Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTHFR	4524	broad.mit.edu	37	1	11861287	11861287	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11861287C>T	uc001atc.1	-	3	590	c.406G>A	c.(406-408)GAG>AAG	p.E136K	MTHFR_uc001atb.1_Missense_Mutation_p.E159K	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	136					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	GTGATCTCCTCCAGGCGCTGA	0.612													17	96	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974915	16974915	+	RNA	SNP	C	T	T	rs59636978	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974915C>T	uc010och.1	+	7		c.1375C>T			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						CTGGTGCTCCCGGCCCCGCCA	0.667													5	42	---	---	---	---	PASS
PHACTR4	65979	broad.mit.edu	37	1	28786756	28786756	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28786756G>C	uc001bpw.2	+	4	506	c.224G>C	c.(223-225)AGA>ACA	p.R75T	PHACTR4_uc001bpu.2_Missense_Mutation_p.R75T|PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Missense_Mutation_p.R59T|PHACTR4_uc001bpy.2_Missense_Mutation_p.R85T	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1	75	RPEL 1.						actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CGAAAGCCAAGAGAAGAGCTG	0.388													8	39	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57233546	57233546	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57233546G>A	uc001cym.3	-	5	1425	c.1019C>T	c.(1018-1020)TCT>TTT	p.S340F	C1orf168_uc009vzu.1_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	340										ovary(3)|skin(2)	5						GGAGTTGCCAGAGTGTCTCAG	0.368													23	107	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57233561	57233561	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57233561G>A	uc001cym.3	-	5	1410	c.1004C>T	c.(1003-1005)TCA>TTA	p.S335L	C1orf168_uc009vzu.1_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	335										ovary(3)|skin(2)	5						TCTCAGATATGAAATTGTTGC	0.353													24	109	---	---	---	---	PASS
DIRAS3	9077	broad.mit.edu	37	1	68512369	68512369	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68512369G>A	uc001ded.2	-	2	907	c.612C>T	c.(610-612)ACC>ACT	p.T204T	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	204					regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						CCTGGAGGCCGGTGGTGGGCT	0.527													51	120	---	---	---	---	PASS
SSX2IP	117178	broad.mit.edu	37	1	85127956	85127956	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85127956C>G	uc001dkh.2	-	9	1127	c.852G>C	c.(850-852)ATG>ATC	p.M284I	SSX2IP_uc001dkf.2_Missense_Mutation_p.M257I|SSX2IP_uc001dkg.2_RNA|SSX2IP_uc010orz.1_Missense_Mutation_p.M257I|SSX2IP_uc001dki.2_Missense_Mutation_p.M284I|SSX2IP_uc010osa.1_Missense_Mutation_p.M257I|SSX2IP_uc001dkj.2_Missense_Mutation_p.M284I|SSX2IP_uc009wci.2_Intron|SSX2IP_uc001dkk.1_Missense_Mutation_p.M280I	NM_014021	NP_054740	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting	284	Potential.				cell adhesion	nucleus|protein complex				ovary(2)	2				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTTCCTTTTTCATTTGTTGAA	0.323													7	231	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92185667	92185667	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92185667C>G	uc001doh.2	-	9	1662	c.1196G>C	c.(1195-1197)GGA>GCA	p.G399A	TGFBR3_uc009wde.2_Missense_Mutation_p.G176A|TGFBR3_uc010osy.1_Missense_Mutation_p.G357A|TGFBR3_uc001doi.2_Missense_Mutation_p.G398A|TGFBR3_uc001doj.2_Missense_Mutation_p.G398A	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	399	Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CGGAAGGCCTCCATTTTGGCC	0.582													27	57	---	---	---	---	PASS
RTCD1	8634	broad.mit.edu	37	1	100732130	100732130	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100732130C>T	uc001dtc.2	+	2	314	c.96C>T	c.(94-96)CTC>CTT	p.L32L	RTCD1_uc010ouh.1_Silent_p.L32L|RTCD1_uc001dtd.2_Silent_p.L32L	NM_003729	NP_003720	O00442	RTC1_HUMAN	RNA terminal phosphate cyclase domain 1 isoform	32					RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)		TCCTAGGCCTCCCCTTGCGGG	0.637													5	13	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145558885	145558885	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145558885C>G	uc001eob.1	+	7	612	c.504C>G	c.(502-504)ATC>ATG	p.I168M	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.I11M	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	168	ANK 4.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACGCAGCTATCTGCTCACAGC	0.572													26	90	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148342528	148342528	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148342528C>T	uc001eqf.2	-	4	543	c.508G>A	c.(508-510)GAG>AAG	p.E170K	LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc009wkf.1_Intron|uc001erd.3_Missense_Mutation_p.E170K|uc001erc.3_RNA|uc010paj.1_Intron|uc010pau.1_5'Flank|uc010pav.1_Missense_Mutation_p.E170K|uc010paw.1_Missense_Mutation_p.E95K	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	170	NBPF 1.					cytoplasm					0						TCTTCATCCTCATCTTCGTCA	0.418													24	417	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151491775	151491775	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151491775C>T	uc009wmw.2	+	2	924	c.780C>T	c.(778-780)CTC>CTT	p.L260L		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	254	Interacts with ZO-2.|Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGAGTCCTCTCAGTGGCTTTA	0.582													13	40	---	---	---	---	PASS
RAB13	5872	broad.mit.edu	37	1	153954762	153954762	+	Intron	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153954762C>A	uc001fdt.1	-						RAB13_uc001fdu.1_3'UTR	NM_002870	NP_002861	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cell adhesion|protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	cytoplasmic vesicle membrane|tight junction	GTP binding|GTPase activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CATTGCTCCCCGTTTTTATCA	0.333													4	98	---	---	---	---	PASS
ADAM15	8751	broad.mit.edu	37	1	155033250	155033250	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155033250C>T	uc001fgr.1	+	19	2320	c.2219C>T	c.(2218-2220)TCT>TTT	p.S740F	EFNA3_uc010pew.1_5'Flank|ADAM15_uc001fgq.1_Missense_Mutation_p.S425F|ADAM15_uc010peu.1_Missense_Mutation_p.S757F|ADAM15_uc001fgt.1_Missense_Mutation_p.S740F|ADAM15_uc010pev.1_Missense_Mutation_p.S750F|ADAM15_uc001fgs.1_Intron|ADAM15_uc001fgu.1_Missense_Mutation_p.S740F|ADAM15_uc001fgw.1_Missense_Mutation_p.S740F|ADAM15_uc001fgv.1_Missense_Mutation_p.S740F|ADAM15_uc001fgx.1_Intron|ADAM15_uc001fgz.1_RNA|ADAM15_uc001fgy.1_RNA|ADAM15_uc001fha.1_RNA|ADAM15_uc001fhb.1_Missense_Mutation_p.S31F|EFNA4_uc001fhc.2_5'Flank|EFNA4_uc001fhd.2_5'Flank|EFNA4_uc001fhe.2_5'Flank	NM_207197	NP_997080	Q13444	ADA15_HUMAN	a disintegrin and metalloproteinase domain 15	740	Cytoplasmic (Potential).				angiogenesis|cell-matrix adhesion|collagen catabolic process|proteolysis	acrosomal vesicle|adherens junction|endomembrane system|flagellum|integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			central_nervous_system(3)|skin(2)|ovary(1)	6	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GCAGCCCAATCTGGTCCCTCT	0.602													7	46	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155629234	155629234	+	3'UTR	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155629234C>T	uc010pgi.1	-	10					YY1AP1_uc001flg.2_3'UTR|YY1AP1_uc010pgg.1_3'UTR|YY1AP1_uc010pgh.1_3'UTR|YY1AP1_uc001flh.2_3'UTR|YY1AP1_uc009wqt.2_3'UTR|YY1AP1_uc001flk.2_3'UTR|YY1AP1_uc001fll.2_3'UTR|YY1AP1_uc009wqv.2_3'UTR|YY1AP1_uc001flm.2_3'UTR|YY1AP1_uc001fli.2_3'UTR|YY1AP1_uc009wqu.2_3'UTR|YY1AP1_uc001flj.2_3'UTR|YY1AP1_uc009wqw.2_3'UTR|YY1AP1_uc001flo.2_3'UTR|YY1AP1_uc001flp.2_3'UTR	NM_139119	NP_620830	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 3						regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					ttgcacaaatcaatgaaacaa	0.050													7	13	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155629585	155629585	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155629585C>T	uc001fln.2	-	11	2278	c.2254G>A	c.(2254-2256)GAG>AAG	p.E752K	YY1AP1_uc001flg.2_Missense_Mutation_p.E491K|YY1AP1_uc010pgg.1_Missense_Mutation_p.E591K|YY1AP1_uc010pgh.1_Missense_Mutation_p.E695K|YY1AP1_uc010pgi.1_Missense_Mutation_p.E844K|YY1AP1_uc001flh.2_Missense_Mutation_p.E824K|YY1AP1_uc009wqt.2_Missense_Mutation_p.E675K|YY1AP1_uc001flk.2_Missense_Mutation_p.E695K|YY1AP1_uc001fll.2_Missense_Mutation_p.E706K|YY1AP1_uc009wqv.2_Missense_Mutation_p.E423K|YY1AP1_uc001flm.2_Missense_Mutation_p.E695K|YY1AP1_uc001fli.2_Missense_Mutation_p.E706K|YY1AP1_uc009wqu.2_Missense_Mutation_p.E539K|YY1AP1_uc001flj.2_Missense_Mutation_p.E686K|YY1AP1_uc009wqw.2_Missense_Mutation_p.E675K|YY1AP1_uc001flo.2_Missense_Mutation_p.E640K|YY1AP1_uc001flp.2_Missense_Mutation_p.E706K	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	752					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CTTCCCTCCTCTGTTTTCACA	0.537													30	99	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155629592	155629592	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155629592C>T	uc001fln.2	-	11	2271	c.2247G>A	c.(2245-2247)GTG>GTA	p.V749V	YY1AP1_uc001flg.2_Silent_p.V488V|YY1AP1_uc010pgg.1_Silent_p.V588V|YY1AP1_uc010pgh.1_Silent_p.V692V|YY1AP1_uc010pgi.1_Silent_p.V841V|YY1AP1_uc001flh.2_Silent_p.V821V|YY1AP1_uc009wqt.2_Silent_p.V672V|YY1AP1_uc001flk.2_Silent_p.V692V|YY1AP1_uc001fll.2_Silent_p.V703V|YY1AP1_uc009wqv.2_Silent_p.V420V|YY1AP1_uc001flm.2_Silent_p.V692V|YY1AP1_uc001fli.2_Silent_p.V703V|YY1AP1_uc009wqu.2_Silent_p.V536V|YY1AP1_uc001flj.2_Silent_p.V683V|YY1AP1_uc009wqw.2_Silent_p.V672V|YY1AP1_uc001flo.2_Silent_p.V637V|YY1AP1_uc001flp.2_Silent_p.V703V	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	749					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CCTCTGTTTTCACAACGGTCC	0.527													30	106	---	---	---	---	PASS
TMEM79	84283	broad.mit.edu	37	1	156261349	156261349	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156261349C>T	uc010phi.1	+	4	1341	c.1145C>T	c.(1144-1146)GCC>GTC	p.A382V	TMEM79_uc001fod.2_Missense_Mutation_p.A223V|TMEM79_uc009wrw.2_Missense_Mutation_p.A382V|C1orf85_uc001fof.3_Intron|C1orf85_uc001fog.1_Intron	NM_032323	NP_115699	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	382						integral to membrane				central_nervous_system(1)	1	Hepatocellular(266;0.158)					CCGGACCACGCCCGCTCGGCC	0.657													7	37	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156948001	156948001	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156948001G>C	uc001fqo.2	-	6	1545	c.505C>G	c.(505-507)CTG>GTG	p.L169V	ARHGEF11_uc001fqn.2_Missense_Mutation_p.L169V	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	169					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ATTACCTGCAGAGGTTTGGGT	0.552													13	30	---	---	---	---	PASS
OR10X1	128367	broad.mit.edu	37	1	158549553	158549553	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158549553A>G	uc010pin.1	-	1	137	c.137T>C	c.(136-138)GTC>GCC	p.V46A		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	46	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					ACAAAAGAAGACCACAAAAAG	0.433													37	108	---	---	---	---	PASS
PPOX	5498	broad.mit.edu	37	1	161138959	161138959	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161138959G>C	uc001fyj.2	+	7	1083	c.793G>C	c.(793-795)GAA>CAA	p.E265Q	PPOX_uc001fyn.2_Intron|PPOX_uc001fyg.2_Missense_Mutation_p.E265Q|PPOX_uc001fyl.2_Missense_Mutation_p.E231Q|PPOX_uc001fym.2_RNA|PPOX_uc001fyk.2_Missense_Mutation_p.E103Q|PPOX_uc001fyh.2_Missense_Mutation_p.E103Q|PPOX_uc010pkg.1_Missense_Mutation_p.E103Q|PPOX_uc009wuc.1_Missense_Mutation_p.E103Q|PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Missense_Mutation_p.E103Q	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	265					heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity			ovary(1)	1	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCTCCAGGCAGAAGGGCGCTG	0.567									Porphyria_Variegata				16	41	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	168014277	168014277	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168014277G>A	uc001gew.2	+	14	2081	c.1839G>A	c.(1837-1839)CAG>CAA	p.Q613Q	DCAF6_uc001gev.2_Silent_p.Q633Q|DCAF6_uc001gex.2_Silent_p.Q690Q|DCAF6_uc010plk.1_Silent_p.Q659Q|DCAF6_uc001gey.2_Silent_p.Q486Q|DCAF6_uc001gez.2_5'UTR	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	613					positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						CTTCAGATCAGACTAGCACTG	0.453													37	90	---	---	---	---	PASS
SCYL3	57147	broad.mit.edu	37	1	169839492	169839492	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169839492C>G	uc001ggs.2	-	6	727	c.529G>C	c.(529-531)GAA>CAA	p.E177Q	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.E177Q|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	177	Protein kinase.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GTTGTGAATTCTGGAGACTAA	0.398													24	69	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185112497	185112497	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185112497C>G	uc001grf.3	-	7	1123	c.851G>C	c.(850-852)GGA>GCA	p.G284A	C1orf25_uc010pon.1_Missense_Mutation_p.G128A	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA	284						intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						ACCAGTGGCTCCAAAAGCATC	0.338													29	122	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213303065	213303065	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213303065G>A	uc010ptr.1	+	6	827	c.668G>A	c.(667-669)CGT>CAT	p.R223H	RPS6KC1_uc001hkd.2_Missense_Mutation_p.R211H|RPS6KC1_uc010pts.1_Missense_Mutation_p.R42H|RPS6KC1_uc010ptt.1_Missense_Mutation_p.R42H|RPS6KC1_uc010ptu.1_Missense_Mutation_p.R42H|RPS6KC1_uc010ptv.1_5'UTR|RPS6KC1_uc001hke.2_Missense_Mutation_p.R42H	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	223					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		CGGGAAAGTCGTAGCCTCTTT	0.413													30	74	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217975148	217975148	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217975148G>C	uc001hlh.1	+	9	987	c.961G>C	c.(961-963)GAA>CAA	p.E321Q	SPATA17_uc001hli.2_Missense_Mutation_p.E321Q	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	321						cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TTCTTACAAAGAACAATTCCG	0.294													13	51	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773838	229773838	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773838C>T	uc001hts.1	+	4	3614	c.3478C>T	c.(3478-3480)CAG>TAG	p.Q1160*	URB2_uc009xfd.1_Nonsense_Mutation_p.Q1160*	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1160						nucleolus				central_nervous_system(2)|ovary(1)	3						TGTTTACTCTCAGATACTGTT	0.552													30	61	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773864	229773864	+	Silent	SNP	C	T	T	rs114023508	byFrequency	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773864C>T	uc001hts.1	+	4	3640	c.3504C>T	c.(3502-3504)CTC>CTT	p.L1168L	URB2_uc009xfd.1_Silent_p.L1168L	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1168						nucleolus				central_nervous_system(2)|ovary(1)	3						TGCCAGCTCTCGCGGGACATG	0.527													35	64	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773886	229773886	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773886C>T	uc001hts.1	+	4	3662	c.3526C>T	c.(3526-3528)CAG>TAG	p.Q1176*	URB2_uc009xfd.1_Nonsense_Mutation_p.Q1176*	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1176						nucleolus				central_nervous_system(2)|ovary(1)	3						TCAGTCTTTTCAGGCAGCCTT	0.498													37	76	---	---	---	---	PASS
COG2	22796	broad.mit.edu	37	1	230810788	230810788	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230810788C>T	uc001htw.2	+	9	1095	c.944C>T	c.(943-945)TCT>TTT	p.S315F	COG2_uc001htx.2_Missense_Mutation_p.S315F|COG2_uc010pwc.1_Missense_Mutation_p.S188F	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	315					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TTGGTGAATTCTGTTTGGCCA	0.393													43	134	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233394101	233394101	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233394101C>T	uc001hvl.2	-	5	1742	c.1507G>A	c.(1507-1509)GAG>AAG	p.E503K	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	503						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ACCTTAGACTCGGAGCCTGTA	0.562													18	57	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242048726	242048726	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242048726G>A	uc001hzh.2	+	15	2862	c.2322G>A	c.(2320-2322)CAG>CAA	p.Q774Q	EXO1_uc001hzi.2_Silent_p.Q774Q|EXO1_uc001hzj.2_Silent_p.Q774Q|EXO1_uc009xgq.2_Silent_p.Q773Q	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	774	Interaction with MSH2.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			CAAGCATCCAGAAGAGAAAGC	0.453								Direct_reversal_of_damage|Editing_and_processing_nucleases					19	53	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551413	248551413	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551413C>G	uc001iei.1	+	1	504	c.504C>G	c.(502-504)TTC>TTG	p.F168L		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTCTCCCGTTCTGTGCCTCTC	0.532													13	35	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8931355	8931355	+	Splice_Site	SNP	C	A	A	rs35065317		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8931355C>A	uc002qzc.2	-	13	1459	c.1277_splice	c.e13-1	p.R426_splice	KIDINS220_uc010yiv.1_Splice_Site_p.R192_splice|KIDINS220_uc002qzd.2_Splice_Site_p.R384_splice|KIDINS220_uc010yiw.1_Splice_Site_p.R427_splice	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GACAAGTGTCCTGTAATTAAA	0.363													4	80	---	---	---	---	PASS
NTSR2	23620	broad.mit.edu	37	2	11798719	11798719	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11798719G>A	uc002rbq.3	-	4	1193	c.1119C>T	c.(1117-1119)GTC>GTT	p.V373V		NM_012344	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	373	Cytoplasmic (Potential).				sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	ACAGGGAGCTGACGGCTTCCA	0.562													21	66	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21233133	21233133	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21233133C>G	uc002red.2	-	26	6735	c.6607G>C	c.(6607-6609)GAT>CAT	p.D2203H		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2203					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ATGATTTCATCAATAATATTA	0.239													24	56	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27460592	27460592	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27460592G>A	uc002rji.2	+	29	4732	c.4570G>A	c.(4570-4572)GAG>AAG	p.E1524K	CAD_uc010eyw.2_Missense_Mutation_p.E1461K	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1524	DHOase (dihydroorotase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CCAGCTGGCAGAGGCTGGCGC	0.647													12	32	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45826690	45826690	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45826690C>G	uc002rus.2	-	4	622	c.546G>C	c.(544-546)AAG>AAC	p.K182N		NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	182					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TCTTGATTTTCTTTAAAGCGG	0.443													56	254	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49244635	49244635	+	Nonsense_Mutation	SNP	G	A	A	rs138079934	byFrequency	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49244635G>A	uc002rww.2	-	4	441	c.367C>T	c.(367-369)CAA>TAA	p.Q123*	FSHR_uc002rwx.2_Nonsense_Mutation_p.Q123*|FSHR_uc010fbn.2_Nonsense_Mutation_p.Q123*|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	123	Extracellular (Potential).|LRR 4.				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	TACAGATATTGAAGGTTGGGA	0.398									Gonadal_Dysgenesis_46_XX				14	52	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54874297	54874297	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54874297G>A	uc002rxu.2	+	24	5145	c.4896G>A	c.(4894-4896)AAG>AAA	p.K1632K	SPTBN1_uc002rxx.2_Silent_p.K1619K	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1632	Interaction with ANK2.|Spectrin 13.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			CCATGTTGAAGAAGCACCAGA	0.552													25	89	---	---	---	---	PASS
LOXL3	84695	broad.mit.edu	37	2	74779555	74779555	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74779555G>A	uc002smp.1	-	2	279	c.207C>T	c.(205-207)ATC>ATT	p.I69I	LOXL3_uc002smo.1_5'Flank|LOXL3_uc010ffm.1_Silent_p.I69I|LOXL3_uc002smq.1_Silent_p.I69I|LOXL3_uc010ffn.1_Silent_p.I69I|DOK1_uc002smr.2_Intron|DOK1_uc002sms.2_5'Flank|DOK1_uc010ffo.2_5'Flank|DOK1_uc002smt.2_5'Flank|DOK1_uc002smu.2_5'Flank|DOK1_uc010yrz.1_5'Flank|DOK1_uc002smv.2_5'Flank|DOK1_uc002smw.1_5'Flank	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	69	SRCR 1.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						CATCATCGCAGATGGTGCCCC	0.652													21	46	---	---	---	---	PASS
RMND5A	64795	broad.mit.edu	37	2	87423846	87423846	+	Intron	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87423846G>A	uc002srs.3	+						uc002ssh.2_3'UTR			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						AAAGTTTTATGGTATAACTAG	0.368													7	11	---	---	---	---	PASS
LMAN2L	81562	broad.mit.edu	37	2	97373526	97373526	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97373526C>G	uc002swu.2	-	7	865	c.829G>C	c.(829-831)GAG>CAG	p.E277Q	LMAN2L_uc002swv.2_Missense_Mutation_p.E288Q|LMAN2L_uc010yut.1_Missense_Mutation_p.E143Q|LMAN2L_uc010yuu.1_Missense_Mutation_p.E141Q|LMAN2L_uc010yuv.1_Missense_Mutation_p.E130Q|LMAN2L_uc010yuw.1_Missense_Mutation_p.E132Q|LMAN2L_uc002sww.2_Missense_Mutation_p.E130Q|LMAN2L_uc010yux.1_Missense_Mutation_p.E132Q	NM_030805	NP_110432	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like isoform 2	277	Lumenal (Potential).				ER to Golgi vesicle-mediated transport|protein folding|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle|Golgi membrane|integral to membrane	mannose binding|metal ion binding				0						GGGGTTCTCTCCACTGTCAGT	0.453													40	109	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102460600	102460600	+	Silent	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102460600C>A	uc002tbg.2	+	12	1115	c.1060C>A	c.(1060-1062)CGA>AGA	p.R354R	MAP4K4_uc002tbc.2_Silent_p.R354R|MAP4K4_uc002tbd.2_Silent_p.R354R|MAP4K4_uc002tbe.2_Silent_p.R354R|MAP4K4_uc002tbf.2_Silent_p.R354R|MAP4K4_uc010yvy.1_Silent_p.R354R|MAP4K4_uc002tbh.2_Silent_p.R354R|MAP4K4_uc002tbi.2_Silent_p.R207R|MAP4K4_uc010yvz.1_Silent_p.R334R|MAP4K4_uc002tbk.2_5'UTR|MAP4K4_uc002tbj.1_Silent_p.R250R	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	354					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TACTCTTCGCCGAGATTTCCT	0.512													3	18	---	---	---	---	PASS
RGPD4	285190	broad.mit.edu	37	2	108488568	108488568	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108488568G>C	uc010ywk.1	+	20	4190	c.4108G>C	c.(4108-4110)GAT>CAT	p.D1370H	RGPD4_uc002tdu.2_Missense_Mutation_p.D557H|RGPD4_uc010ywl.1_Intron	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1370	RanBD1 2.				intracellular transport		binding			skin(2)	2						ATATGATAAAGATGTTGGTCA	0.358													6	373	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109100719	109100719	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109100719G>A	uc002tec.2	+	13	3719	c.3565G>A	c.(3565-3567)GAA>AAA	p.E1189K	GCC2_uc002ted.2_Missense_Mutation_p.E1088K	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1189	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						TTTGGAGCAAGAAATAAAAAT	0.254													21	50	---	---	---	---	PASS
RGPD5	84220	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127775G>C	uc002ths.1	-	23	5355	c.5278C>G	c.(5278-5280)CCT>GCT	p.P1760A	RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform	1760					intracellular transport	cytoplasm	binding				0						GAACGGGAAGGATTTTCTTCC	0.308													3	45	---	---	---	---	PASS
DDX18	8886	broad.mit.edu	37	2	118582552	118582552	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118582552C>T	uc002tlh.1	+	9	1342	c.1243C>T	c.(1243-1245)CTG>TTG	p.L415L		NM_006773	NP_006764	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	415	Helicase C-terminal.						ATP binding|ATP-dependent RNA helicase activity|RNA binding			breast(2)|ovary(1)|lung(1)	4						GAGATTCCTTCTGCTCTTTAC	0.368													40	138	---	---	---	---	PASS
TMEM37	140738	broad.mit.edu	37	2	120194518	120194518	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120194518C>T	uc002tly.2	+	2	109	c.75C>T	c.(73-75)TTC>TTT	p.F25F		NM_183240	NP_899063	Q8WXS4	CCGL_HUMAN	transmembrane protein 37	25	Helical; (Potential).					integral to membrane	calcium channel activity|voltage-gated ion channel activity			breast(1)	1						TTGAATCCTTCATCCGGACCC	0.617													37	57	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135883809	135883809	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135883809G>A	uc002tuj.2	+	10	914	c.889G>A	c.(889-891)GAT>AAT	p.D297N	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.D297N|RAB3GAP1_uc010fng.2_Missense_Mutation_p.D122N|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	297						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		TGTGGATAATGATGTTTATTC	0.308													28	86	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152349881	152349881	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152349881C>T	uc010fnx.2	-	143	19374	c.19183G>A	c.(19183-19185)GAA>AAA	p.E6395K	NEB_uc002txr.2_Intron|RIF1_uc002txp.2_Intron|NEB_uc010zbz.1_Missense_Mutation_p.E164K|NEB_uc002txq.2_Missense_Mutation_p.E274K|NEB_uc010zca.1_Missense_Mutation_p.E226K|NEB_uc010zcb.1_Missense_Mutation_p.E164K	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	6395	Nebulin 176.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTAATGTTTTCTTGGTTGCGC	0.383													14	40	---	---	---	---	PASS
STAM2	10254	broad.mit.edu	37	2	152988551	152988551	+	Intron	SNP	T	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152988551T>C	uc002tyc.3	-						STAM2_uc010foa.1_Intron|STAM2_uc002tyd.2_3'UTR	NM_005843	NP_005834	O75886	STAM2_HUMAN	signal transducing adaptor molecule 2						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)		ACAAAAACTTTCCCTACTTTA	0.333													20	16	---	---	---	---	PASS
NOSTRIN	115677	broad.mit.edu	37	2	169717349	169717349	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169717349G>A	uc002ueg.2	+	14	1228	c.1224G>A	c.(1222-1224)ATG>ATA	p.M408I	NOSTRIN_uc002uef.2_Missense_Mutation_p.M465I|NOSTRIN_uc002uei.2_Missense_Mutation_p.M291I|NOSTRIN_uc010fpu.2_Missense_Mutation_p.M380I|NOSTRIN_uc002ueh.2_Missense_Mutation_p.M330I|NOSTRIN_uc002uej.2_Missense_Mutation_p.M291I|NOSTRIN_uc002uek.2_Missense_Mutation_p.M92I	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2	408					endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						CTTTTTTAATGAAGAGATTAG	0.378													26	75	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179440567	179440567	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179440567C>G	uc010zfg.1	-	275	62812	c.62588G>C	c.(62587-62589)AGA>ACA	p.R20863T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R14558T|TTN_uc010zfi.1_Missense_Mutation_p.R14491T|TTN_uc010zfj.1_Missense_Mutation_p.R14366T|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21790							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCAAGACTCTGACGTTCAC	0.502													48	131	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179481949	179481949	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179481949C>A	uc010zfg.1	-	204	40293	c.40069G>T	c.(40069-40071)GAA>TAA	p.E13357*	TTN_uc010zfh.1_Nonsense_Mutation_p.E7052*|TTN_uc010zfi.1_Nonsense_Mutation_p.E6985*|TTN_uc010zfj.1_Nonsense_Mutation_p.E6860*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14284							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCCTTTTTCCAATCCGGTA	0.323													3	6	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604510	179604510	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604510C>T	uc010zfh.1	-	46	13161	c.12937G>A	c.(12937-12939)GAA>AAA	p.E4313K	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.E4246K|TTN_uc010zfj.1_Missense_Mutation_p.E4121K|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTCTATTTCCTCATATATA	0.378													62	282	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179605584	179605584	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179605584C>T	uc010zfh.1	-	46	12087	c.11863G>A	c.(11863-11865)GAA>AAA	p.E3955K	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.E3888K|TTN_uc010zfj.1_Missense_Mutation_p.E3763K|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	3883							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGTGCTTTCAGGAGTGAGC	0.448													38	146	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196636429	196636429	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196636429C>T	uc002utj.3	-	61	11489	c.11388G>A	c.(11386-11388)CTG>CTA	p.L3796L	DNAH7_uc002uti.3_Silent_p.L279L	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3796					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TTATGGTCTTCAGTAACTTAT	0.378													71	177	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201437629	201437629	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201437629G>C	uc002uvw.2	+	7	2673	c.2560G>C	c.(2560-2562)GAA>CAA	p.E854Q	SGOL2_uc010zhd.1_Missense_Mutation_p.E854Q|SGOL2_uc010zhe.1_Missense_Mutation_p.E854Q	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	854					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AACAATTTCTGAAAATCTACA	0.308													48	144	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206884568	206884568	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206884568T>A	uc002vaz.3	-	7	1705	c.1300A>T	c.(1300-1302)ATA>TTA	p.I434L		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	434					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						GTCCGGCTTATGCTAAGGAAA	0.418													7	36	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	207009718	207009718	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207009718A>C	uc002vbe.2	-	9	897	c.770T>G	c.(769-771)GTT>GGT	p.V257G	NDUFS1_uc010ziq.1_Missense_Mutation_p.V271G|NDUFS1_uc010zir.1_Missense_Mutation_p.V221G|NDUFS1_uc010zis.1_Missense_Mutation_p.V200G|NDUFS1_uc010zit.1_Missense_Mutation_p.V146G|NDUFS1_uc010ziu.1_Missense_Mutation_p.V141G	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	257					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	ATTACTTCCAACCGCATCCAT	0.393													20	77	---	---	---	---	PASS
DNPEP	23549	broad.mit.edu	37	2	220246839	220246839	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220246839C>T	uc010zlg.1	-	11	1065	c.983G>A	c.(982-984)GGA>GAA	p.G328E	DNPEP_uc010zlf.1_RNA|DNPEP_uc002vle.2_Missense_Mutation_p.G320E|DNPEP_uc002vlf.1_Missense_Mutation_p.G306E|DNPEP_uc002vlh.2_Missense_Mutation_p.G267E|DNPEP_uc002vli.1_Missense_Mutation_p.G267E	NM_012100	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	310					peptide metabolic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	L-Glutamic Acid(DB00142)	TGACTGTGCTCCCTGTGCACT	0.602													6	20	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235943740	235943740	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235943740G>A	uc002vvp.2	+	3	487	c.94G>A	c.(94-96)GAG>AAG	p.E32K	SH3BP4_uc010fym.2_Missense_Mutation_p.E32K|SH3BP4_uc002vvq.2_Missense_Mutation_p.E32K	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	32					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		AGGGTTTTCAGAGACGAGCTT	0.532													8	36	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238277324	238277324	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277324G>C	uc002vwl.2	-	10	5067	c.4782C>G	c.(4780-4782)TTC>TTG	p.F1594L	COL6A3_uc002vwo.2_Missense_Mutation_p.F1388L|COL6A3_uc010znj.1_Missense_Mutation_p.F987L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1594	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTCGCACTGTGAAGACCAGTC	0.547													33	229	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238283544	238283544	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238283544G>A	uc002vwl.2	-	8	3475	c.3190C>T	c.(3190-3192)CGG>TGG	p.R1064W	COL6A3_uc002vwo.2_Missense_Mutation_p.R858W|COL6A3_uc010znj.1_Missense_Mutation_p.R457W|COL6A3_uc002vwq.2_Missense_Mutation_p.R858W|COL6A3_uc002vwr.2_Missense_Mutation_p.R657W	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1064	Nonhelical region.|VWFA 6.		R -> Q (in UCMD).		axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACGCGGACCCGGTCCTGGCCC	0.592													13	31	---	---	---	---	PASS
CAND2	23066	broad.mit.edu	37	3	12858016	12858016	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12858016T>A	uc003bxk.2	+	10	1634	c.1585T>A	c.(1585-1587)TGT>AGT	p.C529S	CAND2_uc003bxj.2_Missense_Mutation_p.C436S	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	529	HEAT 11.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						TGTGATGGCCTGTGTGGCTGA	0.647													3	37	---	---	---	---	PASS
TBC1D5	9779	broad.mit.edu	37	3	17349598	17349598	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17349598C>T	uc003cbf.2	-	14	2689	c.1024G>A	c.(1024-1026)GAG>AAG	p.E342K	TBC1D5_uc010heu.2_5'UTR|TBC1D5_uc010hev.2_Missense_Mutation_p.E342K|TBC1D5_uc003cbe.2_Missense_Mutation_p.E342K|TBC1D5_uc010hew.1_Missense_Mutation_p.E294K	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b	342	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						AGGGGGAACTCTCGTCCAAAT	0.438													11	14	---	---	---	---	PASS
CCDC12	151903	broad.mit.edu	37	3	46963564	46963564	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46963564T>G	uc003cqo.2	-	7	532	c.523A>C	c.(523-525)ACC>CCC	p.T175P		NM_144716	NP_653317	Q8WUD4	CCD12_HUMAN	coiled-coil domain containing 12	162											0		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)		GAGTCACAGGTCTTTTGTTCG	0.617													4	14	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47142947	47142947	+	Splice_Site	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47142947C>T	uc003cqs.2	-	8	5068	c.5015_splice	c.e8+1	p.G1672_splice	SETD2_uc003cqv.2_Splice_Site_p.G1739_splice	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACAATACTTACCCATATCTCT	0.358			N|F|S|Mis		clear cell renal carcinoma								39	89	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62261595	62261595	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62261595G>A	uc003dlb.2	+	24	4232	c.3513G>A	c.(3511-3513)CAG>CAA	p.Q1171Q	PTPRG_uc003dlc.2_Silent_p.Q1142Q|PTPRG_uc011bfi.1_Silent_p.Q417Q|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1171	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TCAGTGCTCAGAAAGAGTGTA	0.318													20	27	---	---	---	---	PASS
PPP4R2	151987	broad.mit.edu	37	3	73114035	73114035	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73114035C>G	uc003dph.1	+	8	741	c.671C>G	c.(670-672)TCA>TGA	p.S224*	PPP4R2_uc003dpi.1_Nonsense_Mutation_p.S167*	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	224					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		GAAGTTTCCTCAGTGAGCCCT	0.378													25	58	---	---	---	---	PASS
PPP4R2	151987	broad.mit.edu	37	3	73114241	73114241	+	Silent	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73114241C>A	uc003dph.1	+	8	947	c.877C>A	c.(877-879)CGG>AGG	p.R293R	PPP4R2_uc003dpi.1_Silent_p.R236R	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	293					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		CCGTTGTACCCGGCAGCACTG	0.348													3	34	---	---	---	---	PASS
C3orf52	79669	broad.mit.edu	37	3	111821711	111821711	+	Missense_Mutation	SNP	G	C	C	rs139531193	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111821711G>C	uc003dyq.3	+	3	368	c.295G>C	c.(295-297)GAA>CAA	p.E99Q	C3orf52_uc011bhs.1_Missense_Mutation_p.E99Q|C3orf52_uc011bht.1_Missense_Mutation_p.E99Q	NM_024616	NP_078892	Q5BVD1	TTMP_HUMAN	TPA-induced transmembrane protein	99						endoplasmic reticulum membrane|integral to membrane					0						AGATGAAAATGAAATACTTGA	0.343													2	5	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111996650	111996650	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111996650G>C	uc003dyu.2	-	5	598	c.376C>G	c.(376-378)CTG>GTG	p.L126V	SLC9A10_uc011bhu.1_Translation_Start_Site|SLC9A10_uc010hqc.2_Missense_Mutation_p.L126V	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	126					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ACAGATGCCAGATGCCAAAGA	0.343													29	95	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124746337	124746337	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124746337G>A	uc003ehs.3	-	3	693	c.625C>T	c.(625-627)CAC>TAC	p.H209Y	HEG1_uc011bke.1_Missense_Mutation_p.H209Y	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	209	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						GATGGCAGGTGAAGACTTTCT	0.453													6	27	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125849034	125849034	+	Intron	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125849034G>C	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_3'UTR	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	AAAGCACCGCGAGGCTGCACC	0.582													4	19	---	---	---	---	PASS
TPRA1	131601	broad.mit.edu	37	3	127295478	127295478	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127295478C>T	uc003ejl.2	-	5	771	c.480G>A	c.(478-480)CTG>CTA	p.L160L	TPRA1_uc003ejm.2_RNA|TPRA1_uc003ejo.2_Silent_p.L160L|TPRA1_uc010hsk.2_Silent_p.L160L|TPRA1_uc003ejn.2_Silent_p.L160L	NM_016372	NP_057456	Q86W33	TPRA1_HUMAN	G protein-coupled receptor 175 isoform 1	160	Helical; Name=4; (Potential).				aging|lipid metabolic process	integral to membrane	G-protein coupled receptor activity				0						CAGAGTAGGCCAGGGACAGCA	0.617													3	14	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134920360	134920360	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134920360C>G	uc003eqt.2	+	12	2395	c.2175C>G	c.(2173-2175)CTC>CTG	p.L725L	EPHB1_uc003equ.2_Silent_p.L286L	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	725	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TGGGTATGCTCAGGGGCATCG	0.507													54	139	---	---	---	---	PASS
PCCB	5096	broad.mit.edu	37	3	136045670	136045670	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136045670G>C	uc003eqy.1	+	11	1167	c.1116G>C	c.(1114-1116)GTG>GTC	p.V372V	PCCB_uc003eqz.1_Silent_p.V372V|PCCB_uc011bmc.1_Silent_p.V392V|PCCB_uc011bmd.1_Silent_p.V289V	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta	372	Carboxyltransferase.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	ATTCATCTGTGAAAGGGGCTC	0.408													44	208	---	---	---	---	PASS
IL20RB	53833	broad.mit.edu	37	3	136676841	136676841	+	5'UTR	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136676841C>G	uc003eri.1	+	1					IL20RB_uc003erj.1_RNA	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1						ATTCAGGCTTCGCTGCGACTC	0.502													5	18	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148897410	148897410	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148897410G>A	uc003ewy.3	-	15	2847	c.2594C>T	c.(2593-2595)TCT>TTT	p.S865F	CP_uc011bnr.1_RNA|CP_uc003eww.3_Missense_Mutation_p.S17F|CP_uc003ewx.3_Missense_Mutation_p.S646F|CP_uc003ewz.2_Missense_Mutation_p.S865F	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	865	Plastocyanin-like 5.|F5/8 type A 3.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TCCAGCTCCAGATCTTTCTGG	0.333													11	68	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155232664	155232664	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155232664T>A	uc011bok.1	-	11	1721	c.1444A>T	c.(1444-1446)ACC>TCC	p.T482S	PLCH1_uc011boj.1_Missense_Mutation_p.T482S|PLCH1_uc011bol.1_Missense_Mutation_p.T464S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	482					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGCTCAGTGGTCCCATTACTC	0.348													18	55	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160156757	160156757	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160156757G>C	uc003fdm.2	-	3	410	c.215C>G	c.(214-216)TCT>TGT	p.S72C	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	72						integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AACAGGTAAAGATTCAATGCC	0.393													41	123	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952074	178952074	+	Missense_Mutation	SNP	G	T	T	rs121913283		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952074G>T	uc003fjk.2	+	21	3286	c.3129G>T	c.(3127-3129)ATG>ATT	p.M1043I		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1043	PI3K/PI4K.		M -> I (in cancer; shows an increase in lipid kinase activity).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.M1043I(33)|p.M1043V(14)|p.M1043T(3)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAACAAATGAATGATGCAC	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			28	55	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179399668	179399668	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179399668T>A	uc003fkh.2	+	2	252	c.171T>A	c.(169-171)AAT>AAA	p.N57K	USP13_uc003fkf.2_Missense_Mutation_p.N57K	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	57					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TCTTCTAGAATTCTGAAGGTG	0.423													73	205	---	---	---	---	PASS
LRRC15	131578	broad.mit.edu	37	3	194081538	194081538	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194081538G>T	uc003ftu.2	-	2	321	c.235C>A	c.(235-237)CTC>ATC	p.L79I	LRRC15_uc003ftt.2_Missense_Mutation_p.L85I	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	79	LRR 2.|Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		AGGGCGATGAGGGCTGAGATA	0.587													4	68	---	---	---	---	PASS
PIGZ	80235	broad.mit.edu	37	3	196674789	196674789	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196674789C>A	uc003fxh.2	-	3	1126	c.979G>T	c.(979-981)GGG>TGG	p.G327W		NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	327					GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		TGCAGCACCCCGAAGAGCAGG	0.637													4	87	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197616472	197616472	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197616472C>G	uc003fyo.2	-	11	1457	c.1311G>C	c.(1309-1311)AAG>AAC	p.K437N	IQCG_uc003fyn.2_Missense_Mutation_p.K339N|IQCG_uc003fyp.2_Missense_Mutation_p.K437N|IQCG_uc003fym.2_Missense_Mutation_p.K138N	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	437											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TGCCTCTCCTCTTATCCTTGC	0.443													4	184	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6087327	6087327	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6087327C>G	uc003giu.3	-	4	930	c.654G>C	c.(652-654)GTG>GTC	p.V218V	JAKMIP1_uc010idb.1_Silent_p.V218V|JAKMIP1_uc010idc.1_Silent_p.V53V|JAKMIP1_uc010idd.1_Silent_p.V218V|JAKMIP1_uc011bwc.1_Silent_p.V53V|JAKMIP1_uc003giv.3_Silent_p.V218V|JAKMIP1_uc010ide.2_Silent_p.V218V	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	218	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						AGGCCAGAATCACACGGTCTT	0.522													35	117	---	---	---	---	PASS
WDR1	9948	broad.mit.edu	37	4	10083020	10083020	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10083020G>A	uc003gmf.2	-	11	1528	c.1245C>T	c.(1243-1245)GTC>GTT	p.V415V	WDR1_uc003gmg.2_Silent_p.V275V|WDR1_uc010idm.2_RNA|hsa-mir-3138|MI0014161_5'Flank	NM_017491	NP_059830	O75083	WDR1_HUMAN	WD repeat-containing protein 1 isoform 1	415					platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding			ovary(2)|pancreas(1)	3				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CCCCGGGGCCGACGGCTACGC	0.567													14	31	---	---	---	---	PASS
HSP90AB2P	391634	broad.mit.edu	37	4	13339251	13339251	+	RNA	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13339251G>A	uc003gms.2	+	1		c.4215G>A				NR_003132				Homo sapiens heat shock protein 90Bb (HSP90Bb) mRNA, complete cds.											kidney(1)	1						GGTTGACTCTGAGGATTTCCC	0.438													7	22	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47593107	47593107	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47593107G>C	uc003gxk.1	+	23	4154	c.3990G>C	c.(3988-3990)CTG>CTC	p.L1330L	ATP10D_uc003gxl.1_Silent_p.L578L	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1330	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						CTCCAATTCTGAGAGCTAAGC	0.413													30	92	---	---	---	---	PASS
SLC10A4	201780	broad.mit.edu	37	4	48487058	48487058	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48487058C>A	uc003gyc.2	+	2	919	c.700C>A	c.(700-702)CTA>ATA	p.L234I		NM_152679	NP_689892	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	234	Helical; (Potential).					integral to membrane	bile acid:sodium symporter activity			central_nervous_system(1)	1						GTTACTACCCCTAGGGACCGT	0.557													5	175	---	---	---	---	PASS
GNRHR	2798	broad.mit.edu	37	4	68619664	68619664	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68619664G>A	uc003hdn.2	-	1	2141	c.390C>T	c.(388-390)TTC>TTT	p.F130F	LOC550112_uc003hdl.3_Intron|GNRHR_uc003hdm.2_Silent_p.F130F	NM_000406	NP_000397	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor isoform	130	Helical; Name=3; (Potential).				multicellular organismal development	integral to plasma membrane	gonadotropin-releasing hormone receptor activity			ovary(1)	1					Abarelix(DB00106)|Cetrorelix(DB00050)|Danazol(DB01406)|Gonadorelin(DB00644)|Leuprolide(DB00007)|Nafarelin(DB00666)	CCACCATCATGAAGGCTGGGG	0.507													12	42	---	---	---	---	PASS
METAP1	23173	broad.mit.edu	37	4	99982540	99982540	+	3'UTR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99982540G>C	uc003huf.3	+	11					METAP1_uc003hug.2_RNA|METAP1_uc010ild.2_RNA	NM_015143	NP_055958	P53582	AMPM1_HUMAN	methionyl aminopeptidase 1						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis|regulation of translation	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		CAGAAAGGAAGAGGAACCTTT	0.373													10	34	---	---	---	---	PASS
MANBA	4126	broad.mit.edu	37	4	103595103	103595103	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103595103G>A	uc003hwg.2	-	8	1185	c.1085C>T	c.(1084-1086)TCA>TTA	p.S362L	MANBA_uc011ces.1_Missense_Mutation_p.S305L	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor	362					carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GTCCTGGAATGAATCTGCTGG	0.368													36	104	---	---	---	---	PASS
LEF1	51176	broad.mit.edu	37	4	109004529	109004529	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109004529G>A	uc003hyt.1	-	5	1276	c.621C>T	c.(619-621)ATC>ATT	p.I207I	LEF1_uc011cfj.1_Silent_p.I92I|LEF1_uc011cfk.1_Silent_p.I139I|LEF1_uc003hyu.1_Silent_p.I207I|LEF1_uc003hyv.1_Silent_p.I207I|LEF1_uc010imb.1_RNA	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1	207	Pro-rich.				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		GAGGTGGGGTGATCTGTCCAA	0.463													18	39	---	---	---	---	PASS
NAA15	80155	broad.mit.edu	37	4	140309202	140309202	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140309202T>A	uc003ihu.1	+	20	2821	c.2565T>A	c.(2563-2565)AGT>AGA	p.S855R		NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1	855					angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						ATGGAGATAGTTCTGCAGAAG	0.353													36	85	---	---	---	---	PASS
CLGN	1047	broad.mit.edu	37	4	141320087	141320087	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141320087C>G	uc011chi.1	-	9	1020	c.802G>C	c.(802-804)GAA>CAA	p.E268Q	CLGN_uc003iii.2_Missense_Mutation_p.E268Q	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	268	Lumenal (Potential).|1-1.				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					TTGGGATCTTCAATTTCTTTG	0.408													9	215	---	---	---	---	PASS
SMARCA5	8467	broad.mit.edu	37	4	144469207	144469207	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144469207G>C	uc003ijg.2	+	22	3361	c.2899G>C	c.(2899-2901)GAA>CAA	p.E967Q		NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated	967	SANT 2.				CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					ATTTGACAAAGAAAATGTTTA	0.373													27	69	---	---	---	---	PASS
ARFIP1	27236	broad.mit.edu	37	4	153791962	153791962	+	Missense_Mutation	SNP	G	A	A	rs142219628		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153791962G>A	uc003imz.2	+	4	536	c.260G>A	c.(259-261)CGA>CAA	p.R87Q	ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Missense_Mutation_p.R87Q|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	87					intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					GCAGCTAGTCGACTGGCTCAG	0.443													19	66	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156617936	156617936	+	5'UTR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156617936G>C	uc003iov.2	+	4					GUCY1A3_uc003iou.2_5'UTR|GUCY1A3_uc010iqc.2_5'UTR|GUCY1A3_uc003iow.2_5'UTR|GUCY1A3_uc010iqd.2_5'UTR|GUCY1A3_uc003iox.2_Intron|GUCY1A3_uc003ioz.2_Intron|GUCY1A3_uc003ioy.2_5'UTR|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_5'UTR	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TCCTTGAATTGATAGTGGCTT	0.443													3	16	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164534603	164534603	+	Intron	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164534603C>G	uc003iqs.1	-						MARCH1_uc003iqr.1_Missense_Mutation_p.K18N	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TGGTTGATATCTTGCTTTTTT	0.398													23	90	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7817056	7817056	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7817056C>T	uc003jdz.1	+	23	3028	c.2961C>T	c.(2959-2961)ATC>ATT	p.I987I	ADCY2_uc011cmo.1_Silent_p.I807I|ADCY2_uc010itm.1_Silent_p.I183I	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	987	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TGGATGCCATCAACAAGCACT	0.502											OREG0016499	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	52	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10391798	10391798	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10391798G>A	uc003jet.1	+	7	904	c.721G>A	c.(721-723)GAC>AAC	p.D241N	MARCH6_uc011cmu.1_Missense_Mutation_p.D193N|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Missense_Mutation_p.D136N	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	241	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ggaggaagatgaCGCTGGTGT	0.423													6	18	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37185055	37185055	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37185055T>A	uc011cpa.1	-	25	4547	c.4316A>T	c.(4315-4317)GAA>GTA	p.E1439V	C5orf42_uc011coy.1_5'Flank|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.E514V|C5orf42_uc011cpb.1_Missense_Mutation_p.E320V	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1439										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TGGTTTCTCTTCTTCAATTGG	0.428													43	101	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43533846	43533846	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43533846C>T	uc003job.2	-	9	1493	c.1246G>A	c.(1246-1248)GAT>AAT	p.D416N	PAIP1_uc003joa.2_Missense_Mutation_p.D337N|PAIP1_uc010ivp.2_Missense_Mutation_p.D337N|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.D304N	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	416					mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					ATACCTGGATCAGCTGCAGTG	0.358													30	130	---	---	---	---	PASS
ZFYVE16	9765	broad.mit.edu	37	5	79732916	79732916	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79732916C>T	uc003kgr.3	+	4	714	c.412C>T	c.(412-414)CAT>TAT	p.H138Y	ZFYVE16_uc010jak.1_Missense_Mutation_p.H138Y|ZFYVE16_uc003kgp.2_Missense_Mutation_p.H138Y|ZFYVE16_uc003kgq.3_Missense_Mutation_p.H138Y|ZFYVE16_uc003kgs.3_Missense_Mutation_p.H138Y	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	138					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TAACTTAGTTCATGCAACCAA	0.358													17	245	---	---	---	---	PASS
NR2F1	7025	broad.mit.edu	37	5	92929285	92929285	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92929285G>A	uc003kkj.2	+	3	2696	c.1009G>A	c.(1009-1011)GAT>AAT	p.D337N		NM_005654	NP_005645	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	337					negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			urinary_tract(1)|ovary(1)|lung(1)	3		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		TGGCCTGTCGGATGCGGCCCA	0.587													28	90	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101834305	101834305	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101834305C>G	uc003knn.2	-	1	416	c.244G>C	c.(244-246)GAT>CAT	p.D82H	SLCO6A1_uc003kno.2_Missense_Mutation_p.D82H|SLCO6A1_uc003knp.2_Missense_Mutation_p.D82H|SLCO6A1_uc003knq.2_Missense_Mutation_p.D82H	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	82	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AAACTGTCATCCACTTCTCCC	0.493													61	115	---	---	---	---	PASS
TSSK1B	83942	broad.mit.edu	37	5	112770004	112770004	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112770004G>A	uc003kqm.2	-	1	725	c.533C>T	c.(532-534)TCA>TTA	p.S178L	MCC_uc003kql.3_Intron	NM_032028	NP_114417	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1	178	Protein kinase.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|skin(2)|stomach(1)	5		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		ATACGCTGGTGACCCACAGAA	0.567													7	28	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126734416	126734416	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126734416G>C	uc003kuh.3	+	8	1070	c.708G>C	c.(706-708)CAG>CAC	p.Q236H	MEGF10_uc010jdc.1_Missense_Mutation_p.Q236H|MEGF10_uc010jdd.1_Missense_Mutation_p.Q236H|MEGF10_uc003kui.3_Missense_Mutation_p.Q236H	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	236	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.|EGF-like 4.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		AGTGTGAGCAGAGATGCCCTT	0.507													23	71	---	---	---	---	PASS
KLHL3	26249	broad.mit.edu	37	5	137028181	137028181	+	Intron	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137028181G>A	uc010jek.2	-						KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|MYOT_uc011cye.1_Intron|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_Intron|KLHL3_uc003lbs.1_5'UTR	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CCCACTGGCAGAGACTCATCT	0.522													8	17	---	---	---	---	PASS
CDC25C	995	broad.mit.edu	37	5	137621218	137621218	+	3'UTR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137621218G>C	uc003lcp.1	-	14					CDC25C_uc003lcq.1_3'UTR|CDC25C_uc003lcr.1_3'UTR|CDC25C_uc011cyp.1_3'UTR|CDC25C_uc003lcs.1_3'UTR	NM_001790	NP_001781	P30307	MPIP3_HUMAN	cell division cycle 25C isoform a						cell cycle checkpoint|cell division|cell proliferation|DNA replication|G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm	protein tyrosine phosphatase activity|WW domain binding			lung(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CAGCTCTGCTGAAACCTAATC	0.483													7	19	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141025388	141025388	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141025388C>G	uc003llk.2	-	13	1312	c.1261G>C	c.(1261-1263)GAG>CAG	p.E421Q	FCHSD1_uc010jgg.2_Missense_Mutation_p.E104Q|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	421									FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCGCCGCTCCTGCTCCACC	0.642													4	9	---	---	---	---	PASS
GABRB2	2561	broad.mit.edu	37	5	160758051	160758051	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160758051C>T	uc003lys.1	-	9	1134	c.916G>A	c.(916-918)GAC>AAC	p.D306N	GABRB2_uc011deh.1_Missense_Mutation_p.D145N|GABRB2_uc003lyr.1_Missense_Mutation_p.D306N|GABRB2_uc003lyt.1_Missense_Mutation_p.D306N|GABRB2_uc010jiu.1_Missense_Mutation_p.D243N	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	306	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AGGTACATGTCAATGGCCTTC	0.483													58	134	---	---	---	---	PASS
PDLIM7	9260	broad.mit.edu	37	5	176910713	176910713	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176910713C>G	uc003mhc.1	-	13	1391	c.1306G>C	c.(1306-1308)GAA>CAA	p.E436Q	PDLIM7_uc003mha.1_Missense_Mutation_p.E330Q|PDLIM7_uc003mhb.1_Missense_Mutation_p.E402Q|PDLIM7_uc003mhd.1_Missense_Mutation_p.E288Q|PDLIM7_uc003mhe.1_RNA	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1	436	LIM zinc-binding 3.				cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCTTTCCTTCCAGGTTGATC	0.587													6	27	---	---	---	---	PASS
TBC1D9B	23061	broad.mit.edu	37	5	179318451	179318451	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179318451G>A	uc003mlh.2	-	6	1009	c.972C>T	c.(970-972)TTC>TTT	p.F324F	TBC1D9B_uc003mli.2_Silent_p.F324F|TBC1D9B_uc003mlj.2_Silent_p.F324F	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	324	GRAM 2.					integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTTGGAGATGAACATCTGGC	0.597													32	61	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7581491	7581491	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7581491G>A	uc003mxp.1	+	23	5347	c.5068G>A	c.(5068-5070)GAA>AAA	p.E1690K	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1690	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GAAGGCGATAGAAGATAAAAG	0.458													31	57	---	---	---	---	PASS
HIST1H3I	8354	broad.mit.edu	37	6	27839872	27839872	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27839872C>T	uc003njy.2	-	1	228	c.222G>A	c.(220-222)GAG>GAA	p.E74E		NM_003533	NP_003524	P68431	H31_HUMAN	histone cluster 1, H3i	74					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						CCTGTGCGATCTCCCGTACCA	0.622													28	38	---	---	---	---	PASS
BAT3	7917	broad.mit.edu	37	6	31617000	31617000	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31617000G>A	uc003nvg.3	-	4	713	c.399C>T	c.(397-399)GTC>GTT	p.V133V	BAT3_uc003nvf.3_Silent_p.V133V|BAT3_uc003nvh.3_Silent_p.V133V|BAT3_uc003nvi.3_Silent_p.V133V|BAT3_uc011dnw.1_Silent_p.V133V|BAT3_uc011dnx.1_Silent_p.V133V|BAT3_uc003nvj.1_Silent_p.V133V	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	133					apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0						TTCCAACCATGACATAGCTGT	0.552													45	67	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32017875	32017875	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32017875G>A	uc003nzl.2	-	27	9535	c.9333C>T	c.(9331-9333)GTC>GTT	p.V3111V		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3158	Fibronectin type-III 23.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CTGAGATGGTGACCCCGTCCT	0.632													15	14	---	---	---	---	PASS
PPP2R5D	5528	broad.mit.edu	37	6	42978430	42978430	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42978430G>C	uc003oth.2	+	14	1596	c.1510G>C	c.(1510-1512)GAG>CAG	p.E504Q	MEA1_uc010jyc.1_Intron|PPP2R5D_uc003otg.2_Missense_Mutation_p.E472Q|PPP2R5D_uc010jyd.2_Missense_Mutation_p.E398Q|PPP2R5D_uc011dva.1_Missense_Mutation_p.E353Q|PPP2R5D_uc003oti.2_Missense_Mutation_p.E353Q|PPP2R5D_uc003otj.2_Missense_Mutation_p.E335Q	NM_006245	NP_006236	Q14738	2A5D_HUMAN	delta isoform of regulatory subunit B56, protein	504					nervous system development|signal transduction	cytoplasm|nucleus|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			breast(1)|central_nervous_system(1)	2			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGAAAGGGAAGAGATGTGGCA	0.542													22	38	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43156401	43156401	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43156401G>C	uc003ouk.2	+	8	2203	c.2128G>C	c.(2128-2130)GAG>CAG	p.E710Q	CUL9_uc003ouj.1_3'UTR|CUL9_uc003oul.2_Missense_Mutation_p.E710Q|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_3'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	710					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TCAGGCTGTGGAGGAGGTCAC	0.577													15	22	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75843060	75843060	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75843060G>T	uc003phs.2	-	34	5909	c.5743C>A	c.(5743-5745)CCC>ACC	p.P1915T	COL12A1_uc003pht.2_Missense_Mutation_p.P751T	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1915	Fibronectin type-III 14.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						GTATAAACGGGAACTACAGTC	0.373													27	59	---	---	---	---	PASS
RIPPLY2	134701	broad.mit.edu	37	6	84563822	84563822	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84563822G>A	uc003pke.2	+	3	332	c.181G>A	c.(181-183)GAT>AAT	p.D61N		NM_001009994	NP_001009994	Q5TAB7	RIPP2_HUMAN	ripply2 protein	61					somite rostral/caudal axis specification	nucleus					0						CCAGATGCCCGATGGCCCTGG	0.577													17	34	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567277	5567277	+	3'UTR	SNP	C	A	A	rs17136418		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567277C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		aaaaccaaaacaaaacaaaaa	0.373													14	57	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14733765	14733765	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14733765G>A	uc003ssz.2	-	8	833	c.646C>T	c.(646-648)CTG>TTG	p.L216L	DGKB_uc011jxt.1_Silent_p.L209L|DGKB_uc003sta.2_Silent_p.L216L|DGKB_uc011jxu.1_Silent_p.L216L|DGKB_uc011jxv.1_Silent_p.L216L	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	216	EF-hand 2.|2 (Potential).				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CATTCCTCCAGAGACACGGTT	0.443													6	7	---	---	---	---	PASS
AHR	196	broad.mit.edu	37	7	17378911	17378911	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17378911G>T	uc011jxz.1	+	10	2075	c.1462G>T	c.(1462-1464)GAA>TAA	p.E488*	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	488					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					CTTTTTCAACGAATCTATGAA	0.398													44	122	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41740025	41740025	+	5'UTR	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41740025C>G	uc003thq.2	-	1					LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_5'UTR|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor						cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						TGCTTTTCCTCCCCCCTCACG	0.373										TSP Lung(11;0.080)			15	53	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48269201	48269201	+	Intron	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48269201C>G	uc003toq.2	+						ABCA13_uc003top.2_3'UTR|ABCA13_uc010kyr.2_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CCTAAGTTCTCAAGTGTTTCA	0.418													7	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	63809022	63809022	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63809022G>C	uc011kdo.1	+	4	918	c.781G>C	c.(781-783)GAA>CAA	p.E261Q						SubName: Full=cDNA FLJ57041, moderately similar to Zinc finger protein 92;																		CAAATGTGAAGAATGTGGCAA	0.388													3	15	---	---	---	---	PASS
ZNF138	7697	broad.mit.edu	37	7	64292958	64292958	+	3'UTR	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64292958C>A	uc011kdp.1	+	5					ZNF138_uc003ttg.2_3'UTR|ZNF138_uc011kdq.1_3'UTR|ZNF138_uc003tth.2_RNA|ZNF138_uc010kzs.2_3'UTR	NM_001160183	NP_001153655	B4DFX2	B4DFX2_HUMAN	zinc finger protein 138 isoform 2						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0		Lung NSC(55;0.0795)|all_lung(88;0.18)				GAGAAAAACCCTACAAATGTG	0.383													3	15	---	---	---	---	PASS
GTF2IRD1	9569	broad.mit.edu	37	7	73933938	73933938	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73933938G>C	uc003uaq.2	+	6	1198	c.805G>C	c.(805-807)GAG>CAG	p.E269Q	GTF2IRD1_uc010lbq.2_Missense_Mutation_p.E301Q|GTF2IRD1_uc003uap.2_Missense_Mutation_p.E269Q|GTF2IRD1_uc003uar.1_Missense_Mutation_p.E269Q	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	269						nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CGCCATCCGAGAGCTCAAGCA	0.687													12	45	---	---	---	---	PASS
SRCRB4D	136853	broad.mit.edu	37	7	76033741	76033741	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76033741C>T	uc003ufb.2	-	2	364	c.16G>A	c.(16-18)GAG>AAG	p.E6K	ZP3_uc003ufc.3_Intron	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	6						extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						ATTAGCATCTCTGCTTCCTTG	0.542													10	71	---	---	---	---	PASS
RSBN1L	222194	broad.mit.edu	37	7	77408178	77408178	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77408178C>G	uc010ldt.1	+	8	2278	c.2234C>G	c.(2233-2235)TCT>TGT	p.S745C	RSBN1L_uc003ugm.2_Missense_Mutation_p.S527C	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	745						nucleus				ovary(1)	1						AAACTTCATTCTAAATATGAA	0.363													35	85	---	---	---	---	PASS
ACN9	57001	broad.mit.edu	37	7	96810512	96810512	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96810512G>C	uc003uoo.3	+	2	1494	c.363G>C	c.(361-363)ATG>ATC	p.M121I		NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor	121					regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					CTGAGTCTATGAAACCAAAAT	0.318													9	30	---	---	---	---	PASS
SPDYE6	729597	broad.mit.edu	37	7	101987641	101987641	+	3'UTR	SNP	A	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101987641A>G	uc011kkp.1	-	8					SPDYE6_uc003uzb.2_3'UTR	NM_001146210	NP_001139682	P0CI01	SPDE6_HUMAN	speedy homolog E6												0						GAAAATCCACATCTCCCCTGG	0.483													5	34	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143633147	143633147	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143633147C>G	uc011ktv.1	+	1	822	c.822C>G	c.(820-822)ATC>ATG	p.I274M		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	274	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					AGAAGCTGATCTCTGTCTTCT	0.483													23	78	---	---	---	---	PASS
SOX7	83595	broad.mit.edu	37	8	10584142	10584142	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10584142C>G	uc003wtf.2	-	2	352	c.273G>C	c.(271-273)AAG>AAC	p.K91N	SOX7_uc011kwz.1_Missense_Mutation_p.K143N|uc003wtg.1_5'Flank	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	91	HMG box.				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		CGTACGGCCTCTTCTGGGACA	0.602													6	16	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17612647	17612647	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17612647C>G	uc003wxv.2	-	2	1144	c.670G>C	c.(670-672)GAT>CAT	p.D224H	MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.D224H|MTUS1_uc010lsz.2_Missense_Mutation_p.D224H	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	224						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		CTTTCTCTATCATAAGTAGTT	0.418													25	150	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35406937	35406937	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35406937G>A	uc003xjr.1	+	2	559	c.231G>A	c.(229-231)GCG>GCA	p.A77A	UNC5D_uc003xjs.1_Silent_p.A72A	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	77	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GGTGCAAAGCGAGGCCAGCCA	0.512													12	39	---	---	---	---	PASS
SDCBP	6386	broad.mit.edu	37	8	59494245	59494245	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59494245G>C	uc003xtn.2	+	9	993	c.843G>C	c.(841-843)CGG>CGC	p.R281R	SDCBP_uc003xto.2_Silent_p.R280R|SDCBP_uc003xtr.2_Silent_p.R280R|SDCBP_uc003xtp.2_Silent_p.R275R|SDCBP_uc003xtq.2_Silent_p.R281R|SDCBP_uc003xts.2_Silent_p.R287R|SDCBP_uc011led.1_Silent_p.R222R	NM_005625	NP_005616	O00560	SDCB1_HUMAN	syntenin isoform 1	281					actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TCTCTTGTAGGATGGCACCAA	0.383													24	71	---	---	---	---	PASS
SDCBP	6386	broad.mit.edu	37	8	59494315	59494315	+	3'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59494315G>A	uc003xtn.2	+	9					SDCBP_uc003xto.2_3'UTR|SDCBP_uc003xtr.2_3'UTR|SDCBP_uc003xtp.2_3'UTR|SDCBP_uc003xtq.2_3'UTR|SDCBP_uc003xts.2_3'UTR|SDCBP_uc011led.1_3'UTR	NM_005625	NP_005616	O00560	SDCB1_HUMAN	syntenin isoform 1						actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				ACGGCACCATGGAAATGTAGC	0.458													23	70	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764240	77764240	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764240C>T	uc003yav.2	+	10	5335	c.4948C>T	c.(4948-4950)CAG>TAG	p.Q1650*	ZFHX4_uc003yau.1_Nonsense_Mutation_p.Q1695*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.Q1650*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1650	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCACAAATTCAGATGCAACT	0.428										HNSCC(33;0.089)			23	61	---	---	---	---	PASS
COX6C	1345	broad.mit.edu	37	8	100904266	100904266	+	Translation_Start_Site	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100904266G>C	uc003yiy.1	-	2	44	c.-16C>G	c.(-18--14)ATCAA>ATGAA			NM_004374	NP_004365	P09669	COX6C_HUMAN	cytochrome c oxidase subunit VIc proprotein						respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity		HMGA2/COX6C(2)	soft_tissue(2)	2			all cancers(13;8.32e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TACTGTCCTTGATACGTAtgc	0.279			T	HMGA2	uterine leiomyoma								28	73	---	---	---	---	PASS
GRHL2	79977	broad.mit.edu	37	8	102649155	102649155	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102649155G>T	uc010mbu.2	+	12	1846	c.1516G>T	c.(1516-1518)GGT>TGT	p.G506C		NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3	506						cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			TGAACGAGAAGGGTAAGACAC	0.423													5	158	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105459566	105459566	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105459566C>T	uc003yly.3	-	3	718	c.589G>A	c.(589-591)GAC>AAC	p.D197N		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	197					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCAATTAAGTCTCCATTTTCC	0.453													12	34	---	---	---	---	PASS
OXR1	55074	broad.mit.edu	37	8	107763046	107763046	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107763046G>A	uc011lht.1	+	16	2601	c.2502G>A	c.(2500-2502)GCG>GCA	p.A834A	OXR1_uc003ymf.2_Silent_p.A806A|OXR1_uc011lhu.1_Silent_p.A799A|OXR1_uc010mcg.2_RNA|OXR1_uc010mch.2_Silent_p.A462A|OXR1_uc003ymk.2_Silent_p.A203A|OXR1_uc003yml.2_Silent_p.A176A	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1	834	TLD.				cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GAGAATTTGCGCTTTGGCTTG	0.323													25	115	---	---	---	---	PASS
TTC35	9694	broad.mit.edu	37	8	109498889	109498889	+	3'UTR	SNP	A	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109498889A>G	uc003ymw.1	+	11						NM_014673	NP_055488	Q15006	TTC35_HUMAN	tetratricopeptide repeat domain 35							endoplasmic reticulum|nucleus	binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.34e-10)			TTGGCCTGTAACTTATTTACT	0.318													8	43	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113348981	113348981	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113348981G>A	uc003ynu.2	-	44	7078	c.6919C>T	c.(6919-6921)CAA>TAA	p.Q2307*	CSMD3_uc003yns.2_Nonsense_Mutation_p.Q1509*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.Q2267*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.Q2203*|CSMD3_uc003ynw.1_Nonsense_Mutation_p.Q18*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2307	Extracellular (Potential).|CUB 13.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAACAATCTTGAAAGTTTGGA	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			34	135	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121530149	121530149	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121530149C>T	uc003ypc.1	+	19	2350	c.2305C>T	c.(2305-2307)CAC>TAC	p.H769Y		NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53	769	Interaction with MDM2 (By similarity).				cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TAATAGTAATCACTATCATCA	0.393													25	79	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14776080	14776080	+	Missense_Mutation	SNP	C	T	T	rs61735747	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14776080C>T	uc003zlm.2	-	25	5154	c.4564G>A	c.(4564-4566)GTG>ATG	p.V1522M	FREM1_uc010mic.2_Intron|FREM1_uc003zlk.2_5'Flank|FREM1_uc003zll.2_Missense_Mutation_p.V58M	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1522	CSPG 11.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AGCAGGCCCACGGCCCCTTGG	0.617													27	67	---	---	---	---	PASS
HAUS6	54801	broad.mit.edu	37	9	19082988	19082988	+	Missense_Mutation	SNP	C	G	G	rs146901356		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082988C>G	uc003znk.2	-	8	1006	c.753G>C	c.(751-753)GAG>GAC	p.E251D	HAUS6_uc011lmz.1_Missense_Mutation_p.E6D|HAUS6_uc003znl.1_Missense_Mutation_p.E115D|HAUS6_uc003znm.1_Missense_Mutation_p.E6D	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	251					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						CAACTTCTCTCTCTTTTTCCA	0.353													19	36	---	---	---	---	PASS
KIF27	55582	broad.mit.edu	37	9	86457231	86457231	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86457231C>G	uc004ana.2	-	17	3786	c.3642G>C	c.(3640-3642)AAG>AAC	p.K1214N	KIF27_uc010mpw.2_Missense_Mutation_p.K1148N|KIF27_uc010mpx.2_Missense_Mutation_p.K1117N	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	1214	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						GGCTGGTTTTCTTATAGAAAT	0.368													23	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	90747487	90747487	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90747487G>C	uc011lti.1	-	4	494	c.465C>G	c.(463-465)GTC>GTG	p.V155V						SubName: Full=cDNA FLJ59639;																		CTAACGGGGAGACAATGGGAG	0.607													28	65	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104309797	104309797	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104309797G>A	uc004bbn.2	+	9	1179	c.1089G>A	c.(1087-1089)CTG>CTA	p.L363L		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	363	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		ATGAAAAGCTGAAGGTAGGAA	0.448													11	29	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107547853	107547853	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107547853C>G	uc004bcl.2	-	49	6782	c.6469G>C	c.(6469-6471)GAT>CAT	p.D2157H	NIPSNAP3B_uc004bcj.1_Intron	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	2157					Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCAAAGAAATCCTGGACAGGC	0.438													33	79	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119460323	119460323	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119460323G>A	uc004bjx.2	+	2	460	c.302G>A	c.(301-303)CGG>CAG	p.R101Q	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.R101Q	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	101					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						CTCATGTGTCGGTCCTGTGGG	0.597									Bardet-Biedl_syndrome				25	78	---	---	---	---	PASS
ST6GALNAC4	27090	broad.mit.edu	37	9	130678760	130678760	+	5'UTR	SNP	T	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130678760T>G	uc004bss.2	-	2					ST6GALNAC4_uc004bst.2_Intron	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a						glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						TGGGAAGGGGTGGGAGCCGGG	0.607													5	32	---	---	---	---	PASS
SET	6418	broad.mit.edu	37	9	131457050	131457050	+	3'UTR	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131457050C>G	uc004bvt.3	+	8					SET_uc004bvu.3_3'UTR|SET_uc010myg.2_RNA|SET_uc011mbj.1_3'UTR	NM_001122821	NP_001116293	Q01105	SET_HUMAN	SET translocation (myeloid leukemia-associated)						DNA replication|mRNA metabolic process|negative regulation of histone acetylation|negative regulation of neuron apoptosis|negative regulation of transcription, DNA-dependent|nucleocytoplasmic transport|nucleosome assembly|nucleosome disassembly	cytosol|endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm|protein complex	histone binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		CTCTTGTGCTCAGTCGCCCTG	0.393			T	NUP214	AML								4	18	---	---	---	---	PASS
FIBCD1	84929	broad.mit.edu	37	9	133780649	133780649	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133780649G>C	uc004bzz.2	-	6	1343	c.1098C>G	c.(1096-1098)CTC>CTG	p.L366L	FIBCD1_uc011mcc.1_Silent_p.L366L	NM_032843	NP_116232	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	366	Fibrinogen C-terminal.|Extracellular (Potential).				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding				0	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CAGCCACGGTGAGCGGGTACC	0.657													7	24	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3197793	3197793	+	Silent	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3197793G>T	uc010qah.1	-	13	1547	c.1515C>A	c.(1513-1515)ATC>ATA	p.I505I	PITRM1_uc001igr.1_Silent_p.I537I|PITRM1_uc001igt.1_Silent_p.I537I|PITRM1_uc009xhv.1_Silent_p.I102I|PITRM1_uc001igu.1_Silent_p.I529I|PITRM1_uc010qai.1_Silent_p.I508I|PITRM1_uc001igw.1_Silent_p.I537I			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	505					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						CTTTCTCGTAGATCTGCTGCC	0.557													4	72	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17277345	17277345	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17277345G>C	uc001iou.2	+	7	1599	c.1186G>C	c.(1186-1188)GAG>CAG	p.E396Q	VIM_uc001iov.1_Missense_Mutation_p.E396Q|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.E396Q|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.E354Q|VIM_uc001ipc.1_Missense_Mutation_p.E396Q	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	396	Rod.|Coil 2.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CCTTGACATTGAGATTGCCAC	0.458													14	56	---	---	---	---	PASS
NSUN6	221078	broad.mit.edu	37	10	18940239	18940239	+	5'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18940239G>A	uc010qcp.1	-	1						NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						ACCAGATGCTGAGGAAAATCT	0.448													10	17	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21117520	21117520	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21117520G>A	uc001iqi.2	-	17	2112	c.1715C>T	c.(1714-1716)TCT>TTT	p.S572F	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	572	Nebulin 16.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TGCTATGGTAGAATAGTTAGA	0.338													12	51	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27459817	27459817	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27459817G>A	uc001itm.2	+	8	2568	c.1929G>A	c.(1927-1929)CTG>CTA	p.L643L	MASTL_uc001itl.2_Silent_p.L643L|MASTL_uc009xkw.1_Silent_p.L643L|MASTL_uc009xkx.1_RNA	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine	643	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TGGAGGTGCTGAAAACGTTAG	0.398													28	84	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28273125	28273125	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28273125C>G	uc009xky.2	-	5	768	c.670G>C	c.(670-672)GAA>CAA	p.E224Q	ARMC4_uc010qds.1_5'Flank|ARMC4_uc010qdt.1_5'Flank|ARMC4_uc001itz.2_Missense_Mutation_p.E224Q|ARMC4_uc010qdu.1_5'Flank	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	224							binding			ovary(4)|skin(2)	6						GAGGTATATTCAATAGATTCC	0.328													10	164	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37478443	37478443	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37478443A>G	uc001iza.1	+	25	2401	c.2302A>G	c.(2302-2304)ACG>GCG	p.T768A		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	824						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ACCCAAGGCTACGCATCAAAA	0.289													3	53	---	---	---	---	PASS
ZNF485	220992	broad.mit.edu	37	10	44112076	44112076	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44112076G>A	uc010qfc.1	+	5	779	c.585G>A	c.(583-585)CTG>CTA	p.L195L	ZNF485_uc010qfd.1_Silent_p.L104L	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	195	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGAAGTTCCTGAAGAAGCACT	0.393													31	90	---	---	---	---	PASS
ARID5B	84159	broad.mit.edu	37	10	63852251	63852251	+	Missense_Mutation	SNP	G	A	A	rs137983907		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63852251G>A	uc001jlt.1	+	10	3055	c.3029G>A	c.(3028-3030)CGG>CAG	p.R1010Q		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1010					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					GGGGCGGCGCGGCCGATCAAG	0.567													23	77	---	---	---	---	PASS
AIFM2	84883	broad.mit.edu	37	10	71883680	71883680	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71883680C>A	uc010qjg.1	-	1	174	c.161G>T	c.(160-162)CGA>CTA	p.R54L	AIFM2_uc001jqp.1_Missense_Mutation_p.R54L	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like	54		FAD (Potential).			apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1						CACGGAGGCTCGGAGAGCAGC	0.607													3	21	---	---	---	---	PASS
SPOCK2	9806	broad.mit.edu	37	10	73826705	73826705	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73826705C>A	uc001jso.1	-	8	1328	c.883G>T	c.(883-885)GGC>TGC	p.G295C	SPOCK2_uc001jsp.2_Missense_Mutation_p.G295C	NM_014767	NP_055582	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	295					extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0						GAGACCCGGCCATCCTTGTAG	0.612													4	66	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75568098	75568098	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75568098G>A	uc001jvk.2	-	3	853	c.49C>T	c.(49-51)CAC>TAC	p.H17Y	NDST2_uc010qks.1_5'Flank|NDST2_uc010qkt.1_Intron|NDST2_uc009xro.2_5'Flank|NDST2_uc010qku.1_5'Flank	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	17	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					ATGAGGCGGTGCAGTTCCAGC	0.622													3	4	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92617282	92617282	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92617282C>G	uc001kha.2	-	1	390	c.147G>C	c.(145-147)CTG>CTC	p.L49L	HTR7_uc001kgz.2_Silent_p.L49L|HTR7_uc001khb.2_Silent_p.L49L	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	49	Extracellular (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	TCACCTCGCTCAGCAGGTGCG	0.701													6	11	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96162370	96162370	+	5'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96162370G>A	uc001kjr.2	+	1						NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CCCACCCCCAGATGGTGGGTC	0.697													4	22	---	---	---	---	PASS
ACTR1A	10121	broad.mit.edu	37	10	104262409	104262409	+	5'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104262409G>A	uc001kvv.2	-	1					SUFU_uc001kvw.1_5'Flank|SUFU_uc001kvx.2_5'Flank|SUFU_uc001kvy.1_5'Flank|ACTR1A_uc010qqn.1_5'UTR|ACTR1A_uc010qqo.1_5'UTR	NM_005736	NP_005727	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A,						G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding			central_nervous_system(1)	1		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CTCCATGGCAGAGGAATCTCT	0.612													6	16	---	---	---	---	PASS
CCDC147	159686	broad.mit.edu	37	10	106209909	106209909	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106209909C>G	uc001kyh.2	+	17	2591	c.2457C>G	c.(2455-2457)CTC>CTG	p.L819L		NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147	819	Potential.									ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CCAATGAGCTCCAGAATTTAA	0.328													53	127	---	---	---	---	PASS
ATE1	11101	broad.mit.edu	37	10	123673374	123673374	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123673374G>C	uc001lfp.2	-	4	350	c.268C>G	c.(268-270)CAC>GAC	p.H90D	ATE1_uc001lfq.2_Missense_Mutation_p.H90D|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_5'UTR|ATE1_uc010qtt.1_Missense_Mutation_p.H83D|ATE1_uc001lfr.2_5'UTR|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2	90					protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				ACCTTCTTGTGAGATTTTGAA	0.363													21	46	---	---	---	---	PASS
LDHC	3948	broad.mit.edu	37	11	18451306	18451306	+	Silent	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18451306C>A	uc001mon.3	+	4	379	c.267C>A	c.(265-267)TCC>TCA	p.S89S	LDHC_uc001mom.3_Silent_p.S89S|LDHC_uc009yhp.2_Silent_p.S89S|LDHC_uc001moo.3_5'UTR|LDHC_uc009yhq.2_Intron|LDHC_uc009yhr.2_5'UTR	NM_017448	NP_059144	P07864	LDHC_HUMAN	L-lactate dehydrogenase C	89					glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	CTGCAAACTCCAGAATAGTTA	0.398													4	80	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19955347	19955347	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19955347G>A	uc010rdm.1	+	8	1987	c.1626G>A	c.(1624-1626)GAG>GAA	p.E542E	NAV2_uc001mpp.2_Silent_p.E455E|NAV2_uc001mpr.3_Silent_p.E519E	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	542						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TCAAGGAGGAGCCAAAAGAAG	0.423													23	32	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681643	55681643	+	Missense_Mutation	SNP	C	G	G	rs12786096		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681643C>G	uc010rir.1	-	1	416	c.416G>C	c.(415-417)AGA>ACA	p.R139T		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ATAGCACACTCTGCTAGACAT	0.468													20	46	---	---	---	---	PASS
OR4D10	390197	broad.mit.edu	37	11	59245789	59245789	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245789C>G	uc001nnz.1	+	1	887	c.887C>G	c.(886-888)TCA>TGA	p.S296*		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						GAGATGAAGTCAGCCATGAGG	0.368													9	31	---	---	---	---	PASS
C11orf66	220004	broad.mit.edu	37	11	61254053	61254053	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61254053C>T	uc001nru.1	+	9	930	c.805C>T	c.(805-807)CGA>TGA	p.R269*	C11orf66_uc009ynq.1_Nonsense_Mutation_p.R249*	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN	IIIG9 protein	269										ovary(1)	1						AGCCTTCAGCCGAGGGAATGA	0.577													4	14	---	---	---	---	PASS
POLA2	23649	broad.mit.edu	37	11	65034149	65034149	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65034149C>T	uc001odj.2	+	2	518	c.176C>T	c.(175-177)TCA>TTA	p.S59L	POLA2_uc009yqf.1_Missense_Mutation_p.S59L|POLA2_uc010rod.1_Intron	NM_002689	NP_002680	Q14181	DPOA2_HUMAN	DNA-directed DNA polymerase alpha 2	59					DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)	GGCCTTACCTCAGAGATCCTG	0.383													18	25	---	---	---	---	PASS
FGF3	2248	broad.mit.edu	37	11	69625371	69625371	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69625371G>C	uc001oph.2	-	3	913	c.422C>G	c.(421-423)CCT>CGT	p.P141R		NM_005247	NP_005238	P11487	FGF3_HUMAN	fibroblast growth factor 3 precursor	141					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GCGGGCCCCAGGCGTACTAGA	0.657													14	9	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70507825	70507825	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70507825C>T	uc010rqn.1	-	1	99	c.48G>A	c.(46-48)ACG>ACA	p.T16T	SHANK2_uc001opz.2_Silent_p.T16T|SHANK2_uc001oqc.2_Intron|uc009ysn.1_Missense_Mutation_p.P88L|SHANK2_uc010rqp.1_Silent_p.T16T	NM_133266	NP_573573	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	Error:Variant_position_missing_in_Q9UPX8_after_alignment					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TATTGTAGCCCGTCATCATCA	0.542													28	96	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71185708	71185708	+	Intron	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71185708C>G	uc001oqn.2	+						NADSYN1_uc001oqm.2_RNA|NADSYN1_uc001oqo.2_Intron	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1						NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GCTCCTGGCTCTCCCCTGTAA	0.687													4	10	---	---	---	---	PASS
CLPB	81570	broad.mit.edu	37	11	72145375	72145375	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72145375C>G	uc001osj.2	-	1	194	c.144G>C	c.(142-144)CTG>CTC	p.L48L	CLPB_uc010rqx.1_5'UTR|CLPB_uc010rqy.1_Silent_p.L48L|CLPB_uc001osk.2_Silent_p.L48L|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_5'UTR	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B	48					cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						TGGCTACCCTCAGCCACTGCG	0.692											OREG0021194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	9	---	---	---	---	PASS
RAD52	5893	broad.mit.edu	37	12	1025522	1025522	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1025522C>G	uc001qis.1	-	9	967	c.853G>C	c.(853-855)GAG>CAG	p.E285Q	RAD52_uc001qit.1_RNA|RAD52_uc010sdt.1_Missense_Mutation_p.E208Q|RAD52_uc001qiu.1_Missense_Mutation_p.E285Q|RAD52_uc001qiv.1_RNA|RAD52_uc001qiw.1_RNA|RAD52_uc010sdu.1_Nonstop_Mutation_p.*302S	NM_134424	NP_602296	P43351	RAD52_HUMAN	RAD52 homolog	285					DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			TCACTCTTCTCAGCTGACGGC	0.428								Homologous_recombination					4	10	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8391338	8391338	+	RNA	SNP	T	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8391338T>C	uc010sgk.1	-	2		c.203A>G				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CACAGGATGCTTCACAGTCTA	0.527													3	25	---	---	---	---	PASS
ETV6	2120	broad.mit.edu	37	12	11803042	11803042	+	5'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11803042G>A	uc001qzz.2	+	1						NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				AGAACTTCCTGATCTCTCTCG	0.498			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								25	87	---	---	---	---	PASS
C12orf11	55726	broad.mit.edu	37	12	27067369	27067369	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27067369G>T	uc001rhk.3	-	12	1928	c.1391C>A	c.(1390-1392)TCA>TAA	p.S464*	C12orf11_uc001rhj.3_Intron|C12orf11_uc010sjk.1_Nonsense_Mutation_p.S363*	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN	hypothetical protein LOC55726	464					cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)					GGTGGTTTGTGAAATGATCAT	0.343													27	101	---	---	---	---	PASS
ARNTL2	56938	broad.mit.edu	37	12	27573406	27573406	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27573406G>T	uc001rht.1	+	17	1870	c.1852G>T	c.(1852-1854)GAA>TAA	p.E618*	ARNTL2_uc001rhw.2_Nonsense_Mutation_p.E581*|ARNTL2_uc010sjp.1_3'UTR|ARNTL2_uc001rhu.1_Nonsense_Mutation_p.E604*|ARNTL2_uc009zji.1_Nonsense_Mutation_p.E584*|ARNTL2_uc001rhv.1_Nonsense_Mutation_p.E570*|uc001rhx.2_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	618					circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					GAATTACTTAGAAGCAGAGGG	0.448													19	130	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30833508	30833508	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30833508G>A	uc001rjd.2	-	5	717	c.547C>T	c.(547-549)CAG>TAG	p.Q183*		NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	183					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATTTGTTGCTGAATACGAGGC	0.343													71	140	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32137616	32137616	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32137616G>A	uc001rks.2	+	4	4141	c.3727G>A	c.(3727-3729)GAT>AAT	p.D1243N	C12orf35_uc001rkt.2_5'Flank	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	1243										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			GACTCCTCCAGATGGGAAAAG	0.368													25	57	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46318566	46318566	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46318566G>T	uc001rox.2	-	12	4138	c.3851C>A	c.(3850-3852)CCA>CAA	p.P1284Q	SFRS2IP_uc001row.2_Missense_Mutation_p.P969Q	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1284	Pro-rich.				spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTGGGATGGTGGGGGAGGGGG	0.488													4	74	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49230568	49230568	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49230568G>A	uc001rsm.2	-	10	1111	c.1020C>T	c.(1018-1020)CTC>CTT	p.L340L		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	340						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						GAAGTTTGCGGAGTCTTGCCC	0.537													110	285	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49722719	49722719	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49722719G>A	uc001rtx.3	+	9	1068	c.901G>A	c.(901-903)GAC>AAC	p.D301N	TROAP_uc009zlh.2_Missense_Mutation_p.D301N|TROAP_uc001rty.2_Missense_Mutation_p.D9N	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	301					cell adhesion	cytoplasm				ovary(1)	1						GGACAGCCATGACTCCCACCT	0.468													20	49	---	---	---	---	PASS
GALNT6	11226	broad.mit.edu	37	12	51759233	51759233	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51759233G>A	uc001ryk.2	-	4	1020	c.795C>T	c.(793-795)CTC>CTT	p.L265L	GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Silent_p.L265L	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	265	Catalytic subdomain A.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						CCAGGAACGTGAGCACCTCCG	0.677													13	29	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52163723	52163723	+	Silent	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52163723G>T	uc001ryw.2	+	18	3622	c.3444G>T	c.(3442-3444)GTG>GTT	p.V1148V	SCN8A_uc010snl.1_Silent_p.V1013V	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1148					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	AGGTCCCTGTGGAACAGCCTG	0.512													3	13	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57595667	57595667	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57595667G>C	uc001snd.2	+	67	11039	c.10573G>C	c.(10573-10575)GAT>CAT	p.D3525H		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3525	Extracellular (Potential).|LDL-receptor class A 25.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGATGGCTCGGATGAGCCCAA	0.632													14	49	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57603500	57603500	+	Missense_Mutation	SNP	C	A	A	rs113975567		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57603500C>A	uc001snd.2	+	80	12754	c.12288C>A	c.(12286-12288)GAC>GAA	p.D4096E		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	4096	LDL-receptor class B 34.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCAGCATCGACGTCTTTGAGG	0.567													3	50	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72291701	72291701	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72291701G>A	uc001swu.2	+	11	1289	c.1280G>A	c.(1279-1281)AGA>AAA	p.R427K	TBC1D15_uc009zrv.2_Missense_Mutation_p.R289K|TBC1D15_uc010stt.1_Missense_Mutation_p.R396K|TBC1D15_uc001swv.2_Missense_Mutation_p.R410K|TBC1D15_uc001sww.2_Missense_Mutation_p.R159K	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	405	Rab-GAP TBC.						protein binding|Rab GTPase activator activity				0						TCGAGGTTAAGAGATTATAGA	0.333													28	71	---	---	---	---	PASS
ISCU	23479	broad.mit.edu	37	12	108958094	108958094	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108958094C>A	uc010sxc.1	+	2	259	c.154C>A	c.(154-156)CTT>ATT	p.L52I	SART3_uc001tmz.1_5'Flank|SART3_uc009zux.1_5'Flank|SART3_uc010swx.1_5'Flank|SART3_uc010swz.1_5'Flank|SART3_uc001tna.1_5'Flank|SART3_uc001tnb.2_5'Flank|ISCU_uc010sxa.1_Missense_Mutation_p.L52I|ISCU_uc010sxb.1_Missense_Mutation_p.L52I|ISCU_uc001tnc.3_Missense_Mutation_p.L27I|ISCU_uc009zuy.2_Missense_Mutation_p.L27I|ISCU_uc010sxd.1_Missense_Mutation_p.L52I	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform	52					iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						CGTGGGGTCCCTTGACAAGAC	0.403													4	76	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109654665	109654665	+	Silent	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109654665G>T	uc001tob.2	+	24	3623	c.3504G>T	c.(3502-3504)CTG>CTT	p.L1168L	ACACB_uc001toc.2_Silent_p.L1168L	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1168					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CCCAGGTGCTGGACTGCATCT	0.542													4	53	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109876422	109876422	+	5'Flank	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109876422G>A	uc010sxo.1	+						MYO1H_uc010sxn.1_Missense_Mutation_p.R748K			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						CGGATTATCAGAAAGTAAGTT	0.502													5	10	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112664513	112664513	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112664513C>G	uc009zwc.2	-	37	5656	c.5638G>C	c.(5638-5640)GAA>CAA	p.E1880Q	C12orf51_uc001ttr.1_Missense_Mutation_p.E55Q	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TGTATGAATTCTTCACAAAAT	0.398													12	26	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120652697	120652697	+	Silent	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120652697G>T	uc001txt.2	-	9	1340	c.1209C>A	c.(1207-1209)CCC>CCA	p.P403P	PXN_uc001txu.2_Silent_p.P215P|PXN_uc001txv.2_Silent_p.P284P|PXN_uc001txx.2_Silent_p.P236P|PXN_uc001txy.2_Silent_p.P369P|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	403	LIM zinc-binding 1.				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTCACAGTAGGGCTGTCCAT	0.617													4	44	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121654786	121654786	+	Intron	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121654786G>C	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Missense_Mutation_p.E55Q|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ggcagaagtggaaatggagtc	0.129													8	12	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121654802	121654802	+	Intron	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121654802G>A	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Missense_Mutation_p.R60K|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					gagtcccctagaaggtacgta	0.154													12	21	---	---	---	---	PASS
IFT88	8100	broad.mit.edu	37	13	21157156	21157156	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21157156C>T	uc001unh.2	+	5	574	c.178C>T	c.(178-180)CCA>TCA	p.P60S	IFT88_uc001uni.2_Missense_Mutation_p.P51S|IFT88_uc001unj.2_Missense_Mutation_p.P50S|IFT88_uc010tcq.1_Missense_Mutation_p.P50S	NM_175605	NP_783195	Q13099	IFT88_HUMAN	intraflagellar transport 88 homolog isoform 1	60					cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		CAGAAGACCTCCAGTAAGTGA	0.219													20	68	---	---	---	---	PASS
EBPL	84650	broad.mit.edu	37	13	50235171	50235171	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50235171C>A	uc001vdg.2	-	4	617	c.554G>T	c.(553-555)TGG>TTG	p.W185L	EBPL_uc001vdh.2_RNA|EBPL_uc001vdi.2_3'UTR	NM_032565	NP_115954	Q9BY08	EBPL_HUMAN	emopamil binding related protein, delta8-delta7	185	Helical; (Potential).				sterol metabolic process	endoplasmic reticulum membrane|integral to membrane	cholestenol delta-isomerase activity				0		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		CCATGACTGCCACAGTAGCAG	0.428													4	71	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96513055	96513055	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96513055C>T	uc001vmt.2	-	32	3897	c.3727G>A	c.(3727-3729)GAA>AAA	p.E1243K		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1243	Glucosyltransferase.				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						AAAAAACGTTCATATAAATGA	0.254													13	65	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113532599	113532599	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113532599G>C	uc001vsi.3	+	29	3484	c.3396G>C	c.(3394-3396)CTG>CTC	p.L1132L	ATP11A_uc001vsj.3_Intron|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	1132	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CCAGCAGCCTGAGTTTCTGAT	0.572													17	47	---	---	---	---	PASS
TRAPPC6B	122553	broad.mit.edu	37	14	39627491	39627491	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39627491G>A	uc001wut.1	-	3	600	c.265C>T	c.(265-267)CAG>TAG	p.Q89*	TRAPPC6B_uc001wuu.1_Nonsense_Mutation_p.Q89*|TRAPPC6B_uc001wuv.1_RNA|TRAPPC6B_uc010tqd.1_Intron	NM_001079537	NP_001073005	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B isoform	89					vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		TTAATTACCTGATGATTTGTC	0.274													7	42	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39783995	39783995	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39783995C>T	uc001wvg.3	+	15	1684	c.1348C>T	c.(1348-1350)CAA>TAA	p.Q450*	CTAGE5_uc010tqe.1_Nonsense_Mutation_p.Q412*|CTAGE5_uc001wuz.3_Nonsense_Mutation_p.Q438*|CTAGE5_uc001wuy.3_Nonsense_Mutation_p.Q370*|CTAGE5_uc001wvb.3_Nonsense_Mutation_p.Q421*|CTAGE5_uc001wvc.3_Nonsense_Mutation_p.Q395*|CTAGE5_uc001wva.3_Nonsense_Mutation_p.Q421*|CTAGE5_uc001wvh.3_Nonsense_Mutation_p.Q450*|CTAGE5_uc001wvf.3_Nonsense_Mutation_p.Q375*|CTAGE5_uc001wvi.3_Nonsense_Mutation_p.Q455*|CTAGE5_uc010amz.2_Nonsense_Mutation_p.Q66*|CTAGE5_uc001wvj.3_Nonsense_Mutation_p.Q421*	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	450	Potential.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCATTCTTATCAAGGGCAGGT	0.229													19	53	---	---	---	---	PASS
PPIL5	122769	broad.mit.edu	37	14	50074213	50074213	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50074213G>A	uc001wwn.2	+	3	702	c.378G>A	c.(376-378)GTG>GTA	p.V126V	SDCCAG1_uc010anj.1_Intron|PPIL5_uc001wwo.2_Intron|PPIL5_uc010ank.2_Silent_p.V67V|PPIL5_uc001wwp.2_RNA	NM_152329	NP_689542	Q96L50	LLR1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 5	126											0	all_epithelial(31;0.0021)|Breast(41;0.0124)					TCACACCAGTGAAGACTTCAG	0.368													31	95	---	---	---	---	PASS
SDCCAG1	9147	broad.mit.edu	37	14	50255908	50255908	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50255908G>A	uc001wxc.2	-	28	2919	c.2851C>T	c.(2851-2853)CAT>TAT	p.H951Y	SDCCAG1_uc010anj.1_Missense_Mutation_p.H951Y|SDCCAG1_uc001wwz.2_Missense_Mutation_p.H151Y|SDCCAG1_uc001wxa.2_Missense_Mutation_p.H231Y|SDCCAG1_uc010tqi.1_Missense_Mutation_p.H930Y|SDCCAG1_uc001wxe.2_Missense_Mutation_p.H909Y	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	951						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		TGTAACTCATGAGTTATAACC	0.428													53	169	---	---	---	---	PASS
C14orf182	283551	broad.mit.edu	37	14	50472344	50472344	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50472344G>C	uc001wxi.1	-	1	1895	c.174C>G	c.(172-174)CTC>CTG	p.L58L		NM_001012706	NP_001012724	A1A4T8	CN182_HUMAN	hypothetical protein LOC283551	58											0						CCCCGCTACTGAGTGGCAAGA	0.522													42	151	---	---	---	---	PASS
ESR2	2100	broad.mit.edu	37	14	64727309	64727309	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64727309G>A	uc001xha.1	-	5	1278	c.810C>T	c.(808-810)CTC>CTT	p.L270L	ESR2_uc001xgu.2_Silent_p.L270L|ESR2_uc001xgv.2_Silent_p.L270L|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Silent_p.L270L|ESR2_uc001xgy.1_Silent_p.L270L|ESR2_uc001xgz.1_Silent_p.L270L|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_Silent_p.L270L|ESR2_uc010aqd.1_RNA	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	270	Steroid-binding.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CCAGGAGGGTGAGCACTAGCT	0.677													21	30	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65194411	65194411	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65194411C>G	uc001xho.1	+	2	331	c.62C>G	c.(61-63)TCT>TGT	p.S21C	PLEKHG3_uc001xhn.1_Missense_Mutation_p.S21C|PLEKHG3_uc001xhp.2_Missense_Mutation_p.S21C|PLEKHG3_uc010aqh.1_5'Flank	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	21	Ser-rich.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		AGCCTGACCTCTACCACCTCC	0.667													3	10	---	---	---	---	PASS
ADAM21P1	145241	broad.mit.edu	37	14	70713661	70713661	+	Silent	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70713661G>T	uc010ttg.1	-	1	858	c.207C>A	c.(205-207)GTC>GTA	p.V69V		NR_003951				SubName: Full=ADAM21-like protein;												0						CCACTATGTTGACAACAAGAA	0.368													31	97	---	---	---	---	PASS
ZDHHC22	283576	broad.mit.edu	37	14	77605820	77605820	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77605820G>C	uc010asp.2	-	2	465	c.262C>G	c.(262-264)CCA>GCA	p.P88A		NM_174976	NP_777636	Q8N966	ZDH22_HUMAN	zinc finger, DHHC domain containing 22	88	DHHC-type.					integral to membrane	acyltransferase activity|zinc ion binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		GAGGGGCATGGAGTCTTCCTG	0.627													5	9	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89168814	89168814	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89168814C>G	uc001xxg.2	-	15	2400	c.2214G>C	c.(2212-2214)TTG>TTC	p.L738F	EML5_uc001xxh.1_5'UTR	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	738	WD 11.					cytoplasm|microtubule				ovary(3)	3						CGTAGTCTTTCAAAGGATGAA	0.388													7	53	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92088132	92088132	+	Missense_Mutation	SNP	G	C	C	rs143009010		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92088132G>C	uc001xzs.1	-	19	2220	c.2080C>G	c.(2080-2082)CTA>GTA	p.L694V	CATSPERB_uc010aub.1_Missense_Mutation_p.L216V	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	694					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				GTGCTCTTTAGAAAGGTCATA	0.383													51	137	---	---	---	---	PASS
C14orf48	256369	broad.mit.edu	37	14	94464544	94464544	+	5'UTR	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94464544C>G	uc001ycg.1	+	2					C14orf48_uc001ycf.2_RNA|C14orf48_uc010twp.1_RNA	NR_024184				Homo sapiens cDNA FLJ40422 fis, clone TESTI2038858.												0				Epithelial(152;0.114)|all cancers(159;0.191)|COAD - Colon adenocarcinoma(157;0.208)		AGGGGACCTTCAAGGGCTGTG	0.512													17	20	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96752292	96752292	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96752292C>T	uc001yfi.2	-	42	6402	c.6037G>A	c.(6037-6039)GAA>AAA	p.E2013K		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	2013										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GCCGCAGTTTCATAAATGGTC	0.557													6	16	---	---	---	---	PASS
EVL	51466	broad.mit.edu	37	14	100607527	100607527	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100607527G>A	uc001ygt.2	+	12	1338	c.1099G>A	c.(1099-1101)GCT>ACT	p.A367T	EVL_uc001ygu.2_Missense_Mutation_p.A369T|EVL_uc010avu.2_Missense_Mutation_p.A226T|EVL_uc001ygw.1_5'Flank	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like	367	EVH2.				actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				GATGAAGCCTGCTGGGAGCGT	0.647													7	38	---	---	---	---	PASS
SNORD114-12	767590	broad.mit.edu	37	14	101434481	101434481	+	5'Flank	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101434481C>T	uc001yjc.2	+						SNORD114-11_uc001yjb.2_RNA|SNORD114-13_uc001yjd.2_5'Flank	NR_003205				Homo sapiens small nucleolar RNA, C/D box 114-12 (SNORD114-12), non-coding RNA.												0						GTGTGTGAGTCATGCACAGTG	0.413													8	18	---	---	---	---	PASS
MIR410	574434	broad.mit.edu	37	14	101532269	101532269	+	RNA	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101532269C>A	hsa-mir-410|MI0002465	+			c.21C>A			MIR656_hsa-mir-656|MI0003678_5'Flank																	0						AAGAGGTTGTCTGTGATGAGT	0.607													4	47	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102442048	102442048	+	Splice_Site	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102442048G>C	uc001yks.2	+	2	421	c.257_splice	c.e2-1	p.E86_splice		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ATGATTTGTAGAGGACGTCGG	0.323													3	76	---	---	---	---	PASS
INF2	64423	broad.mit.edu	37	14	105181636	105181636	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105181636C>T	uc001ypb.2	+	22	3853	c.3710C>T	c.(3709-3711)TCT>TTT	p.S1237F	INF2_uc010tyi.1_Missense_Mutation_p.S1237F|INF2_uc001ypc.2_Intron|INF2_uc010awz.1_RNA	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1	1237					actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CCCCCTGATTCTGATGATAAT	0.557													48	132	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105410194	105410194	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105410194C>T	uc010axc.1	-	7	11714	c.11594G>A	c.(11593-11595)CGC>CAC	p.R3865H	AHNAK2_uc001ypx.2_Missense_Mutation_p.R3765H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3865						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCCACCTGGCGAGCTTGGAC	0.607													63	154	---	---	---	---	PASS
CYFIP1	23191	broad.mit.edu	37	15	22933811	22933811	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22933811C>T	uc001yus.2	+	8	834	c.730C>T	c.(730-732)CTG>TTG	p.L244L	CYFIP1_uc001yut.2_Silent_p.L244L|CYFIP1_uc010aya.1_Silent_p.L272L	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform	244					axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TATTGTGAATCTGTGTGTGGA	0.522													33	148	---	---	---	---	PASS
HERC2P2	400322	broad.mit.edu	37	15	23313237	23313237	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23313237G>A	uc001yvr.2	-	18	2702	c.2502C>T	c.(2500-2502)ATC>ATT	p.I834I	HERC2P2_uc010ayf.1_RNA|HERC2P2_uc001yvq.2_5'Flank|HERC2P2_uc001yvo.3_5'Flank|HERC2P2_uc001yvp.3_RNA					RecName: Full=Putative HERC2-like protein 3;												0						GCGTGAGAGCGATGCTCTGCA	0.612													4	10	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25322274	25322274	+	Intron	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25322274C>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-12_uc001yxv.1_RNA|SNORD116-13_uc001yxw.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCATCATCCTCATTGAACTGA	0.433													18	72	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29393870	29393870	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29393870G>A	uc001zck.2	+	9	1614	c.1407G>A	c.(1405-1407)CTG>CTA	p.L469L	APBA2_uc010azj.2_Silent_p.L457L|APBA2_uc010uat.1_Silent_p.L457L|APBA2_uc001zcl.2_Silent_p.L457L|APBA2_uc001zcm.1_Silent_p.L161L	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	469	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		TTGTAGTGCTGATGGCCAGAC	0.592													4	18	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34047305	34047305	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34047305G>C	uc001zhi.2	+	58	8509	c.8439G>C	c.(8437-8439)GAG>GAC	p.E2813D	RYR3_uc010bar.2_Missense_Mutation_p.E2813D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2813	4.|Cytoplasmic (By similarity).|4 X approximate repeats.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTCCATGGAGAAGAGGTTTG	0.443													4	20	---	---	---	---	PASS
C15orf57	90416	broad.mit.edu	37	15	40856969	40856969	+	Intron	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40856969G>A	uc001zmc.1	-						C15orf57_uc001zly.2_Intron|C15orf57_uc001zma.1_Missense_Mutation_p.S4F|C15orf57_uc001zmb.1_Intron|C15orf57_uc010bbr.2_Intron	NM_001080792	NP_001074261	Q9BV29	CO057_HUMAN	coiled-coil domain containing 32 isoform a											ovary(1)	1						GCTCACACCAGAGCCCCGCAT	0.592													10	34	---	---	---	---	PASS
CATSPER2	117155	broad.mit.edu	37	15	43932621	43932621	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43932621C>T	uc001zsh.2	-	5	677	c.462G>A	c.(460-462)TTG>TTA	p.L154L	CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Silent_p.L154L|CATSPER2_uc001zsj.2_Silent_p.L154L|CATSPER2_uc001zsk.2_Silent_p.L154L	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2	154	Helical; Name=Segment S2; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TGAAAATAAGCAAGATAAACC	0.418													43	97	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50152570	50152570	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50152570G>A	uc001zxu.2	-	28	3542	c.3400C>T	c.(3400-3402)CAC>TAC	p.H1134Y	ATP8B4_uc010ber.2_Missense_Mutation_p.H1007Y|ATP8B4_uc010ufd.1_Missense_Mutation_p.H944Y|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Missense_Mutation_p.H137Y	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	1134	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCTTCTTGGTGAGCAAAAGCA	0.507													50	115	---	---	---	---	PASS
TCF12	6938	broad.mit.edu	37	15	57565418	57565418	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57565418C>G	uc002aec.2	+	18	2148	c.1864C>G	c.(1864-1866)CAA>GAA	p.Q622E	TCF12_uc010ugm.1_Missense_Mutation_p.Q674E|TCF12_uc010ugn.1_Missense_Mutation_p.Q642E|TCF12_uc002aea.2_Missense_Mutation_p.Q646E|TCF12_uc010bfs.2_Missense_Mutation_p.Q43E|TCF12_uc002aeb.2_Missense_Mutation_p.Q646E|TCF12_uc002aed.2_Missense_Mutation_p.Q622E|TCF12_uc002aee.2_Missense_Mutation_p.Q452E|TCF12_uc010bft.2_Missense_Mutation_p.Q476E|TCF12_uc010ugo.1_Missense_Mutation_p.Q386E|TCF12_uc010ugp.1_Missense_Mutation_p.Q279E|TCF12_uc010ugq.1_Missense_Mutation_p.Q256E|TCF12_uc010ugr.1_Missense_Mutation_p.Q235E	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b	622	Helix-loop-helix motif.				immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TATTCTTCATCAAGCCGTGGC	0.448			T	TEC	extraskeletal myxoid chondrosarcoma								11	40	---	---	---	---	PASS
FAM96A	84191	broad.mit.edu	37	15	64385901	64385901	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64385901C>T	uc002amt.1	-	1	307	c.67G>A	c.(67-69)GAG>AAG	p.E23K	FAM96A_uc002amu.1_Missense_Mutation_p.E23K|FAM96A_uc010uin.1_Missense_Mutation_p.E23K|SNX1_uc010bgv.2_5'Flank|SNX1_uc010uio.1_5'Flank|SNX1_uc002amv.2_5'Flank|SNX1_uc002amw.2_5'Flank|SNX1_uc002amx.2_5'Flank|SNX1_uc002amy.2_5'Flank|SNX1_uc010bgw.2_5'Flank	NM_032231	NP_115607	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A	23					chromosome segregation						0						GCTCCCGGCTCAGAGAGGCCG	0.582													8	27	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68620499	68620499	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68620499C>A	uc002ari.2	-	16	2090	c.2003G>T	c.(2002-2004)TGC>TTC	p.C668F	ITGA11_uc010bib.2_Missense_Mutation_p.C668F	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	668	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	GGCGGCCAGGCAGGTGGCATC	0.577													6	38	---	---	---	---	PASS
RNPS1	10921	broad.mit.edu	37	16	2312402	2312402	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2312402C>T	uc002cpt.2	-	6	1099	c.553G>A	c.(553-555)GGG>AGG	p.G185R	RNPS1_uc002cpu.2_Missense_Mutation_p.G185R|RNPS1_uc002cpv.2_Missense_Mutation_p.G8R|RNPS1_uc002cpw.2_Missense_Mutation_p.G185R|RNPS1_uc002cpx.2_Missense_Mutation_p.G162R|RNPS1_uc010uwa.1_RNA	NM_080594	NP_542161	Q15287	RNPS1_HUMAN	RNA-binding protein S1, serine-rich domain	185	Necessary for interaction with PNN and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|RRM.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|termination of RNA polymerase II transcription	cytosol|nuclear speck	mRNA 3'-UTR binding|nucleotide binding|protein binding			ovary(1)	1						TTAATTTTCCCATAGGTGGAA	0.488													23	50	---	---	---	---	PASS
ZNF205	7755	broad.mit.edu	37	16	3170223	3170223	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3170223G>A	uc002cub.2	+	7	1697	c.1562G>A	c.(1561-1563)CGG>CAG	p.R521Q	ZNF205_uc002cua.2_Missense_Mutation_p.R521Q	NM_001042428	NP_001035893	O95201	ZN205_HUMAN	zinc finger protein 205	521	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						AACCTGCACCGGCACGAGAAG	0.632													9	22	---	---	---	---	PASS
CLUAP1	23059	broad.mit.edu	37	16	3569975	3569975	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3569975G>A	uc002cvk.1	+	7	757	c.652G>A	c.(652-654)GAA>AAA	p.E218K	CLUAP1_uc002cvj.1_Missense_Mutation_p.E218K|CLUAP1_uc002cvl.1_Missense_Mutation_p.E218K|CLUAP1_uc002cvm.1_Missense_Mutation_p.E52K	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	218	Potential.					nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						AGCCAAAATCGAAAAGAGAAA	0.383													40	147	---	---	---	---	PASS
COQ7	10229	broad.mit.edu	37	16	19085285	19085285	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19085285G>T	uc002dfr.2	+	3	355	c.295G>T	c.(295-297)GAG>TAG	p.E99*	COQ7_uc002dfs.2_Nonsense_Mutation_p.E85*	NM_016138	NP_057222	Q99807	COQ7_HUMAN	COQ7 protein	99	1.|2 X approximate tandem repeats.				ubiquinone biosynthetic process	mitochondrial inner membrane|nucleus	oxidoreductase activity|transition metal ion binding			skin(1)	1						AAAGTTCAATGAGTTGATGGT	0.453													3	37	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19621680	19621680	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19621680G>A	uc002dgn.1	+	12	978	c.966G>A	c.(964-966)ATG>ATA	p.M322I	C16orf62_uc002dgo.1_Missense_Mutation_p.M322I|C16orf62_uc002dgp.1_Missense_Mutation_p.M71I|C16orf62_uc010vas.1_Missense_Mutation_p.M196I|C16orf62_uc002dgm.1_Missense_Mutation_p.M322I	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	322						integral to membrane				ovary(1)	1						TGACATGCATGATCAGAGGGA	0.547													5	17	---	---	---	---	PASS
CTF1	1489	broad.mit.edu	37	16	30910757	30910757	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30910757C>G	uc002dzw.2	+	2	84	c.47C>G	c.(46-48)TCA>TGA	p.S16*	CTF1_uc002dzx.2_Nonsense_Mutation_p.S15*	NM_001330	NP_001321	Q16619	CTF1_HUMAN	cardiotrophin 1 isoform 1	16					cell proliferation|cell-cell signaling|muscle organ development|positive regulation of cell proliferation	extracellular space	cytokine activity|leukemia inhibitory factor receptor binding				0			Colorectal(24;0.198)			ACTGATTCCTCAGTCTCACTT	0.562													21	52	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57063929	57063929	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57063929G>A	uc002ekk.1	+	10	2575	c.2350G>A	c.(2350-2352)GTG>ATG	p.V784M	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.V533M|NLRC5_uc002ekl.2_Missense_Mutation_p.V589M|NLRC5_uc002ekm.2_Missense_Mutation_p.V589M|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	784	LRR 4.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				CAGCATCTGCGTGTCAACCCT	0.577													20	58	---	---	---	---	PASS
DOK4	55715	broad.mit.edu	37	16	57508776	57508776	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57508776G>A	uc010cdb.2	-	5	826	c.528C>T	c.(526-528)CTC>CTT	p.L176L	DOK4_uc002elu.1_Silent_p.L176L|DOK4_uc002elv.3_Silent_p.L176L	NM_018110	NP_060580	Q8TEW6	DOK4_HUMAN	docking protein 4	176	IRS-type PTB.						insulin receptor binding			skin(1)	1						GCCACGAGACGAGCTTCACAC	0.637													11	30	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57757006	57757006	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57757006G>A	uc002emi.2	+	11	1590	c.1501G>A	c.(1501-1503)GAC>AAC	p.D501N	CCDC135_uc002emj.2_Missense_Mutation_p.D501N|CCDC135_uc002emk.2_Missense_Mutation_p.D436N	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	501						cytoplasm				central_nervous_system(1)	1						CCTGAAGACAGACTACTTCAA	0.577													31	75	---	---	---	---	PASS
CCDC113	29070	broad.mit.edu	37	16	58292407	58292407	+	Missense_Mutation	SNP	G	A	A	rs151051990		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58292407G>A	uc002ene.2	+	4	605	c.526G>A	c.(526-528)GAG>AAG	p.E176K	CCDC113_uc010vid.1_Missense_Mutation_p.E122K	NM_014157	NP_054876	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113 isoform 1	176	Potential.					protein complex					0						GAAATACATTGAGGACATGAA	0.408													13	61	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72992824	72992824	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72992824G>A	uc002fck.2	-	2	1894	c.1221C>T	c.(1219-1221)ACC>ACT	p.T407T	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	407					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GTACCGAGCTGGTGAGCCCGC	0.657													40	106	---	---	---	---	PASS
CDYL2	124359	broad.mit.edu	37	16	80666970	80666970	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80666970G>T	uc002ffs.2	-	3	885	c.780C>A	c.(778-780)TTC>TTA	p.F260L		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	260						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GGATGTGCGTGAACCCTTCTT	0.552													31	85	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2202737	2202737	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202737C>A	uc002fub.1	-	2	1365	c.1310G>T	c.(1309-1311)GGA>GTA	p.G437V	SMG6_uc002fud.1_Missense_Mutation_p.G406V	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	437	Interaction with telomeric DNA.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						ACTACCAGATCCAAACAAAAG	0.542													42	78	---	---	---	---	PASS
SRR	63826	broad.mit.edu	37	17	2222174	2222174	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2222174C>G	uc002fue.1	+	4	418	c.350C>G	c.(349-351)GCA>GGA	p.A117G	SRR_uc002fui.1_5'UTR	NM_021947	NP_068766	Q9GZT4	SRR_HUMAN	serine racemase	117					D-serine biosynthetic process|L-serine metabolic process|protein homotetramerization|pyruvate biosynthetic process|response to lipopolysaccharide	cytoplasm|neuronal cell body|soluble fraction	ATP binding|calcium ion binding|D-serine ammonia-lyase activity|glycine binding|L-serine ammonia-lyase activity|magnesium ion binding|PDZ domain binding|protein homodimerization activity|pyridoxal phosphate binding|serine racemase activity|threonine racemase activity				0		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	AAAAAACTTGCAATACAAGCC	0.438													57	95	---	---	---	---	PASS
TRPV1	7442	broad.mit.edu	37	17	3494637	3494637	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3494637G>A	uc010vrr.1	-	2	822	c.295C>T	c.(295-297)CAG>TAG	p.Q99*	TRPV1_uc010vro.1_Nonsense_Mutation_p.Q99*|TRPV1_uc010vrp.1_Nonsense_Mutation_p.Q99*|TRPV1_uc010vrq.1_Silent_p.P73P|TRPV1_uc010vrs.1_Nonsense_Mutation_p.Q99*|TRPV1_uc010vrt.1_Nonsense_Mutation_p.Q99*|TRPV1_uc010vru.1_Nonsense_Mutation_p.Q99*	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,	99	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	ACAGAGTCCTGGGACAGCAGC	0.582													10	12	---	---	---	---	PASS
ASGR1	432	broad.mit.edu	37	17	7080605	7080605	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7080605G>A	uc002ges.3	-	3	521	c.111C>T	c.(109-111)TCC>TCT	p.S37S	ASGR1_uc010clx.1_5'Flank	NM_001671	NP_001662	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	37	Cytoplasmic (Probable).				receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2						GGCGAGGTCCGGAGCAGAGAC	0.682											OREG0024128	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	27	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	T	T	rs112431538		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577085C>T	uc002gim.2	-	8	1047	c.853G>A	c.(853-855)GAG>AAG	p.E285K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	285	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCTCTTCCTCTGTGCGCCGG	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			14	24	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578188C>A	uc002gim.2	-	6	855	c.661G>T	c.(661-663)GAG>TAG	p.E221*	TP53_uc002gig.1_Nonsense_Mutation_p.E221*|TP53_uc002gih.2_Nonsense_Mutation_p.E221*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E89*|TP53_uc010cng.1_Nonsense_Mutation_p.E89*|TP53_uc002gii.1_Nonsense_Mutation_p.E89*|TP53_uc010cnh.1_Nonsense_Mutation_p.E221*|TP53_uc010cni.1_Nonsense_Mutation_p.E221*|TP53_uc002gij.2_Nonsense_Mutation_p.E221*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.E128*|TP53_uc002gio.2_Nonsense_Mutation_p.E89*|TP53_uc010vug.1_Nonsense_Mutation_p.E182*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	221	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.E221*(5)|p.E221fs*4(3)|p.E221G(2)|p.E221K(2)|p.E221D(2)|p.E221fs*26(2)|p.E221E(2)|p.Y220_P223delYEPP(1)|p.?(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCAGGCGGCTCATAGGGCACC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	15	---	---	---	---	PASS
C17orf59	54785	broad.mit.edu	37	17	8092491	8092491	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8092491G>T	uc010vut.1	-	1	1074	c.968C>A	c.(967-969)GCG>GAG	p.A323E		NM_017622	NP_060092	Q96GS4	CQ059_HUMAN	hypothetical protein LOC54785	323											0						CTCGCAGCGCGCCAGCAGGGT	0.647													3	35	---	---	---	---	PASS
MED24	9862	broad.mit.edu	37	17	38187864	38187864	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38187864C>G	uc002htt.2	-	11	1307	c.994G>C	c.(994-996)GAG>CAG	p.E332Q	MED24_uc010wes.1_Missense_Mutation_p.E192Q|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Missense_Mutation_p.E357Q|MED24_uc002htu.2_Missense_Mutation_p.E319Q|MED24_uc010cwn.2_Missense_Mutation_p.E319Q|MED24_uc010weu.1_Missense_Mutation_p.E242Q|MED24_uc010wev.1_Missense_Mutation_p.E282Q|MED24_uc010wew.1_Missense_Mutation_p.E261Q|MED24_uc010wex.1_Missense_Mutation_p.E37Q	NM_014815	NP_055630	O75448	MED24_HUMAN	mediator complex subunit 24 isoform 1	332					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)					TTGACATCCTCAGTGAAGTCC	0.567													17	69	---	---	---	---	PASS
TMEM99	147184	broad.mit.edu	37	17	38991464	38991464	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38991464C>T	uc002hvj.1	+	3	1003	c.696C>T	c.(694-696)CTC>CTT	p.L232L		NM_145274	NP_660317	Q8N816	TMM99_HUMAN	transmembrane protein 99 precursor	232	Helical; (Potential).					integral to membrane				skin(1)	1		Breast(137;0.000301)				GGCAAAGCCTCATATTACTCT	0.398													45	59	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40330146	40330146	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40330146C>A	uc002hzb.2	-	4	890	c.557G>T	c.(556-558)CGG>CTG	p.R186L		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	186	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCCTGGCCCCGGCGGCCAAA	0.592													4	78	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630635	44630635	+	3'UTR	SNP	A	G	G	rs150521815	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630635A>G	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TACACAGCATACAATTCCTGT	0.239													4	39	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62020202	62020202	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62020202G>A	uc002jds.1	-	23	4349	c.4272C>T	c.(4270-4272)GTC>GTT	p.V1424V		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1424	Helical; Name=S3 of repeat IV; (Potential).|IV.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	TGGACAGGATGACGACCACGA	0.602													6	22	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65882295	65882295	+	Intron	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65882295C>T	uc002jgf.2	+						BPTF_uc002jge.2_Missense_Mutation_p.S702F|BPTF_uc010wqm.1_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACCACTACCTCCATCCAGCCT	0.378													34	59	---	---	---	---	PASS
SGSH	6448	broad.mit.edu	37	17	78188482	78188482	+	Silent	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78188482G>C	uc002jxz.3	-	4	525	c.438C>G	c.(436-438)CTC>CTG	p.L146L	SGSH_uc002jya.3_5'UTR|SGSH_uc002jxy.2_Silent_p.L146L|SGSH_uc010wue.1_Missense_Mutation_p.S158C	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	146			L -> P (in MPS3A; severe).		proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GCCCCACCTGGAGGACGGAGC	0.612													13	30	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358													4	48	---	---	---	---	PASS
DSC1	1823	broad.mit.edu	37	18	28710778	28710778	+	Intron	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28710778C>G	uc002kwn.2	-						DSC1_uc002kwm.2_Silent_p.L837L|uc002kwo.1_5'Flank	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein						homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			AATTTTTAATCAGAGTGTGTC	0.254													25	69	---	---	---	---	PASS
ZNF57	126295	broad.mit.edu	37	19	2918122	2918122	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2918122G>C	uc002lwr.2	+	4	1651	c.1503G>C	c.(1501-1503)GAG>GAC	p.E501D	ZNF57_uc010xha.1_Missense_Mutation_p.E469D	NM_173480	NP_775751	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	501					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACTGGAGAGAAACCTCACA	0.463													29	37	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9061174	9061174	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9061174G>C	uc002mkp.2	-	3	26476	c.26272C>G	c.(26272-26274)CAA>GAA	p.Q8758E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8760	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATTGTGGATTGAGCAGGACCT	0.498													22	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	9800798	9800798	+	3'UTR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9800798G>C	uc010xkx.1	-	3										RecName: Full=Zinc finger protein 562;																		actaattaaagatggcaacca	0.124													11	11	---	---	---	---	PASS
CD97	976	broad.mit.edu	37	19	14516631	14516631	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14516631C>T	uc002myl.2	+	14	1824	c.1701C>T	c.(1699-1701)CTC>CTT	p.L567L	CD97_uc002mym.2_Silent_p.L518L|CD97_uc002myn.2_Silent_p.L474L	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor	567	Helical; Name=1; (Potential).				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						TGTGCATCCTCACTTTCCTGC	0.632													23	79	---	---	---	---	PASS
PLVAP	83483	broad.mit.edu	37	19	17487865	17487865	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17487865G>A	uc002ngk.1	-	1	283	c.233C>T	c.(232-234)ACG>ATG	p.T78M		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	78	Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0						CTGGGAGGCCGTGAGCCCTAG	0.617													10	32	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21606279	21606279	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21606279C>G	uc002npx.2	+	2	714	c.434C>G	c.(433-435)TCT>TGT	p.S145C	ZNF493_uc002npw.2_Missense_Mutation_p.S273C|ZNF493_uc002npy.2_Missense_Mutation_p.S145C	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	145	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGTGGCACATCTTTCTACCAA	0.348													31	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23329025	23329025	+	RNA	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23329025G>C	uc002nrb.1	+	4		c.1378G>C								Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85.																		ATACTGTAGAGAAATTTTACA	0.348													10	44	---	---	---	---	PASS
PDCD2L	84306	broad.mit.edu	37	19	34900411	34900411	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34900411C>A	uc002nvj.2	+	4	715	c.682C>A	c.(682-684)CAA>AAA	p.Q228K		NM_032346	NP_115722	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	228						cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GTTGCTTTCCCAAAGGTGAGG	0.507													4	44	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39001344	39001344	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39001344C>G	uc002oit.2	+	60	9175	c.9045C>G	c.(9043-9045)CTC>CTG	p.L3015L	RYR1_uc002oiu.2_Silent_p.L3015L|RYR1_uc002oiv.1_5'UTR|RYR1_uc010xuf.1_5'Flank	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3015	Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ACCACTGCCTCTATTTCTTGT	0.567													46	152	---	---	---	---	PASS
EID2B	126272	broad.mit.edu	37	19	40023151	40023151	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40023151C>G	uc002olz.1	-	1	344	c.292G>C	c.(292-294)GAG>CAG	p.E98Q		NM_152361	NP_689574	Q96D98	EID2B_HUMAN	EP300 interacting inhibitor of differentiation	98					cell differentiation|muscle organ development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCCAGATACTCGCGGAACAAC	0.612													7	52	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42848852	42848852	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42848852C>G	uc002otl.3	+	12	2599	c.1964C>G	c.(1963-1965)TCA>TGA	p.S655*	MEGF8_uc002otm.3_Nonsense_Mutation_p.S196*	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	705	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GAGCAGATCTCAGGCACTGTG	0.687													13	43	---	---	---	---	PASS
CEACAM1	634	broad.mit.edu	37	19	43026092	43026092	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43026092G>A	uc002otv.2	-	3	800	c.687C>T	c.(685-687)GTC>GTT	p.V229V	uc010eif.1_Intron|uc002ott.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron|CEACAM1_uc010eii.2_5'Flank|CEACAM1_uc002otw.2_Silent_p.V229V|CEACAM1_uc010eij.2_Silent_p.V229V|CEACAM1_uc002otx.2_Silent_p.V229V|CEACAM1_uc002oty.2_Silent_p.V229V|CEACAM1_uc002otz.2_Silent_p.V229V|CEACAM1_uc010eik.2_Intron|CEACAM1_uc002oua.2_Silent_p.V229V|CEACAM1_uc002oub.2_Silent_p.V229V|CEACAM1_uc002ouc.2_Silent_p.V229V	NM_001712	NP_001703	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion	229	Ig-like C2-type 1.|Extracellular (Potential).				angiogenesis|cell migration|homophilic cell adhesion|integrin-mediated signaling pathway	extracellular region|integral to plasma membrane|membrane fraction				ovary(1)|central_nervous_system(1)	2		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	CATTCAAGGTGACTGGGTCAC	0.557													40	131	---	---	---	---	PASS
ZNF575	284346	broad.mit.edu	37	19	44039832	44039832	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44039832G>C	uc002ows.2	+	4	1259	c.731G>C	c.(730-732)AGA>ACA	p.R244T	ZNF575_uc002owq.2_Missense_Mutation_p.R343T	NM_174945	NP_777605	Q86XF7	ZN575_HUMAN	zinc finger protein 575	244					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0199)				AAGGGGGAGAGAGACTGAGCC	0.612													5	19	---	---	---	---	PASS
CBLC	23624	broad.mit.edu	37	19	45285644	45285644	+	Silent	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45285644C>G	uc002ozs.2	+	4	738	c.675C>G	c.(673-675)CTC>CTG	p.L225L	CBLC_uc010ejt.2_Silent_p.L225L	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral	225	SH2-like.|Cbl-PTB.				cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CAACACTCCTCAAGAACTGGC	0.612			M		AML								25	122	---	---	---	---	PASS
DMPK	1760	broad.mit.edu	37	19	46285508	46285508	+	5'Flank	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46285508C>G	uc002pdd.1	-						DMPK_uc010xxs.1_5'Flank|DMPK_uc002pde.1_5'Flank|DMPK_uc002pdf.1_Missense_Mutation_p.E35Q|DMPK_uc002pdg.1_Missense_Mutation_p.E35Q|DMPK_uc002pdh.1_Missense_Mutation_p.E35Q|DMPK_uc002pdi.1_Missense_Mutation_p.G41A|DMPK_uc010xxt.1_Missense_Mutation_p.E35Q|DMPK_uc010xxu.1_5'Flank	NM_001081563	NP_001075032	Q09013	DMPK_HUMAN	myotonic dystrophy protein kinase isoform 1						regulation of heart contraction		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)	3		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		GCGCCCAGCTCCTGGTGGACG	0.692													5	6	---	---	---	---	PASS
TBC1D17	79735	broad.mit.edu	37	19	50387619	50387619	+	Silent	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50387619C>T	uc002pqo.2	+	11	1388	c.1236C>T	c.(1234-1236)TTC>TTT	p.F412F	TBC1D17_uc010ybg.1_Silent_p.F379F|TBC1D17_uc002pqp.2_Silent_p.F63F|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_Silent_p.F63F|TBC1D17_uc002pqs.2_RNA	NM_024682	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	412	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		TGTATCACTTCGACCTCGGTG	0.662													51	207	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51361378	51361378	+	Silent	SNP	C	G	G	rs2739452		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51361378C>G	uc002pts.1	+	3	341	c.300C>G	c.(298-300)CTC>CTG	p.L100L	KLK3_uc010ycj.1_Silent_p.L100L|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_Intron	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	100	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CACACCCGCTCTACGATATGA	0.582													6	46	---	---	---	---	PASS
LILRA3	11026	broad.mit.edu	37	19	54802062	54802062	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54802062G>A	uc002qfd.2	-	6	1191	c.1126C>T	c.(1126-1128)CAT>TAT	p.H376Y	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Missense_Mutation_p.H312Y	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	376	Ig-like C2-type 4.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGTACTTATGAGATTGGCGC	0.577													33	103	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54932504	54932504	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54932504C>G	uc002qfq.2	+	3	451	c.359C>G	c.(358-360)TCC>TGC	p.S120C	TTYH1_uc010yey.1_Missense_Mutation_p.S169C|TTYH1_uc002qfr.2_Missense_Mutation_p.S120C|TTYH1_uc002qft.2_Missense_Mutation_p.S120C|TTYH1_uc002qfu.1_Missense_Mutation_p.S35C	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	120	Extracellular (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GATGGGGTGTCCCAGCTCAGC	0.627													10	60	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243927	56243927	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243927C>G	uc002qly.2	-	2	1298	c.1270G>C	c.(1270-1272)GAG>CAG	p.E424Q		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	424	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		ATCACGCCCTCAGACTCAGAT	0.483													49	187	---	---	---	---	PASS
ZNF582	147948	broad.mit.edu	37	19	56895710	56895710	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56895710C>T	uc002qmz.1	-	5	1235	c.1076G>A	c.(1075-1077)AGA>AAA	p.R359K	ZNF582_uc002qmy.2_Missense_Mutation_p.R390K	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	359	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		GGTATGAATTCTCTGATGTCG	0.418													25	193	---	---	---	---	PASS
ZNF304	57343	broad.mit.edu	37	19	57869292	57869292	+	3'UTR	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57869292C>G	uc010ygw.1	+	3					ZNF304_uc010etw.2_3'UTR|ZNF304_uc010etx.2_3'UTR	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		TCATAGGACTCACACCAGAGC	0.433													18	62	---	---	---	---	PASS
ZNF418	147686	broad.mit.edu	37	19	58438051	58438051	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58438051G>A	uc002qqs.1	-	4	1790	c.1498C>T	c.(1498-1500)CAT>TAT	p.H500Y	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.H415Y	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	500	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		ACTCTCTGATGAACACGAAAC	0.448													150	94	---	---	---	---	PASS
ZBTB45	84878	broad.mit.edu	37	19	59028353	59028353	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59028353C>T	uc002qtd.2	-	2	980	c.688G>A	c.(688-690)GAG>AAG	p.E230K	ZBTB45_uc002qte.2_Missense_Mutation_p.E230K|ZBTB45_uc002qtf.2_Missense_Mutation_p.E230K	NM_032792	NP_116181	Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	230					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GCCTGGCCCTCGCCTGGGCCG	0.672											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	51	270	---	---	---	---	PASS
HNF4A	3172	broad.mit.edu	37	20	43030114	43030114	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43030114G>A	uc002xma.2	+	1	191	c.102G>A	c.(100-102)TTG>TTA	p.L34L	HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|uc002xlw.1_Intron|HNF4A_uc002xly.2_Silent_p.L34L|HNF4A_uc002xlz.2_Silent_p.L34L|HNF4A_uc010ggq.2_5'UTR	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	34					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TGCAGGTGTTGACGATGGGCA	0.587													5	36	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47713022	47713022	+	3'UTR	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47713022C>T	uc002xty.2	+	25					CSE1L_uc010zyg.1_3'UTR|CSE1L_uc010ghx.2_3'UTR|CSE1L_uc010ghy.2_3'UTR|CSE1L_uc010zyh.1_3'UTR	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CCTAGGAAATCACAGGCTTCT	0.423													9	27	---	---	---	---	PASS
TMEM189	387521	broad.mit.edu	37	20	48741430	48741430	+	3'UTR	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48741430G>A	uc002xvg.2	-	6					TMEM189-UBE2V1_uc002xvf.2_Intron|TMEM189_uc010zyq.1_RNA|TMEM189_uc010gif.2_3'UTR|TMEM189_uc010zyp.1_3'UTR	NM_199129	NP_954580	A5PLL7	TM189_HUMAN	transmembrane protein 189 isoform 1							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(9;3.02e-07)			AAAAATCAGTGGCTCAAGTAT	0.542													5	12	---	---	---	---	PASS
C20orf85	128602	broad.mit.edu	37	20	56728657	56728657	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56728657G>A	uc002xyv.2	+	2	164	c.126G>A	c.(124-126)GGG>GGA	p.G42G		NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	hypothetical protein LOC128602	42										ovary(1)	1	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			AGAACTGGGGGTTTTTAACAA	0.428													24	106	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60419818	60419818	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60419818C>G	uc002ybn.1	+	5	685	c.671C>G	c.(670-672)TCC>TGC	p.S224C	CDH4_uc002ybp.1_Missense_Mutation_p.S150C	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	224	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGCATTGACTCCATGTCCGGC	0.617													15	34	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737520	62737520	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737520A>C	uc011abt.1	-	1	665	c.665T>G	c.(664-666)GTG>GGG	p.V222G		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	222	Helical; Name=5; (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CACGGGCAGCACGAAGCCCAG	0.657													8	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862897	10862897	+	IGR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862897G>C								None (None upstream) : TPTE (43846 downstream)																							ACAAGGGCTTGAGTGGATGGG	0.557													20	192	---	---	---	---	PASS
KRTAP24-1	643803	broad.mit.edu	37	21	31654758	31654758	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31654758G>C	uc002ynv.2	-	1	519	c.493C>G	c.(493-495)CTA>GTA	p.L165V		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	165						keratin filament	structural molecule activity				0						CAGTGGTTTAGAGTTTGGAAA	0.443													40	121	---	---	---	---	PASS
DYRK1A	1859	broad.mit.edu	37	21	38862650	38862650	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38862650G>C	uc002ywk.2	+	6	913	c.838G>C	c.(838-840)GAA>CAA	p.E280Q	DYRK1A_uc002ywi.2_Missense_Mutation_p.E280Q|DYRK1A_uc002ywj.2_Missense_Mutation_p.E271Q|DYRK1A_uc002ywl.2_Missense_Mutation_p.E280Q|DYRK1A_uc002ywm.2_Missense_Mutation_p.E280Q|DYRK1A_uc011aei.1_Missense_Mutation_p.E41Q	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	280	Protein kinase.				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						TGCGACTCCAGAACTTAGTAT	0.428													5	124	---	---	---	---	PASS
BCL2L13	23786	broad.mit.edu	37	22	18189520	18189520	+	Intron	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18189520C>T	uc002zmw.2	+						BCL2L13_uc002zmx.2_Intron|BCL2L13_uc002zmy.2_Intron|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_Intron|BCL2L13_uc002zmz.2_Intron|BCL2L13_uc002zna.2_5'UTR	NM_015367	NP_056182	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)						induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)		ATTCTCTTTTCATTTCCTGGG	0.502													28	88	---	---	---	---	PASS
TUBA8	51807	broad.mit.edu	37	22	18604215	18604215	+	Intron	SNP	C	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18604215C>T	uc002znv.1	+						TUBA8_uc002znr.2_Intron|TUBA8_uc002znw.1_Silent_p.L15L|TUBA8_uc002znu.1_Intron	NM_018943	NP_061816	Q9NY65	TBA8_HUMAN	tubulin, alpha 8						microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0						GGCCCAGACTCTCTGACCTCG	0.607													7	27	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23237769	23237769	+	RNA	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23237769G>A	uc011aim.1	+	363		c.15172G>A			uc011aiw.1_Silent_p.L180L|uc010gtu.1_RNA|uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						GCAGCTACCTGAGCCTGACGC	0.602													10	24	---	---	---	---	PASS
SH3BP1	23616	broad.mit.edu	37	22	38038899	38038899	+	Intron	SNP	C	G	G			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38038899C>G	uc003ati.2	+						SH3BP1_uc003atg.1_Intron|SH3BP1_uc011anl.1_Intron|SH3BP1_uc003ath.1_Intron|SH3BP1_uc003atj.1_Intron|SH3BP1_uc003atk.1_Intron|uc003atl.1_RNA	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1						signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GCCGTGTCCACAGGAAGGCCT	0.632													15	29	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44969327	44969327	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44969327G>T	uc004dge.3	+	28	4384	c.4009G>T	c.(4009-4011)GAG>TAG	p.E1337*	KDM6A_uc011mkz.1_Nonsense_Mutation_p.E1389*|KDM6A_uc011mla.1_Nonsense_Mutation_p.E1292*|KDM6A_uc011mlb.1_Nonsense_Mutation_p.E1344*|KDM6A_uc011mlc.1_Nonsense_Mutation_p.E1041*|KDM6A_uc011mld.1_Nonsense_Mutation_p.E976*	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	1337					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						AAAACAGGTGGAGGTTTTTGA	0.348			D|N|F|S		renal|oesophageal SCC|MM								8	71	---	---	---	---	PASS
APEX2	27301	broad.mit.edu	37	X	55033263	55033263	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55033263G>A	uc004dtz.2	+	6	1028	c.952G>A	c.(952-954)GCA>ACA	p.A318T	APEX2_uc011mom.1_Missense_Mutation_p.A147T	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	318					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding			breast(1)	1						CTCTGTGCCTGCAAAACAGTG	0.567								Other_BER_factors					13	24	---	---	---	---	PASS
FOXR2	139628	broad.mit.edu	37	X	55650500	55650500	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55650500G>T	uc004duo.2	+	1	668	c.356G>T	c.(355-357)GGG>GTG	p.G119V		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	119					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						AAAGACGAAGGGTCTAACTGC	0.527													4	58	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73964271	73964271	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73964271G>C	uc004eby.2	-	3	738	c.121C>G	c.(121-123)CTA>GTA	p.L41V		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	41					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GCAGCTTCTAGAGCTGCAAAT	0.463													12	10	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75004933	75004933	+	5'UTR	SNP	G	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75004933G>C	uc004ecj.1	-	1						NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2											ovary(1)|skin(1)	2						CGATCAGTCGGAGAGAGGACC	0.557													6	15	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109696041	109696041	+	Silent	SNP	C	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109696041C>A	uc004eor.1	+	3	2442	c.2196C>A	c.(2194-2196)TCC>TCA	p.S732S	RGAG1_uc011msr.1_Silent_p.S732S	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	732										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GAGGGATGTCCATGTCGCCCA	0.527													4	73	---	---	---	---	PASS
CDR1	1038	broad.mit.edu	37	X	139865962	139865962	+	Silent	SNP	G	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139865962G>A	uc004fbg.1	-	1	762	c.570C>T	c.(568-570)TTC>TTT	p.F190F	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	190	5 X 6 AA approximate repeats.|3.										0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				ACGTCTTCCAGAAAATCCATG	0.448													69	139	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9208	9208	+	RNA	SNP	T	C	C			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9208T>C	uc011mfi.1	+	1		c.546T>C			uc004cov.3_5'Flank|uc004cow.1_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		ACAACACATAATGACCCACCA	0.483													4	44	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													8	4	---	---	---	---	
CLCNKB	1188	broad.mit.edu	37	1	16379015	16379016	+	Intron	INS	-	GGGGCTGGGA	GGGGCTGGGA	rs112841009	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16379015_16379016insGGGGCTGGGA	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron|CLCNKB_uc001axy.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		cctcggacatgggggctgacac	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273434	207273439	+	IGR	DEL	TGTGTA	-	-	rs35665980		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273434_207273439delTGTGTA								C4BPB (99 upstream) : C4BPA (4072 downstream)																							tgtgtgtgtgtgtgtatgtgtgtgtg	0.257													3	5	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240348390	240348390	+	Intron	DEL	C	-	-	rs74216355		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240348390delC	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			cctataccttcccccttctct	0.030													6	3	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1133189	1133190	+	Intron	DEL	CA	-	-	rs71960569		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1133189_1133190delCA	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		tggacacatgcacacacacaca	0.218													5	3	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1285181	1285182	+	Intron	INS	-	GG	GG	rs62108101		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1285181_1285182insGG	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		atgtggtgtgttgtgtgtgtgt	0.000													4	2	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	87204958	87204958	+	Intron	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87204958delT	uc010fgv.2	+						RMND5A_uc002srs.3_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						Gttatttttattttttttttt	0.318													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																							tgaacctttcttttgagagag	0.000													11	9	---	---	---	---	
SCN2A	6326	broad.mit.edu	37	2	166148001	166148001	+	Intron	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166148001delT	uc002udc.2	+						SCN2A_uc002udd.2_5'Flank	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	tctttctttcttttctttctt	0.000													4	2	---	---	---	---	
DCAF17	80067	broad.mit.edu	37	2	172305519	172305520	+	Intron	INS	-	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172305519_172305520insT	uc002ugx.2	+						DCAF17_uc010zdq.1_Intron|DCAF17_uc010fqf.1_Intron|DCAF17_uc010zdr.1_Intron	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						TATCAtttgtcttttttttttc	0.163													4	2	---	---	---	---	
MARS2	92935	broad.mit.edu	37	2	198572076	198572077	+	3'UTR	INS	-	TTC	TTC	rs150680100	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198572076_198572077insTTC	uc002uuq.2	+	1					uc002uup.2_Intron	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor						methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					L-Methionine(DB00134)	GCCTGCTCCTATTCATTTCTCT	0.416													4	3	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													5	3	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219324814	219324815	+	Intron	INS	-	A	A	rs68110625		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219324814_219324815insA	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		actaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126220914	126220915	+	Intron	DEL	TG	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126220914_126220915delTG	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		tgtatgtgtatgtgtgtgtgtt	0.262													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194672812	194672815	+	IGR	DEL	GAAG	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194672812_194672815delGAAG								FAM43A (263048 upstream) : C3orf21 (116200 downstream)																							gaaagagaaagaaggaaggaagga	0.000													4	2	---	---	---	---	
NOP14	8602	broad.mit.edu	37	4	2952613	2952616	+	Intron	DEL	GAGT	-	-	rs3832272		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952613_2952616delGAGT	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						cagagagagagagtgagaaagaga	0.245													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12185515	12185516	+	IGR	INS	-	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12185515_12185516insA								HS3ST1 (754978 upstream) : None (None downstream)																							cgtccctctacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39279671	39279672	+	Intron	INS	-	A	A			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39279671_39279672insA	uc003gtv.2	+						WDR19_uc011byi.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						aagattccgtcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49121582	49121582	+	IGR	DEL	C	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49121582delC								CWH43 (57489 upstream) : None (None downstream)																							gcattccattccattccactc	0.000													23	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49133800	49133800	+	IGR	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49133800delT								CWH43 (69707 upstream) : None (None downstream)																							attccattcgtttccattcca	0.000													4	2	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964674	139964675	+	Intron	INS	-	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964674_139964675insT	uc003ihl.2	+						CCRN4L_uc003ihk.1_3'UTR	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					CTGGTTTTCACTTTTTTTTTTT	0.381													6	3	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37310597	37310601	+	Intron	DEL	TCATC	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37310597_37310601delTCATC	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAGATGGTTCATCATACATGATA	0.185													32	13	---	---	---	---	
ISL1	3670	broad.mit.edu	37	5	50687458	50687458	+	Intron	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50687458delT	uc003jor.2	+							NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1						generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TCTTGGCATCTTTTTTTTTTT	0.428													6	4	---	---	---	---	
GFM2	84340	broad.mit.edu	37	5	74037263	74037263	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74037263delA	uc003kdh.1	-						GFM2_uc003kdi.1_Intron|GFM2_uc010izj.1_Intron|GFM2_uc010izk.1_Intron|GFM2_uc003kdj.1_Intron|GFM2_uc010izl.1_Intron	NM_032380	NP_115756	Q969S9	RRF2M_HUMAN	mitochondrial elongation factor G2 isoform 1						mitochondrial translation|ribosome disassembly	mitochondrion	GTP binding|GTPase activity				0		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		TGCAAAGTTTAAAAAAAAAAT	0.269													6	5	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140031160	140031161	+	Intron	INS	-	A	A	rs75532104		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140031160_140031161insA	uc003lgq.2	+						IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gactccgtctcaaaaaaaaaaa	0.104													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161266786	161266793	+	IGR	DEL	TCTTTCTT	-	-	rs28419071	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161266786_161266793delTCTTTCTT								GABRA6 (137188 upstream) : GABRA1 (7404 downstream)																							tctttctttctctttctttctttctttc	0.000													4	2	---	---	---	---	
CDHR2	54825	broad.mit.edu	37	5	175998466	175998467	+	Intron	INS	-	AA	AA	rs146957297	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175998466_175998467insAA	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						ACCCCACAAACTGGTTACAGCA	0.371													2	4	---	---	---	---	
GFPT2	9945	broad.mit.edu	37	5	179729286	179729287	+	Intron	INS	-	A	A	rs34163399		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179729286_179729287insA	uc003mlw.1	-							NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	gactcaatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109818588	109818589	+	Intron	DEL	CA	-	-	rs71809712		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109818588_109818589delCA	uc003ptn.2	-						AKD1_uc011eas.1_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						ctctctctctcacacactcctc	0.050													6	3	---	---	---	---	
SERAC1	84947	broad.mit.edu	37	6	158579538	158579538	+	Intron	DEL	A	-	-	rs111829898		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158579538delA	uc003qrc.2	-						SERAC1_uc003qrb.2_Intron	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1						GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CTTTCCAATTAAAAAAAAAAT	0.294													5	3	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51085963	51085968	+	Intron	DEL	TGGTGA	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51085963_51085968delTGGTGA	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron|COBL_uc003tpo.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					gtggtggtggtggtgatggtgatggt	0.175													4	3	---	---	---	---	
UBAP2	55833	broad.mit.edu	37	9	33956316	33956316	+	Intron	DEL	T	-	-	rs68127153		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33956316delT	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GTGAATGCAAttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66545695	66545695	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66545695delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		CTGTAAGAGGAAAAAAAAACA	0.373													4	2	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													12	6	---	---	---	---	
VIM	7431	broad.mit.edu	37	10	17272904	17272904	+	Intron	DEL	T	-	-	rs5783538		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17272904delT	uc001iou.2	+						uc001iot.1_5'Flank|VIM_uc001iov.1_Intron|VIM_uc001iow.1_Intron|VIM_uc001iox.1_Intron|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_Intron|VIM_uc001ipb.1_Intron|VIM_uc009xjv.1_Intron|VIM_uc001ipc.1_Intron	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin						cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CCTTGAGCGAttttttttttt	0.234											OREG0020050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42355710	42355714	+	IGR	DEL	CATTC	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42355710_42355714delCATTC								None (None upstream) : LOC441666 (471601 downstream)																							tattaaattgcattccattccattc	0.000													5	3	---	---	---	---	
SLC18A2	6571	broad.mit.edu	37	10	119013080	119013080	+	Intron	DEL	T	-	-	rs2256299		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119013080delT	uc001ldd.1	+						SLC18A2_uc009xyy.1_Intron	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GCGGGGGGggtcgtggttggc	0.284													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	51580530	51580530	+	IGR	DEL	A	-	-	rs111460771		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51580530delA								OR4C46 (64321 upstream) : None (None downstream)																							atgtgaagatatttccttttc	0.000													4	4	---	---	---	---	
OLR1	4973	broad.mit.edu	37	12	10319126	10319126	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10319126delA	uc001qxo.1	-						OLR1_uc010sgz.1_Intron|OLR1_uc010sha.1_Intron	NM_002543	NP_002534	P78380	OLR1_HUMAN	oxidized low density lipoprotein (lectin-like)						blood circulation|blood coagulation|inflammatory response|leukocyte migration|proteolysis	extracellular region|integral to plasma membrane|membrane fraction	sugar binding			ovary(1)	1						aactccatctaaaaaaaaaaa	0.080													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109883170	109883173	+	Intron	DEL	TTCC	-	-	rs67955379		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109883170_109883173delTTCC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						CATTCTTCCTTTCCTCAAATATGC	0.358													6	4	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49830213	49830214	+	Intron	INS	-	A	A	rs147882512	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49830213_49830214insA	uc001vcu.2	+						CDADC1_uc001vcs.1_Intron|CDADC1_uc001vct.1_Intron|CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		CTCCTTTTTTTTAAAAAAAAAA	0.262													3	4	---	---	---	---	
TBC1D4	9882	broad.mit.edu	37	13	75923091	75923098	+	Intron	DEL	GTGTGTGT	-	-	rs151307196		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75923091_75923098delGTGTGTGT	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		gagagagagagtgtgtgtgtgtgtgtgt	0.192													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106148132	106148132	+	IGR	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106148132delT								DAOA (4750 upstream) : EFNB2 (993966 downstream)																							ccttccttcctttcttccttc	0.244													3	4	---	---	---	---	
YLPM1	56252	broad.mit.edu	37	14	75264230	75264231	+	Intron	INS	-	T	T			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75264230_75264231insT	uc001xqj.3	+						YLPM1_uc001xql.3_Intron	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TACATGGAGAATTTTTTTTTTC	0.327													4	2	---	---	---	---	
GALC	2581	broad.mit.edu	37	14	88442994	88442994	+	Intron	DEL	C	-	-	rs112016425		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88442994delC	uc001xvt.2	-						GALC_uc010tvw.1_Intron|GALC_uc010tvx.1_Intron|GALC_uc010tvy.1_Intron|GALC_uc010tvz.1_Intron|GALC_uc001xvu.1_Intron	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor						carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						aggcttctctcgtcgcccagg	0.100													4	3	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92548989	92548989	+	Intron	DEL	G	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92548989delG	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron|ATXN3_uc010twl.1_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ttttttttccgtttctttttt	0.129													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53889664	53889664	+	Intron	DEL	T	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53889664delT	uc002acj.2	-							NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		TTTCACACTGTTTTTTTGCAA	0.294													3	5	---	---	---	---	
SNUPN	10073	broad.mit.edu	37	15	75909902	75909902	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75909902delA	uc002ban.2	-						SNUPN_uc002bao.2_Intron|SNUPN_uc002bap.2_Intron|SNUPN_uc002baq.2_Intron|SNUPN_uc002bar.2_Intron|SNUPN_uc002bas.2_Intron	NM_005701	NP_005692	O95149	SPN1_HUMAN	snurportin 1						ncRNA metabolic process|protein import into nucleus|spliceosomal snRNP assembly	cytosol|nuclear pore	protein transporter activity|RNA cap binding			pancreas(1)	1						TGCTGGAAGGAAAAAAAAGGC	0.274													124	7	---	---	---	---	
TRAF7	84231	broad.mit.edu	37	16	2214128	2214128	+	Intron	DEL	G	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2214128delG	uc002cow.2	+							NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7						activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						GGAGCTCGGTGGGGGGGGGTG	0.502													4	2	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4938713	4938714	+	Intron	INS	-	TT	TT	rs34143557		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4938713_4938714insTT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						tttatcctgcattttttttttt	0.000													10	8	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14721881	14721881	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14721881delA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagacaaaacaaaaaaaaaaa	0.139													7	4	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15705322	15705323	+	Intron	DEL	AC	-	-	rs77194873		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15705322_15705323delAC	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						aaaaaaaaaaacaaaaaaCTAC	0.124													7	6	---	---	---	---	
TMEM219	124446	broad.mit.edu	37	16	29982566	29982566	+	Intron	DEL	C	-	-	rs12934406	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29982566delC	uc002duw.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TMEM219_uc002duy.2_Intron|TMEM219_uc010bzk.1_Intron|TMEM219_uc002duz.2_Intron|TMEM219_uc010bzl.1_Intron|TAOK2_uc002dva.1_5'Flank|TAOK2_uc002dvb.1_5'Flank|TAOK2_uc002dvc.1_5'Flank	NM_194280	NP_919256	Q86XT9	TM219_HUMAN	transmembrane protein 219							integral to membrane					0						gactccatctcaaaaaaaaaa	0.184													8	4	---	---	---	---	
GDPD3	79153	broad.mit.edu	37	16	30119308	30119309	+	Intron	DEL	AC	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30119308_30119309delAC	uc002dwp.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_Intron	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						gagactcTTGacacacacacac	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32176904	32176904	+	IGR	DEL	G	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32176904delG								HERC2P4 (13030 upstream) : TP53TG3B (507937 downstream)																							AAAAAAAAAAGAAATCAAAGC	0.284													4	2	---	---	---	---	
AP1G1	164	broad.mit.edu	37	16	71779749	71779757	+	Intron	DEL	CATATATTT	-	-	rs11277696		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71779749_71779757delCATATATTT	uc010cgg.2	-						AP1G1_uc002fba.2_Intron|AP1G1_uc002fbb.2_Intron|AP1G1_uc002faz.2_Intron	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				AATCCCAAAGCATATATTTCAGTGGTAGA	0.349													4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81253526	81253527	+	Intron	INS	-	TTATT	TTATT	rs141224532	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81253526_81253527insTTATT	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ttagacatgaattatttaatcc	0.282													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53285938	53285939	+	IGR	INS	-	GAAG	GAAG	rs143873127	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53285938_53285939insGAAG								STXBP4 (44489 upstream) : HLF (56382 downstream)																							gagggagggaagaaggaaggaa	0.163													4	2	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71410687	71410688	+	Intron	DEL	AG	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71410687_71410688delAG	uc010dfm.2	-						SDK2_uc010dfn.2_Intron	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						CTTCAGAAACAGAGGGGGGATT	0.554													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	111052	111052	+	Intron	DEL	C	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:111052delC	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		ctaggttcagcctacaggagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57429217	57429218	+	IGR	DEL	AG	-	-	rs141641247	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57429217_57429218delAG								CCBE1 (64573 upstream) : PMAIP1 (137974 downstream)																							AAAAAAAAAAAGAGGAAGACAG	0.243													4	2	---	---	---	---	
BSG	682	broad.mit.edu	37	19	580946	580959	+	Intron	DEL	CCCGGACCCAGCCC	-	-	rs12977323		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:580946_580959delCCCGGACCCAGCCC	uc002loz.2	+						BSG_uc002loy.2_Intron|BSG_uc002lpa.2_Intron|BSG_uc002lpb.2_Intron|BSG_uc010drr.2_Intron|BSG_uc002lpc.2_Intron|BSG_uc002lpd.2_5'Flank	NM_001728	NP_001719	P35613	BASI_HUMAN	basigin isoform 1 precursor						blood coagulation|cell surface receptor linked signaling pathway|leukocyte migration|pyruvate metabolic process	Golgi membrane|integral to membrane|melanosome	lactate transmembrane transporter activity|mannose binding|protein binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTGGGGGTCCCGGACCCAGCCCTCCGGACTGG	0.729													4	2	---	---	---	---	
CIB3	117286	broad.mit.edu	37	19	16283777	16283780	+	Intron	DEL	GAAG	-	-	rs3076228		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16283777_16283780delGAAG	uc002nds.2	-						CIB3_uc010eae.2_Intron|CIB3_uc010eaf.2_Intron|CIB3_uc010eag.2_Intron	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic								calcium ion binding			ovary(1)	1						aaaaagaaaagaaggaaggaagga	0.020													6	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27731986	27731989	+	IGR	DEL	TGTT	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27731986_27731989delTGTT								None (None upstream) : LOC148189 (549413 downstream)																							ggaaacactctgtttgtaaagtct	0.000													694	7	---	---	---	---	
CBLC	23624	broad.mit.edu	37	19	45297714	45297714	+	Intron	DEL	C	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45297714delC	uc002ozs.2	+						CBLC_uc010ejt.2_Intron	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				ctgggactttctttttttttt	0.149			M		AML								5	3	---	---	---	---	
RAB22A	57403	broad.mit.edu	37	20	56934552	56934552	+	Intron	DEL	T	-	-	rs33925119		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56934552delT	uc002xyz.2	+							NM_020673	NP_065724	Q9UL26	RB22A_HUMAN	RAS-related protein RAB-22A						endocytosis|endosome organization|protein transport|small GTPase mediated signal transduction	early endosome|endosome membrane|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			tttattaaaCTTTTTTTTTTT	0.169													4	2	---	---	---	---	
KRTAP10-9	386676	broad.mit.edu	37	21	46048132	46048132	+	3'UTR	DEL	C	-	-	rs67739305		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46048132delC	uc002zfp.3	+	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198690	NP_941963	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament					0						TCCCTGACCTCCCCCCCGGGC	0.697													4	2	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47419706	47419707	+	Intron	INS	-	G	G	rs149102148	by1000genomes	TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47419706_47419707insG	uc002zhu.1	+						COL6A1_uc010gqd.1_Intron|COL6A1_uc002zhv.1_5'Flank|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	ACGCTGCTCACGGGGGGGTGGG	0.624													6	5	---	---	---	---	
TAB1	10454	broad.mit.edu	37	22	39815792	39815792	+	Intron	DEL	A	-	-			TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39815792delA	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_Intron|TAB1_uc003axu.1_Intron	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						accctgtctcaaaaaaaaaaa	0.249													6	3	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16716680	16716682	+	Intron	DEL	TTT	-	-	rs72307111		TCGA-DK-A1AB-01	TCGA-DK-A1AB-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16716680_16716682delTTT	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					ctttgttttgtttttttttttta	0.138													1	5	---	---	---	---	
