Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CLCNKB	1188	broad.mit.edu	37	1	16363393	16363412	+	Intron	DEL	TCAGTGCACCATGATCTCCA	-	-	rs71003234		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16363393_16363412delTCAGTGCACCATGATCTCCA	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076			chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
FAM131C	348487	broad.mit.edu	37	1	16386305	16386306	+	Intron	INS	-	C	C	rs143272992		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386305_16386306insC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429			hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30196204	30196205	+	IGR	INS	-	CAC	CAC	rs147183868	by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30196204_30196205insCAC								PTPRU (542889 upstream) : MATN1 (987921 downstream)																																			---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57498844	57498845	+	Intron	INS	-	ACAC	ACAC	rs141683665	by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57498844_57498845insACAC	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170			Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)															---	---	---	---
USH2A	7399	broad.mit.edu	37	1	215914591	215914592	+	Intron	INS	-	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215914591_215914592insA	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
DEGS1	8560	broad.mit.edu	37	1	224379894	224379894	+	Intron	DEL	T	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224379894delT	uc001hoj.2	+						DEGS1_uc001hoi.2_Intron	NM_144780	NP_659004			degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)														---	---	---	---
WDR26	80232	broad.mit.edu	37	1	224586836	224586837	+	Intron	INS	-	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224586836_224586837insT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_Intron	NM_025160	NP_079436			WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)														---	---	---	---
MRPL30	51263	broad.mit.edu	37	2	99779655	99779655	+	Intron	DEL	C	-	-	rs68130738		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779655delC	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214			SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1																		---	---	---	---
COL8A1	1295	broad.mit.edu	37	3	99509436	99509436	+	Intron	DEL	T	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99509436delT	uc003dtg.1	+						COL8A1_uc003dth.1_Intron|COL8A1_uc003dti.1_Intron	NM_001850	NP_001841			alpha 1 type VIII collagen precursor						angiogenesis|cell adhesion	basement membrane|collagen type VIII					0																		---	---	---	---
KLHL6	89857	broad.mit.edu	37	3	183245512	183245513	+	Intron	DEL	GT	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183245512_183245513delGT	uc003flr.2	-						KLHL6_uc003fls.1_Intron|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713			kelch-like 6											haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)															---	---	---	---
FAM114A1	92689	broad.mit.edu	37	4	38934057	38934058	+	Intron	DEL	AC	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38934057_38934058delAC	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron|FAM114A1_uc010ifi.2_Intron	NM_138389	NP_612398			hypothetical protein LOC92689							cytoplasm				ovary(1)	1																		---	---	---	---
ADH1C	126	broad.mit.edu	37	4	100261040	100261041	+	Intron	INS	-	A	A	rs138827617	by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100261040_100261041insA	uc003huu.2	-							NM_000669	NP_000660			class I alcohol dehydrogenase, gamma subunit						ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
PHIP	55023	broad.mit.edu	37	6	79735452	79735453	+	Intron	INS	-	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79735452_79735453insA	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404			pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)														---	---	---	---
AIM1	202	broad.mit.edu	37	6	106987579	106987581	+	Intron	DEL	AAA	-	-	rs11366105		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106987579_106987581delAAA	uc003prh.2	+						AIM1_uc003pri.2_5'Flank	NM_001624	NP_001615			absent in melanoma 1								sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)														---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123868450	123868451	+	Intron	DEL	AA	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123868450_123868451delAA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|TRDN_uc010keo.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	81213789	81213794	+	IGR	DEL	CACACA	-	-	rs62517186		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81213789_81213794delCACACA								TPD52 (129953 upstream) : ZBTB10 (184060 downstream)																																			---	---	---	---
NDRG1	10397	broad.mit.edu	37	8	134292668	134292669	+	Intron	INS	-	T	T	rs34104549		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134292668_134292669insT	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714			N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
GSDMD	79792	broad.mit.edu	37	8	144641496	144641496	+	Intron	DEL	C	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144641496delC	uc010mfe.2	+						uc003yye.2_5'Flank|GSDMD_uc003yyf.2_Intron|GSDMD_uc003yyi.2_Intron|GSDMD_uc003yyg.2_Intron|GSDMD_uc003yyh.2_Intron	NM_024736	NP_079012			gasdermin D												0																		---	---	---	---
FAM190B	54462	broad.mit.edu	37	10	86215039	86215040	+	Intron	INS	-	TT	TT	rs11201044		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86215039_86215040insTT	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Intron	NM_018999	NP_061872			granule cell antiserum positive 14											ovary(3)|skin(1)	4																		---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
LRP4	4038	broad.mit.edu	37	11	46886651	46886651	+	Intron	DEL	T	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46886651delT	uc001ndn.3	-						uc001ndl.2_Intron|LRP4_uc001ndm.3_5'Flank	NM_002334	NP_002325			low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)														---	---	---	---
RTN4RL2	349667	broad.mit.edu	37	11	57234850	57234851	+	Intron	INS	-	T	T	rs112047355		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57234850_57234851insT	uc010rjt.1	+							NM_178570	NP_848665			reticulon 4 receptor-like 2 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	27288144	27288144	+	IGR	DEL	A	-	-	rs11301501		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27288144delA								C12orf71 (52689 upstream) : STK38L (108934 downstream)																																			---	---	---	---
ZIC5	85416	broad.mit.edu	37	13	100622668	100622688	+	In_Frame_Del	DEL	GGCGGCGGCGGCGGCGGCGGC	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100622668_100622688delGGCGGCGGCGGCGGCGGCGGC	uc001vom.1	-	1	1491_1511	c.1242_1262delGCCGCCGCCGCCGCCGCCGCC	c.(1240-1263)CCGCCGCCGCCGCCGCCGCCGCCA>CCA	p.414_421PPPPPPPP>P		NM_033132	NP_149123	Q96T25	ZIC5_HUMAN	zinc finger protein of the cerebellum 5	414_421	Pro-rich.				cell differentiation	nucleus	DNA binding|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
PROZ	8858	broad.mit.edu	37	13	113816154	113816155	+	Intron	INS	-	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113816154_113816155insT	uc001vta.1	+						PROZ_uc010agr.1_Intron	NM_003891	NP_003882			protein Z, vitamin K-dependent plasma						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)													---	---	---	---
SIP1	8487	broad.mit.edu	37	14	39597689	39597690	+	Intron	INS	-	T	T	rs149334273		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39597689_39597690insT	uc001wuq.2	+						SIP1_uc001wur.2_Intron|SIP1_uc001wus.2_Intron|SIP1_uc010amx.2_Intron	NM_003616	NP_003607			SMN-interacting protein 1 isoform alpha						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)														---	---	---	---
EML5	161436	broad.mit.edu	37	14	89124421	89124423	+	Intron	DEL	ACC	-	-	rs143248735		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89124421_89124423delACC	uc001xxg.2	-						EML5_uc001xxf.2_Intron|EML5_uc001xxh.1_Intron	NM_183387	NP_899243			echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3																		---	---	---	---
FMN1	342184	broad.mit.edu	37	15	33256125	33256126	+	Intron	DEL	CA	-	-	rs35753530		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33256125_33256126delCA	uc001zhf.3	-							NM_001103184	NP_001096654			formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)														---	---	---	---
HIGD2B	123346	broad.mit.edu	37	15	72968748	72968749	+	Intron	INS	-	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72968748_72968749insT	uc002ava.2	-							NR_002780				Homo sapiens HIG1 domain family, member 2B pseudogene, mRNA (cDNA clone IMAGE:5742106).												0																		---	---	---	---
MLST8	64223	broad.mit.edu	37	16	2255805	2255805	+	Intron	DEL	G	-	-	rs3214648		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2255805delG	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_5'UTR|MLST8_uc010uvy.1_5'UTR|MLST8_uc002cpg.2_5'UTR|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_5'UTR	NM_022372	NP_071767			G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0																		---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74493530	74493531	+	Intron	INS	-	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74493530_74493531insA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
RHOT1	55288	broad.mit.edu	37	17	30500729	30500730	+	Intron	INS	-	A	A	rs79743579		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30500729_30500730insA	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777			ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)																---	---	---	---
MLX	6945	broad.mit.edu	37	17	40719105	40719105	+	5'UTR	DEL	C	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40719105delC	uc002iag.2	+	1					MLX_uc002iaf.2_5'UTR|MLX_uc002iah.2_5'UTR	NM_170607	NP_733752			transcription factor-like protein 4 isoform						energy reserve metabolic process|negative regulation of transcription, DNA-dependent|positive regulation of cellular metabolic process	cytoplasm|nucleus	DNA binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding				0		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)														---	---	---	---
EXOC7	23265	broad.mit.edu	37	17	74093808	74093813	+	Intron	DEL	AAAAAG	-	-	rs57781252		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74093808_74093813delAAAAAG	uc002jqs.2	-						EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron|EXOC7_uc002jqu.2_Intron	NM_001145297	NP_001138769			exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)															---	---	---	---
CEP76	79959	broad.mit.edu	37	18	12680596	12680597	+	Intron	DEL	AA	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12680596_12680597delAA	uc002kri.2	-						PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Intron|CEP76_uc010wzz.1_Intron	NM_024899	NP_079175			centrosomal protein 76kDa						G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0																		---	---	---	---
ALDH16A1	126133	broad.mit.edu	37	19	49964655	49964655	+	Intron	DEL	A	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964655delA	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160			aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)														---	---	---	---
SUMO1P1	391257	broad.mit.edu	37	20	52492025	52492026	+	RNA	INS	-	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52492025_52492026insA	uc010gik.2	-	1		c.223_224insT				NR_002189				Homo sapiens SUMO1 pseudogene 1, mRNA (cDNA clone IMAGE:6619211).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	20229947	20229948	+	IGR	INS	-	T	T	rs140136910	by1000genomes;by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229947_20229948insT								TMPRSS15 (453977 upstream) : None (None downstream)																																			---	---	---	---
ERG	2078	broad.mit.edu	37	21	39763697	39763697	+	Intron	DEL	A	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39763697delA	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron	NM_001136155	NP_001129627			ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	44756755	44756755	+	IGR	DEL	A	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756755delA								CRYAA (163842 upstream) : SIK1 (77643 downstream)																																			---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347			gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
ITGB1BP2	26548	broad.mit.edu	37	X	70521864	70521865	+	Intron	INS	-	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70521864_70521865insT	uc004dzr.1	+						BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_5'UTR	NM_012278	NP_036410			integrin beta 1 binding protein 2						muscle organ development|signal transduction		SH3 domain binding			ovary(1)	1	Renal(35;0.156)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10011935	10011936	+	IGR	INS	-	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10011935_10011936insT								TTTY22 (361081 upstream) : None (None downstream)																																			---	---	---	---
RBMY1A1	5940	broad.mit.edu	37	Y	23710117	23710117	+	Intron	DEL	T	-	-			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:23710117delT	uc004fuq.3	+						RBMY1A1_uc010nxa.2_Intron|RBMY1A1_uc004fur.3_Intron|RBMY1A1_uc011nbd.1_Intron	NM_001006120	NP_001006120			RNA binding motif protein, Y-linked, family 1,						mRNA processing|RNA splicing|spermatogenesis	nucleus	nucleotide binding|RNA binding				0																		---	---	---	---
AMY2B	280	broad.mit.edu	37	1	104118115	104118115	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104118115C>T	uc001duq.2	+	9	1670	c.1054C>T	c.(1054-1056)CGA>TGA	p.R352*	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Nonsense_Mutation_p.R352*|AMY2B_uc001dus.1_RNA	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	352		Chloride (By similarity).			carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)														---	---	---	---
ATP1A1	476	broad.mit.edu	37	1	116941382	116941382	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116941382T>G	uc001ege.2	+	16	2603	c.2264T>G	c.(2263-2265)TTT>TGT	p.F755C	ATP1A1_uc010owv.1_Missense_Mutation_p.F724C|ATP1A1_uc010oww.1_Missense_Mutation_p.F755C|ATP1A1_uc010owx.1_Missense_Mutation_p.F724C|C1orf203_uc009whb.2_Intron|ATP1A1_uc001egh.2_5'Flank	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	755	Cytoplasmic (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)													---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152188153	152188153	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188153G>A	uc001ezt.1	-	3	6028	c.5952C>T	c.(5950-5952)TCC>TCT	p.S1984S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1984	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152190998	152190998	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152190998C>T	uc001ezt.1	-	3	3183	c.3107G>A	c.(3106-3108)AGC>AAC	p.S1036N		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1036	12.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152285533	152285533	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285533C>T	uc001ezu.1	-	3	1865	c.1829G>A	c.(1828-1830)GGG>GAG	p.G610E	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	610	Filaggrin 3.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
LCE2D	353141	broad.mit.edu	37	1	152636662	152636662	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152636662G>C	uc001fag.2	+	2	136	c.81G>C	c.(79-81)AAG>AAC	p.K27N		NM_178430	NP_848517	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	27	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
NHLH1	4807	broad.mit.edu	37	1	160340766	160340766	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160340766C>T	uc001fwa.2	+	2	687	c.245C>T	c.(244-246)ACG>ATG	p.T82M		NM_005598	NP_005589	Q02575	HEN1_HUMAN	nescient helix loop helix 1	82	Basic motif.				cell differentiation|central nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176709162	176709162	+	Silent	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176709162G>C	uc001gkz.2	+	14	5145	c.3981G>C	c.(3979-3981)GTG>GTC	p.V1327V	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1327					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---
F13B	2165	broad.mit.edu	37	1	197021789	197021789	+	Silent	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197021789C>A	uc001gtt.1	-	9	1574	c.1530G>T	c.(1528-1530)GTG>GTT	p.V510V		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	510	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
ADORA1	134	broad.mit.edu	37	1	203134527	203134527	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134527C>T	uc001gze.1	+	4	913	c.480C>T	c.(478-480)GGC>GGT	p.G160G	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Silent_p.G160G|ADORA1_uc010pqg.1_Silent_p.G92G|ADORA1_uc009xak.1_Nonsense_Mutation_p.Q86*|ADORA1_uc010pqh.1_Silent_p.G193G	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	160	Extracellular (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)													---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240371129	240371129	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371129C>T	uc010pyd.1	+	5	3242	c.3017C>T	c.(3016-3018)GCG>GTG	p.A1006V	FMN2_uc010pye.1_Missense_Mutation_p.A1010V	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1006	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25656795	25656795	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25656795G>C	uc002rgh.2	-	13	1577	c.1327C>G	c.(1327-1329)CTG>GTG	p.L443V	DTNB_uc002rgg.2_Missense_Mutation_p.L72V|DTNB_uc010yko.1_Missense_Mutation_p.L386V|DTNB_uc010ykp.1_Missense_Mutation_p.L239V|DTNB_uc002rgo.2_Missense_Mutation_p.L234V|DTNB_uc002rgi.2_Missense_Mutation_p.L443V|DTNB_uc002rgj.2_Missense_Mutation_p.L443V|DTNB_uc002rgk.2_Missense_Mutation_p.L413V|DTNB_uc002rgl.2_Missense_Mutation_p.L413V|DTNB_uc002rgq.2_Missense_Mutation_p.L443V|DTNB_uc002rgm.2_Missense_Mutation_p.L413V|DTNB_uc002rgn.2_Missense_Mutation_p.L239V|DTNB_uc002rgr.1_Missense_Mutation_p.L432V|DTNB_uc010ykq.1_Missense_Mutation_p.L296V	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1	443	Potential.|Syntrophin-binding region.					cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ASXL2	55252	broad.mit.edu	37	2	25966067	25966067	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25966067A>C	uc002rgs.2	-	12	3360	c.3139T>G	c.(3139-3141)TCC>GCC	p.S1047A	ASXL2_uc002rgt.1_Intron	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1047					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ZNF512	84450	broad.mit.edu	37	2	27838091	27838091	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27838091G>A	uc002rla.2	+	11	1275	c.1188G>A	c.(1186-1188)TGG>TGA	p.W396*	ZNF512_uc010ylv.1_Nonsense_Mutation_p.W317*|ZNF512_uc010ylw.1_Nonsense_Mutation_p.W367*|ZNF512_uc002rlb.2_Nonsense_Mutation_p.W317*|ZNF512_uc010ylx.1_Nonsense_Mutation_p.W317*|ZNF512_uc002rlc.2_Nonsense_Mutation_p.W317*|ZNF512_uc010yly.1_RNA|ZNF512_uc010ylz.1_Nonsense_Mutation_p.W289*	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512	396					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CEBPZ	10153	broad.mit.edu	37	2	37455880	37455880	+	Silent	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37455880A>G	uc002rpz.2	-	2	486	c.456T>C	c.(454-456)AAT>AAC	p.N152N	C2orf56_uc010ynj.1_5'Flank|C2orf56_uc002rqa.3_5'Flank|C2orf56_uc002rqc.3_5'Flank|C2orf56_uc010ynk.1_5'Flank|C2orf56_uc010ynl.1_5'Flank	NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta	152					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)																---	---	---	---
IMMT	10989	broad.mit.edu	37	2	86378626	86378626	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86378626C>T	uc002sqz.3	-	12	1583	c.1195G>A	c.(1195-1197)GAT>AAT	p.D399N	IMMT_uc002sqy.3_Missense_Mutation_p.D140N|IMMT_uc002srb.3_Missense_Mutation_p.D388N|IMMT_uc002sra.3_Missense_Mutation_p.D398N|IMMT_uc010ytd.1_Missense_Mutation_p.D387N|IMMT_uc010yte.1_Missense_Mutation_p.D352N|IMMT_uc002src.1_Missense_Mutation_p.D135N	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	399	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1																		---	---	---	---
CCDC74A	90557	broad.mit.edu	37	2	132285734	132285734	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132285734A>C	uc002tta.2	+	1	243	c.191A>C	c.(190-192)CAC>CCC	p.H64P	CCDC74A_uc010fnb.1_Missense_Mutation_p.H64P|CCDC74A_uc002ttb.2_Missense_Mutation_p.H64P	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	64	Potential.									skin(1)	1																		---	---	---	---
ZAK	51776	broad.mit.edu	37	2	174047608	174047608	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174047608G>A	uc002uhz.2	+	4	474	c.274G>A	c.(274-276)GAT>AAT	p.D92N	ZAK_uc002uhx.2_Missense_Mutation_p.D92N|ZAK_uc002uhy.2_Missense_Mutation_p.D92N|ZAK_uc010zei.1_5'UTR|ZAK_uc002uia.1_Missense_Mutation_p.D92N	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1	92	Protein kinase.				activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	186678562	186678562	+	RNA	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186678562G>T	uc002upm.2	+	2		c.3200G>T			uc010zfu.1_Silent_p.T1204T					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																														---	---	---	---
TFPI	7035	broad.mit.edu	37	2	188348868	188348868	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188348868T>A	uc002upx.2	-	6	644	c.611A>T	c.(610-612)AAG>ATG	p.K204M	TFPI_uc002upy.2_Missense_Mutation_p.K204M|TFPI_uc002upz.2_Missense_Mutation_p.K200M|TFPI_uc002uqa.2_Missense_Mutation_p.K204M|TFPI_uc002uqb.2_Missense_Mutation_p.K204M	NM_006287	NP_006278	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor isoform a	204					blood coagulation, extrinsic pathway	extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)													---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196729058	196729058	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196729058C>G	uc002utj.3	-	41	7422	c.7321G>C	c.(7321-7323)GAT>CAT	p.D2441H		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2441	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212288966	212288966	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212288966C>T	uc002veg.1	-	23	2878	c.2780G>A	c.(2779-2781)CGA>CAA	p.R927Q	ERBB4_uc002veh.1_Missense_Mutation_p.R927Q|ERBB4_uc010zji.1_Missense_Mutation_p.R917Q|ERBB4_uc010zjj.1_Missense_Mutation_p.R917Q	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	927	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
COL6A3	1293	broad.mit.edu	37	2	238280910	238280910	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238280910G>A	uc002vwl.2	-	9	4035	c.3750C>T	c.(3748-3750)TAC>TAT	p.Y1250Y	COL6A3_uc002vwo.2_Silent_p.Y1044Y|COL6A3_uc010znj.1_Silent_p.Y643Y|COL6A3_uc002vwq.2_Silent_p.Y1044Y|COL6A3_uc002vwr.2_Silent_p.Y843Y	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1250	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9100112	9100112	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9100112C>T	uc003brf.1	-	7	1522	c.846G>A	c.(844-846)CGG>CGA	p.R282R	SRGAP3_uc003brg.1_Silent_p.R282R|SRGAP3_uc003bri.1_RNA|SRGAP3_uc003brj.1_Silent_p.R142R	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	282					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
THRB	7068	broad.mit.edu	37	3	24164613	24164613	+	Missense_Mutation	SNP	C	T	T	rs121918708		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24164613C>T	uc003ccx.3	-	11	1497	c.1148G>A	c.(1147-1149)CGC>CAC	p.R383H	THRB_uc010hfe.2_Missense_Mutation_p.R383H|THRB_uc003ccy.3_Missense_Mutation_p.R383H|THRB_uc003ccz.3_Missense_Mutation_p.R378H	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta	383	Ligand-binding.|Interaction with NR2F6.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
SUSD5	26032	broad.mit.edu	37	3	33195166	33195166	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33195166C>A	uc003cfo.1	-	5	1376	c.958G>T	c.(958-960)GCT>TCT	p.A320S		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	320	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47364083	47364083	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47364083G>T	uc003crd.2	+	3	412	c.286G>T	c.(286-288)GCC>TCC	p.A96S	KLHL18_uc003crc.2_Missense_Mutation_p.A96S|KLHL18_uc011bav.1_5'UTR	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	96	BTB.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62459960	62459960	+	Missense_Mutation	SNP	G	T	T	rs151301388		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62459960G>T	uc003dll.2	-	24	3725	c.3365C>A	c.(3364-3366)ACC>AAC	p.T1122N	CADPS_uc003dlj.1_Missense_Mutation_p.T72N|CADPS_uc003dlk.1_Missense_Mutation_p.T570N|CADPS_uc003dlm.2_Missense_Mutation_p.T1083N|CADPS_uc003dln.2_Missense_Mutation_p.T1043N	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1122	Interaction with DRD2.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78656095	78656095	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78656095A>G	uc003dqe.2	-	29	4740	c.4532T>C	c.(4531-4533)CTC>CCC	p.L1511P	ROBO1_uc003dqb.2_Missense_Mutation_p.L1472P|ROBO1_uc003dqc.2_Missense_Mutation_p.L1411P|ROBO1_uc003dqd.2_Missense_Mutation_p.L1466P|ROBO1_uc010hoh.2_Missense_Mutation_p.L703P|ROBO1_uc011bgl.1_Missense_Mutation_p.L1083P	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1511	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89390956	89390956	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89390956T>C	uc003dqy.2	+	5	1247	c.1022T>C	c.(1021-1023)GTT>GCT	p.V341A	EPHA3_uc003dqx.1_Missense_Mutation_p.V341A|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	341	Extracellular (Potential).|Fibronectin type-III 1.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89528535	89528535	+	Intron	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89528535C>G	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
FILIP1L	11259	broad.mit.edu	37	3	99569912	99569912	+	Nonsense_Mutation	SNP	A	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99569912A>T	uc003dtm.2	-	5	1071	c.608T>A	c.(607-609)TTA>TAA	p.L203*	C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Nonsense_Mutation_p.L203*|FILIP1L_uc010hpf.2_5'UTR|FILIP1L_uc010hpg.2_5'UTR|FILIP1L_uc003dtn.2_5'UTR|FILIP1L_uc003dtp.1_5'UTR	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1	203	Potential.					cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1																		---	---	---	---
SLC7A14	57709	broad.mit.edu	37	3	170244454	170244454	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170244454A>T	uc003fgz.2	-	2	588	c.272T>A	c.(271-273)TTC>TAC	p.F91Y	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	91	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)															---	---	---	---
ATP11B	23200	broad.mit.edu	37	3	182587059	182587059	+	Silent	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182587059C>G	uc003flb.2	+	17	2063	c.1806C>G	c.(1804-1806)CTC>CTG	p.L602L	ATP11B_uc003flc.2_Silent_p.L186L	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	602	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)															---	---	---	---
KIAA1430	57587	broad.mit.edu	37	4	186097014	186097014	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186097014C>T	uc003ixf.3	-	3	1393	c.1246G>A	c.(1246-1248)GAT>AAT	p.D416N	KIAA1430_uc003ixg.2_Missense_Mutation_p.D416N	NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587	416	Potential.										0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)														---	---	---	---
KIF2A	3796	broad.mit.edu	37	5	61659532	61659532	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61659532C>G	uc003jsy.3	+	14	1584	c.1273C>G	c.(1273-1275)CAA>GAA	p.Q425E	KIF2A_uc003jsz.3_Missense_Mutation_p.Q425E|KIF2A_uc010iwp.2_Missense_Mutation_p.Q406E|KIF2A_uc003jsx.3_Missense_Mutation_p.Q405E|KIF2A_uc010iwq.2_Missense_Mutation_p.Q228E	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1	425	Kinesin-motor.				blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)														---	---	---	---
MYOT	9499	broad.mit.edu	37	5	137206682	137206682	+	Silent	SNP	C	A	A	rs34593399	by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137206682C>A	uc011cye.1	+	2	359	c.342C>A	c.(340-342)TCC>TCA	p.S114S	MYOT_uc003lbv.2_Silent_p.S114S|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_5'UTR	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	114	Necessary for interaction with ACTN1.				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
PCDHA11	56138	broad.mit.edu	37	5	140250587	140250587	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250587G>A	uc003lia.2	+	1	2757	c.1899G>A	c.(1897-1899)ACG>ACA	p.T633T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.T633T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	633	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167858361	167858361	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167858361G>A	uc003lzu.2	+	15	2285	c.2192G>A	c.(2191-2193)TGG>TAG	p.W731*	WWC1_uc003lzv.2_Nonsense_Mutation_p.W731*|WWC1_uc011den.1_Nonsense_Mutation_p.W731*|WWC1_uc003lzw.2_Nonsense_Mutation_p.W530*|WWC1_uc010jjf.1_5'UTR	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	731	C2.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
CAGE1	285782	broad.mit.edu	37	6	7373546	7373546	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7373546T>G	uc003mxi.2	-	4	1819	c.1098A>C	c.(1096-1098)AGA>AGC	p.R366S	CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_Missense_Mutation_p.R257S|CAGE1_uc003mxk.1_Missense_Mutation_p.R257S	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN	cancer antigen 1	502	Potential.										0	Ovarian(93;0.0418)																	---	---	---	---
ITPR3	3710	broad.mit.edu	37	6	33636823	33636823	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33636823G>C	uc011drk.1	+	18	2298	c.2079G>C	c.(2077-2079)TGG>TGC	p.W693C		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	693	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19																		---	---	---	---
TULP1	7287	broad.mit.edu	37	6	35466171	35466171	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35466171G>T	uc003okv.3	-	15	1574	c.1562C>A	c.(1561-1563)CCG>CAG	p.P521Q	TEAD3_uc003oku.3_5'Flank|TEAD3_uc010jvx.2_5'Flank|TULP1_uc003okw.3_Missense_Mutation_p.P468Q	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1	521					dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
IL17F	112744	broad.mit.edu	37	6	52101719	52101719	+	3'UTR	SNP	T	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52101719T>G	uc003pam.1	-	3					IL17F_uc003pal.1_3'UTR	NM_052872	NP_443104			interleukin 17F precursor						cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)																	---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57398320	57398320	+	Intron	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57398320A>G	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
SMAP1	60682	broad.mit.edu	37	6	71562283	71562283	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71562283G>A	uc003pfr.2	+	8	953	c.705G>A	c.(703-705)ACG>ACA	p.T235T	SMAP1_uc003pfs.2_Silent_p.T208T|SMAP1_uc010kao.2_Silent_p.T208T|SMAP1_uc010kap.2_Silent_p.T225T	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating	235					regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0																		---	---	---	---
MAP3K7	6885	broad.mit.edu	37	6	91269867	91269867	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91269867C>T	uc003pnz.1	-	5	572	c.410G>A	c.(409-411)TGT>TAT	p.C137Y	MAP3K7_uc003poa.1_Missense_Mutation_p.C137Y|MAP3K7_uc003pob.1_Missense_Mutation_p.C137Y|MAP3K7_uc003poc.1_Missense_Mutation_p.C137Y	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	137	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)														---	---	---	---
AIM1	202	broad.mit.edu	37	6	106991352	106991352	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106991352G>A	uc003prh.2	+	9	4182	c.3695G>A	c.(3694-3696)TGT>TAT	p.C1232Y	AIM1_uc003pri.2_Missense_Mutation_p.C36Y	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1232	Beta/gamma crystallin 'Greek key' 5.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)														---	---	---	---
CNKSR3	154043	broad.mit.edu	37	6	154743791	154743791	+	Intron	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154743791A>G	uc003qpy.2	-							NM_173515	NP_775786			CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)														---	---	---	---
CNKSR3	154043	broad.mit.edu	37	6	154743792	154743792	+	Intron	SNP	A	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154743792A>T	uc003qpy.2	-							NM_173515	NP_775786			CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)														---	---	---	---
KIF25	3834	broad.mit.edu	37	6	168440804	168440804	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168440804C>T	uc003qwk.1	+	6	816	c.554C>T	c.(553-555)GCG>GTG	p.A185V	KIF25_uc003qwl.1_Missense_Mutation_p.A185V	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	185	Kinesin-motor.				microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)														---	---	---	---
THBS2	7058	broad.mit.edu	37	6	169626379	169626379	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169626379G>A	uc003qwt.2	-	17	2682	c.2434C>T	c.(2434-2436)CGA>TGA	p.R812*		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	812	TSP type-3 4.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)														---	---	---	---
SP8	221833	broad.mit.edu	37	7	20824871	20824871	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20824871C>T	uc003suy.2	-	3	752	c.511G>A	c.(511-513)GGG>AGG	p.G171R	SP8_uc003suz.2_Missense_Mutation_p.G189R	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor isoform 2	171					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1																		---	---	---	---
PURB	5814	broad.mit.edu	37	7	44924525	44924525	+	Silent	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44924525G>T	uc003tme.2	-	1	436	c.423C>A	c.(421-423)GGC>GGA	p.G141G		NM_033224	NP_150093	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	141	By similarity.				regulation of myeloid cell differentiation	DNA replication factor A complex	mRNA binding|single-stranded DNA binding|transcription factor binding				0																		---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127953233	127953233	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127953233C>T	uc003vmp.2	-	18	2255	c.2140G>A	c.(2140-2142)GAG>AAG	p.E714K	RBM28_uc003vmo.2_Missense_Mutation_p.E256K|RBM28_uc011koj.1_Missense_Mutation_p.E573K	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	714					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
DEFB135	613209	broad.mit.edu	37	8	11842018	11842018	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11842018C>T	uc003wuw.1	+	2	153	c.153C>T	c.(151-153)AAC>AAT	p.N51N		NM_001033017	NP_001028189	Q30KP9	DB135_HUMAN	beta-defensin 135 precursor	51					defense response to bacterium	extracellular region					0																		---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32505536	32505536	+	Intron	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505536G>A	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Silent_p.V100V|NRG1_uc010lvt.2_Silent_p.V100V	NM_013964	NP_039258			neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72977792	72977792	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72977792A>G	uc003xza.2	-	4	621	c.446T>C	c.(445-447)GTC>GCC	p.V149A		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	149	Cytoplasmic (Potential).|ANK 3.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
CDH17	1015	broad.mit.edu	37	8	95206855	95206855	+	Intron	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95206855T>A	uc003ygh.2	-						CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Intron	NM_004063	NP_004054			cadherin 17 precursor							integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)															---	---	---	---
CNTNAP3	79937	broad.mit.edu	37	9	39178303	39178303	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39178303T>C	uc004abi.2	-	5	832	c.593A>G	c.(592-594)AAA>AGA	p.K198R	CNTNAP3_uc004abj.2_Missense_Mutation_p.K198R|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Missense_Mutation_p.K198R|CNTNAP3_uc011lqs.1_Missense_Mutation_p.K198R|CNTNAP3_uc004abl.1_Missense_Mutation_p.K110R	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	198	Extracellular (Potential).|Laminin G-like 1.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)														---	---	---	---
C9orf171	389799	broad.mit.edu	37	9	135374805	135374805	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135374805C>T	uc004cbn.2	+	4	498	c.450C>T	c.(448-450)CAC>CAT	p.H150H	C9orf171_uc004cbo.2_Silent_p.H114H	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799	150										ovary(4)|large_intestine(1)	5																		---	---	---	---
SLC34A3	142680	broad.mit.edu	37	9	140128709	140128709	+	Silent	SNP	G	C	C	rs146097023		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140128709G>C	uc004cmf.1	+	10	1260	c.1074G>C	c.(1072-1074)GTG>GTC	p.V358V	SLC34A3_uc004cmd.1_Silent_p.V358V|SLC34A3_uc011met.1_Silent_p.V358V	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	358	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)														---	---	---	---
SLC16A9	220963	broad.mit.edu	37	10	61424004	61424004	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61424004C>T	uc010qig.1	-	4	866	c.417G>A	c.(415-417)GCG>GCA	p.A139A		NM_194298	NP_919274	Q7RTY1	MOT9_HUMAN	solute carrier family 16 (monocarboxylic acid	139	Helical; (Potential).				urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3																		---	---	---	---
RGR	5995	broad.mit.edu	37	10	86008799	86008799	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86008799C>A	uc001kdc.1	+	3	396	c.358C>A	c.(358-360)CGT>AGT	p.R120S	RGR_uc001kdb.1_Missense_Mutation_p.P107Q|RGR_uc001kdd.1_Missense_Mutation_p.R124S|RGR_uc001kde.1_Missense_Mutation_p.R120S	NM_001012720	NP_001012738	P47804	RGR_HUMAN	retinal G-protein coupled receptor isoform 2	120	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity|protein binding			ovary(1)	1																		---	---	---	---
PDZD8	118987	broad.mit.edu	37	10	119133926	119133926	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119133926G>A	uc001lde.1	-	1	1012	c.813C>T	c.(811-813)ATC>ATT	p.I271I		NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	271					intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)														---	---	---	---
CTSD	1509	broad.mit.edu	37	11	1774867	1774867	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1774867C>T	uc001luc.1	-	9	1238	c.1105G>A	c.(1105-1107)GGC>AGC	p.G369S	CTSD_uc009yda.1_RNA	NM_001909	NP_001900	P07339	CATD_HUMAN	cathepsin D preproprotein	369					cell death|proteolysis	extracellular space|lysosome|melanosome	aspartic-type endopeptidase activity				0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
OR51M1	390059	broad.mit.edu	37	11	5410875	5410875	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5410875C>G	uc010qzc.1	+	1	247	c.247C>G	c.(247-249)CTG>GTG	p.L83V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	83						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR51I2	390064	broad.mit.edu	37	11	5474876	5474876	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5474876C>A	uc010qzf.1	+	1	158	c.158C>A	c.(157-159)CCC>CAC	p.P53H	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
NLRP10	338322	broad.mit.edu	37	11	7982173	7982173	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7982173G>A	uc001mfv.1	-	2	1003	c.986C>T	c.(985-987)ACG>ATG	p.T329M		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	329	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)														---	---	---	---
OR4A15	81328	broad.mit.edu	37	11	55135528	55135528	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135528G>T	uc010rif.1	+	1	169	c.169G>T	c.(169-171)GTC>TTC	p.V57F		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	57	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
MS4A14	84689	broad.mit.edu	37	11	60183390	60183390	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60183390C>A	uc001npj.2	+	5	1514	c.949C>A	c.(949-951)CCT>ACT	p.P317T	MS4A14_uc001npi.2_Missense_Mutation_p.P205T|MS4A14_uc001npn.2_Missense_Mutation_p.P55T|MS4A14_uc001npk.2_Missense_Mutation_p.P300T|MS4A14_uc001npl.2_Missense_Mutation_p.P55T|MS4A14_uc001npm.2_Missense_Mutation_p.P55T	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	317						integral to membrane	receptor activity			breast(1)	1																		---	---	---	---
CAPN5	726	broad.mit.edu	37	11	76829348	76829348	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76829348C>T	uc001oxx.2	+	8	1302	c.1117C>T	c.(1117-1119)CGC>TGC	p.R373C	CAPN5_uc009yup.2_Missense_Mutation_p.R413C|CAPN5_uc009yuq.2_Missense_Mutation_p.R409C|CAPN5_uc001oxy.2_Missense_Mutation_p.R413C|CAPN5_uc001oya.2_5'Flank	NM_004055	NP_004046	O15484	CAN5_HUMAN	calpain 5	373	Domain III.				proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
PCF11	51585	broad.mit.edu	37	11	82874885	82874885	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82874885G>A	uc001ozx.3	+	3	828	c.483G>A	c.(481-483)GTG>GTA	p.V161V	PCF11_uc010rsu.1_Silent_p.V161V	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	161					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1																		---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
TECTA	7007	broad.mit.edu	37	11	121032936	121032936	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121032936C>T	uc010rzo.1	+	15	5129	c.5129C>T	c.(5128-5130)CCC>CTC	p.P1710L		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1710					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)														---	---	---	---
OR8D2	283160	broad.mit.edu	37	11	124189623	124189623	+	Silent	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189623T>C	uc010sah.1	-	1	471	c.471A>G	c.(469-471)ACA>ACG	p.T157T		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)														---	---	---	---
GALNT8	26290	broad.mit.edu	37	12	4874570	4874570	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4874570A>G	uc001qne.1	+	10	1711	c.1619A>G	c.(1618-1620)GAG>GGG	p.E540G		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	540	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
C12orf35	55196	broad.mit.edu	37	12	32136728	32136728	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32136728A>G	uc001rks.2	+	4	3253	c.2839A>G	c.(2839-2841)ACT>GCT	p.T947A		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	947										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)															---	---	---	---
COL2A1	1280	broad.mit.edu	37	12	48367927	48367927	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48367927A>G	uc001rqu.2	-	53	4443	c.4262T>C	c.(4261-4263)ATC>ACC	p.I1421T	COL2A1_uc001rqt.2_Missense_Mutation_p.I202T|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.I1352T	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1421	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)													---	---	---	---
BAZ2A	11176	broad.mit.edu	37	12	56993020	56993020	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56993020G>A	uc001slq.1	-	27	5495	c.5301C>T	c.(5299-5301)GGC>GGT	p.G1767G	BAZ2A_uc001slp.1_Silent_p.G1765G|BAZ2A_uc001slo.1_Silent_p.G573G|BAZ2A_uc009zov.1_Silent_p.G733G|BAZ2A_uc009zow.1_Silent_p.G1735G	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1767					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0																		---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	72863563	72863563	+	Silent	SNP	G	A	A	rs149072587	byFrequency	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72863563G>A	uc001sxa.2	+	4	1236	c.1206G>A	c.(1204-1206)CCG>CCA	p.P402P		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	402	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100206067	100206067	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100206067G>A	uc001tge.1	-	3	655	c.238C>T	c.(238-240)CAG>TAG	p.Q80*	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Nonsense_Mutation_p.Q80*	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	80	ANK 2.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
PTPN11	5781	broad.mit.edu	37	12	112891073	112891073	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112891073T>A	uc001ttx.2	+	4	787	c.407T>A	c.(406-408)CTT>CAT	p.L136H	PTPN11_uc001ttw.1_Missense_Mutation_p.L136H	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	136	SH2 2.				axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding			haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392								Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				---	---	---	---
OASL	8638	broad.mit.edu	37	12	121458498	121458498	+	Nonsense_Mutation	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121458498T>A	uc001tzj.1	-	6	1417	c.1411A>T	c.(1411-1413)AAA>TAA	p.K471*	OASL_uc001tzk.1_3'UTR	NM_003733	NP_003724	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like isoform a	471	Ubiquitin-like 2.				interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
ULK1	8408	broad.mit.edu	37	12	132380356	132380356	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132380356T>A	uc001uje.2	+	3	501	c.233T>A	c.(232-234)CTG>CAG	p.L78Q		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	78	Protein kinase.				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)														---	---	---	---
C13orf34	79866	broad.mit.edu	37	13	73303150	73303150	+	Silent	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73303150T>A	uc001viv.1	+	2	191	c.72T>A	c.(70-72)CCT>CCA	p.P24P	C13orf37_uc001viu.2_5'Flank|C13orf34_uc010thq.1_5'UTR|C13orf34_uc010aen.1_Silent_p.P99P|C13orf34_uc010thr.1_5'UTR|C13orf34_uc001viw.1_Silent_p.P24P	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis	24					cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77636799	77636799	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77636799C>G	uc001vkf.2	-	75	12683	c.12592G>C	c.(12592-12594)GAT>CAT	p.D4198H	MYCBP2_uc010aev.2_Missense_Mutation_p.D3602H|MYCBP2_uc001vke.2_Missense_Mutation_p.D815H	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	4198					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77671759	77671759	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77671759G>A	uc001vkf.2	-	57	9507	c.9416C>T	c.(9415-9417)GCT>GTT	p.A3139V	MYCBP2_uc010aev.2_Missense_Mutation_p.A2543V|MYCBP2_uc001vkg.1_Missense_Mutation_p.A662V|MYCBP2_uc010aew.2_Missense_Mutation_p.A525V	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	3139					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101797186	101797186	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101797186A>C	uc001vox.1	-	16	2090	c.1901T>G	c.(1900-1902)TTT>TGT	p.F634C	NALCN_uc001voy.2_Missense_Mutation_p.F349C	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	634	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
TRIM9	114088	broad.mit.edu	37	14	51467488	51467488	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51467488C>T	uc001wyx.3	-	6	2142	c.1377G>A	c.(1375-1377)ACG>ACA	p.T459T	TRIM9_uc001wyy.2_Silent_p.T455T|TRIM9_uc001wyz.3_Silent_p.T459T	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	459	Fibronectin type-III.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)																	---	---	---	---
KLC1	3831	broad.mit.edu	37	14	104053664	104053664	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104053664T>A	uc010tyd.1	+	4	479	c.439T>A	c.(439-441)TTA>ATA	p.L147I	C14orf153_uc001ynl.3_RNA|C14orf153_uc010tyc.1_Missense_Mutation_p.L160I	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1	106					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)																---	---	---	---
ADSSL1	122622	broad.mit.edu	37	14	105201396	105201396	+	Nonsense_Mutation	SNP	A	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105201396A>T	uc001ypd.2	+	2	306	c.232A>T	c.(232-234)AAA>TAA	p.K78*	INF2_uc010tyi.1_Intron|ADSSL1_uc001ype.2_Nonsense_Mutation_p.K121*|ADSSL1_uc001ypf.2_RNA	NM_152328	NP_689541	Q8N142	PURA1_HUMAN	adenylosuccinate synthase like 1 isoform 2	78					AMP biosynthetic process|immune system process|purine base metabolic process	cytosol	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(1)|central_nervous_system(1)	2		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)	L-Aspartic Acid(DB00128)													---	---	---	---
SNORD116-4	100033416	broad.mit.edu	37	15	25327987	25327987	+	Intron	SNP	T	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25327987T>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|SNORD116-16_uc001yya.2_RNA|IPW_uc001yyb.3_5'Flank|SNORD116-19_uc001yyc.2_5'Flank|uc001yyd.2_5'Flank|SNORD116-18_uc010ayk.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0																		---	---	---	---
IGDCC3	9543	broad.mit.edu	37	15	65621754	65621754	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65621754C>A	uc002aos.2	-	13	2431	c.2179G>T	c.(2179-2181)GCA>TCA	p.A727S	IGDCC3_uc002aor.1_Missense_Mutation_p.A14S	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	727	Cytoplasmic (Potential).									ovary(3)	3																		---	---	---	---
AXIN1	8312	broad.mit.edu	37	16	354405	354405	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:354405G>C	uc002cgp.1	-	5	1330	c.1153C>G	c.(1153-1155)CCT>GCT	p.P385A	AXIN1_uc002cgq.1_Missense_Mutation_p.P385A	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	385	Interaction with GSK3B (By similarity).				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)																---	---	---	---
IGFALS	3483	broad.mit.edu	37	16	1841608	1841608	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1841608G>C	uc002cmy.2	-	2	892	c.811C>G	c.(811-813)CTG>GTG	p.L271V	IGFALS_uc010uvn.1_Missense_Mutation_p.L309V|IGFALS_uc010uvo.1_5'UTR	NM_004970	NP_004961	P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid	271	LRR 9.				cell adhesion|signal transduction	soluble fraction	insulin-like growth factor binding				0																		---	---	---	---
LRRC29	26231	broad.mit.edu	37	16	67241591	67241591	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67241591T>C	uc002esd.2	-	4	1486	c.589A>G	c.(589-591)AGA>GGA	p.R197G	LRRC29_uc002ese.2_Missense_Mutation_p.R197G|LRRC29_uc002esf.2_Missense_Mutation_p.R197G|LRRC29_uc002esg.2_Missense_Mutation_p.R197G	NM_012163	NP_036295	Q8WV35	LRC29_HUMAN	F-box and leucine-rich repeat protein 9	197	LRR 7.										0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)														---	---	---	---
GALNS	2588	broad.mit.edu	37	16	88884510	88884510	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88884510C>G	uc002fly.3	-	13	1476	c.1387G>C	c.(1387-1389)GAG>CAG	p.E463Q	GALNS_uc002flx.2_RNA|GALNS_uc010cid.2_Missense_Mutation_p.E469Q|GALNS_uc002flz.3_Missense_Mutation_p.E146Q	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	463						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)													---	---	---	---
BCL6B	255877	broad.mit.edu	37	17	6927474	6927474	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6927474C>T	uc002geg.2	+	3	309	c.252C>T	c.(250-252)CCC>CCT	p.P84P	BCL6B_uc010clt.1_Silent_p.P84P	NM_181844	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B (zinc finger	84	BTB.					nucleus	zinc ion binding			skin(1)	1																		---	---	---	---
ZBTB4	57659	broad.mit.edu	37	17	7369455	7369455	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7369455G>A	uc002ghc.3	-	3	916	c.666C>T	c.(664-666)GCC>GCT	p.A222A	ZBTB4_uc002ghd.3_Silent_p.A222A	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	222					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)														---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577570C>T	uc002gim.2	-	7	905	c.711G>A	c.(709-711)ATG>ATA	p.M237I	TP53_uc002gig.1_Missense_Mutation_p.M237I|TP53_uc002gih.2_Missense_Mutation_p.M237I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M105I|TP53_uc010cng.1_Missense_Mutation_p.M105I|TP53_uc002gii.1_Missense_Mutation_p.M105I|TP53_uc010cnh.1_Missense_Mutation_p.M237I|TP53_uc010cni.1_Missense_Mutation_p.M237I|TP53_uc002gij.2_Missense_Mutation_p.M237I|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M144I|TP53_uc002gio.2_Missense_Mutation_p.M105I	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	237	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		M -> L (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.M237I(99)|p.M237K(8)|p.0?(7)|p.M237V(6)|p.M237fs*10(4)|p.M237R(3)|p.M237T(2)|p.M237L(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.M237_N239delMCN(1)|p.H233fs*6(1)|p.M144I(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)|p.M237fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21319829	21319829	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319829C>T	uc002gyv.1	+	3	1880	c.1175C>T	c.(1174-1176)GCG>GTG	p.A392V		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	392	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
HOXB13	10481	broad.mit.edu	37	17	46805729	46805729	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46805729G>A	uc002ioa.2	-	1	383	c.227C>T	c.(226-228)GCT>GTT	p.A76V		NM_006361	NP_006352	Q92826	HXB13_HUMAN	homeobox B13	76					angiogenesis|epidermis development|response to wounding		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
FAM117A	81558	broad.mit.edu	37	17	47788713	47788713	+	Silent	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47788713C>A	uc002ipk.2	-	8	1335	c.1266G>T	c.(1264-1266)CCG>CCT	p.P422P	FAM117A_uc010wlz.1_Silent_p.P150P	NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	422	Pro-rich.									ovary(1)	1																		---	---	---	---
SYNGR2	9144	broad.mit.edu	37	17	76167968	76167968	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76167968C>T	uc002juu.1	+	4	653	c.626C>T	c.(625-627)ACC>ATC	p.T209I	SYNGR2_uc002jut.2_Missense_Mutation_p.P239S|SYNGR2_uc002juv.1_3'UTR|SYNGR2_uc010dhi.1_RNA	NM_004710	NP_004701	O43760	SNG2_HUMAN	synaptogyrin 2	209						integral to plasma membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)															---	---	---	---
ANKRD12	23253	broad.mit.edu	37	18	9255014	9255014	+	Silent	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9255014T>C	uc002knv.2	+	9	2006	c.1749T>C	c.(1747-1749)TAT>TAC	p.Y583Y	ANKRD12_uc002knw.2_Silent_p.Y560Y|ANKRD12_uc002knx.2_Silent_p.Y560Y|ANKRD12_uc010dkx.1_Silent_p.Y290Y	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	583						nucleus				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
ZNF521	25925	broad.mit.edu	37	18	22805131	22805131	+	Silent	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22805131G>T	uc002kvk.2	-	4	2998	c.2751C>A	c.(2749-2751)GCC>GCA	p.A917A	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.A917A|ZNF521_uc002kvl.2_Silent_p.A697A	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	917					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)							T	PAX5	ALL								---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24035839	24035839	+	Silent	SNP	T	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24035839T>C	uc002kvw.2	-	5	1202	c.642A>G	c.(640-642)GGA>GGG	p.G214G	KCTD1_uc010xbj.1_Silent_p.G822G|KCTD1_uc010xbk.1_Silent_p.G214G|KCTD1_uc002kvy.2_3'UTR	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain	214					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
TCEB3C	162699	broad.mit.edu	37	18	44549225	44549225	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44549225G>A	uc010dnr.2	-	1	1074	c.1074C>T	c.(1072-1074)GTC>GTT	p.V358V	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_001100817	NP_001094287	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	358	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0																		---	---	---	---
PCSK4	54760	broad.mit.edu	37	19	1488005	1488005	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1488005G>A	uc002ltb.1	-	4	536	c.474C>T	c.(472-474)GAC>GAT	p.D158D	PCSK4_uc002lta.2_Translation_Start_Site	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	158	Catalytic (By similarity).	Charge relay system (By similarity).			proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
KCNJ14	3770	broad.mit.edu	37	19	48967993	48967993	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48967993C>T	uc002pje.1	+	3	1675	c.1270C>T	c.(1270-1272)CGA>TGA	p.R424*	KCNJ14_uc002pjf.1_Nonsense_Mutation_p.R424*	NM_013348	NP_037480	Q9UNX9	IRK14_HUMAN	potassium inwardly-rectifying channel J14	424	Cytoplasmic (By similarity).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)														---	---	---	---
ZNF132	7691	broad.mit.edu	37	19	58944795	58944795	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58944795C>T	uc002qst.3	-	3	2417	c.2016G>A	c.(2014-2016)CGG>CGA	p.R672R		NM_003433	NP_003424	P52740	ZN132_HUMAN	zinc finger protein 132	672	C2H2-type 17.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)														---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4854604	4854604	+	Silent	SNP	C	A	A	rs62636560	byFrequency;by1000genomes	TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4854604C>A	uc002wlg.1	-	11	1455	c.1080G>T	c.(1078-1080)CCG>CCT	p.P360P	SLC23A2_uc010zqr.1_Silent_p.P245P|SLC23A2_uc002wlh.1_Silent_p.P360P|SLC23A2_uc002wli.2_Silent_p.P359P	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	360					L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2																		---	---	---	---
XRN2	22803	broad.mit.edu	37	20	21306950	21306950	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21306950G>A	uc002wsf.1	+	2	204	c.109G>A	c.(109-111)GAT>AAT	p.D37N	XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_5'UTR	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	37					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
SSTR4	6754	broad.mit.edu	37	20	23016831	23016831	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23016831G>C	uc002wsr.2	+	1	775	c.711G>C	c.(709-711)AAG>AAC	p.K237N		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	237	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)																	---	---	---	---
NANP	140838	broad.mit.edu	37	20	25597072	25597072	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25597072G>C	uc002wuy.2	-	2	300	c.236C>G	c.(235-237)GCA>GGA	p.A79G		NM_152667	NP_689880	Q8TBE9	NANP_HUMAN	N-acetylneuraminic acid phosphatase	79					N-acetylneuraminate biosynthetic process		N-acylneuraminate-9-phosphatase activity|phosphoglycolate phosphatase activity				0																		---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52609046	52609046	+	Intron	SNP	C	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52609046C>A	uc002xws.2	-						BCAS1_uc010zza.1_Intron|BCAS1_uc010zzb.1_Intron|BCAS1_uc010gim.2_Intron|BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60582625	60582625	+	Missense_Mutation	SNP	G	C	C	rs6089604		TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60582625G>C	uc002ybs.2	-	6	1952	c.1952C>G	c.(1951-1953)CCT>CGT	p.P651R		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	651	TAFH.				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
ADRM1	11047	broad.mit.edu	37	20	60883243	60883243	+	Intron	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60883243C>T	uc002ycn.2	+						ADRM1_uc002yco.2_Intron	NM_007002	NP_008933			adhesion regulating molecule 1 precursor						proteasome assembly|transcription elongation from RNA polymerase II promoter	cytoplasm|integral to plasma membrane|membrane fraction|nucleus|proteasome complex	endopeptidase activator activity|protease binding|proteasome binding				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)															---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26224916	26224916	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26224916C>T	uc003abz.1	+	15	3210	c.2960C>T	c.(2959-2961)ACG>ATG	p.T987M	MYO18B_uc003aca.1_Missense_Mutation_p.T868M|MYO18B_uc010guy.1_Missense_Mutation_p.T868M|MYO18B_uc010guz.1_Missense_Mutation_p.T868M|MYO18B_uc011aka.1_Missense_Mutation_p.T141M|MYO18B_uc011akb.1_Missense_Mutation_p.T500M	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	987	Myosin head-like.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36690172	36690172	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36690172C>T	uc003apg.2	-	28	4034	c.3803G>A	c.(3802-3804)CGC>CAC	p.R1268H		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1268	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11								T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				---	---	---	---
RANGAP1	5905	broad.mit.edu	37	22	41650402	41650402	+	Silent	SNP	C	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41650402C>T	uc003azs.2	-	10	2640	c.1170G>A	c.(1168-1170)GAG>GAA	p.E390E	RANGAP1_uc003azt.2_Silent_p.E390E|RANGAP1_uc003azu.2_Silent_p.E390E|RANGAP1_uc003azr.2_5'Flank|RANGAP1_uc010gyk.2_5'Flank|RANGAP1_uc011aoz.1_Silent_p.E335E	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	390	Asp/Glu-rich (highly acidic).|Asp/Glu-rich (highly acidic).				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0																		---	---	---	---
TBC1D25	4943	broad.mit.edu	37	X	48418150	48418150	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48418150G>T	uc004dka.1	+	6	965	c.854G>T	c.(853-855)CGC>CTC	p.R285L	TBC1D25_uc011mly.1_Missense_Mutation_p.R227L|TBC1D25_uc004dkb.1_Missense_Mutation_p.R31L|TBC1D25_uc011mlz.1_Missense_Mutation_p.R31L|TBC1D25_uc011mma.1_Missense_Mutation_p.R31L|TBC1D25_uc004dkc.1_Missense_Mutation_p.R31L|TBC1D25_uc011mmb.1_Missense_Mutation_p.R289L|TBC1D25_uc011mmc.1_Missense_Mutation_p.R31L|TBC1D25_uc011mmd.1_Missense_Mutation_p.R31L	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	285	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TFDP3	51270	broad.mit.edu	37	X	132351883	132351883	+	Silent	SNP	G	A	A			TCGA-D7-6820-01	TCGA-D7-6820-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132351883G>A	uc004exb.1	-	1	494	c.405C>T	c.(403-405)GGC>GGT	p.G135G		NM_016521	NP_057605	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	135	Potential.					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
