Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
C1orf174	339448	broad.mit.edu	37	1	3806284	3806286	+	3'UTR	DEL	AAG	-	-	rs59405380		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3806284_3806286delAAG	uc001alf.2	-	4					C1orf174_uc009vls.2_RNA	NM_207356	NP_997239			hypothetical protein LOC339448												0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)														---	---	---	---
ZBTB40	9923	broad.mit.edu	37	1	22818140	22818140	+	Intron	DEL	T	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22818140delT	uc001bft.2	+						ZBTB40_uc001bfu.2_Intron|ZBTB40_uc009vqi.1_Intron	NM_001083621	NP_001077090			zinc finger and BTB domain containing 40						bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)														---	---	---	---
PIGK	10026	broad.mit.edu	37	1	77595400	77595403	+	Intron	DEL	AAAT	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77595400_77595403delAAAT	uc001dhk.2	-						PIGK_uc010orj.1_Intron|PIGK_uc009wbx.2_Intron	NM_005482	NP_005473			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|protein thiol-disulfide exchange|proteolysis	GPI-anchor transamidase complex	cysteine-type endopeptidase activity|GPI-anchor transamidase activity|protein binding			ovary(2)|pancreas(1)	3																		---	---	---	---
ABCD3	5825	broad.mit.edu	37	1	94883978	94883980	+	5'UTR	DEL	GCC	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94883978_94883980delGCC	uc001dqn.3	+	1					ABCD3_uc001dqm.3_5'UTR|ABCD3_uc010oto.1_5'UTR|ABCD3_uc010otp.1_5'UTR|ABCD3_uc009wdr.2_5'UTR	NM_002858	NP_002849			ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144852792	144852793	+	Intron	DEL	TT	-	-	rs72112087		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852792_144852793delTT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NDUFS2	4720	broad.mit.edu	37	1	161182364	161182365	+	Intron	INS	-	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161182364_161182365insT	uc001fyv.2	+						NDUFS2_uc001fyw.2_Intron|NDUFS2_uc010pkj.1_Intron|NDUFS2_uc001fyx.2_Intron|FCER1G_uc001fyz.1_5'Flank|FCER1G_uc001fza.1_5'Flank	NM_004550	NP_004541			NADH dehydrogenase (ubiquinone) Fe-S protein 2						mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity|protein binding|quinone binding			skin(1)	1	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		NADH(DB00157)													---	---	---	---
MTA3	57504	broad.mit.edu	37	2	42760223	42760223	+	Intron	DEL	C	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42760223delC	uc002rso.1	+							NM_020744	NP_065795			metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2																		---	---	---	---
LRCH3	84859	broad.mit.edu	37	3	197541957	197541961	+	Intron	DEL	GTTTT	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197541957_197541961delGTTTT	uc011bul.1	+						LRCH3_uc003fyj.1_Intron|LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron	NM_032773	NP_116162			leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)														---	---	---	---
SPATA5	166378	broad.mit.edu	37	4	123949662	123949662	+	Intron	DEL	T	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123949662delT	uc003iez.3	+							NM_145207	NP_660208			spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0																		---	---	---	---
DHX29	54505	broad.mit.edu	37	5	54585143	54585144	+	Frame_Shift_Ins	INS	-	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54585143_54585144insC	uc003jpx.2	-	8	1140_1141	c.1020_1021insG	c.(1018-1023)AATTTTfs	p.N340fs	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	340_341							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)																---	---	---	---
MAP3K1	4214	broad.mit.edu	37	5	56178732	56178732	+	Intron	DEL	G	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56178732delG	uc003jqw.3	+							NM_005921	NP_005912			mitogen-activated protein kinase kinase kinase						cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)														---	---	---	---
TAPBP	6892	broad.mit.edu	37	6	33280796	33280796	+	Intron	DEL	T	-	-	rs67868917		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33280796delT	uc003odx.1	-						TAPBP_uc010jus.1_Intron|TAPBP_uc003ody.2_Intron|TAPBP_uc003odz.2_Intron|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Intron	NM_003190	NP_003181			tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1																		---	---	---	---
MED20	9477	broad.mit.edu	37	6	41888526	41888527	+	Intron	INS	-	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41888526_41888527insA	uc003ork.2	-						MED20_uc003orj.2_Intron|MED20_uc011duh.1_Intron|MED20_uc011dui.1_Intron|MED20_uc011duj.1_Intron|BYSL_uc003orl.2_5'Flank	NM_004275	NP_004266			Trf (TATA binding protein-related						regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	mediator complex	DNA-directed RNA polymerase activity|protein binding				0	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000367)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
TTK	7272	broad.mit.edu	37	6	80717577	80717596	+	Frame_Shift_Del	DEL	ACTGGTTGAGTTTGTTGCTC	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80717577_80717596delACTGGTTGAGTTTGTTGCTC	uc003pjc.2	+	3	265_284	c.191_210delACTGGTTGAGTTTGTTGCTC	c.(190-210)GACTGGTTGAGTTTGTTGCTCfs	p.D64fs	TTK_uc003pjb.3_Frame_Shift_Del_p.D64fs	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	64_70					mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)														---	---	---	---
SNX8	29886	broad.mit.edu	37	7	2297644	2297644	+	Intron	DEL	T	-	-	rs71984612		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2297644delT	uc003slw.2	-							NM_013321	NP_037453			sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)														---	---	---	---
RSPH10B2	728194	broad.mit.edu	37	7	6825467	6825467	+	Intron	DEL	A	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6825467delA	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc011jxc.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836			radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
ETV1	2115	broad.mit.edu	37	7	13950864	13950864	+	Splice_Site	DEL	C	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13950864delC	uc011jxq.1	-	10	1609	c.870_splice	c.e10+1	p.E290_splice	ETV1_uc011jxn.1_Splice_Site_p.E250_splice|ETV1_uc011jxo.1_Splice_Site_p.E187_splice|ETV1_uc011jxp.1_Splice_Site_p.E232_splice|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_Splice_Site|ETV1_uc011jxr.1_Splice_Site_p.E272_splice|ETV1_uc011jxs.1_Splice_Site_p.E272_splice|ETV1_uc010ktv.2_Splice_Site_p.E159_splice	NM_004956	NP_004947			ets variant gene 1 isoform a						transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35								T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								---	---	---	---
Unknown	0	broad.mit.edu	37	7	63033168	63033176	+	IGR	DEL	GAGGAGGAG	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63033168_63033176delGAGGAGGAG								LOC100287704 (221017 upstream) : ZNF727 (472645 downstream)																																			---	---	---	---
HGSNAT	138050	broad.mit.edu	37	8	43050798	43050799	+	Intron	INS	-	AGA	AGA	rs144111342	by1000genomes	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43050798_43050799insAGA	uc003xpx.3	+							NM_152419	NP_689632			heparan-alpha-glucosaminide N-acetyltransferase						lysosomal transport|protein oligomerization	integral to membrane|lysosomal membrane	heparan-alpha-glucosaminide N-acetyltransferase activity				0	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)															---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9725916	9725916	+	Intron	DEL	T	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9725916delT	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870			SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	132152375	132152376	+	IGR	INS	-	AAA	AAA	rs34559456		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132152375_132152376insAAA								LOC116437 (454900 upstream) : SFRS8 (43259 downstream)																																			---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113458698	113458699	+	Intron	INS	-	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113458698_113458699insT	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|ATP11A_uc001vsm.1_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113458757	113458757	+	Intron	DEL	C	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113458757delC	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|ATP11A_uc001vsm.1_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
UPF3A	65110	broad.mit.edu	37	13	115057210	115057211	+	Frame_Shift_Ins	INS	-	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115057210_115057211insA	uc001vup.2	+	7	826_827	c.789_790insA	c.(787-792)TGCAAAfs	p.C263fs	UPF3A_uc001vuq.2_Frame_Shift_Ins_p.C230fs|UPF3A_uc001vus.2_RNA|UPF3A_uc001vur.2_RNA|UPF3A_uc001vut.2_Frame_Shift_Ins_p.C62fs|UPF3A_uc001vuu.2_5'UTR	NM_023011	NP_075387	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A	263_264					mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation	cytoplasm|nucleus|plasma membrane	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			skin(1)	1	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)														---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106800270	106800271	+	Intron	INS	-	C	C	rs147832868	by1000genomes	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106800270_106800271insC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
NF1P1	440225	broad.mit.edu	37	15	22137194	22137194	+	Intron	DEL	C	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22137194delC	uc010tzs.1	-											Human NF1-related locus DNA in A9 mouse DNA background.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	21902060	21902061	+	Intron	INS	-	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21902060_21902061insA	uc002djs.3	-						uc010vbo.1_Intron|uc002dju.1_5'Flank					Homo sapiens cDNA FLJ45371 fis, clone BRHIP3017855, highly  similar to Homo sapiens nuclear pore complex interacting protein (NPIP).																														---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577087	7577087	+	Frame_Shift_Del	DEL	G	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577087delG	uc002gim.2	-	8	1045	c.851delC	c.(850-852)ACAfs	p.T284fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.T284fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.T152fs|TP53_uc010cng.1_Frame_Shift_Del_p.T152fs|TP53_uc002gii.1_Frame_Shift_Del_p.T152fs|TP53_uc010cnh.1_Frame_Shift_Del_p.T284fs|TP53_uc010cni.1_Frame_Shift_Del_p.T284fs|TP53_uc002gij.2_Frame_Shift_Del_p.T284fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	284	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.T284P(7)|p.T284fs*61(3)|p.T284T(3)|p.T284A(3)|p.?(2)|p.T284fs*21(2)|p.T284fs*62(2)|p.R283fs*16(2)|p.T284I(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.R283_T284>T(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.R283fs*59(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CWC25	54883	broad.mit.edu	37	17	36958914	36958915	+	Intron	INS	-	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36958914_36958915insC	uc002hqu.2	-						CWC25_uc010wdv.1_Intron|PIP4K2B_uc002hqs.2_5'Flank|PIP4K2B_uc010wdt.1_5'Flank	NM_017748	NP_060218			coiled-coil domain containing 49												0																		---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72218928	72218928	+	Intron	DEL	T	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72218928delT	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	2079954	2079954	+	IGR	DEL	G	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2079954delG								C18orf2 (672773 upstream) : METTL4 (457571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	30362345	30362347	+	IGR	DEL	CTT	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30362345_30362347delCTT								KLHL14 (9371 upstream) : C18orf34 (155019 downstream)																																			---	---	---	---
ACAA2	10449	broad.mit.edu	37	18	47310305	47310305	+	Intron	DEL	A	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47310305delA	uc002ldw.3	-						ACAA2_uc002ldx.3_Intron	NM_006111	NP_006102			acetyl-coenzyme A acyltransferase 2						anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1																		---	---	---	---
CYB5A	1528	broad.mit.edu	37	18	71930382	71930384	+	Intron	DEL	AAA	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71930382_71930384delAAA	uc002lli.2	-						CYB5A_uc002llh.2_Intron	NM_148923	NP_683725			cytochrome b-5 isoform 1						electron transport chain|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	aldo-keto reductase (NADP) activity|cytochrome-c oxidase activity|enzyme binding|heme binding				0		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)			Methoxyflurane(DB01028)													---	---	---	---
HCN2	610	broad.mit.edu	37	19	603265	603265	+	Intron	DEL	G	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:603265delG	uc002lpe.2	+							NM_001194	NP_001185			hyperpolarization activated cyclic						cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TJP3	27134	broad.mit.edu	37	19	3719751	3719753	+	Intron	DEL	AAG	-	-	rs60042923		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3719751_3719753delAAG	uc010xhs.1	+						TJP3_uc010xht.1_Intron|TJP3_uc010xhu.1_5'Flank	NM_014428	NP_055243			tight junction protein 3							tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)												OREG0025089	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SYMPK	8189	broad.mit.edu	37	19	46318759	46318771	+	3'UTR	DEL	CCCCGCCCCGTCC	-	-	rs3840933		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46318759_46318771delCCCCGCCCCGTCC	uc002pdn.2	-	27					RSPH6A_uc002pdm.2_5'Flank	NM_004819	NP_004810			symplekin						cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)														---	---	---	---
MCM8	84515	broad.mit.edu	37	20	5975123	5975124	+	3'UTR	DEL	AG	-	-	rs11472210		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5975123_5975124delAG	uc002wmi.2	+	19					MCM8_uc002wmj.2_3'UTR|MCM8_uc002wmk.2_3'UTR|MCM8_uc002wml.2_3'UTR|MCM8_uc010gbp.2_3'UTR|MCM8_uc002wmm.2_3'UTR	NM_032485	NP_115874			minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1																		---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	44119406	44119407	+	IGR	INS	-	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44119406_44119407insA								WFDC2 (9235 upstream) : SPINT3 (21694 downstream)																																			---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074331	62074333	+	Intron	DEL	CAC	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074331_62074333delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
TRMT2A	27037	broad.mit.edu	37	22	20104493	20104511	+	Splice_Site	DEL	GGCCTGTCACAAGGGAAGT	-	-	rs11544956		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20104493_20104511delGGCCTGTCACAAGGGAAGT	uc002zrk.1	-	2	150	c.-65_splice	c.e2-1		TRMT2A_uc002zrl.1_5'UTR|TRMT2A_uc002zrm.1_5'UTR|TRMT2A_uc002zrn.1_5'UTR|TRMT2A_uc011ahk.1_5'UTR|RANBP1_uc011ahl.1_5'Flank|RANBP1_uc002zro.1_5'Flank|RANBP1_uc002zrp.2_5'Flank	NM_182984	NP_892029			HpaII tiny fragments locus 9C						RNA processing		nucleotide binding|RNA binding|RNA methyltransferase activity			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																																			---	---	---	---
ODZ1	10178	broad.mit.edu	37	X	123838709	123838709	+	Intron	DEL	A	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123838709delA	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068			odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23																		---	---	---	---
IDS	3423	broad.mit.edu	37	X	148607451	148607451	+	Intron	DEL	T	-	-			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148607451delT	uc004fcw.3	-						IDS_uc010nsu.1_Intron|uc004fcz.2_RNA	NM_000202	NP_000193			iduronate-2-sulfatase isoform a precursor							lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)																	---	---	---	---
ATAD3A	55210	broad.mit.edu	37	1	1463251	1463251	+	Intron	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1463251C>T	uc001afz.1	+						ATAD3A_uc001aga.1_Intron|ATAD3A_uc001agb.1_Intron	NM_018188	NP_060658			ATPase family, AAA domain containing 3A								ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)														---	---	---	---
TNFRSF8	943	broad.mit.edu	37	1	12169629	12169629	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12169629C>T	uc001atq.2	+	5	650	c.428C>T	c.(427-429)GCG>GTG	p.A143V	TNFRSF8_uc010obc.1_Missense_Mutation_p.A32V	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	143	TNFR-Cys 3.|Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
DLGAP3	58512	broad.mit.edu	37	1	35370218	35370218	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35370218T>C	uc001byc.2	-	1	767	c.767A>G	c.(766-768)AAG>AGG	p.K256R		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	256					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)																---	---	---	---
TIE1	7075	broad.mit.edu	37	1	43775063	43775063	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43775063C>T	uc001ciu.2	+	9	1272	c.1193C>T	c.(1192-1194)ACC>ATC	p.T398I	TIE1_uc010okd.1_Missense_Mutation_p.T398I|TIE1_uc010oke.1_Missense_Mutation_p.T353I|TIE1_uc009vwq.2_Missense_Mutation_p.T354I|TIE1_uc010okf.1_Missense_Mutation_p.T43I|TIE1_uc010okg.1_Missense_Mutation_p.T43I|TIE1_uc010okc.1_Silent_p.H306H	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	398	Ig-like C2-type 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
ZSWIM5	57643	broad.mit.edu	37	1	45484944	45484944	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45484944A>T	uc001cnd.2	-	14	2968	c.2740T>A	c.(2740-2742)TTC>ATC	p.F914I		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	914							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)															OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70501901	70501901	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70501901G>A	uc001dep.2	+	17	2009	c.1979G>A	c.(1978-1980)GGG>GAG	p.G660E	LRRC7_uc009wbg.2_Intron|LRRC7_uc001deq.2_5'Flank	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	660						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
PTGER3	5733	broad.mit.edu	37	1	71477911	71477911	+	Intron	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71477911T>C	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron|PTGER3_uc001dfq.2_Missense_Mutation_p.Q385R	NM_198714	NP_942007			prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)													---	---	---	---
PTGER3	5733	broad.mit.edu	37	1	71477912	71477912	+	Intron	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71477912G>T	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron|PTGER3_uc001dfq.2_Missense_Mutation_p.Q385K	NM_198714	NP_942007			prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)													---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79392725	79392725	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79392725G>A	uc001diq.3	-	8	1085	c.929C>T	c.(928-930)TCA>TTA	p.S310L		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	310	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103467974	103467974	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103467974T>G	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
DDX20	11218	broad.mit.edu	37	1	112308719	112308719	+	Missense_Mutation	SNP	C	A	A	rs145908941		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112308719C>A	uc001ebs.2	+	11	2030	c.1673C>A	c.(1672-1674)ACC>AAC	p.T558N	DDX20_uc010owf.1_Missense_Mutation_p.T320N|DDX20_uc001ebt.2_Missense_Mutation_p.T166N	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	558					assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FLG	2312	broad.mit.edu	37	1	152283455	152283455	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283455T>C	uc001ezu.1	-	3	3943	c.3907A>G	c.(3907-3909)AGA>GGA	p.R1303G	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1303	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152329104	152329104	+	Silent	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329104T>G	uc001ezw.3	-	3	1231	c.1158A>C	c.(1156-1158)GGA>GGC	p.G386G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	386	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152329376	152329376	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329376T>G	uc001ezw.3	-	3	959	c.886A>C	c.(886-888)AGT>CGT	p.S296R	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	296	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
LCE1C	353133	broad.mit.edu	37	1	152777877	152777877	+	Silent	SNP	G	C	C	rs138242706		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152777877G>C	uc001fap.1	-	2	129	c.78C>G	c.(76-78)ACC>ACG	p.T26T		NM_178351	NP_848128	Q5T751	LCE1C_HUMAN	late cornified envelope 1C	26	Pro-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
C1orf61	10485	broad.mit.edu	37	1	156377704	156377704	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156377704G>A	uc001fou.1	-	5	352	c.235C>T	c.(235-237)CGG>TGG	p.R79W	C1orf61_uc001fot.1_5'Flank|C1orf61_uc001fov.1_RNA|C1orf61_uc001fow.1_Intron|C1orf61_uc001fox.1_Intron	NM_006365	NP_006356	Q13536	CROC4_HUMAN	transcriptional activator of the c-fos promoter	79						nucleus				skin(1)	1	Hepatocellular(266;0.158)																	---	---	---	---
CD1E	913	broad.mit.edu	37	1	158324317	158324317	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158324317T>A	uc001fse.2	+	2	448	c.209T>A	c.(208-210)GTC>GAC	p.V70D	CD1E_uc010pid.1_Missense_Mutation_p.V68D|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.V70D|CD1E_uc001fsk.2_Missense_Mutation_p.V70D|CD1E_uc001fsj.2_Missense_Mutation_p.V70D|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.V70D|CD1E_uc001fry.2_Missense_Mutation_p.V70D|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.V70D|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Missense_Mutation_p.V70D|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	70					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)																	---	---	---	---
TNN	63923	broad.mit.edu	37	1	175048581	175048581	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175048581G>A	uc001gkl.1	+	3	635	c.522G>A	c.(520-522)GCG>GCA	p.A174A	TNN_uc010pmx.1_Silent_p.A174A	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	174	EGF-like 1.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
CACNA1E	777	broad.mit.edu	37	1	181726082	181726082	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181726082T>C	uc001gow.2	+	30	4314	c.4149T>C	c.(4147-4149)GAT>GAC	p.D1383D	CACNA1E_uc009wxs.2_Silent_p.D1271D|CACNA1E_uc001gox.1_Silent_p.D609D|CACNA1E_uc009wxt.2_Silent_p.D609D	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1383	Extracellular (Potential).|III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183253135	183253135	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183253135T>C	uc001gqc.1	-	7	904	c.569A>G	c.(568-570)GAG>GGG	p.E190G	NMNAT2_uc001gqb.1_Missense_Mutation_p.E185G|NMNAT2_uc001gqd.2_Missense_Mutation_p.E85G	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase	190					water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186024787	186024787	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186024787A>C	uc001grq.1	+	45	7354	c.7125A>C	c.(7123-7125)AAA>AAC	p.K2375N		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2375	Ig-like C2-type 21.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186060048	186060048	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186060048C>T	uc001grq.1	+	64	10115	c.9886C>T	c.(9886-9888)CGA>TGA	p.R3296*		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3296	Ig-like C2-type 31.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196311337	196311337	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196311337T>G	uc001gtd.1	-	15	1485	c.1425A>C	c.(1423-1425)GAA>GAC	p.E475D	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Missense_Mutation_p.E475D|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.E475D|KCNT2_uc001gth.1_5'UTR	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	475	Cytoplasmic (Potential).|RCK N-terminal.					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
CFHR1	3078	broad.mit.edu	37	1	196796126	196796126	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196796126A>T	uc001gtn.2	+	3	535	c.421A>T	c.(421-423)AGG>TGG	p.R141W	CFHR1_uc001gtm.2_Intron	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor	141	Sushi 2.				complement activation	extracellular space					0																		---	---	---	---
CFHR1	3078	broad.mit.edu	37	1	196797212	196797212	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196797212T>C	uc001gtn.2	+	4	557	c.443T>C	c.(442-444)GTG>GCG	p.V148A	CFHR1_uc001gtm.2_Missense_Mutation_p.V52A	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor	148	Sushi 3.				complement activation	extracellular space					0																		---	---	---	---
CFHR2	3080	broad.mit.edu	37	1	196927034	196927034	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196927034A>C	uc001gtq.1	+	4	521	c.444A>C	c.(442-444)AAA>AAC	p.K148N	CFHR2_uc001gtr.1_Missense_Mutation_p.K24N	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	148	Sushi 3.					extracellular region				skin(2)|ovary(1)	3																		---	---	---	---
ZBTB41	360023	broad.mit.edu	37	1	197159959	197159959	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197159959A>T	uc001gtx.1	-	3	1400	c.1331T>A	c.(1330-1332)TTT>TAT	p.F444Y	ZBTB41_uc009wyz.1_RNA	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	444	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
KIF14	9928	broad.mit.edu	37	1	200569554	200569554	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200569554A>G	uc010ppk.1	-	12	2669	c.2230T>C	c.(2230-2232)TGT>CGT	p.C744R	KIF14_uc010ppj.1_Missense_Mutation_p.C253R	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	744	Potential.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7																		---	---	---	---
PM20D1	148811	broad.mit.edu	37	1	205814505	205814505	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205814505C>T	uc001hdj.2	-	3	482	c.437G>A	c.(436-438)CGT>CAT	p.R146H	PM20D1_uc009xbr.2_RNA	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor	146						extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)															---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216369967	216369967	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216369967T>G	uc001hku.1	-	19	4566	c.4179A>C	c.(4177-4179)AAA>AAC	p.K1393N	USH2A_uc001hkv.2_Missense_Mutation_p.K1393N	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1393	Extracellular (Potential).|Fibronectin type-III 4.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216372990	216372990	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216372990A>T	uc001hku.1	-	17	4177	c.3790T>A	c.(3790-3792)TCT>ACT	p.S1264T	USH2A_uc001hkv.2_Missense_Mutation_p.S1264T	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1264	Fibronectin type-III 3.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218607762	218607762	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218607762A>C	uc001hlm.2	+	4	1379	c.726A>C	c.(724-726)AAA>AAC	p.K242N	TGFB2_uc001hln.2_Missense_Mutation_p.K270N|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2	242					activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
MIR320B-2	100302180	broad.mit.edu	37	1	224444779	224444779	+	RNA	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224444779T>G	hsa-mir-320b-2|MI0003839	-			c.65T>G			NVL_uc001hok.2_Intron|NVL_uc001hol.2_Intron|NVL_uc010pvd.1_Intron|NVL_uc010pve.1_Intron|NVL_uc010pvf.1_Intron																	0																		---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237666672	237666672	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237666672T>C	uc001hyl.1	+	22	2600	c.2480T>C	c.(2479-2481)CTG>CCG	p.L827P		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	827	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237841399	237841399	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237841399A>C	uc001hyl.1	+	61	9002	c.8882A>C	c.(8881-8883)AAG>ACG	p.K2961T	RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2961	Modulator (Potential).|Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
OR13G1	441933	broad.mit.edu	37	1	247836046	247836046	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247836046A>C	uc001idi.1	-	1	298	c.298T>G	c.(298-300)TTG>GTG	p.L100V		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)															---	---	---	---
OR2M4	26245	broad.mit.edu	37	1	248402431	248402431	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248402431C>T	uc010pzh.1	+	1	201	c.201C>T	c.(199-201)TCC>TCT	p.S67S		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
CENPO	79172	broad.mit.edu	37	2	25037238	25037238	+	Intron	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25037238C>T	uc002rfo.1	+						CENPO_uc002rfn.2_Intron|CENPO_uc002rfp.1_Intron|CENPO_uc002rfq.1_Intron	NM_024322	NP_077298			centromere protein O						cell division|CenH3-containing nucleosome assembly at centromere|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)																	---	---	---	---
HNRPLL	92906	broad.mit.edu	37	2	38809209	38809209	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38809209T>G	uc002rqw.2	-						HNRPLL_uc002rqv.2_Intron|HNRPLL_uc002rqx.2_Intron	NM_138394	NP_612403			heterogeneous nuclear ribonucleoprotein L-like						mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)																---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50724791	50724791	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724791T>C	uc010fbq.2	-	14	4156	c.2679A>G	c.(2677-2679)ACA>ACG	p.T893T	NRXN1_uc002rxb.3_Silent_p.T525T|NRXN1_uc002rxe.3_Silent_p.T853T|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
USP34	9736	broad.mit.edu	37	2	61463049	61463049	+	Intron	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61463049G>C	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
CCT4	10575	broad.mit.edu	37	2	62106082	62106082	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62106082C>A	uc002sbo.2	-	5	593	c.444G>T	c.(442-444)TTG>TTT	p.L148F	CCT4_uc010ypp.1_Missense_Mutation_p.L92F|CCT4_uc010ypq.1_5'UTR|CCT4_uc010ypr.1_Missense_Mutation_p.L92F|CCT4_uc010yps.1_Missense_Mutation_p.L118F	NM_006430	NP_006421	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	148					'de novo' posttranslational protein folding	melanosome|microtubule organizing center|nucleus	ATP binding|unfolded protein binding			ovary(2)	2	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)															---	---	---	---
PPP3R1	5534	broad.mit.edu	37	2	68480181	68480181	+	5'Flank	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68480181T>A	uc002sei.1	-							NM_000945	NP_000936			protein phosphatase 3, regulatory subunit B,						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)													---	---	---	---
MOGS	7841	broad.mit.edu	37	2	74689328	74689328	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74689328C>T	uc010ffj.2	-	4	1751	c.1588G>A	c.(1588-1590)GAC>AAC	p.D530N	MOGS_uc010ffh.2_Missense_Mutation_p.D255N|MOGS_uc010yrt.1_Missense_Mutation_p.D411N|MOGS_uc010ffi.2_Missense_Mutation_p.D424N	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	530	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0																		---	---	---	---
LIPT1	51601	broad.mit.edu	37	2	99778961	99778961	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99778961T>C	uc002szm.3	+	4	881	c.541T>C	c.(541-543)TTA>CTA	p.L181L	MRPL30_uc002szl.1_Intron|LIPT1_uc002szn.3_Silent_p.L181L|LIPT1_uc002szo.3_Silent_p.L181L|LIPT1_uc002szp.3_Silent_p.L181L|LIPT1_uc002szq.3_Silent_p.L181L|MRPL30_uc002szr.2_Intron	NM_145198	NP_660199	Q9Y234	LIPT_HUMAN	lipoyltransferase 1 precursor	181					lipid metabolic process|protein lipoylation	mitochondrion	acyltransferase activity				0					Lipoic Acid(DB00166)													---	---	---	---
ANAPC1	64682	broad.mit.edu	37	2	112608407	112608407	+	Silent	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112608407T>A	uc002thi.2	-	14	1843	c.1596A>T	c.(1594-1596)CTA>CTT	p.L532L		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	532					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2																		---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125521689	125521689	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125521689T>G	uc002tno.2	+	16	2859	c.2495T>G	c.(2494-2496)CTT>CGT	p.L832R	CNTNAP5_uc010flu.2_Missense_Mutation_p.L833R	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	832	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167284375	167284375	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167284375T>G	uc002udu.1	-	17	2903	c.2776A>C	c.(2776-2778)ACC>CCC	p.T926P	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	926					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1																		---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167297957	167297957	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167297957T>G	uc002udu.1	-	14	2233	c.2106A>C	c.(2104-2106)CAA>CAC	p.Q702H	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	702					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1																		---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167300144	167300144	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167300144T>G	uc002udu.1	-	13	1796	c.1669A>C	c.(1669-1671)ATT>CTT	p.I557L	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	557	Helical; Name=S2 of repeat II; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1																		---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168101280	168101280	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168101280T>C	uc002udx.2	+	8	3396	c.3378T>C	c.(3376-3378)ACT>ACC	p.T1126T	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.T951T|XIRP2_uc010fpq.2_Silent_p.T904T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	951	Xin 17.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168114459	168114459	+	3'UTR	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114459T>G	uc002udx.2	+	10					XIRP2_uc010fpn.2_Missense_Mutation_p.F501C|XIRP2_uc010fpo.2_Missense_Mutation_p.F468C|XIRP2_uc010fpp.2_Missense_Mutation_p.F468C|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Missense_Mutation_p.F246C	NM_152381	NP_689594			xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
ABCB11	8647	broad.mit.edu	37	2	169780314	169780314	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169780314C>A	uc002ueo.1	-	28	3910	c.3784G>T	c.(3784-3786)GAC>TAC	p.D1262Y	ABCB11_uc010zda.1_Missense_Mutation_p.D680Y|ABCB11_uc010zdb.1_Missense_Mutation_p.D738Y	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	1262	Cytoplasmic (Potential).|ABC transporter 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)													---	---	---	---
EVX2	344191	broad.mit.edu	37	2	176945351	176945351	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176945351C>T	uc010zeu.1	-	3	1101	c.915G>A	c.(913-915)GCG>GCA	p.A305A		NM_001080458	NP_001073927	Q03828	EVX2_HUMAN	even-skipped homeobox 2	305	Poly-Ala.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179391989	179391989	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179391989T>A	uc010zfg.1	-	312	100246	c.100022A>T	c.(100021-100023)GAT>GTT	p.D33341V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D27036V|TTN_uc010zfi.1_Missense_Mutation_p.D26969V|TTN_uc010zfj.1_Missense_Mutation_p.D26844V|TTN_uc002umq.2_Missense_Mutation_p.D257V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	34268							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179466402	179466402	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179466402C>A	uc010zfg.1	-	235	47935	c.47711G>T	c.(47710-47712)TGC>TTC	p.C15904F	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.C9599F|TTN_uc010zfi.1_Missense_Mutation_p.C9532F|TTN_uc010zfj.1_Missense_Mutation_p.C9407F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16831							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179500379	179500379	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179500379G>T	uc010zfg.1	-	176	34192	c.33968C>A	c.(33967-33969)GCT>GAT	p.A11323D	TTN_uc010zfh.1_Missense_Mutation_p.A5018D|TTN_uc010zfi.1_Missense_Mutation_p.A4951D|TTN_uc010zfj.1_Missense_Mutation_p.A4826D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12250							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179522877	179522877	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179522877T>G	uc010zfk.1	-	29	2543	c.1995A>C	c.(1993-1995)GAA>GAC	p.E665D	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179583663	179583663	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179583663T>G	uc010zfg.1	-	81	20756	c.20532A>C	c.(20530-20532)GAA>GAC	p.E6844D	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E3505D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7771							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179595679	179595679	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179595679T>G	uc010zfg.1	-	57	14205	c.13981A>C	c.(13981-13983)AGC>CGC	p.S4661R	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S1322R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5588							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179604391	179604391	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604391T>C	uc010zfh.1	-	46	13280	c.13056A>G	c.(13054-13056)GAA>GAG	p.E4352E	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.E4285E|TTN_uc010zfj.1_Silent_p.E4160E|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	4278							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179640745	179640745	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179640745A>C	uc010zfg.1	-	28	6070	c.5846T>G	c.(5845-5847)TTT>TGT	p.F1949C	TTN_uc010zfh.1_Missense_Mutation_p.F1903C|TTN_uc010zfi.1_Missense_Mutation_p.F1903C|TTN_uc010zfj.1_Missense_Mutation_p.F1903C|TTN_uc002unb.2_Missense_Mutation_p.F1949C|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1949							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179640748	179640748	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179640748T>G	uc010zfg.1	-	28	6067	c.5843A>C	c.(5842-5844)GAG>GCG	p.E1948A	TTN_uc010zfh.1_Missense_Mutation_p.E1902A|TTN_uc010zfi.1_Missense_Mutation_p.E1902A|TTN_uc010zfj.1_Missense_Mutation_p.E1902A|TTN_uc002unb.2_Missense_Mutation_p.E1948A|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1948							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179643981	179643981	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179643981T>C	uc010zfg.1	-	23	4162	c.3938A>G	c.(3937-3939)AAG>AGG	p.K1313R	TTN_uc010zfh.1_Missense_Mutation_p.K1267R|TTN_uc010zfi.1_Missense_Mutation_p.K1267R|TTN_uc010zfj.1_Missense_Mutation_p.K1267R|TTN_uc002unb.2_Missense_Mutation_p.K1313R|uc002unc.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1313							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198968559	198968559	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198968559T>G	uc010fsp.2	+	5	3295	c.3004T>G	c.(3004-3006)TTC>GTC	p.F1002V	PLCL1_uc002uuv.3_Missense_Mutation_p.F923V	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	1002					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210517892	210517892	+	5'UTR	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210517892A>C	uc002vde.1	+	4					MAP2_uc002vdc.1_5'UTR|MAP2_uc002vdd.1_5'UTR|MAP2_uc002vdf.1_5'UTR|MAP2_uc002vdg.1_5'UTR|MAP2_uc002vdh.1_5'UTR|MAP2_uc002vdi.1_5'UTR	NM_002374	NP_002365			microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210561456	210561456	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210561456A>C	uc002vde.1	+	8	4619	c.4371A>C	c.(4369-4371)GAA>GAC	p.E1457D	MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.E1453D	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1457	Calmodulin-binding (Potential).				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215797379	215797379	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215797379T>C	uc002vew.2	-	53	7987	c.7767A>G	c.(7765-7767)CAA>CAG	p.Q2589Q	ABCA12_uc002vev.2_Silent_p.Q2271Q|ABCA12_uc010zjn.1_Silent_p.Q1516Q	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	2589					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215840651	215840651	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215840651G>A	uc002vew.2	-	34	5459	c.5239C>T	c.(5239-5241)CTC>TTC	p.L1747F	ABCA12_uc002vev.2_Missense_Mutation_p.L1429F|ABCA12_uc010zjn.1_Missense_Mutation_p.L674F	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1747	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
ACSL3	2181	broad.mit.edu	37	2	223773616	223773616	+	Nonsense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223773616T>G	uc002vni.2	+	4	577	c.126T>G	c.(124-126)TAT>TAG	p.Y42*	ACSL3_uc002vnj.2_Nonsense_Mutation_p.Y42*	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	42	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)			T	ETV1	prostate								---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225796292	225796292	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225796292A>C	uc010fwz.1	-	2	456	c.217T>G	c.(217-219)TTG>GTG	p.L73V	DOCK10_uc002vob.2_Missense_Mutation_p.L67V|DOCK10_uc002vod.1_Missense_Mutation_p.L73V	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	73							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
PID1	55022	broad.mit.edu	37	2	229890475	229890475	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229890475T>C	uc002vpr.3	-	3	664	c.626A>G	c.(625-627)AAG>AGG	p.K209R	PID1_uc002vps.3_Missense_Mutation_p.K207R|PID1_uc002vpt.3_Missense_Mutation_p.K176R|PID1_uc002vpu.3_Missense_Mutation_p.K127R	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	209	PID.					cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
DNAJB3	414061	broad.mit.edu	37	2	234652384	234652384	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234652384T>A	uc002vuz.2	-	1	278	c.179A>T	c.(178-180)AAG>ATG	p.K60M	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 3	60	J.				protein folding		heat shock protein binding|unfolded protein binding				0																		---	---	---	---
LRRN1	57633	broad.mit.edu	37	3	3886560	3886560	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3886560T>C	uc003bpt.3	+	2	996	c.235T>C	c.(235-237)TTA>CTA	p.L79L	SUMF1_uc003bps.1_Intron	NM_020873	NP_065924	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1 precursor	79	Extracellular (Potential).|LRR 1.					integral to membrane				central_nervous_system(1)	1				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)														---	---	---	---
GRIP2	80852	broad.mit.edu	37	3	14583376	14583376	+	Intron	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14583376G>A	uc011avi.1	-						GRIP2_uc011avh.1_5'Flank|GRIP2_uc003byv.1_5'Flank	NM_001080423	NP_001073892			glutamate receptor interacting protein 2						synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1																		---	---	---	---
LRRC3B	116135	broad.mit.edu	37	3	26751365	26751365	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26751365T>G	uc003cdp.2	+	2	791	c.202T>G	c.(202-204)TTA>GTA	p.L68V	LRRC3B_uc003cdq.2_Missense_Mutation_p.L68V	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B precursor	68	LRR 1.					integral to membrane				pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
GOLGA4	2803	broad.mit.edu	37	3	37365440	37365440	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37365440C>T	uc003cgv.2	+	14	2367	c.2063C>T	c.(2062-2064)TCA>TTA	p.S688L	GOLGA4_uc010hgr.1_Missense_Mutation_p.S249L|GOLGA4_uc003cgw.2_Missense_Mutation_p.S710L|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.S569L	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	688	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	T	T	rs121913403		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266113C>T	uc010hia.1	+	4	266	c.110C>T	c.(109-111)TCT>TTT	p.S37F	CTNNB1_uc003ckp.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckq.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckr.2_Missense_Mutation_p.S37F|CTNNB1_uc011azf.1_Missense_Mutation_p.S30F|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	37			S -> C (in PTR, hepatoblastoma and ovarian cancer).|SG -> W (in hepatocellular carcinoma).|S -> F (in PTR).|S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes).|S -> Y (in hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.S37F(147)|p.S37C(124)|p.A5_A80del(63)|p.S37A(59)|p.S37Y(23)|p.S37P(16)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.W25_I140del(4)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.V22_G80>NNNNN(1)|p.GIHS34?(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.G34_S37del(1)|p.I35_S37>T(1)|p.I35_K170del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.S37S(1)|p.S37T(1)|p.V22_S71>A(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.S37_G38>W(1)|p.A5_Q143>E(1)|p.I35_G38del(1)|p.H36_E53>L(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.S37_A39>S(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.I35_T41del(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	S37F(HUTU80_SMALL_INTESTINE)|S37C(SNU398_LIVER)|S37C(JHUEM2_ENDOMETRIUM)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41268778	41268778	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41268778C>A	uc010hia.1	+	8	1172	c.1016C>A	c.(1015-1017)ACC>AAC	p.T339N	CTNNB1_uc003ckp.2_Missense_Mutation_p.T339N|CTNNB1_uc003ckq.2_Missense_Mutation_p.T339N|CTNNB1_uc003ckr.2_Missense_Mutation_p.T339N|CTNNB1_uc011azf.1_Missense_Mutation_p.T332N|CTNNB1_uc011azg.1_Missense_Mutation_p.T267N|uc010hib.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	339	ARM 5.				adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
RAD54L2	23132	broad.mit.edu	37	3	51673938	51673938	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51673938A>C	uc011bdt.1	+	13	2279	c.2154A>C	c.(2152-2154)GAA>GAC	p.E718D	RAD54L2_uc003dbh.2_Missense_Mutation_p.E309D|RAD54L2_uc011bdu.1_Missense_Mutation_p.E412D|RAD54L2_uc003dbj.2_Missense_Mutation_p.E44D	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2	718						nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)														---	---	---	---
ZXDC	79364	broad.mit.edu	37	3	126194495	126194495	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126194495C>G	uc003eiv.2	-	1	268	c.214G>C	c.(214-216)GGC>CGC	p.G72R	ZXDC_uc010hsh.2_RNA|ZXDC_uc003eix.2_Missense_Mutation_p.G72R	NM_025112	NP_079388	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C isoform 1	72					positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|LRR domain binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.155)														---	---	---	---
CCRL1	51554	broad.mit.edu	37	3	132319585	132319585	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132319585C>T	uc003eow.2	+	2	427	c.344C>T	c.(343-345)ACT>ATT	p.T115I	ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Missense_Mutation_p.T115I	NM_016557	NP_057641	Q9NPB9	CCRL1_HUMAN	chemokine (C-C motif) receptor-like 1	115	Helical; Name=3; (Potential).				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity				0																		---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140281094	140281094	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140281094A>C	uc003etn.2	+	13	2346	c.2156A>C	c.(2155-2157)GAG>GCG	p.E719A		NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	719	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
SI	6476	broad.mit.edu	37	3	164758792	164758792	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164758792G>A	uc003fei.2	-	18	2157	c.2095C>T	c.(2095-2097)CTC>TTC	p.L699F		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	699	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)										HNSCC(35;0.089)			---	---	---	---
WDR49	151790	broad.mit.edu	37	3	167240189	167240189	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167240189A>C	uc003fev.1	-	12	1938	c.1632T>G	c.(1630-1632)ATT>ATG	p.I544M	WDR49_uc003feu.1_Missense_Mutation_p.I369M|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	544										large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195515821	195515821	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515821G>C	uc011bto.1	-	2	3090	c.2630C>G	c.(2629-2631)TCT>TGT	p.S877C	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.S759C	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	882	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20255569	20255569	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20255569T>G	uc003gpr.1	+	1	335	c.131T>G	c.(130-132)CTG>CGG	p.L44R	SLIT2_uc003gps.1_Missense_Mutation_p.L44R	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	44	LRRNT.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115891689	115891689	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115891689T>G	uc003ibu.2	-	4	1797	c.1118A>C	c.(1117-1119)GAG>GCG	p.E373A	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	373	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)														---	---	---	---
TRAM1L1	133022	broad.mit.edu	37	4	118005450	118005450	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118005450T>G	uc003ibv.3	-	1	1287	c.1100A>C	c.(1099-1101)AAA>ACA	p.K367T		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	367	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1																		---	---	---	---
QRFPR	84109	broad.mit.edu	37	4	122301756	122301756	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301756C>T	uc010inj.1	-	1	426	c.47G>A	c.(46-48)CGG>CAG	p.R16Q	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Missense_Mutation_p.R16Q|QRFPR_uc010inl.1_Missense_Mutation_p.R16Q	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	16	Extracellular (Potential).					plasma membrane	neuropeptide Y receptor activity				0																		---	---	---	---
INTU	27152	broad.mit.edu	37	4	128626767	128626767	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128626767T>A	uc003ifk.1	+	11	1658	c.1588T>A	c.(1588-1590)TTG>ATG	p.L530M	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	530										ovary(1)	1																		---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155250772	155250772	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155250772C>T	uc003inw.2	-	11	2456	c.2456G>A	c.(2455-2457)CGA>CAA	p.R819Q	DCHS2_uc003inx.2_Missense_Mutation_p.R1274Q	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	819	Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
GUCY1B3	2983	broad.mit.edu	37	4	156717663	156717663	+	Splice_Site	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156717663G>T	uc003ipc.2	+	8	1144	c.977_splice	c.e8+1	p.S326_splice	GUCY1B3_uc011cio.1_Splice_Site_p.S348_splice|GUCY1B3_uc011cip.1_Splice_Site_p.S306_splice|GUCY1B3_uc003ipd.2_Splice_Site_p.S254_splice|GUCY1B3_uc010iqf.2_Splice_Site_p.S326_splice|GUCY1B3_uc010iqg.2_Splice_Site_p.S254_splice|GUCY1B3_uc011ciq.1_Splice_Site_p.S254_splice	NM_000857	NP_000848			guanylate cyclase 1, soluble, beta 3						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)														---	---	---	---
SLC12A7	10723	broad.mit.edu	37	5	1073883	1073883	+	Silent	SNP	C	A	A	rs149182820	byFrequency	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1073883C>A	uc003jbu.2	-	17	2172	c.2106G>T	c.(2104-2106)GCG>GCT	p.A702A		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	702					potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)													---	---	---	---
CDH6	1004	broad.mit.edu	37	5	31313505	31313505	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31313505T>G	uc003jhe.1	+	8	1660	c.1334T>G	c.(1333-1335)CTT>CGT	p.L445R	CDH6_uc003jhd.1_Missense_Mutation_p.L445R	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	445	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7																		---	---	---	---
CCL28	56477	broad.mit.edu	37	5	43412389	43412389	+	Silent	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43412389G>C	uc003jnu.2	-	1	100	c.30C>G	c.(28-30)GCC>GCG	p.A10A	CCL28_uc003jns.2_RNA|CCL28_uc003jnt.2_RNA	NM_148672	NP_683513	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28 precursor	10					chemotaxis|immune response	extracellular space	chemokine activity			ovary(1)|kidney(1)	2																		---	---	---	---
FGF10	2255	broad.mit.edu	37	5	44310564	44310564	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44310564A>C	uc003jog.1	-	2	394	c.394T>G	c.(394-396)TTA>GTA	p.L132V		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	132					actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)																	---	---	---	---
CAMK4	814	broad.mit.edu	37	5	110710585	110710585	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110710585T>G	uc011cvj.1	+	4	377	c.278T>G	c.(277-279)CTT>CGT	p.L93R	CAMK4_uc003kpf.2_Missense_Mutation_p.L93R|CAMK4_uc010jbv.2_Intron	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	93	Protein kinase.				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127873078	127873078	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127873078G>A	uc003kuu.2	-	1	658	c.219C>T	c.(217-219)CGC>CGT	p.R73R	FBN2_uc003kuv.2_Silent_p.R73R|FBN2_uc003kuw.3_Silent_p.R73R|FBN2_uc003kux.1_Silent_p.R73R	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	73					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
PCDHB1	29930	broad.mit.edu	37	5	140432474	140432474	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140432474A>T	uc003lik.1	+	1	1496	c.1419A>T	c.(1417-1419)AAA>AAT	p.K473N		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	473	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDH1	5097	broad.mit.edu	37	5	141244931	141244931	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141244931G>A	uc003llq.2	-	3	1082	c.965C>T	c.(964-966)GCG>GTG	p.A322V	PCDH1_uc003llp.2_Missense_Mutation_p.A322V|PCDH1_uc011dbf.1_Missense_Mutation_p.A300V	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	322	Extracellular (Potential).|Cadherin 3.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)														---	---	---	---
RNF145	153830	broad.mit.edu	37	5	158588590	158588590	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158588590T>G	uc003lxp.2	-	10	1623	c.1310A>C	c.(1309-1311)GAG>GCG	p.E437A	RNF145_uc011ddy.1_Missense_Mutation_p.E451A|RNF145_uc003lxo.1_Missense_Mutation_p.E465A|RNF145_uc011ddz.1_Missense_Mutation_p.E454A|RNF145_uc010jiq.1_Missense_Mutation_p.E467A	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	437						integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
GABRA1	2554	broad.mit.edu	37	5	161277869	161277869	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161277869T>C	uc010jiw.2	+	3	521	c.53T>C	c.(52-54)CTG>CCG	p.L18P	GABRA1_uc010jix.2_Missense_Mutation_p.L18P|GABRA1_uc010jiy.2_Missense_Mutation_p.L18P|GABRA1_uc003lyx.3_Missense_Mutation_p.L18P|GABRA1_uc010jiz.2_Missense_Mutation_p.L18P|GABRA1_uc010jja.2_Missense_Mutation_p.L18P|GABRA1_uc010jjb.2_Missense_Mutation_p.L18P	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	18					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)													---	---	---	---
GABRA1	2554	broad.mit.edu	37	5	161302657	161302657	+	Intron	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161302657A>C	uc010jiw.2	+						GABRA1_uc010jix.2_Intron|GABRA1_uc010jiy.2_Intron|GABRA1_uc003lyx.3_Intron|GABRA1_uc010jiz.2_Intron|GABRA1_uc010jja.2_Intron|GABRA1_uc010jjb.2_Intron	NM_000806	NP_000797			gamma-aminobutyric acid (GABA) A receptor, alpha						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)													---	---	---	---
GABRA1	2554	broad.mit.edu	37	5	161324259	161324259	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161324259A>G	uc010jiw.2	+	11	1670	c.1202A>G	c.(1201-1203)AAG>AGG	p.K401R	GABRA1_uc010jix.2_Missense_Mutation_p.K401R|GABRA1_uc010jiy.2_Missense_Mutation_p.K401R|GABRA1_uc003lyx.3_Missense_Mutation_p.K401R|GABRA1_uc010jiz.2_Missense_Mutation_p.K401R|GABRA1_uc010jja.2_Missense_Mutation_p.K401R|GABRA1_uc010jjb.2_Missense_Mutation_p.K401R	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	401	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)													---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169144380	169144380	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169144380T>G	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ALDH5A1	7915	broad.mit.edu	37	6	24502805	24502805	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24502805G>T	uc003neg.2	+	2	437	c.409G>T	c.(409-411)GAC>TAC	p.D137Y	ALDH5A1_uc003nef.2_Missense_Mutation_p.D137Y	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor	137					acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)													---	---	---	---
OR2J3	442186	broad.mit.edu	37	6	29080491	29080491	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29080491A>C	uc011dll.1	+	1	824	c.824A>C	c.(823-825)AAG>ACG	p.K275T		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	275	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
HLA-DOA	3111	broad.mit.edu	37	6	32974622	32974622	+	Intron	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32974622A>T	uc003ocr.2	-						HLA-DOA_uc010juj.2_Intron	NM_002119	NP_002110			major histocompatibility complex, class II, DO						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0																		---	---	---	---
FGD2	221472	broad.mit.edu	37	6	36982750	36982750	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36982750G>A	uc010jwp.1	+	8	1136	c.965G>A	c.(964-966)CGT>CAT	p.R322H	FGD2_uc003ong.2_Missense_Mutation_p.R44H|FGD2_uc011dtv.1_Translation_Start_Site|FGD2_uc003oni.1_Missense_Mutation_p.R128H	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	322	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3																		---	---	---	---
TMEM63B	55362	broad.mit.edu	37	6	44119697	44119697	+	Silent	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44119697C>A	uc003owr.2	+	19	1852	c.1788C>A	c.(1786-1788)ATC>ATA	p.I596I	TMEM63B_uc003ows.2_Silent_p.I499I|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	596						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)													OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
HMGCLL1	54511	broad.mit.edu	37	6	55360220	55360220	+	Silent	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55360220A>T	uc003pcn.2	-	8	1041	c.882T>A	c.(880-882)CTT>CTA	p.L294L	HMGCLL1_uc003pco.2_Silent_p.L264L|HMGCLL1_uc010jzx.2_Silent_p.L165L|HMGCLL1_uc011dxc.1_Silent_p.L232L|HMGCLL1_uc011dxd.1_Silent_p.L161L|HMGCLL1_uc011dxe.1_Intron	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-Coenzyme A	294							hydroxymethylglutaryl-CoA lyase activity|metal ion binding			skin(2)|ovary(1)|pancreas(1)	4	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---
BMP5	653	broad.mit.edu	37	6	55639011	55639011	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55639011A>G	uc003pcq.2	-	4	1575	c.863T>C	c.(862-864)CTT>CCT	p.L288P	BMP5_uc011dxf.1_Missense_Mutation_p.L288P	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	288					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
BAI3	577	broad.mit.edu	37	6	69666638	69666638	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69666638A>C	uc003pev.3	+	8	1910	c.1462A>C	c.(1462-1464)ACA>CCA	p.T488P	BAI3_uc010kak.2_Missense_Mutation_p.T488P	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	488	TSP type-1 4.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
OGFRL1	79627	broad.mit.edu	37	6	72011128	72011128	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72011128A>C	uc003pfx.1	+	7	895	c.732A>C	c.(730-732)AAA>AAC	p.K244N		NM_024576	NP_078852	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	244						membrane	receptor activity				0																		---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	72957723	72957723	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72957723A>C	uc003pga.2	+	12	2211	c.2134A>C	c.(2134-2136)AGT>CGT	p.S712R	RIMS1_uc011dyb.1_Missense_Mutation_p.S338R|RIMS1_uc003pgc.2_Missense_Mutation_p.S338R|RIMS1_uc010kaq.2_Missense_Mutation_p.S186R|RIMS1_uc011dyc.1_Missense_Mutation_p.S186R|RIMS1_uc010kar.2_Missense_Mutation_p.S105R|RIMS1_uc011dyd.1_Missense_Mutation_p.S171R|RIMS1_uc003pgf.2_5'Flank|RIMS1_uc003pgg.2_5'Flank|RIMS1_uc003pgi.2_5'Flank|RIMS1_uc003pgh.2_5'Flank|RIMS1_uc003pgd.2_5'Flank|RIMS1_uc003pge.2_5'Flank|RIMS1_uc003pgb.3_Missense_Mutation_p.S338R|RIMS1_uc010kas.1_Missense_Mutation_p.S171R	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	712					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75818831	75818831	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75818831T>C	uc003phs.2	-	52	8169	c.8003A>G	c.(8002-8004)GAA>GGA	p.E2668G	COL12A1_uc003pht.2_Missense_Mutation_p.E1504G	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2668	TSP N-terminal.|Nonhelical region (NC3).				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
MCHR2	84539	broad.mit.edu	37	6	100369098	100369098	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100369098C>T	uc003pqh.1	-	6	1056	c.741G>A	c.(739-741)ATG>ATA	p.M247I	MCHR2_uc003pqi.1_Missense_Mutation_p.M247I	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	247	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)														---	---	---	---
KPNA5	3841	broad.mit.edu	37	6	117047700	117047700	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117047700C>T	uc003pxh.2	+	12	1299	c.1168C>T	c.(1168-1170)CTT>TTT	p.L390F		NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5	387	NLS binding site (minor) (By similarity).|ARM 8.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)														---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123653049	123653049	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123653049T>G	uc003pzj.1	-	23	1468	c.1446A>C	c.(1444-1446)AAA>AAC	p.K482N	TRDN_uc010kem.1_5'UTR	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	482	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
LTV1	84946	broad.mit.edu	37	6	144178565	144178565	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144178565G>A	uc003qjs.2	+	5	630	c.523G>A	c.(523-525)GAG>AAG	p.E175K	LTV1_uc003qju.1_5'UTR|C6orf94_uc010khj.2_5'UTR	NM_032860	NP_116249	Q96GA3	LTV1_HUMAN	LTV1 homolog	175	Asp-rich.									ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	145157547	145157547	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145157547C>T	uc003qkt.2	+	70	10027	c.9935C>T	c.(9934-9936)TCA>TTA	p.S3312L		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	3312					muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152462330	152462330	+	Intron	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152462330G>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152639292	152639292	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152639292T>G	uc010kiw.2	-	86	17098	c.16496A>C	c.(16495-16497)AAG>ACG	p.K5499T	SYNE1_uc010kiv.2_Missense_Mutation_p.K23T|SYNE1_uc003qos.3_Missense_Mutation_p.K23T|SYNE1_uc003qot.3_Missense_Mutation_p.K5428T|SYNE1_uc003qou.3_Missense_Mutation_p.K5499T|SYNE1_uc010kiz.2_Missense_Mutation_p.K1254T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5499	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
LPA	4018	broad.mit.edu	37	6	160969506	160969506	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160969506T>G	uc003qtl.2	-							NM_005577	NP_005568			lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11076035	11076035	+	Intron	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11076035T>A	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
ETV1	2115	broad.mit.edu	37	7	13949251	13949251	+	Intron	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13949251A>C	uc011jxq.1	-						ETV1_uc011jxn.1_Intron|ETV1_uc011jxo.1_Intron|ETV1_uc011jxp.1_Intron|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_Intron|ETV1_uc011jxr.1_Intron|ETV1_uc011jxs.1_Intron|ETV1_uc010ktv.2_Intron	NM_004956	NP_004947			ets variant gene 1 isoform a						transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35								T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								---	---	---	---
SP4	6671	broad.mit.edu	37	7	21516783	21516783	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21516783A>T	uc003sva.2	+	4	1946	c.1765A>T	c.(1765-1767)ACG>TCG	p.T589S	SP4_uc003svb.2_Missense_Mutation_p.T276S	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	589					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5																		---	---	---	---
TRIL	9865	broad.mit.edu	37	7	28997245	28997245	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28997245C>A	uc003szt.2	-	3	785	c.418G>T	c.(418-420)GGG>TGG	p.G140W	uc003szu.1_5'Flank	NM_014817	NP_055632	Q7L0X0	TRIL_HUMAN	TLR4 interactor with leucine rich repeats	140	LRR 4.|Extracellular (Potential).				inflammatory response|innate immune response|regulation of cytokine production involved in immune response|toll-like receptor 4 signaling pathway	lipopolysaccharide receptor complex	lipopolysaccharide binding				0																		---	---	---	---
CCDC129	223075	broad.mit.edu	37	7	31617987	31617987	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31617987A>C	uc003tcj.1	+	8	2102	c.1109A>C	c.(1108-1110)AAC>ACC	p.N370T	CCDC129_uc011kad.1_Missense_Mutation_p.N380T|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Missense_Mutation_p.N396T|CCDC129_uc003tck.1_Missense_Mutation_p.N278T	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	370											0																		---	---	---	---
KBTBD2	25948	broad.mit.edu	37	7	32909492	32909492	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909492G>T	uc003tdb.2	-	4	1996	c.1337C>A	c.(1336-1338)TCT>TAT	p.S446Y	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	446	Kelch 3.										0			GBM - Glioblastoma multiforme(11;0.0499)															---	---	---	---
KBTBD2	25948	broad.mit.edu	37	7	32909937	32909937	+	Silent	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909937A>G	uc003tdb.2	-	4	1551	c.892T>C	c.(892-894)TTA>CTA	p.L298L	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	298											0			GBM - Glioblastoma multiforme(11;0.0499)															---	---	---	---
AMPH	273	broad.mit.edu	37	7	38505774	38505774	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38505774A>T	uc003tgu.2	-	8	734	c.665T>A	c.(664-666)GTG>GAG	p.V222E	AMPH_uc003tgv.2_Missense_Mutation_p.V222E|AMPH_uc003tgt.2_5'Flank	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	222	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
COBL	23242	broad.mit.edu	37	7	51111178	51111178	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51111178C>T	uc003tpr.3	-	8	1493	c.1308G>A	c.(1306-1308)CAG>CAA	p.Q436Q	COBL_uc003tps.2_Silent_p.Q493Q|COBL_uc011kcl.1_Silent_p.Q436Q|COBL_uc010kzc.2_Silent_p.Q436Q|COBL_uc003tpp.3_Silent_p.Q222Q|COBL_uc003tpq.3_Silent_p.Q377Q	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	436										skin(3)|ovary(2)	5	Glioma(55;0.08)																	---	---	---	---
ZNF92	168374	broad.mit.edu	37	7	64863616	64863616	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64863616A>G	uc003ttz.2	+	4	732	c.589A>G	c.(589-591)AGA>GGA	p.R197G	ZNF92_uc003tua.2_Missense_Mutation_p.R128G|ZNF92_uc010kzu.2_Missense_Mutation_p.R165G|ZNF92_uc003tub.2_Missense_Mutation_p.R121G	NM_152626	NP_689839	Q03936	ZNF92_HUMAN	zinc finger protein 92 isoform 2	197						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(55;0.159)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77789342	77789342	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77789342T>G	uc003ugx.2	-	16	3099	c.2845A>C	c.(2845-2847)ACT>CCT	p.T949P	MAGI2_uc003ugy.2_Missense_Mutation_p.T935P|MAGI2_uc010ldx.1_Missense_Mutation_p.T542P	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	949	PDZ 5.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
HGF	3082	broad.mit.edu	37	7	81335016	81335016	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81335016C>T	uc003uhl.2	-	16	1976	c.1811G>A	c.(1810-1812)TGC>TAC	p.C604Y	HGF_uc003uhm.2_Missense_Mutation_p.C599Y	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	604	Peptidase S1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82387933	82387933	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82387933G>A	uc003uhx.2	-	25	15676	c.15387C>T	c.(15385-15387)GTC>GTT	p.V5129V		NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	5052					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82582534	82582534	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82582534T>G	uc003uhx.2	-	5	8024	c.7735A>C	c.(7735-7737)ACT>CCT	p.T2579P	PCLO_uc003uhv.2_Missense_Mutation_p.T2579P|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2510					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88963087	88963087	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963087A>C	uc011khi.1	+	4	1329	c.791A>C	c.(790-792)AAG>ACG	p.K264T		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	264						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
PPP1R3A	5506	broad.mit.edu	37	7	113518368	113518368	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518368T>C	uc010ljy.1	-	4	2810	c.2779A>G	c.(2779-2781)ACT>GCT	p.T927A		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	927					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34																		---	---	---	---
TSPAN12	23554	broad.mit.edu	37	7	120446741	120446741	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120446741C>A	uc003vjk.2	-	7	848	c.474G>T	c.(472-474)AAG>AAT	p.K158N	TSPAN12_uc010lkj.2_Missense_Mutation_p.K31N	NM_012338	NP_036470	O95859	TSN12_HUMAN	transmembrane 4 superfamily member 12	158	Extracellular (Potential).				angiogenesis|cell surface receptor linked signaling pathway|regulation of angiogenesis|retina layer formation	integral to plasma membrane|membrane fraction					0	all_neural(327;0.117)																	---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137170147	137170147	+	Silent	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137170147A>T	uc003vtt.2	-	24	2401	c.2400T>A	c.(2398-2400)TCT>TCA	p.S800S	DGKI_uc003vtu.2_Silent_p.S500S	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	800					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2077170	2077170	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2077170G>A	uc003wpx.3	+	32	3888	c.3750G>A	c.(3748-3750)CAG>CAA	p.Q1250Q	MYOM2_uc011kwi.1_Silent_p.Q675Q	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1250					muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2857642	2857642	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2857642C>T	uc011kwk.1	-	53	8434	c.8044G>A	c.(8044-8046)GGT>AGT	p.G2682S	CSMD1_uc011kwj.1_Missense_Mutation_p.G2011S|CSMD1_uc010lrg.2_Missense_Mutation_p.G692S	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2682	Extracellular (Potential).|Sushi 18.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35606063	35606063	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35606063T>C	uc003xjr.1	+	12	2113	c.1785T>C	c.(1783-1785)TCT>TCC	p.S595S	UNC5D_uc003xjs.1_Silent_p.S590S|UNC5D_uc003xju.1_Silent_p.S171S	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	595	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
WHSC1L1	54904	broad.mit.edu	37	8	38135877	38135877	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38135877C>G	uc003xli.2	-	22	4332	c.3814G>C	c.(3814-3816)GAG>CAG	p.E1272Q	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E1261Q|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E1223Q|WHSC1L1_uc003xlh.2_Missense_Mutation_p.E51Q	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1272	Post-SET.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)					T	NUP98	AML								---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	39091556	39091556	+	Silent	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39091556A>G	uc003xmt.3	+	16	2018	c.1773A>G	c.(1771-1773)CCA>CCG	p.P591P	ADAM32_uc011lch.1_Silent_p.P492P|ADAM32_uc003xmu.3_Silent_p.P485P|ADAM32_uc003xmv.2_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	591	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48647875	48647875	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48647875G>A	uc003xqd.2	+	20	2620	c.2611G>A	c.(2611-2613)GAA>AAA	p.E871K	KIAA0146_uc011ldc.1_Missense_Mutation_p.E801K|KIAA0146_uc011ldd.1_Missense_Mutation_p.R811Q|KIAA0146_uc003xqe.2_Missense_Mutation_p.E346K|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc010lxt.2_Silent_p.T503T|KIAA0146_uc011ldf.1_Missense_Mutation_p.E376K|KIAA0146_uc011ldg.1_Missense_Mutation_p.E361K|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	871											0		Lung NSC(58;0.175)																---	---	---	---
SNAI2	6591	broad.mit.edu	37	8	49831428	49831428	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49831428T>G	uc003xqp.2	-	3	909	c.745A>C	c.(745-747)ACC>CCC	p.T249P		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	249	C2H2-type 5; atypical.				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52321405	52321405	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321405G>A	uc003xqu.3	-	17	2880	c.2779C>T	c.(2779-2781)CCT>TCT	p.P927S	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	927					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
PRDM14	63978	broad.mit.edu	37	8	70970953	70970953	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70970953G>A	uc003xym.2	-	6	1510	c.1308C>T	c.(1306-1308)CTC>CTT	p.L436L		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	436	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)															---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72964896	72964896	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72964896A>C	uc003xza.2	-	14	1924	c.1749T>G	c.(1747-1749)TTT>TTG	p.F583L	uc011lff.1_RNA|uc003xyy.2_RNA	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	583	ANK 15.|Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
HNF4G	3174	broad.mit.edu	37	8	76456063	76456063	+	5'UTR	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76456063A>G	uc003yaq.2	+	3					HNF4G_uc003yap.1_5'UTR|HNF4G_uc003yar.2_Missense_Mutation_p.T36A	NM_004133	NP_004124			hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89198699	89198699	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89198699T>G	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92352623	92352623	+	Intron	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92352623T>G	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897			solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106813376	106813376	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813376T>C	uc003ymd.2	+	8	1089	c.1066T>C	c.(1066-1068)TCC>CCC	p.S356P	ZFPM2_uc011lhs.1_Missense_Mutation_p.S87P|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	356	C2H2-type 2.				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113240981	113240981	+	Intron	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113240981T>C	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113243805	113243805	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113243805T>G	uc003ynu.2	-	69	10956	c.10797A>C	c.(10795-10797)AAA>AAC	p.K3599N	CSMD3_uc003yns.2_Missense_Mutation_p.K2801N|CSMD3_uc003ynt.2_Missense_Mutation_p.K3559N|CSMD3_uc011lhx.1_Missense_Mutation_p.K3430N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3599	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113563095	113563095	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113563095A>G	uc003ynu.2	-	27	4528	c.4369T>C	c.(4369-4371)TTT>CTT	p.F1457L	CSMD3_uc003yns.2_Missense_Mutation_p.F729L|CSMD3_uc003ynt.2_Missense_Mutation_p.F1417L|CSMD3_uc011lhx.1_Missense_Mutation_p.F1353L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1457	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113662404	113662404	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113662404A>C	uc003ynu.2	-	19	3338	c.3179T>G	c.(3178-3180)CTT>CGT	p.L1060R	CSMD3_uc003yns.2_Missense_Mutation_p.L332R|CSMD3_uc003ynt.2_Missense_Mutation_p.L1020R|CSMD3_uc011lhx.1_Missense_Mutation_p.L956R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1060	Extracellular (Potential).|Sushi 5.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
SLC30A8	169026	broad.mit.edu	37	8	118174111	118174111	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118174111T>G	uc003yoh.2	+	5	937	c.707T>G	c.(706-708)CTT>CGT	p.L236R	SLC30A8_uc010mcz.2_Missense_Mutation_p.L187R|SLC30A8_uc011lia.1_Missense_Mutation_p.L187R|SLC30A8_uc003yog.2_Missense_Mutation_p.L187R	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	236	Helical; (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)															---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139715560	139715560	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139715560A>C	uc003yvd.2	-	31	2995	c.2548T>G	c.(2548-2550)TTA>GTA	p.L850V	COL22A1_uc011ljo.1_Missense_Mutation_p.L150V	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	850	Pro-rich.|Gly-rich.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8341911	8341911	+	Nonsense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8341911T>A	uc003zkk.2	-	39	5440	c.4729A>T	c.(4729-4731)AAA>TAA	p.K1577*	PTPRD_uc003zkp.2_Nonsense_Mutation_p.K1171*|PTPRD_uc003zkq.2_Nonsense_Mutation_p.K1170*|PTPRD_uc003zkr.2_Nonsense_Mutation_p.K1161*|PTPRD_uc003zks.2_Nonsense_Mutation_p.K1170*|PTPRD_uc003zkl.2_Nonsense_Mutation_p.K1568*|PTPRD_uc003zkm.2_Nonsense_Mutation_p.K1564*|PTPRD_uc003zkn.2_Nonsense_Mutation_p.K1166*|PTPRD_uc003zko.2_Nonsense_Mutation_p.K1167*	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1577	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
DNAI1	27019	broad.mit.edu	37	9	34517452	34517452	+	Missense_Mutation	SNP	G	A	A	rs150107677		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34517452G>A	uc003zum.2	+	19	2181	c.1988G>A	c.(1987-1989)CGC>CAC	p.R663H		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	663	WD 5.				cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)										Kartagener_syndrome				---	---	---	---
TMEM2	23670	broad.mit.edu	37	9	74319525	74319525	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74319525G>A	uc011lsa.1	-	18	3720	c.3180C>T	c.(3178-3180)CTC>CTT	p.L1060L	TMEM2_uc011lrz.1_Silent_p.L53L|TMEM2_uc010mos.2_Silent_p.L997L|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	1060						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)														---	---	---	---
COL15A1	1306	broad.mit.edu	37	9	101818614	101818614	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101818614T>A	uc004azb.1	+	35	3471	c.3265T>A	c.(3265-3267)TTT>ATT	p.F1089I		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1089	Triple-helical region 8 (COL8).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)																---	---	---	---
SMC2	10592	broad.mit.edu	37	9	106864469	106864469	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106864469G>C	uc004bbv.2	+	8	1153	c.865G>C	c.(865-867)GAT>CAT	p.D289H	SMC2_uc004bbu.1_Missense_Mutation_p.D289H|SMC2_uc004bbw.2_Missense_Mutation_p.D289H|SMC2_uc011lvl.1_Missense_Mutation_p.D289H|SMC2_uc010mtg.1_Missense_Mutation_p.D144H|SMC2_uc010mth.1_Missense_Mutation_p.D239H|SMC2_uc004bbx.2_Missense_Mutation_p.D289H	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	289	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9																		---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113243533	113243533	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113243533G>T	uc010mtz.2	-	12	2691	c.2354C>A	c.(2353-2355)CCA>CAA	p.P785Q	SVEP1_uc010mua.1_Missense_Mutation_p.P785Q|SVEP1_uc004beu.2_Missense_Mutation_p.P785Q	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	785	Sushi 4.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120474967	120474967	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120474967T>G	uc004bjz.2	+	3	852	c.561T>G	c.(559-561)ATT>ATG	p.I187M	TLR4_uc004bka.2_Missense_Mutation_p.I147M|TLR4_uc004bkb.2_Translation_Start_Site	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	187	Extracellular (Potential).|LRR 6.				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124535628	124535628	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124535628A>C	uc004bln.2	+	12	2806	c.2737A>C	c.(2737-2739)AGC>CGC	p.S913R	DAB2IP_uc004blo.2_Missense_Mutation_p.S817R|DAB2IP_uc004blp.2_Missense_Mutation_p.S346R	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	941	Pro-rich.				activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LMX1B	4010	broad.mit.edu	37	9	129455843	129455843	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129455843G>A	uc004bqj.2	+	5	763	c.713G>A	c.(712-714)CGC>CAC	p.R238H	LMX1B_uc004bqi.2_Missense_Mutation_p.R238H|LMX1B_uc011maa.1_Missense_Mutation_p.R238H	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	238	Homeobox.				dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														Nail-Patella_Syndrome				---	---	---	---
TTF1	7270	broad.mit.edu	37	9	135277625	135277625	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135277625T>C	uc004cbl.2	-	2	636	c.584A>G	c.(583-585)GAG>GGG	p.E195G	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	195	N-terminal region (NRD) (By similarity).				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)														---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12833242	12833242	+	Intron	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12833242G>A	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13698746	13698746	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13698746G>A	uc001ims.2	-	22	3195	c.2843C>T	c.(2842-2844)ACC>ATC	p.T948I	FRMD4A_uc009xjf.1_Missense_Mutation_p.T948I	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	948	Ser-rich.					cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
ZEB1	6935	broad.mit.edu	37	10	31810641	31810641	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31810641T>A	uc001ivs.3	+	7	2441	c.2378T>A	c.(2377-2379)ATC>AAC	p.I793N	ZEB1_uc001ivr.3_Missense_Mutation_p.I575N|ZEB1_uc010qee.1_Missense_Mutation_p.I575N|ZEB1_uc010qef.1_Missense_Mutation_p.I575N|ZEB1_uc009xlj.1_Missense_Mutation_p.I719N|ZEB1_uc010qeg.1_Missense_Mutation_p.I652N|ZEB1_uc009xlk.1_Missense_Mutation_p.I575N|ZEB1_uc001ivt.3_Missense_Mutation_p.I575N|ZEB1_uc001ivu.3_Missense_Mutation_p.I794N|ZEB1_uc001ivv.3_Missense_Mutation_p.I773N|ZEB1_uc010qeh.1_Missense_Mutation_p.I726N|ZEB1_uc009xlo.1_Missense_Mutation_p.I776N|ZEB1_uc009xlp.2_Missense_Mutation_p.I777N	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	793					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)																---	---	---	---
ZEB1	6935	broad.mit.edu	37	10	31815887	31815887	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31815887G>A	uc001ivs.3	+	9	3133	c.3070G>A	c.(3070-3072)GAG>AAG	p.E1024K	ZEB1_uc001ivr.3_Missense_Mutation_p.E806K|ZEB1_uc010qee.1_Missense_Mutation_p.E806K|ZEB1_uc010qef.1_Missense_Mutation_p.E806K|ZEB1_uc001ivt.3_Missense_Mutation_p.E806K|ZEB1_uc001ivu.3_Missense_Mutation_p.E1025K|ZEB1_uc001ivv.3_Missense_Mutation_p.E1004K|ZEB1_uc010qeh.1_Missense_Mutation_p.E957K|ZEB1_uc009xlp.2_Missense_Mutation_p.E1008K	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	1024	Glu-rich (acidic).				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)																---	---	---	---
KIF5B	3799	broad.mit.edu	37	10	32323763	32323763	+	Silent	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32323763G>C	uc001iwe.3	-	11	1436	c.966C>G	c.(964-966)GCC>GCG	p.A322A		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	322	Kinesin-motor.				stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)																---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53667323	53667323	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53667323T>C	uc001jjm.2	+	5	904	c.710T>C	c.(709-711)CTT>CCT	p.L237P	PRKG1_uc001jjn.2_Missense_Mutation_p.L252P|PRKG1_uc001jjo.2_Missense_Mutation_p.L252P	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	237	cGMP 2.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
H2AFY2	55506	broad.mit.edu	37	10	71868938	71868938	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71868938G>A	uc001jqm.2	+	8	1387	c.928G>A	c.(928-930)GCG>ACG	p.A310T	H2AFY2_uc001jqn.2_RNA|AIFM2_uc010qjg.1_Intron	NM_018649	NP_061119	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	310	Macro.				chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1																		---	---	---	---
MYOZ1	58529	broad.mit.edu	37	10	75391755	75391755	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75391755G>T	uc001jur.2	-	6	1198	c.833C>A	c.(832-834)TCT>TAT	p.S278Y		NM_021245	NP_067068	Q9NP98	MYOZ1_HUMAN	myozenin 1	278					myofibril assembly	nucleus|pseudopodium	FATZ binding			ovary(2)	2	Prostate(51;0.0112)																	---	---	---	---
POLR3A	11128	broad.mit.edu	37	10	79770279	79770279	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770279G>T	uc001jzn.2	-	12	1686	c.1592C>A	c.(1591-1593)ACC>AAC	p.T531N		NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	531					innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)															---	---	---	---
SH2D4B	387694	broad.mit.edu	37	10	82369292	82369292	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82369292G>A	uc001kck.1	+	6	1400	c.970G>A	c.(970-972)GCC>ACC	p.A324T	SH2D4B_uc001kcl.1_Missense_Mutation_p.A276T|SH2D4B_uc001kcm.1_Missense_Mutation_p.A71T	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B isoform 1	323											0			Colorectal(32;0.229)															---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87362286	87362286	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87362286A>C	uc001kdl.1	-	16	2875	c.2774T>G	c.(2773-2775)CTC>CGC	p.L925R	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.L496R|uc001kdk.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	925	Cytoplasmic (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117026287	117026287	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117026287T>A	uc001lcg.2	+	12	2172	c.1786T>A	c.(1786-1788)TTT>ATT	p.F596I		NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	596	Kelch 6.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
HTRA1	5654	broad.mit.edu	37	10	124273782	124273782	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124273782C>T	uc001lgj.2	+	9	1478	c.1350C>T	c.(1348-1350)GAC>GAT	p.D450D		NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor	450	PDZ.				proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
CPXM2	119587	broad.mit.edu	37	10	125528097	125528097	+	Missense_Mutation	SNP	C	T	T	rs139425659	byFrequency	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125528097C>T	uc001lhk.1	-	9	1569	c.1244G>A	c.(1243-1245)CGG>CAG	p.R415Q	CPXM2_uc001lhj.2_RNA	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	415					cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)														---	---	---	---
INPP5A	3632	broad.mit.edu	37	10	134579334	134579334	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134579334A>G	uc001llp.2	+	12	1209	c.961A>G	c.(961-963)ATC>GTC	p.I321V	INPP5A_uc001llo.1_Missense_Mutation_p.I321V|INPP5A_uc001llq.2_Missense_Mutation_p.I216V	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A	321					cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)														---	---	---	---
ART5	116969	broad.mit.edu	37	11	3661431	3661431	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3661431C>G	uc001lyb.1	-	2	621	c.228G>C	c.(226-228)GAG>GAC	p.E76D	ART5_uc001lyc.1_Missense_Mutation_p.E76D|ART5_uc001lyd.2_Missense_Mutation_p.E76D|ART5_uc009yea.2_Missense_Mutation_p.E76D	NM_053017	NP_443750	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5 precursor	76						extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3716775	3716775	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3716775C>T	uc001lyh.2	-	26	4362	c.4071G>A	c.(4069-4071)CTG>CTA	p.L1357L	NUP98_uc001lyi.2_Silent_p.L1357L|NUP98_uc001lyg.2_Silent_p.L322L	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1374					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
OR51L1	119682	broad.mit.edu	37	11	5021135	5021135	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5021135A>G	uc010qyu.1	+	1	923	c.923A>G	c.(922-924)AAG>AGG	p.K308R		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
NLRP10	338322	broad.mit.edu	37	11	7982281	7982281	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7982281C>T	uc001mfv.1	-	2	895	c.878G>A	c.(877-879)CGG>CAG	p.R293Q		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	293	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)														---	---	---	---
ANO5	203859	broad.mit.edu	37	11	22294501	22294501	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22294501T>G	uc001mqi.2	+	19	2518	c.2201T>G	c.(2200-2202)CTT>CGT	p.L734R	ANO5_uc001mqj.2_Missense_Mutation_p.L733R	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	734	Helical; (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
MPPED2	744	broad.mit.edu	37	11	30516921	30516921	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30516921T>C	uc001msr.2	-	3	578	c.458A>G	c.(457-459)CAG>CGG	p.Q153R	MPPED2_uc001msq.3_Missense_Mutation_p.Q153R|MPPED2_uc009yji.2_Missense_Mutation_p.Q27R	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	153					nervous system development		hydrolase activity|metal ion binding			skin(1)	1																		---	---	---	---
FOLH1	2346	broad.mit.edu	37	11	49170270	49170270	+	Silent	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49170270T>G	uc001ngy.2	-	18	2245	c.1984A>C	c.(1984-1986)AGA>CGA	p.R662R	FOLH1_uc001ngx.2_Intron|FOLH1_uc001ngz.2_Intron|FOLH1_uc009yly.2_Silent_p.R647R|FOLH1_uc009ylz.2_Intron|FOLH1_uc009yma.2_Silent_p.R354R	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	662	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)													---	---	---	---
OR5D13	390142	broad.mit.edu	37	11	55541616	55541616	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541616G>T	uc010ril.1	+	1	703	c.703G>T	c.(703-705)GGG>TGG	p.G235W		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)																---	---	---	---
OR8H1	219469	broad.mit.edu	37	11	56058469	56058469	+	Nonsense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56058469G>A	uc010rje.1	-	1	70	c.70C>T	c.(70-72)CAG>TAG	p.Q24*		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)																	---	---	---	---
OR8K1	390157	broad.mit.edu	37	11	56113852	56113852	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56113852T>C	uc010rjg.1	+	1	338	c.338T>C	c.(337-339)TTC>TCC	p.F113S		NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K,	113	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)														HNSCC(65;0.19)			---	---	---	---
C11orf82	220042	broad.mit.edu	37	11	82645281	82645281	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82645281T>C	uc001ozt.2	+	6	3145	c.2901T>C	c.(2899-2901)TCT>TCC	p.S967S	C11orf82_uc010rsr.1_Silent_p.S666S|C11orf82_uc010rss.1_Silent_p.S666S|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	967					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2																		---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83177774	83177774	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83177774T>G	uc001paj.2	-	21	2694	c.2391A>C	c.(2389-2391)AAA>AAC	p.K797N	DLG2_uc001pai.2_Missense_Mutation_p.K676N|DLG2_uc010rsy.1_Missense_Mutation_p.K746N|DLG2_uc010rsz.1_Missense_Mutation_p.K793N|DLG2_uc010rta.1_Missense_Mutation_p.K779N|DLG2_uc001pak.2_Missense_Mutation_p.K902N|DLG2_uc010rtb.1_Missense_Mutation_p.K764N|DLG2_uc010rsw.1_Missense_Mutation_p.K261N|DLG2_uc010rsx.1_Missense_Mutation_p.K274N	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	797	Guanylate kinase-like.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
NAALAD2	10003	broad.mit.edu	37	11	89891405	89891405	+	Missense_Mutation	SNP	C	T	T	rs138601382		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89891405C>T	uc001pdf.3	+	7	998	c.889C>T	c.(889-891)CGC>TGC	p.R297C	NAALAD2_uc009yvx.2_Missense_Mutation_p.R297W|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Missense_Mutation_p.R297W|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	297	Extracellular (Potential).|NAALADase.				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)																---	---	---	---
GPR83	10888	broad.mit.edu	37	11	94113910	94113910	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94113910G>A	uc001pet.2	-	4	849	c.677C>T	c.(676-678)CCA>CTA	p.P226L		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor	226	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
PGR	5241	broad.mit.edu	37	11	100920697	100920697	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100920697C>T	uc001pgh.2	-	6	3194	c.2451G>A	c.(2449-2451)GAG>GAA	p.E817E	PGR_uc001pgg.2_Silent_p.E198E|PGR_uc001pgi.2_Silent_p.E715E|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	817	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)													---	---	---	---
ELMOD1	55531	broad.mit.edu	37	11	107518203	107518203	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107518203T>G	uc010rvs.1	+	7	834	c.430T>G	c.(430-432)TTC>GTC	p.F144V	ELMOD1_uc001pjm.2_Missense_Mutation_p.F144V|ELMOD1_uc010rvt.1_Missense_Mutation_p.F138V	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	144	ELMO.				phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)														---	---	---	---
OR8D1	283159	broad.mit.edu	37	11	124179779	124179779	+	Missense_Mutation	SNP	T	C	C	rs148332664		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124179779T>C	uc010sag.1	-	1	884	c.884A>G	c.(883-885)AAG>AGG	p.K295R		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	295	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)														---	---	---	---
GPRC5D	55507	broad.mit.edu	37	12	13103044	13103044	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13103044C>T	uc010shp.1	-	1	275	c.275G>A	c.(274-276)CGC>CAC	p.R92H		NM_018654	NP_061124	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, family C, group 5,	92	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)														---	---	---	---
ADAMTS20	80070	broad.mit.edu	37	12	43771298	43771298	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43771298T>C	uc010skx.1	-	32	4865	c.4865A>G	c.(4864-4866)AAG>AGG	p.K1622R		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1622	TSP type-1 14.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)														---	---	---	---
SARNP	84324	broad.mit.edu	37	12	56211464	56211464	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56211464G>A	uc001sht.2	-	1	77	c.22C>T	c.(22-24)CTC>TTC	p.L8F	SARNP_uc009zoa.2_RNA|SARNP_uc001shs.3_RNA|DNAJC14_uc001shu.1_Intron|SARNP_uc001shv.3_Missense_Mutation_p.L8F|ORMDL2_uc001shw.1_5'Flank	NM_033082	NP_149073	P82979	SARNP_HUMAN	cytokine induced protein 29 kDa	8	SAP.				regulation of transcription, DNA-dependent|regulation of translation|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding				0																		---	---	---	---
ESYT1	23344	broad.mit.edu	37	12	56532198	56532198	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56532198T>A	uc001sjq.2	+	22	2398	c.2348T>A	c.(2347-2349)GTG>GAG	p.V783E	ESYT1_uc001sjr.2_Missense_Mutation_p.V793E	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	783						integral to membrane				ovary(4)|skin(1)	5																		---	---	---	---
SPRYD4	283377	broad.mit.edu	37	12	56863084	56863084	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56863084G>T	uc001sli.3	+	2	422	c.347G>T	c.(346-348)GGT>GTT	p.G116V	SPRYD4_uc010sqo.1_Missense_Mutation_p.G104V	NM_207344	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	116	B30.2/SPRY.					nucleus					0																		---	---	---	---
LRP1	4035	broad.mit.edu	37	12	57588239	57588239	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57588239A>G	uc001snd.2	+	49	8487	c.8021A>G	c.(8020-8022)GAT>GGT	p.D2674G	MIR1228_hsa-mir-1228|MI0006318_5'Flank	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2674	LDL-receptor class A 14.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)													---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77423789	77423789	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77423789G>A	uc001sym.3	-	10	1942	c.1706C>T	c.(1705-1707)TCA>TTA	p.S569L	E2F7_uc009zse.2_Missense_Mutation_p.S56L	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	569					cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78362351	78362351	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78362351T>C	uc001syp.2	+	5	713	c.540T>C	c.(538-540)TCT>TCC	p.S180S	NAV3_uc001syo.2_Silent_p.S180S	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	180	CH.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
C12orf63	374467	broad.mit.edu	37	12	97098562	97098562	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97098562A>C	uc001tet.1	+	14	1869	c.1791A>C	c.(1789-1791)AAA>AAC	p.K597N		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	597										skin(6)|ovary(1)	7																		---	---	---	---
TAOK3	51347	broad.mit.edu	37	12	118673381	118673381	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118673381A>C	uc001twx.2	-	8	828	c.533T>G	c.(532-534)TTC>TGC	p.F178C	TAOK3_uc001tww.2_Missense_Mutation_p.F8C|TAOK3_uc001twy.3_Missense_Mutation_p.F178C	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	178	Protein kinase.				MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35735957	35735957	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35735957C>G	uc001uvb.2	+	24	4138	c.3932C>G	c.(3931-3933)CCA>CGA	p.P1311R	NBEA_uc010abi.2_Missense_Mutation_p.P2R	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1311						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41134122	41134122	+	Silent	SNP	C	T	T	rs34650827	byFrequency;by1000genomes	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41134122C>T	uc001uxl.3	-	2	1891	c.1506G>A	c.(1504-1506)TCG>TCA	p.S502S	FOXO1_uc010acc.1_Silent_p.S317S	NM_002015	NP_002006	Q12778	FOXO1_HUMAN	forkhead box O1	502					anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
SIAH3	283514	broad.mit.edu	37	13	46357648	46357648	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46357648G>A	uc001vap.2	-	2	762	c.680C>T	c.(679-681)TCG>TTG	p.S227L		NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN	seven in absentia homolog 3	227					multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2																		---	---	---	---
PCDH20	64881	broad.mit.edu	37	13	61987191	61987191	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61987191T>G	uc001vid.3	-	2	1405	c.1041A>C	c.(1039-1041)AAA>AAC	p.K347N	PCDH20_uc010thj.1_Missense_Mutation_p.K347N	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	320	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84453706	84453706	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84453706C>T	uc001vlk.2	-	1	2823	c.1937G>A	c.(1936-1938)CGA>CAA	p.R646Q		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	646	Cytoplasmic (Potential).					integral to membrane		p.R646*(1)		ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84455053	84455053	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84455053A>C	uc001vlk.2	-	1	1476	c.590T>G	c.(589-591)GTC>GGC	p.V197G		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	197	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110822922	110822922	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110822922G>A	uc001vqw.3	-	42	3836	c.3714C>T	c.(3712-3714)CGC>CGT	p.R1238R	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1238	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
SLC7A8	23428	broad.mit.edu	37	14	23634555	23634555	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23634555C>T	uc001wiz.2	-	3	1173	c.447G>A	c.(445-447)CCG>CCA	p.P149P	SLC7A8_uc010akj.2_Silent_p.P149P	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	149					blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)													---	---	---	---
SLC22A17	51310	broad.mit.edu	37	14	23816789	23816789	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23816789C>T	uc001wjl.2	-	7	1152	c.1096G>A	c.(1096-1098)GGC>AGC	p.G366S	SLC22A17_uc010akk.2_Missense_Mutation_p.G148S|SLC22A17_uc001wjn.2_RNA|SLC22A17_uc001wjm.2_Missense_Mutation_p.G366S	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	366	Helical; (Potential).				siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)														---	---	---	---
FAM179B	23116	broad.mit.edu	37	14	45432289	45432289	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45432289G>C	uc001wvv.2	+	1	874	c.665G>C	c.(664-666)GGA>GCA	p.G222A	FAM179B_uc001wvw.2_Missense_Mutation_p.G222A|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvq.2_5'Flank|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.G222A|FAM179B_uc001wvu.2_Missense_Mutation_p.G222A	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116	222							binding			skin(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75296047	75296047	+	Splice_Site	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75296047G>A	uc001xqj.3	+	19	6418	c.6294_splice	c.e19+1	p.R2098_splice	YLPM1_uc001xql.3_Splice_Site	NM_019589	NP_062535			YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79117589	79117589	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79117589T>G	uc001xun.2	+	3	513	c.22T>G	c.(22-24)TTC>GTC	p.F8V	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.F142V	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	381	Laminin G-like 2.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22382782	22382782	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22382782T>G	uc001yuc.1	+	7	1291	c.310T>G	c.(310-312)TTG>GTG	p.L104V	LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Missense_Mutation_p.L104V	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
SNORD116-4	100033416	broad.mit.edu	37	15	25342905	25342905	+	Intron	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25342905A>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-26_uc001yyl.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0																		---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33916158	33916158	+	Missense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33916158T>A	uc001zhi.2	+	20	2578	c.2508T>A	c.(2506-2508)GAT>GAA	p.D836E	RYR3_uc010bar.2_Missense_Mutation_p.D836E	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	836	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
PIAS1	8554	broad.mit.edu	37	15	68445923	68445923	+	Intron	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68445923T>C	uc002aqz.2	+						PIAS1_uc010ujx.1_Intron	NM_016166	NP_057250			protein inhibitor of activated STAT, 1						androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2																		---	---	---	---
BNC1	646	broad.mit.edu	37	15	83933195	83933195	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83933195G>A	uc002bjt.1	-	4	896	c.808C>T	c.(808-810)CAT>TAT	p.H270Y	BNC1_uc010uos.1_Missense_Mutation_p.H258Y	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	270					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100537680	100537680	+	Silent	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100537680G>C	uc002bvv.1	-	19	2785	c.2706C>G	c.(2704-2706)CCC>CCG	p.P902P		NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	902	TSP type-1 3.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
PDZD9	255762	broad.mit.edu	37	16	21995670	21995670	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21995670G>A	uc002dka.1	-	5	844	c.527C>T	c.(526-528)TCC>TTC	p.S176F		NM_173806	NP_776167	Q8IXQ8	PDZD9_HUMAN	hypothetical protein LOC255762	238										pancreas(1)	1																		---	---	---	---
LCMT1	51451	broad.mit.edu	37	16	25137405	25137405	+	Intron	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25137405T>C	uc002dnx.1	+						LCMT1_uc002dny.1_Intron|LCMT1_uc002dnz.1_Intron|LCMT1_uc002doa.1_Intron|LCMT1_uc002dnw.1_RNA	NM_016309	NP_057393			leucine carboxyl methyltransferase 1 isoform a								protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)													---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	26147171	26147171	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147171G>A	uc002dof.2	+	2	1365	c.973G>A	c.(973-975)GAT>AAT	p.D325N		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	325	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
ITGAM	3684	broad.mit.edu	37	16	31336626	31336626	+	Silent	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31336626G>C	uc002ebq.2	+	20	2504	c.2406G>C	c.(2404-2406)GTG>GTC	p.V802V	ITGAM_uc002ebr.2_Silent_p.V803V|ITGAM_uc010can.2_Silent_p.V208V|ITGAM_uc002ebs.1_Silent_p.V208V|ITGAM_uc010vfj.1_RNA	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	802	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1																		---	---	---	---
CBLN1	869	broad.mit.edu	37	16	49313480	49313480	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49313480A>C	uc002efq.2	-	3	756	c.417T>G	c.(415-417)ATT>ATG	p.I139M		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	139	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)																---	---	---	---
CNOT1	23019	broad.mit.edu	37	16	58572769	58572769	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58572769A>G	uc002env.2	-	36	5335	c.5042T>C	c.(5041-5043)CTG>CCG	p.L1681P	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.L1676P|CNOT1_uc010vik.1_Missense_Mutation_p.L638P	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1681					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)														---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65016134	65016134	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016134T>G	uc002eoi.2	-	8	1504	c.1070A>C	c.(1069-1071)AAG>ACG	p.K357T	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Missense_Mutation_p.K357T|CDH11_uc010vin.1_Missense_Mutation_p.K231T|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	357	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
CBFB	865	broad.mit.edu	37	16	67063330	67063330	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67063330A>C	uc002era.2	+	1	281	c.20A>C	c.(19-21)GAC>GCC	p.D7A	CBFB_uc002erb.2_Missense_Mutation_p.D7A|CBFB_uc010vja.1_Missense_Mutation_p.D7A	NM_001755	NP_001746	Q13951	PEBB_HUMAN	core-binding factor, beta subunit isoform 2	7					transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)				T	MYH11	AML								---	---	---	---
ZFP3	124961	broad.mit.edu	37	17	4995828	4995828	+	Silent	SNP	G	A	A	rs146498999		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4995828G>A	uc002gaq.2	+	2	1154	c.1029G>A	c.(1027-1029)GGG>GGA	p.G343G		NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3	343	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
GUCY2D	3000	broad.mit.edu	37	17	7918766	7918766	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7918766C>T	uc002gjt.2	+	15	2964	c.2890C>T	c.(2890-2892)CGC>TGC	p.R964C		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	964	Guanylate cyclase.|Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)																---	---	---	---
LHX1	3975	broad.mit.edu	37	17	35300044	35300044	+	Intron	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35300044C>T	uc002hnh.1	+							NM_005568	NP_005559			LIM homeobox protein 1						cerebellar Purkinje cell differentiation|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation|cervix development|comma-shaped body morphogenesis|dorsal/ventral pattern formation|ectoderm formation|embryonic pattern specification|embryonic retina morphogenesis in camera-type eye|embryonic viscerocranium morphogenesis|endoderm formation|forebrain regionalization|head development|motor axon guidance|negative regulation of transcription, DNA-dependent|nephric duct morphogenesis|nephron tubule epithelial cell differentiation|neuron migration|oviduct epithelium development|paramesonephric duct development|positive regulation of anterior head development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of transcription, DNA-dependent|post-embryonic development|primitive streak formation|renal vesicle morphogenesis|retina layer formation|S-shaped body morphogenesis|spinal cord association neuron differentiation|transcription from RNA polymerase II promoter|ureteric bud development|uterine epithelium development|vagina development	nucleus|protein complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(25;0.00607)																---	---	---	---
CDK12	51755	broad.mit.edu	37	17	37618685	37618685	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37618685G>C	uc010cvv.2	+	1	947	c.361G>C	c.(361-363)GAC>CAC	p.D121H	CDK12_uc010wef.1_Missense_Mutation_p.D121H|CDK12_uc002hrw.3_Missense_Mutation_p.D121H	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	121					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19															TCGA Ovarian(9;0.13)			---	---	---	---
WIPF2	147179	broad.mit.edu	37	17	38433367	38433367	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38433367G>A	uc002hug.1	+	7	1453	c.1213G>A	c.(1213-1215)GTA>ATA	p.V405I	WIPF2_uc002huh.1_Missense_Mutation_p.V255I|WIPF2_uc010cww.1_Missense_Mutation_p.V255I|WIPF2_uc002hui.1_Missense_Mutation_p.V405I|WIPF2_uc010cwx.1_Missense_Mutation_p.V147I|WIPF2_uc010cwy.1_Missense_Mutation_p.V405I	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein	405						cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3															HNSCC(43;0.11)			---	---	---	---
SOST	50964	broad.mit.edu	37	17	41832885	41832885	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41832885G>A	uc002iec.1	-	2	514	c.467C>T	c.(466-468)GCG>GTG	p.A156V		NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor	156	CTCK.				negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)														---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46262095	46262095	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46262095C>T	uc002ini.1	-	7	669	c.557G>A	c.(556-558)CGC>CAC	p.R186H	SKAP1_uc002inj.1_Missense_Mutation_p.R186H|SKAP1_uc010dbd.1_Missense_Mutation_p.R92H|SKAP1_uc010dbe.1_Missense_Mutation_p.R186H	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform	186	PH.				positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
UNC13D	201294	broad.mit.edu	37	17	73831582	73831582	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73831582G>A	uc002jpp.2	-	20	2136	c.1756C>T	c.(1756-1758)CAC>TAC	p.H586Y	UNC13D_uc010wsk.1_Missense_Mutation_p.H586Y|UNC13D_uc002jpq.1_Missense_Mutation_p.H236Y	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	586	MHD1.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)											Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
PGS1	9489	broad.mit.edu	37	17	76394412	76394412	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76394412A>C	uc002jvm.2	+	4	503	c.491A>C	c.(490-492)GAC>GCC	p.D164A	PGS1_uc010wtt.1_RNA|PGS1_uc010dho.2_5'Flank|PGS1_uc002jvn.2_5'Flank|PGS1_uc002jvo.2_5'Flank|PGS1_uc002jvp.1_5'Flank	NM_024419	NP_077733	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	164					phospholipid biosynthetic process	endoplasmic reticulum|mitochondrion	ATP binding|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)															---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8113616	8113616	+	Silent	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113616A>G	uc002knn.3	+	12	2492	c.1989A>G	c.(1987-1989)GCA>GCG	p.A663A	PTPRM_uc010dkv.2_Silent_p.A663A|PTPRM_uc010wzl.1_Silent_p.A450A	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	663	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
KIAA0802	23255	broad.mit.edu	37	18	8824700	8824700	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8824700G>A	uc002knr.2	+	15	3334	c.3192G>A	c.(3190-3192)GCG>GCA	p.A1064A	KIAA0802_uc002knq.2_Silent_p.A1023A|KIAA0802_uc002kns.2_Silent_p.A404A	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	1374											0																		---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25532149	25532149	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25532149G>C	uc002kwg.2	-	16	3148	c.2689C>G	c.(2689-2691)CTT>GTT	p.L897V	CDH2_uc010xbn.1_Missense_Mutation_p.L866V	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	897	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25593870	25593870	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25593870T>G	uc002kwg.2	-	3	635	c.176A>C	c.(175-177)AAG>ACG	p.K59T	CDH2_uc010xbn.1_Missense_Mutation_p.K28T	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	59					adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
SERPINB11	89778	broad.mit.edu	37	18	61379931	61379931	+	Intron	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61379931A>C	uc002ljk.3	+						SERPINB11_uc010xes.1_Intron|SERPINB11_uc010dqd.2_Intron|SERPINB11_uc002ljj.3_Intron|SERPINB11_uc010dqe.2_Intron|SERPINB11_uc010dqf.2_Intron	NM_080475	NP_536723			serpin peptidase inhibitor, clade B, member 11						regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)																---	---	---	---
HMSD	284293	broad.mit.edu	37	18	61627381	61627381	+	Intron	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61627381G>T	uc010dqj.2	+						SERPINB8_uc002ljs.1_5'Flank	NM_001123366	NP_001116838			histocompatibility (minor) serpin domain							extracellular region	serine-type endopeptidase inhibitor activity				0																		---	---	---	---
NETO1	81832	broad.mit.edu	37	18	70532412	70532412	+	Intron	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70532412A>C	uc002lkw.2	-						NETO1_uc002lkx.1_Intron|NETO1_uc002lky.1_Intron|NETO1_uc002lkz.2_Intron	NM_138966	NP_620416			neuropilin- and tolloid-like protein 1 isoform 3						memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)														---	---	---	---
NFIC	4782	broad.mit.edu	37	19	3433553	3433553	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3433553C>T	uc010xhi.1	+	4	734	c.672C>T	c.(670-672)GGC>GGT	p.G224G	NFIC_uc002lxo.2_Silent_p.G215G|NFIC_uc010xhh.1_Silent_p.G215G|NFIC_uc002lxp.2_Silent_p.G224G|NFIC_uc010xhj.1_Silent_p.G224G|NFIC_uc002lxq.1_Silent_p.G176G	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2	224					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)														---	---	---	---
ITGB1BP3	27231	broad.mit.edu	37	19	3938712	3938712	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3938712A>G	uc002lyz.3	+	5	568	c.278A>G	c.(277-279)GAC>GGC	p.D93G	ITGB1BP3_uc010xia.1_Missense_Mutation_p.D98G	NM_170678	NP_733778	Q9NPI5	NRK2_HUMAN	integrin beta 1 binding protein 3	93					pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity			skin(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
EMR3	84658	broad.mit.edu	37	19	14730285	14730285	+	Intron	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14730285T>C	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960			egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6																		---	---	---	---
CYP4F12	66002	broad.mit.edu	37	19	15807710	15807710	+	Intron	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15807710G>A	uc002nbl.2	+							NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)																	---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19356206	19356206	+	Missense_Mutation	SNP	G	A	A	rs150818380		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19356206G>A	uc002nlz.2	+	13	3676	c.3577G>A	c.(3577-3579)GGG>AGG	p.G1193R	NCAN_uc002nma.2_Intron	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1193	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
ZNF99	7652	broad.mit.edu	37	19	22942268	22942268	+	Missense_Mutation	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22942268T>C	uc010xrh.1	-	4	506	c.506A>G	c.(505-507)AAC>AGC	p.N169S		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)																---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	31040160	31040160	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31040160A>G	uc002nsu.1	+	4	3772	c.3634A>G	c.(3634-3636)ACA>GCA	p.T1212A	ZNF536_uc010edd.1_Missense_Mutation_p.T1212A	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1212					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
CAPN12	147968	broad.mit.edu	37	19	39233129	39233129	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39233129A>G	uc002ojd.1	-	3	656	c.347T>C	c.(346-348)CTG>CCG	p.L116P		NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12	116	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)															---	---	---	---
SNRPA	6626	broad.mit.edu	37	19	41269579	41269579	+	Nonsense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41269579C>T	uc002ooz.2	+	5	1223	c.688C>T	c.(688-690)CAG>TAG	p.Q230*	SNRPA_uc002opa.2_Nonsense_Mutation_p.Q180*	NM_004596	NP_004587	P09012	SNRPA_HUMAN	small nuclear ribonucleoprotein polypeptide A	230	RRM 2.					nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding			skin(2)|ovary(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)															---	---	---	---
CEACAM7	1087	broad.mit.edu	37	19	42181400	42181400	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42181400G>A	uc002ori.1	-	4	740	c.738C>T	c.(736-738)CTC>CTT	p.L246L	CEACAM7_uc010ehx.2_Silent_p.L246L|CEACAM7_uc010ehy.1_Silent_p.L153L	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	246						anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)														---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47424393	47424393	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47424393T>G	uc010ekv.2	+	1	2461	c.2461T>G	c.(2461-2463)TTA>GTA	p.L821V		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	821					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
LRRC4B	94030	broad.mit.edu	37	19	51021951	51021951	+	Missense_Mutation	SNP	C	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021951C>G	uc002pss.2	-	3	1156	c.1019G>C	c.(1018-1020)TGT>TCT	p.C340S		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	340	LRRCT.|Extracellular (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53669151	53669151	+	Nonsense_Mutation	SNP	T	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669151T>A	uc010eqm.1	-	4	692	c.592A>T	c.(592-594)AGA>TGA	p.R198*		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	133	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53669240	53669240	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669240T>G	uc010eqm.1	-	4	603	c.503A>C	c.(502-504)GAG>GCG	p.E168A		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	103					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
LAIR1	3903	broad.mit.edu	37	19	54866947	54866947	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54866947C>T	uc002qfk.1	-	10	1104	c.794G>A	c.(793-795)CGG>CAG	p.R265Q	LAIR1_uc002qfl.1_Missense_Mutation_p.R248Q|LAIR1_uc002qfm.1_Missense_Mutation_p.R264Q|LAIR1_uc002qfn.1_Missense_Mutation_p.R247Q|LAIR1_uc010yex.1_Missense_Mutation_p.R258Q|LAIR1_uc002qfo.2_Missense_Mutation_p.R247Q	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like	265	Cytoplasmic (Potential).					integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)														---	---	---	---
ZFP28	140612	broad.mit.edu	37	19	57066167	57066167	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57066167A>C	uc002qnj.2	+	8	2084	c.2013A>C	c.(2011-2013)AAA>AAC	p.K671N	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	671					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)														---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3578562	3578562	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3578562T>G	uc002wim.2	+	22	3569	c.3479T>G	c.(3478-3480)CTT>CGT	p.L1160R	ATRN_uc002wil.2_Missense_Mutation_p.L1160R	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	1160	Extracellular (Potential).				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8755266	8755266	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8755266A>C	uc002wnb.2	+	27	3014	c.3011A>C	c.(3010-3012)AAG>ACG	p.K1004T	PLCB1_uc010zrb.1_Missense_Mutation_p.K903T|PLCB1_uc002wna.2_Missense_Mutation_p.K1004T|PLCB1_uc002wnc.1_Missense_Mutation_p.K903T|PLCB1_uc002wnd.1_Missense_Mutation_p.K581T	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	1004					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
ANKRD5	63926	broad.mit.edu	37	20	10030351	10030351	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10030351C>T	uc002wno.2	+	7	1527	c.1134C>T	c.(1132-1134)ATC>ATT	p.I378I	uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Silent_p.I378I|ANKRD5_uc010gbz.2_Silent_p.I189I	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	378							calcium ion binding			ovary(1)|breast(1)	2																		---	---	---	---
SPTLC3	55304	broad.mit.edu	37	20	13140736	13140736	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13140736G>A	uc002wod.1	+	11	1791	c.1502G>A	c.(1501-1503)CGG>CAG	p.R501Q		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	501					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
PAX1	5075	broad.mit.edu	37	20	21687603	21687603	+	Missense_Mutation	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21687603G>T	uc002wsj.2	+	2	868	c.814G>T	c.(814-816)GGG>TGG	p.G272W	PAX1_uc010zsl.1_Missense_Mutation_p.G272W|PAX1_uc010zsm.1_Missense_Mutation_p.G248W	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	272					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2																		---	---	---	---
DUSP15	128853	broad.mit.edu	37	20	30436211	30436211	+	Missense_Mutation	SNP	C	T	T	rs115873559	by1000genomes	TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30436211C>T	uc002wwu.1	-	10	961	c.884G>A	c.(883-885)CGC>CAC	p.R295H	FOXS1_uc002wwt.1_5'Flank			Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;	295						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
ASXL1	171023	broad.mit.edu	37	20	31021453	31021453	+	Missense_Mutation	SNP	G	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31021453G>C	uc002wxs.2	+	11	1878	c.1452G>C	c.(1450-1452)GAG>GAC	p.E484D	ASXL1_uc010geb.2_Missense_Mutation_p.E375D	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	484					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248								F|N|Mis		MDS|CMML								---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	43031251	43031251	+	Intron	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43031251A>T	uc002xma.2	+						HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|uc002xlw.1_RNA|HNF4A_uc002xly.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Missense_Mutation_p.I21L	NM_000457	NP_000448			hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
ZSWIM3	140831	broad.mit.edu	37	20	44486628	44486628	+	Intron	SNP	G	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44486628G>T	uc002xqd.2	+						ACOT8_uc002xqa.1_5'Flank|ACOT8_uc010zxe.1_5'Flank|ACOT8_uc002xqc.1_5'Flank|ACOT8_uc010zxf.1_5'Flank|ZSWIM3_uc010zxg.1_Intron	NM_080752	NP_542790			zinc finger, SWIM domain containing 3								zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZNF335	63925	broad.mit.edu	37	20	44587966	44587966	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44587966C>T	uc002xqw.2	-	15	2250	c.2127G>A	c.(2125-2127)GGG>GGA	p.G709G	ZNF335_uc010zxk.1_Silent_p.G554G	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	709					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZNF335	63925	broad.mit.edu	37	20	44596236	44596236	+	Silent	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44596236A>T	uc002xqw.2	-	6	975	c.852T>A	c.(850-852)CGT>CGA	p.R284R	ZNF335_uc010zxk.1_Silent_p.R129R|ZNF335_uc002xqx.1_Silent_p.R252R|ZNF335_uc002xqy.2_Silent_p.R129R	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	284					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)																---	---	---	---
COL20A1	57642	broad.mit.edu	37	20	61939894	61939894	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61939894G>A	uc011aau.1	+	8	876	c.776G>A	c.(775-777)GGC>GAC	p.G259D	COL20A1_uc011aav.1_Missense_Mutation_p.G80D	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	259	VWFA.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)																	---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62851193	62851193	+	Missense_Mutation	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62851193C>T	uc002yii.2	+	13	2463	c.2099C>T	c.(2098-2100)GCC>GTC	p.A700V	MYT1_uc002yih.2_Missense_Mutation_p.A402V|MYT1_uc002yij.2_Missense_Mutation_p.A359V	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	700	Ser-rich.				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
ADAMTS5	11096	broad.mit.edu	37	21	28327188	28327188	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28327188A>C	uc002ymg.2	-	2	1836	c.1107T>G	c.(1105-1107)GAT>GAG	p.D369E		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	369	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	30927571	30927571	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30927571T>G	uc002yno.1	-	16	2873	c.2409A>C	c.(2407-2409)GAA>GAC	p.E803D	GRIK1_uc002ynn.2_Missense_Mutation_p.E788D|GRIK1_uc011acs.1_Missense_Mutation_p.E803D|GRIK1_uc011act.1_Missense_Mutation_p.E664D	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	803	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
DSCR6	53820	broad.mit.edu	37	21	38390197	38390197	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38390197G>A	uc002yvv.2	+	4	473	c.263G>A	c.(262-264)CGT>CAT	p.R88H	DSCR6_uc011aec.1_5'UTR|DSCR6_uc010gnd.2_5'UTR	NM_018962	NP_061835	P57055	DSCR6_HUMAN	Down syndrome critical region protein 6	88	Ripply homology domain.					nucleus				breast(1)	1		Myeloproliferative disorder(46;0.0632)																---	---	---	---
ERG	2078	broad.mit.edu	37	21	39755499	39755499	+	Silent	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39755499G>A	uc010gnw.2	-	12	1582	c.1287C>T	c.(1285-1287)CAC>CAT	p.H429H	ERG_uc002yxa.2_Silent_p.H422H|ERG_uc011aek.1_Silent_p.H330H|ERG_uc010gnv.2_Silent_p.H306H|ERG_uc010gnx.2_Silent_p.H405H|ERG_uc011ael.1_Silent_p.H429H|ERG_uc002yxb.2_Silent_p.H405H	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	429					cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
MED15	51586	broad.mit.edu	37	22	20918980	20918980	+	Intron	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20918980C>A	uc002zsp.2	+						MED15_uc002zso.2_Intron|MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_5'Flank	NM_001003891	NP_001003891			mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)													OREG0026319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SGSM1	129049	broad.mit.edu	37	22	25251628	25251628	+	Missense_Mutation	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25251628A>G	uc003abg.2	+	8	939	c.782A>G	c.(781-783)AAC>AGC	p.N261S	SGSM1_uc003abh.2_Missense_Mutation_p.N261S|SGSM1_uc010guu.1_Missense_Mutation_p.N261S|SGSM1_uc003abj.2_Missense_Mutation_p.N261S|SGSM1_uc003abi.1_Missense_Mutation_p.N236S|SGSM1_uc003abf.2_Missense_Mutation_p.N261S	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	261						Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5																		---	---	---	---
APOL2	23780	broad.mit.edu	37	22	36623750	36623750	+	Silent	SNP	C	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36623750C>T	uc003aoz.2	-	5	1050	c.714G>A	c.(712-714)GCG>GCA	p.A238A	APOL2_uc011amm.1_Silent_p.A350A|APOL2_uc003apa.2_Silent_p.A238A	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2	238					acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0																		---	---	---	---
EIF3L	51386	broad.mit.edu	37	22	38246076	38246076	+	Intron	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38246076A>T	uc003auf.2	+						EIF3L_uc003aue.1_Intron|EIF3L_uc011ann.1_Intron|EIF3L_uc003aug.2_Intron|MIR659_hsa-mir-659|MI0003683_5'Flank	NM_016091	NP_057175			eukaryotic translation initiation factor 3							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
RANGAP1	5905	broad.mit.edu	37	22	41670686	41670686	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41670686G>A	uc003azs.2	-	2	1628	c.158C>T	c.(157-159)GCT>GTT	p.A53V	RANGAP1_uc003azt.2_Missense_Mutation_p.A53V|RANGAP1_uc003azu.2_Missense_Mutation_p.A53V|RANGAP1_uc011aoz.1_Missense_Mutation_p.A43V	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	53	LRR 1.				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0																		---	---	---	---
ARSF	416	broad.mit.edu	37	X	3002505	3002505	+	Missense_Mutation	SNP	G	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3002505G>A	uc004cre.1	+	6	849	c.628G>A	c.(628-630)GGC>AGC	p.G210S	ARSF_uc004crf.1_Missense_Mutation_p.G210S	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	210						extracellular region	arylsulfatase activity|metal ion binding	p.G210S(1)		ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
VCX3B	425054	broad.mit.edu	37	X	8434381	8434381	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8434381C>A	uc010ndo.2	+	4	915	c.608C>A	c.(607-609)CCA>CAA	p.P203Q		NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	203	10.|11 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus					0																		---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12736165	12736165	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12736165C>A	uc004cuz.1	+	16	3726	c.3220C>A	c.(3220-3222)CAA>AAA	p.Q1074K	FRMPD4_uc011mij.1_Missense_Mutation_p.Q1066K	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1074					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29935668	29935668	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29935668T>G	uc004dby.2	+	7	1374	c.866T>G	c.(865-867)TTT>TGT	p.F289C		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	289	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
KDM5C	8242	broad.mit.edu	37	X	53245002	53245002	+	Missense_Mutation	SNP	C	A	A			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53245002C>A	uc004drz.2	-	7	1471	c.938G>T	c.(937-939)CGG>CTG	p.R313L	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.R246L|KDM5C_uc004dsa.2_Missense_Mutation_p.R312L	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	313					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18								N|F|S		clear cell renal carcinoma								---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67937258	67937258	+	Missense_Mutation	SNP	G	A	A	rs149322857		TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67937258G>A	uc004dxa.2	+	5	634	c.262G>A	c.(262-264)GAG>AAG	p.E88K	STARD8_uc004dxb.2_Missense_Mutation_p.E168K|STARD8_uc004dxc.3_Missense_Mutation_p.E88K	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	88					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
ZDHHC15	158866	broad.mit.edu	37	X	74698782	74698782	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74698782A>C	uc004ecg.2	-	3	680	c.202T>G	c.(202-204)TTT>GTT	p.F68V	ZDHHC15_uc004ech.2_Missense_Mutation_p.F59V|ZDHHC15_uc011mqo.1_RNA|ZDHHC15_uc004eci.2_Missense_Mutation_p.F59V	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	68	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(2)	2																		---	---	---	---
FAM46D	169966	broad.mit.edu	37	X	79698243	79698243	+	Missense_Mutation	SNP	A	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79698243A>C	uc004edl.1	+	5	539	c.205A>C	c.(205-207)AGT>CGT	p.S69R	FAM46D_uc004edm.1_Missense_Mutation_p.S69R	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	69										lung(2)	2																		---	---	---	---
HDX	139324	broad.mit.edu	37	X	83599419	83599419	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83599419T>G	uc004eek.1	-	6	1608	c.1499A>C	c.(1498-1500)GAA>GCA	p.E500A	HDX_uc011mqv.1_Missense_Mutation_p.E500A|HDX_uc004eel.1_Missense_Mutation_p.E442A	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	500						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
PCDH11X	27328	broad.mit.edu	37	X	91090643	91090643	+	Missense_Mutation	SNP	T	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91090643T>G	uc004efk.1	+	1	985	c.140T>G	c.(139-141)CTT>CGT	p.L47R	PCDH11X_uc004efl.1_Missense_Mutation_p.L47R|PCDH11X_uc004efo.1_Missense_Mutation_p.L47R|PCDH11X_uc010nmv.1_Missense_Mutation_p.L47R|PCDH11X_uc004efm.1_Missense_Mutation_p.L47R|PCDH11X_uc004efn.1_Missense_Mutation_p.L47R|PCDH11X_uc004efh.1_Missense_Mutation_p.L47R|PCDH11X_uc004efj.1_Missense_Mutation_p.L47R	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	47	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2																		---	---	---	---
MAGEC1	9947	broad.mit.edu	37	X	140993256	140993256	+	Silent	SNP	T	C	C			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140993256T>C	uc004fbt.2	+	4	352	c.66T>C	c.(64-66)CCT>CCC	p.P22P	MAGEC1_uc010nsl.1_5'UTR	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	22							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)														HNSCC(15;0.026)			---	---	---	---
SPANXN1	494118	broad.mit.edu	37	X	144337294	144337294	+	Missense_Mutation	SNP	A	T	T			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337294A>T	uc004fcb.2	+	2	179	c.179A>T	c.(178-180)AAG>ATG	p.K60M		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	60											0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
CD99L2	83692	broad.mit.edu	37	X	149945911	149945911	+	Intron	SNP	A	G	G			TCGA-D7-6822-01	TCGA-D7-6822-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149945911A>G	uc004fel.2	-						CD99L2_uc004fek.2_Intron|CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650			CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
