348472C>T	uc003duc.2	+	2	414	c.146C>T	c.(145-147)ACA>ATA	p.T49I		NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	49	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
ZPLD1	131368	broad.mit.edu	37	3	102176700	102176700	+	Intron	SNP	A	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102176700A>C	uc003dvs.1	+						ZPLD1_uc003dvt.1_Intron|ZPLD1_uc011bhg.1_Intron	NM_175056	NP_778226			zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5																		---	---	---	---
GP9	2815	broad.mit.edu	37	3	128780696	128780696	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128780696C>T	uc003elm.2	+	3	301	c.114C>T	c.(112-114)TGC>TGT	p.C38C		NM_000174	NP_000165	P14770	GPIX_HUMAN	glycoprotein IX (platelet) precursor	38	Extracellular (Potential).|LRRNT.				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane	protein binding				0					Quinine(DB00468)													---	---	---	---
HTT	3064	broad.mit.edu	37	4	3182315	3182315	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3182315A>C	uc011bvq.1	+	37	4837	c.4692A>C	c.(4690-4692)AAA>AAC	p.K1564N		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1562					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)														---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20611744	20611744	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20611744G>C	uc003gpr.1	+	34	4005	c.3801G>C	c.(3799-3801)TTG>TTC	p.L1267F	SLIT2_uc003gps.1_Missense_Mutation_p.L1259F	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1267	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
CWH43	80157	broad.mit.edu	37	4	48994096	48994096	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48994096G>A	uc003gyv.2	+	4	682	c.500G>A	c.(499-501)CGT>CAT	p.R167H	CWH43_uc011bzl.1_Missense_Mutation_p.R140H	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	167					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
PPAT	5471	broad.mit.edu	37	4	57261654	57261654	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57261654A>G	uc003hbr.2	-	11	1620	c.1418T>C	c.(1417-1419)ATA>ACA	p.I473T		NM_002703	NP_002694	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	473					glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Glutamine(DB00130)|Thioguanine(DB00352)													---	---	---	---
GPRIN3	285513	broad.mit.edu	37	4	90170079	90170079	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170079G>C	uc003hsm.1	-	2	1702	c.1183C>G	c.(1183-1185)CAG>GAG	p.Q395E		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	395										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)														---	---	---	---
EXOSC9	5393	broad.mit.edu	37	4	122722979	122722979	+	Intron	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122722979C>G	uc003iea.2	+						EXOSC9_uc003idz.2_Intron|EXOSC9_uc003ieb.2_Missense_Mutation_p.Q6E|EXOSC9_uc010inp.1_5'Flank	NM_005033	NP_005024			exosome component 9 isoform 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0																		---	---	---	---
KIAA0947	23379	broad.mit.edu	37	5	5462426	5462426	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5462426C>A	uc003jdm.3	+	13	3201	c.2979C>A	c.(2977-2979)GAC>GAA	p.D993E		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	993										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
HIST1H2BE	8344	broad.mit.edu	37	6	26184287	26184287	+	Silent	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26184287G>C	uc003ngt.2	+	1	264	c.264G>C	c.(262-264)TCG>TCC	p.S88S		NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be	88					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0																		---	---	---	---
ZNF192	7745	broad.mit.edu	37	6	28120096	28120096	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28120096G>C	uc003nkn.1	+	5	893	c.709G>C	c.(709-711)GAT>CAT	p.D237H	ZNF192_uc010jqx.1_Missense_Mutation_p.D237H|ZNF192_uc010jqy.1_Missense_Mutation_p.D50H|ZNF192_uc011dkz.1_Missense_Mutation_p.D50H	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192	237	KRAB.				viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38877309	38877309	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38877309C>G	uc003ooe.1	+	63	9478	c.8878C>G	c.(8878-8880)CGT>GGT	p.R2960G	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8									p.R2960R(1)		skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
FHL5	9457	broad.mit.edu	37	6	97051544	97051544	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97051544A>C	uc003pos.1	+	3	460	c.55A>C	c.(55-57)AAA>CAA	p.K19Q	FHL5_uc003pot.1_Missense_Mutation_p.K19Q	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	19	C4-type (Potential).					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)														---	---	---	---
EYA4	2070	broad.mit.edu	37	6	133783490	133783490	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133783490T>G	uc003qec.3	+	8	913	c.455T>G	c.(454-456)CTT>CGT	p.L152R	EYA4_uc011ecq.1_Missense_Mutation_p.L98R|EYA4_uc011ecr.1_Missense_Mutation_p.L98R|EYA4_uc003qed.3_Missense_Mutation_p.L152R|EYA4_uc003qee.3_Missense_Mutation_p.L129R|EYA4_uc011ecs.1_Missense_Mutation_p.L152R|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	152			L -> R (in a colorectal cancer sample; somatic mutation).		anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	p.L152R(1)		large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)														---	---	---	---
BCLAF1	9774	broad.mit.edu	37	6	136590668	136590668	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136590668C>T	uc003qgx.1	-	9	2379	c.2126G>A	c.(2125-2127)GGA>GAA	p.G709E	BCLAF1_uc011edb.1_5'Flank|BCLAF1_uc003qgw.1_Missense_Mutation_p.G536E|BCLAF1_uc003qgy.1_Missense_Mutation_p.G707E|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.G707E	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	709					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152265607	152265607	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152265607C>A	uc003qom.3	+	6	1430	c.1060C>A	c.(1060-1062)CTG>ATG	p.L354M	ESR1_uc010kin.2_Missense_Mutation_p.L354M|ESR1_uc010kio.2_Missense_Mutation_p.L356M|ESR1_uc010kip.2_Missense_Mutation_p.L353M|ESR1_uc003qon.3_Missense_Mutation_p.L354M|ESR1_uc003qoo.3_Missense_Mutation_p.L354M|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Missense_Mutation_p.L135M|ESR1_uc010kit.1_Missense_Mutation_p.L91M|ESR1_uc011eey.1_Missense_Mutation_p.L91M	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	354	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
THBS2	7058	broad.mit.edu	37	6	169632105	169632105	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169632105G>A	uc003qwt.2	-	14	2369	c.2121C>T	c.(2119-2121)TGC>TGT	p.C707C		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	707	TSP type-3 1.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)														---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2262355	2262355	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2262355C>T	uc003slh.1	-	5	592	c.326G>A	c.(325-327)CGC>CAC	p.R109H	MAD1L1_uc003slf.1_Missense_Mutation_p.R109H|MAD1L1_uc003slg.1_Missense_Mutation_p.R109H|MAD1L1_uc010ksh.1_Missense_Mutation_p.R109H|MAD1L1_uc003sli.1_5'UTR|MAD1L1_uc010ksi.1_Missense_Mutation_p.R62H|MAD1L1_uc010ksj.2_Missense_Mutation_p.R109H	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	109	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
EPDR1	54749	broad.mit.edu	37	7	37960772	37960772	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37960772G>A	uc003tfp.2	+	1	610	c.591G>A	c.(589-591)CGG>CGA	p.R197R	EPDR1_uc003tfq.2_Silent_p.R197R|EPDR1_uc010kxh.2_5'Flank	NM_017549	NP_060019	Q9UM22	EPDR1_HUMAN	ependymin related protein 1 precursor	77					cell-matrix adhesion	extracellular region	calcium ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
PHTF2	57157	broad.mit.edu	37	7	77523312	77523312	+	Splice_Site	SNP	T	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77523312T>G	uc003ugs.3	+	4	342	c.216_splice	c.e4+2	p.L72_splice	PHTF2_uc003ugo.3_Intron|PHTF2_uc003ugp.2_Intron|PHTF2_uc003ugq.3_Intron|PHTF2_uc010ldv.2_Intron|PHTF2_uc003ugr.3_Splice_Site_p.L38_splice|PHTF2_uc003ugt.3_Splice_Site_p.L38_splice|PHTF2_uc003ugu.3_Intron	NM_001127357	NP_001120829			putative homeodomain transcription factor 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68930132	68930132	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68930132G>T	uc003xxv.1	+	2	220	c.193G>T	c.(193-195)GTG>TTG	p.V65L	PREX2_uc003xxu.1_Missense_Mutation_p.V65L|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	65	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68930133	68930133	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68930133T>A	uc003xxv.1	+	2	221	c.194T>A	c.(193-195)GTG>GAG	p.V65E	PREX2_uc003xxu.1_Missense_Mutation_p.V65E|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	65	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68982086	68982086	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68982086G>T	uc003xxv.1	+	13	1487	c.1460G>T	c.(1459-1461)TGT>TTT	p.C487F	PREX2_uc003xxu.1_Missense_Mutation_p.C487F|PREX2_uc011lez.1_Missense_Mutation_p.C422F	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	487					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
SLCO5A1	81796	broad.mit.edu	37	8	70594509	70594509	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70594509G>T	uc003xyl.2	-	7	2399	c.1692C>A	c.(1690-1692)CAC>CAA	p.H564Q	SLCO5A1_uc010lzb.2_Missense_Mutation_p.H509Q|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.H564Q	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	564	Extracellular (Potential).|Kazal-like.					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77690640	77690640	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77690640T>A	uc003yav.2	+	4	3599	c.3212T>A	c.(3211-3213)ATC>AAC	p.I1071N	ZFHX4_uc003yau.1_Missense_Mutation_p.I1097N|ZFHX4_uc003yaw.1_Missense_Mutation_p.I1071N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1071						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92355626	92355626	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92355626T>G	uc003yex.2	+	10	1350	c.1072T>G	c.(1072-1074)TTC>GTC	p.F358V	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.F358V|SLC26A7_uc003yfa.2_Missense_Mutation_p.F358V	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	358	Helical; (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
EIF3H	8667	broad.mit.edu	37	8	117671101	117671101	+	Silent	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117671101A>G	uc003yoa.2	-	3	434	c.408T>C	c.(406-408)TCT>TCC	p.S136S	EIF3H_uc003yob.2_Silent_p.S150S|EIF3H_uc011lhz.1_Silent_p.S136S	NM_003756	NP_003747	O15372	EIF3H_HUMAN	eukaryotic translation initiation factor 3,	136	MPN.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)																	---	---	---	---
COL14A1	7373	broad.mit.edu	37	8	121256184	121256184	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121256184G>C	uc003yox.2	+	20	2681	c.2416G>C	c.(2416-2418)GTC>CTC	p.V806L	COL14A1_uc003yoy.2_Missense_Mutation_p.V484L	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	806	Fibronectin type-III 6.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82335006	82335006	+	Missense_Mutation	SNP	C	T	T	rs140356709		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82335006C>T	uc004ald.2	+	17	2560	c.1711C>T	c.(1711-1713)CGC>TGC	p.R571C	TLE4_uc004alc.2_Missense_Mutation_p.R546C|TLE4_uc010mpr.2_Missense_Mutation_p.R425C|TLE4_uc004ale.2_Missense_Mutation_p.R183C|TLE4_uc011lsq.1_Missense_Mutation_p.R514C|TLE4_uc010mps.2_Missense_Mutation_p.R470C|TLE4_uc004alf.2_Missense_Mutation_p.R485C	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment								p.R546C(1)		lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	118974146	118974146	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118974146G>T	uc004bjn.2	+	4	2234	c.1853G>T	c.(1852-1854)GGA>GTA	p.G618V	PAPPA_uc011lxp.1_Intron|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	618					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124522152	124522152	+	Intron	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124522152G>A	uc004bln.2	+						DAB2IP_uc004blo.2_Intron	NM_032552	NP_115941			disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20500664	20500664	+	Intron	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20500664C>A	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron|PLXDC2_uc009xkc.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
ZNF33B	7582	broad.mit.edu	37	10	43089832	43089832	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43089832T>C	uc001jaf.1	-	5	681	c.566A>G	c.(565-567)GAG>GGG	p.E189G	ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Missense_Mutation_p.E77G|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B	189						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
CEP55	55165	broad.mit.edu	37	10	95276832	95276832	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95276832A>G	uc009xug.2	+	6	1002	c.820A>G	c.(820-822)AAA>GAA	p.K274E	CEP55_uc001kiq.3_Missense_Mutation_p.K274E	NM_001127182	NP_001120654	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	274	Potential.				cell division|mitosis	centriole|cleavage furrow|midbody					0		Colorectal(252;0.207)																---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	133106478	133106478	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133106478G>C	uc001lkp.2	-	3	752	c.666C>G	c.(664-666)ATC>ATG	p.I222M		NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	222										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
MAPK8IP1	9479	broad.mit.edu	37	11	45924104	45924104	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45924104G>A	uc001nbr.2	+	5	956	c.786G>A	c.(784-786)TCG>TCA	p.S262S		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	262	JNK-binding domain (JBD).				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)														---	---	---	---
OR9G9	504191	broad.mit.edu	37	11	56468183	56468183	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468183C>A	uc010rjn.1	+	1	320	c.320C>A	c.(319-321)GCC>GAC	p.A107D		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
ACTN3	89	broad.mit.edu	37	11	66330310	66330310	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66330310A>T	uc001oio.1	+	21	2450	c.2432A>T	c.(2431-2433)AAC>ATC	p.N811I	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	811	EF-hand 2.|2; possibly ancestral.				focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0																		---	---	---	---
ANKRD13D	338692	broad.mit.edu	37	11	67068796	67068796	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67068796C>T	uc001okc.1	+	13	1525	c.1014C>T	c.(1012-1014)AGC>AGT	p.S338S	ANKRD13D_uc001okd.1_Silent_p.S425S|ANKRD13D_uc001oke.1_Silent_p.S338S|ANKRD13D_uc001okg.1_Silent_p.S121S|ANKRD13D_uc001okh.1_Silent_p.S121S|ANKRD13D_uc001oki.1_Silent_p.S75S|SSH3_uc001okj.2_5'Flank|SSH3_uc001okk.2_5'Flank|SSH3_uc001okl.2_5'Flank	NM_207354	NP_997237	Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	338										ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)															---	---	---	---
GAB2	9846	broad.mit.edu	37	11	77961191	77961191	+	Intron	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77961191G>C	uc001ozh.2	-						GAB2_uc001ozg.2_Intron	NM_080491	NP_536739			GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)															---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78387401	78387401	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78387401G>A	uc001ozl.3	-	30	5755	c.5292C>T	c.(5290-5292)GCC>GCT	p.A1764A	ODZ4_uc001ozk.3_5'UTR|ODZ4_uc009yvb.1_Silent_p.A348A	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1764	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
PGR	5241	broad.mit.edu	37	11	100999722	100999722	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100999722A>G	uc001pgh.2	-	1	823	c.80T>C	c.(79-81)CTG>CCG	p.L27P	PGR_uc001pgi.2_Missense_Mutation_p.L27P|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	27	Modulating, Pro-Rich.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)													---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40689398	40689398	+	Silent	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40689398G>T	uc001rmg.3	+	23	3169	c.3048G>T	c.(3046-3048)CTG>CTT	p.L1016L	LRRK2_uc001rmh.1_Silent_p.L638L|LRRK2_uc009zjw.2_5'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1016	LRR 2.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
ANKRD52	283373	broad.mit.edu	37	12	56650822	56650822	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56650822G>A	uc001skm.3	-	4	328	c.238C>T	c.(238-240)CGT>TGT	p.R80C	ANKRD52_uc001skn.1_RNA	NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	80	ANK 3.						protein binding			ovary(2)	2																		---	---	---	---
FZD10	11211	broad.mit.edu	37	12	130648028	130648028	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130648028C>G	uc001uii.2	+	1	997	c.541C>G	c.(541-543)CCG>GCG	p.P181A	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	181	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)														---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29933476	29933476	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29933476C>T	uc001usl.3	+	6	3071	c.3013C>T	c.(3013-3015)CGG>TGG	p.R1005W		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	995	Localization to the growing distal tip of microtubules.|Potential.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
FRY	10129	broad.mit.edu	37	13	32869526	32869526	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32869526C>T	uc001utx.2	+	61	9467	c.8971C>T	c.(8971-8973)CGC>TGC	p.R2991C	FRY_uc010tdw.1_RNA|FRY_uc001utz.2_Missense_Mutation_p.R522C|FRY_uc010tdx.1_Missense_Mutation_p.R361C	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	2991					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52509058	52509058	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52509058C>T	uc001vfw.2	-	21	4389	c.4232G>A	c.(4231-4233)CGG>CAG	p.R1411Q	ATP7B_uc010adv.2_Missense_Mutation_p.R981Q|ATP7B_uc001vfx.2_Missense_Mutation_p.R1204Q|ATP7B_uc001vfy.2_Missense_Mutation_p.R1300Q|ATP7B_uc010tgt.1_Missense_Mutation_p.R1346Q|ATP7B_uc010tgu.1_Missense_Mutation_p.R1363Q|ATP7B_uc010tgv.1_Missense_Mutation_p.R1333Q|ATP7B_uc001vfv.2_Missense_Mutation_p.R683Q|ATP7B_uc010tgs.1_Missense_Mutation_p.R622Q	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1411	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding	p.R1411W(1)		ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
LRRC16B	90668	broad.mit.edu	37	14	24538052	24538052	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24538052C>T	uc001wlj.2	+	38	4016	c.3859C>T	c.(3859-3861)CGC>TGC	p.R1287C	LRRC16B_uc001wlk.2_Missense_Mutation_p.R340C|CPNE6_uc010tnv.1_5'Flank|CPNE6_uc001wlm.2_5'Flank|CPNE6_uc001wll.2_5'Flank	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1287										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
COCH	1690	broad.mit.edu	37	14	31354637	31354637	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31354637G>A	uc001wqr.2	+	10	851	c.771G>A	c.(769-771)ACG>ACA	p.T257T	COCH_uc001wqp.2_Silent_p.T257T|COCH_uc001wqq.3_Silent_p.T257T|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.T108T	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	257	VWFA 1.				sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)														---	---	---	---
PELI2	57161	broad.mit.edu	37	14	56757012	56757012	+	Silent	SNP	C	T	T	rs146968853		TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56757012C>T	uc001xch.2	+	5	820	c.534C>T	c.(532-534)CCC>CCT	p.P178P		NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2	178					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1																		---	---	---	---
ESR2	2100	broad.mit.edu	37	14	64746715	64746715	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64746715A>T	uc001xha.1	-	3	987	c.519T>A	c.(517-519)TTT>TTA	p.F173L	ESR2_uc001xgu.2_Missense_Mutation_p.F173L|ESR2_uc001xgv.2_Missense_Mutation_p.F173L|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Missense_Mutation_p.F173L|ESR2_uc001xgy.1_Missense_Mutation_p.F173L|ESR2_uc001xgz.1_Missense_Mutation_p.F173L|ESR2_uc010aqb.1_Intron|ESR2_uc010aqc.1_Missense_Mutation_p.F173L	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	173	Nuclear receptor.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)													---	---	---	---
ESRRB	2103	broad.mit.edu	37	14	76905997	76905997	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76905997C>T	uc001xsq.1	+	2	368	c.301C>T	c.(301-303)CGC>TGC	p.R101C	ESRRB_uc001xsr.2_Missense_Mutation_p.R101C|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	101						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)														---	---	---	---
STUB1	10273	broad.mit.edu	37	16	732036	732036	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:732036A>C	uc002cit.2	+	5	1040	c.629A>C	c.(628-630)GAC>GCC	p.D210A	STUB1_uc002ciu.2_Missense_Mutation_p.D138A|STUB1_uc010bqz.2_RNA|STUB1_uc002civ.2_RNA|JMJD8_uc002ciw.1_3'UTR|JMJD8_uc002cix.1_3'UTR|JMJD8_uc002ciy.1_3'UTR	NM_005861	NP_005852	Q9UNE7	CHIP_HUMAN	STIP1 homology and U-box containing protein 1	210					cellular response to misfolded protein|DNA repair|misfolded or incompletely synthesized protein catabolic process|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K63-linked ubiquitination|protein maturation|regulation of glucocorticoid metabolic process|ubiquitin-dependent SMAD protein catabolic process	cytoplasm|nuclear inclusion body|ubiquitin conjugating enzyme complex|ubiquitin ligase complex	Hsp70 protein binding|Hsp90 protein binding|kinase binding|misfolded protein binding|protein binding, bridging|protein homodimerization activity|SMAD binding|TPR domain binding|ubiquitin-ubiquitin ligase activity				0		Hepatocellular(780;0.00335)																---	---	---	---
KIAA0430	9665	broad.mit.edu	37	16	15703512	15703512	+	Silent	SNP	T	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15703512T>C	uc002ddr.2	-	20	4015	c.3822A>G	c.(3820-3822)CAA>CAG	p.Q1274Q	KIAA0430_uc002ddq.2_Silent_p.Q1108Q|KIAA0430_uc010uzv.1_Silent_p.Q1270Q|KIAA0430_uc010uzw.1_Silent_p.Q1273Q	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	1273						peroxisome	nucleotide binding|RNA binding				0																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	T	T	rs28934576	by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577120C>T	uc002gim.2	-	8	1012	c.818G>A	c.(817-819)CGT>CAT	p.R273H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
MYH8	4626	broad.mit.edu	37	17	10300235	10300235	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10300235G>A	uc002gmm.2	-	31	4342	c.4247C>T	c.(4246-4248)TCC>TTC	p.S1416F	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1416	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11														Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11713560	11713560	+	Intron	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11713560C>G	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26107840	26107840	+	Silent	SNP	G	A	A	rs34719207	byFrequency;by1000genomes	TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26107840G>A	uc002gzu.2	-	9	1221	c.957C>T	c.(955-957)TTC>TTT	p.F319F	NOS2_uc010crh.1_Silent_p.F319F|NOS2_uc010wab.1_Silent_p.F319F	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	319					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
EVI2B	2124	broad.mit.edu	37	17	29631298	29631298	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29631298G>T	uc002hgk.2	-	2	1485	c.1330C>A	c.(1330-1332)CCT>ACT	p.P444T	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.P459T	NM_006495	NP_006486	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B precursor	444	Cytoplasmic (Potential).					cytoplasm|integral to plasma membrane				ovary(2)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)														---	---	---	---
KIF2B	84643	broad.mit.edu	37	17	51900738	51900738	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51900738G>C	uc002iua.2	+	1	500	c.344G>C	c.(343-345)TGG>TCG	p.W115S	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	115					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8																		---	---	---	---
MRC2	9902	broad.mit.edu	37	17	60742129	60742129	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60742129C>G	uc002jad.2	+	2	741	c.339C>G	c.(337-339)GAC>GAG	p.D113E	MRC2_uc002jac.2_Missense_Mutation_p.D113E	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	113	Extracellular (Potential).|Ricin B-type lectin.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
CANT1	124583	broad.mit.edu	37	17	76989937	76989937	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76989937G>A	uc002jwn.2	-	6	1340	c.901C>T	c.(901-903)CGC>TGC	p.R301C	CANT1_uc002jwk.2_Missense_Mutation_p.R301C|CANT1_uc002jwj.2_Missense_Mutation_p.R301C|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_RNA	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	301	Lumenal (Potential).			R->A: Reduces activity by 99%.	positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)					T	ETV4	prostate								---	---	---	---
TBXA2R	6915	broad.mit.edu	37	19	3600344	3600344	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600344C>T	uc002lyg.1	-	2	503	c.289G>A	c.(289-291)GCC>ACC	p.A97T	TBXA2R_uc002lye.1_Missense_Mutation_p.A97T	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	97	Extracellular (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)													---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9063102	9063102	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9063102G>T	uc002mkp.2	-	3	24548	c.24344C>A	c.(24343-24345)CCA>CAA	p.P8115Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8117	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
GRIK5	2901	broad.mit.edu	37	19	42510819	42510819	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42510819C>T	uc002osj.1	-	15	2050	c.2015G>A	c.(2014-2016)GGC>GAC	p.G672D	GRIK5_uc002osi.1_Missense_Mutation_p.G244D	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	672	Extracellular (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)													---	---	---	---
NCOA6	23054	broad.mit.edu	37	20	33324511	33324511	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33324511G>A	uc002xav.2	-	13	8516	c.5945C>T	c.(5944-5946)GCC>GTC	p.A1982V	NCOA6_uc002xaw.2_Missense_Mutation_p.A1982V	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1982	EP300/CRSP3-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7																		---	---	---	---
JPH2	57158	broad.mit.edu	37	20	42744524	42744524	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42744524C>T	uc002xli.1	-	4	2664	c.1791G>A	c.(1789-1791)TCG>TCA	p.S597S		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	597	Pro-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
APCDD1L	164284	broad.mit.edu	37	20	57036311	57036311	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57036311G>A	uc002xze.1	-	4	1227	c.1041C>T	c.(1039-1041)GGC>GGT	p.G347G	APCDD1L_uc010zzp.1_Silent_p.G358G	NM_153360	NP_699191	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated	347						integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)															---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62076114	62076114	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076114C>T	uc002yey.1	-	4	765	c.588G>A	c.(586-588)GCG>GCA	p.A196A	KCNQ2_uc002yez.1_Silent_p.A196A|KCNQ2_uc002yfa.1_Silent_p.A196A|KCNQ2_uc002yfb.1_Silent_p.A196A|KCNQ2_uc011aax.1_Silent_p.A196A|KCNQ2_uc002yfc.1_Silent_p.A196A	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	196	Helical; Voltage-sensor; Name=Segment S4; (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
RTEL1	51750	broad.mit.edu	37	20	62326251	62326251	+	Silent	SNP	C	T	T			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62326251C>T	uc002yfu.1	+	32	3610	c.3267C>T	c.(3265-3267)GAC>GAT	p.D1089D	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Silent_p.D1089D|RTEL1_uc011abd.1_Silent_p.D1113D|RTEL1_uc011abe.1_Silent_p.D866D|RTEL1_uc002yfw.2_RNA|RTEL1_uc002yfx.1_Silent_p.D334D|TNFRSF6B_uc002yfy.2_5'Flank|TNFRSF6B_uc002yfz.2_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	1089					DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)															---	---	---	---
HSF2BP	11077	broad.mit.edu	37	21	44949700	44949700	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44949700G>A	uc002zdi.2	-	9	1271	c.939C>T	c.(937-939)AAC>AAT	p.N313N	HSF2BP_uc011aey.1_Silent_p.N238N	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding	313					spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)														---	---	---	---
SHOX	6473	broad.mit.edu	37	X	591691	591691	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:591691A>G	uc004cph.1	+	2	750	c.59A>G	c.(58-60)AAC>AGC	p.N20S	SHOX_uc004cpi.2_Missense_Mutation_p.N20S	NM_000451	NP_000442	O15266	SHOX_HUMAN	short stature homeobox isoform SHOXa	20	Poly-Gly.				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
PHEX	5251	broad.mit.edu	37	X	22244557	22244557	+	Intron	SNP	T	C	C			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22244557T>C	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435			phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
MAGEB1	4112	broad.mit.edu	37	X	30269232	30269232	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30269232A>G	uc004dcc.2	+	4	942	c.622A>G	c.(622-624)ATC>GTC	p.I208V	MAGEB1_uc004dcd.2_Missense_Mutation_p.I208V|MAGEB1_uc004dce.2_Missense_Mutation_p.I208V	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	208	MAGE.										0																		---	---	---	---
CYLC1	1538	broad.mit.edu	37	X	83128313	83128313	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128313T>A	uc004eei.1	+	4	618	c.597T>A	c.(595-597)GAT>GAA	p.D199E	CYLC1_uc004eeh.1_Missense_Mutation_p.D198E	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	199					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5																		---	---	---	---
DCAF12L2	340578	broad.mit.edu	37	X	125299536	125299536	+	Silent	SNP	G	A	A			TCGA-D7-6817-01	TCGA-D7-6817-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299536G>A	uc004euk.1	-	1	399	c.372C>T	c.(370-372)GAC>GAT	p.D124D		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	124										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7																		---	---	---	---
