Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5937208	5937208	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5937208G>A	uc001alq.1	-	20	3028	c.2762C>T	c.(2761-2763)TCT>TTT	p.S921F	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_RNA|NPHP4_uc001alt.1_RNA	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	921					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGCGCACAGACCTCATCCG	0.667													8	19	---	---	---	---	PASS
PRAMEF1	65121	broad.mit.edu	37	1	12856067	12856067	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12856067G>T	uc001auj.1	+	4	1450	c.1347G>T	c.(1345-1347)AGG>AGT	p.R449S		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	449											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGCCCAAGAGGATCTTCATTG	0.562													16	352	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43779034	43779034	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43779034G>A	uc001ciu.2	+	13	2235	c.2156G>A	c.(2155-2157)CGG>CAG	p.R719Q	TIE1_uc010okd.1_Missense_Mutation_p.R719Q|TIE1_uc010oke.1_Missense_Mutation_p.R674Q|TIE1_uc009vwq.2_Missense_Mutation_p.R675Q|TIE1_uc010okf.1_Missense_Mutation_p.R364Q|TIE1_uc010okg.1_Missense_Mutation_p.R364Q	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	719	Fibronectin type-III 3.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTCCGCATGCGGGCCAGCATT	0.647													44	156	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	58521828	58521828	+	Intron	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58521828G>A	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						GGTGGGGGACGTGGGGCAGCA	0.468													20	88	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158815714	158815714	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158815714C>G	uc001fsz.1	+	5	1108	c.908C>G	c.(907-909)GCA>GGA	p.A303G		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	303	HIN-200.				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					ATCGAAATAGCAAATAAAACT	0.333													36	134	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176863936	176863936	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176863936C>T	uc001glc.2	-	17	2914	c.2702G>A	c.(2701-2703)CGG>CAG	p.R901Q	ASTN1_uc001glb.1_Missense_Mutation_p.R901Q|ASTN1_uc001gld.1_Missense_Mutation_p.R901Q	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	909					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GTCTCTTTCCCGCTCCTCAGA	0.532													52	171	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181741311	181741311	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181741311G>A	uc001gow.2	+	37	5248	c.5083G>A	c.(5083-5085)GGC>AGC	p.G1695S	CACNA1E_uc009wxs.2_Missense_Mutation_p.G1583S|CACNA1E_uc001gox.1_Missense_Mutation_p.G921S|CACNA1E_uc009wxt.2_Missense_Mutation_p.G921S	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1695	Extracellular (Potential).|IV.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						CGAACGCTGCGGCACCGATCT	0.552													28	258	---	---	---	---	PASS
SNRNP27	11017	broad.mit.edu	37	2	70122315	70122315	+	Missense_Mutation	SNP	C	T	T	rs143382169		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70122315C>T	uc002sfw.2	+	2	151	c.124C>T	c.(124-126)CGC>TGC	p.R42C	SNRNP27_uc002sfv.2_RNA|SNRNP27_uc002sfx.2_Missense_Mutation_p.R42C	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa	42	Arg-rich.				mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						GAGAAGGAGCCGCTCGCGATC	0.557													28	83	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166806100	166806100	+	Intron	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166806100C>G	uc002udk.2	-						TTC21B_uc002udl.2_Intron|uc002udm.1_RNA	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						ATGATTAACACGTACCTTCCA	0.348													16	164	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179404687	179404687	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179404687G>A	uc010zfg.1	-	301	90625	c.90401C>T	c.(90400-90402)CCT>CTT	p.P30134L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P23829L|TTN_uc010zfi.1_Missense_Mutation_p.P23762L|TTN_uc010zfj.1_Missense_Mutation_p.P23637L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31061							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATAATCAGGATATTCTGG	0.368													23	106	---	---	---	---	PASS
GPBAR1	151306	broad.mit.edu	37	2	219128369	219128369	+	Silent	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219128369C>A	uc010zjw.1	+	2	1169	c.922C>A	c.(922-924)CGG>AGG	p.R308R	GPBAR1_uc010zjx.1_Silent_p.R308R|GPBAR1_uc010zjy.1_Silent_p.R308R	NM_170699	NP_733800	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	308	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGAGCCTCCCGGGACAGTCC	0.652													21	38	---	---	---	---	PASS
CHDH	55349	broad.mit.edu	37	3	53853588	53853588	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53853588G>A	uc003dgz.2	-	7	1674	c.1234C>T	c.(1234-1236)CGG>TGG	p.R412W		NM_018397	NP_060867	Q8NE62	CHDH_HUMAN	choline dehydrogenase precursor	412					alcohol metabolic process		choline dehydrogenase activity|flavin adenine dinucleotide binding			ovary(1)|central_nervous_system(1)	2		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	GTGGGGACCCGCCCGTGGTCA	0.612													40	85	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108110711	108110711	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108110711C>T	uc003dxa.1	-	38	5443	c.5386G>A	c.(5386-5388)GAA>AAA	p.E1796K		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1796	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TCCATATTTTCTCTTGTCCTT	0.443													19	358	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128284	147128284	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128284G>A	uc003ewe.2	+	1	1104	c.385G>A	c.(385-387)GGG>AGG	p.G129R		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	129					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CGGGGGCTTCGGGGGCCCACA	0.716													15	32	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170244566	170244566	+	Missense_Mutation	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170244566T>C	uc003fgz.2	-	2	476	c.160A>G	c.(160-162)ACC>GCC	p.T54A	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	54						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCCACTGTGGTGAGTACCTGG	0.572													16	105	---	---	---	---	PASS
ACAP2	23527	broad.mit.edu	37	3	195022294	195022294	+	Intron	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195022294T>C	uc003fun.3	-							NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						AAAGCAAAAATTTTTTTTACC	0.323													14	80	---	---	---	---	PASS
TRPC3	7222	broad.mit.edu	37	4	122835998	122835998	+	Silent	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122835998C>A	uc003ieg.2	-	4	1352	c.1278G>T	c.(1276-1278)GTG>GTT	p.V426V	TRPC3_uc010inr.2_Intron|TRPC3_uc003ief.2_Silent_p.V353V|TRPC3_uc011cgl.1_Silent_p.V90V	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN	transient receptor potential cation channel,	341	Helical; (Potential).				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						CCACGACCAGCACAACGAGAC	0.542													21	42	---	---	---	---	PASS
FBXL7	23194	broad.mit.edu	37	5	15936809	15936809	+	Silent	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15936809C>T	uc003jfn.1	+	4	1471	c.990C>T	c.(988-990)AGC>AGT	p.S330S		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	330	LRR 6.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						AGGAGCTGAGCGTCAGCGACT	0.677													4	30	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140230162	140230162	+	Silent	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140230162G>T	uc003lhu.2	+	1	2806	c.2082G>T	c.(2080-2082)GTG>GTT	p.V694V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.V694V	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	694	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACGCTGGTGGATGTCAACG	0.652													20	70	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140710561	140710561	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140710561G>T	uc003lji.1	+	1	310	c.310G>T	c.(310-312)GTG>TTG	p.V104L	PCDHGA1_uc011dan.1_Missense_Mutation_p.V104L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	104	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCGTGTCTCGTGAGTTTTAA	0.458													78	151	---	---	---	---	PASS
HIST1H2AG	8969	broad.mit.edu	37	6	27101231	27101231	+	Silent	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27101231G>T	uc003niw.2	+	1	415	c.381G>T	c.(379-381)GCG>GCT	p.A127A	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.2_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	127					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0						ACCACAAGGCGAAGGGCAAGT	0.517													25	75	---	---	---	---	PASS
HIST1H4L	8368	broad.mit.edu	37	6	27841106	27841106	+	Silent	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27841106C>T	uc003njz.2	-	1	184	c.183G>A	c.(181-183)GTG>GTA	p.V61V	HIST1H3I_uc003njy.2_5'Flank	NM_003546	NP_003537	P62805	H4_HUMAN	histone cluster 1, H4l	61					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|breast(1)	2						TCTCCAAAAACACTTTAAGAA	0.567													28	78	---	---	---	---	PASS
PPP1R10	5514	broad.mit.edu	37	6	30570171	30570171	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30570171C>T	uc003nqn.1	-	19	2807	c.2255G>A	c.(2254-2256)CGT>CAT	p.R752H	PPP1R10_uc010jsc.1_Missense_Mutation_p.R406H	NM_002714	NP_002705	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	752	Gly-rich.				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4						TTCGTGAGGACGATGCCCACC	0.642													14	319	---	---	---	---	PASS
NCR3	259197	broad.mit.edu	37	6	31557387	31557387	+	Missense_Mutation	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31557387T>C	uc003nuv.2	-	3	676	c.412A>G	c.(412-414)ACA>GCA	p.T138A	NCR3_uc003nuw.2_Missense_Mutation_p.T138A|NCR3_uc003nux.1_Missense_Mutation_p.T138A	NM_147130	NP_667341	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	138	Helical; (Potential).				cell recognition|immune response|inflammatory response|positive regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGGAGGACTGTACCAGCCCCT	0.582													8	48	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70610139	70610139	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70610139C>G	uc003pfc.1	+	4	292	c.175C>G	c.(175-177)CTA>GTA	p.L59V		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	59	TSP N-terminal.				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						AGGTTTTGATCTAGGAGACAG	0.294													9	37	---	---	---	---	PASS
CCT6A	908	broad.mit.edu	37	7	56122148	56122148	+	Silent	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56122148C>G	uc003trl.1	+	3	452	c.288C>G	c.(286-288)GTC>GTG	p.V96V	PSPH_uc003trh.2_5'Flank|PSPH_uc003tri.2_5'Flank|PSPH_uc003trj.2_Intron|PSPH_uc003trk.1_5'Flank|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Silent_p.V65V	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	96					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTCTAATGTCCTAATCATTG	0.388													116	769	---	---	---	---	PASS
CCT6A	908	broad.mit.edu	37	7	56122192	56122192	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56122192C>G	uc003trl.1	+	3	496	c.332C>G	c.(331-333)TCT>TGT	p.S111C	PSPH_uc003trh.2_5'Flank|PSPH_uc003tri.2_5'Flank|PSPH_uc003trj.2_Intron|PSPH_uc003trk.1_5'Flank|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Missense_Mutation_p.S80C	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	111					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTCTACATTTCTGAAGTATGC	0.343													94	622	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123594484	123594484	+	Missense_Mutation	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594484G>C	uc003vld.2	+	4	1262	c.860G>C	c.(859-861)AGA>ACA	p.R287T	SPAM1_uc003vle.2_Missense_Mutation_p.R287T|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.R287T|SPAM1_uc010lku.2_Missense_Mutation_p.R287T	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	287				R->T: Loss of activity.	binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	GAAGCCATCAGAGTTTCCAAA	0.408													6	152	---	---	---	---	PASS
WDR60	55112	broad.mit.edu	37	7	158715181	158715181	+	Missense_Mutation	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158715181T>C	uc003woe.3	+	16	2193	c.2035T>C	c.(2035-2037)TGT>CGT	p.C679R	WDR60_uc010lqv.2_Intron|WDR60_uc010lqw.2_Missense_Mutation_p.C311R	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	679										ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		ATACGTCCTCTGTGTGTGGGA	0.542													12	71	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143614744	143614744	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143614744G>A	uc003ywm.2	+	24	3670	c.3487G>A	c.(3487-3489)GCC>ACC	p.A1163T		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1163	Extracellular (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCGCCGCTCCGCCCTCTTCCA	0.657													6	12	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84605720	84605720	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84605720G>T	uc004amn.2	+	4	382	c.335G>T	c.(334-336)GGC>GTC	p.G112V		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	112						integral to membrane					0						AGTCCTCGGGGCCAGCATCAT	0.542													10	28	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103109670	103109670	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103109670G>A	uc004bas.2	-	3	414	c.199C>T	c.(199-201)CAT>TAT	p.H67Y	TEX10_uc011lvf.1_Missense_Mutation_p.H2Y|TEX10_uc011lvg.1_Missense_Mutation_p.H70Y|TEX10_uc011lvh.1_Missense_Mutation_p.H2Y|TEX10_uc004bat.2_Missense_Mutation_p.H67Y	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1	67						integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TTGTAGTGATGCATCTGTGAC	0.313													45	204	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123870120	123870120	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123870120G>T	uc004bkx.1	+	6	880	c.849G>T	c.(847-849)ATG>ATT	p.M283I	CEP110_uc004bkw.2_Missense_Mutation_p.M283I	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	283	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						AAAAAAAGATGATAGAAACTG	0.289													3	35	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17146596	17146596	+	Silent	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17146596G>T	uc001ioo.2	-	12	1291	c.1239C>A	c.(1237-1239)GTC>GTA	p.V413V		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	413	EGF-like 6.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AATAACCAGAGACAGTGTCCT	0.378													5	26	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23287294	23287294	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23287294G>A	uc001irm.3	+	11	1476	c.1393G>A	c.(1393-1395)GCA>ACA	p.A465T	ARMC3_uc010qcv.1_Missense_Mutation_p.A465T|ARMC3_uc010qcw.1_Missense_Mutation_p.A202T	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	465	ARM 11.						binding				0						CGCTGTCACCGCAACTGCGTG	0.483													14	16	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24874007	24874007	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24874007C>G	uc001isb.2	-	26	5698	c.5211G>C	c.(5209-5211)ATG>ATC	p.M1737I	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1736	Interaction with CTNNA1.				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TTCCTTTTTTCATAACATCAA	0.408													43	172	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27702350	27702350	+	Missense_Mutation	SNP	G	A	A	rs147881350		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27702350G>A	uc001itu.2	-	1	948	c.830C>T	c.(829-831)ACG>ATG	p.T277M		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	277					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CAGGTTGAGCGTTTTGTTCAC	0.612													19	76	---	---	---	---	PASS
WAC	51322	broad.mit.edu	37	10	28824542	28824542	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824542G>A	uc001iuf.2	+	3	215	c.130G>A	c.(130-132)GAA>AAA	p.E44K	WAC_uc001iud.2_5'UTR|WAC_uc001iue.2_5'UTR|WAC_uc009xlb.2_5'UTR|WAC_uc001iug.2_Missense_Mutation_p.E44K|WAC_uc001iuh.2_5'UTR	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil	44					cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						TCACAGACATGAAAAGATGCG	0.433													26	104	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64944425	64944425	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64944425G>A	uc001jmn.2	-	21	7204	c.6904C>T	c.(6904-6906)CAT>TAT	p.H2302Y	JMJD1C_uc001jml.2_Missense_Mutation_p.H2065Y|JMJD1C_uc001jmm.2_Missense_Mutation_p.H2014Y|JMJD1C_uc010qiq.1_Missense_Mutation_p.H2120Y|JMJD1C_uc009xpi.2_Missense_Mutation_p.H2120Y|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_Missense_Mutation_p.H209Y	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2302	JmjC.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCTGGCAAATGAGAGGCCAAA	0.378													31	96	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85984344	85984344	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85984344G>T	uc001kcy.2	-	2	645	c.637C>A	c.(637-639)CAG>AAG	p.Q213K	LRIT2_uc010qmc.1_Missense_Mutation_p.Q213K	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	213	LRRCT.					integral to membrane				ovary(2)	2						TTGACAAACTGGACAAGCCCC	0.557													26	73	---	---	---	---	PASS
SEC31B	25956	broad.mit.edu	37	10	102262235	102262235	+	Missense_Mutation	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102262235C>A	uc001krc.1	-	11	1288	c.1186G>T	c.(1186-1188)GGG>TGG	p.G396W	SEC31B_uc010qpo.1_Missense_Mutation_p.G395W|SEC31B_uc001krd.1_Translation_Start_Site|SEC31B_uc001krf.1_Translation_Start_Site|SEC31B_uc001kre.1_Translation_Start_Site|SEC31B_uc001krg.1_Translation_Start_Site	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B	396					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		ACCAGCTTCCCTCCAAACTGG	0.493													4	68	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108432647	108432647	+	Silent	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108432647T>C	uc001kym.2	-	15	2045	c.2037A>G	c.(2035-2037)AGA>AGG	p.R679R	SORCS1_uc001kyl.2_Silent_p.R679R|SORCS1_uc009xxs.2_Silent_p.R679R|SORCS1_uc001kyn.1_Silent_p.R679R|SORCS1_uc001kyo.2_Silent_p.R679R	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	679	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCTGCCAAGGTCTGTAGTCCT	0.502													5	65	---	---	---	---	PASS
ADD3	120	broad.mit.edu	37	10	111881894	111881894	+	Silent	SNP	A	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111881894A>G	uc001kyt.3	+	10	1301	c.987A>G	c.(985-987)GGA>GGG	p.G329G	ADD3_uc001kys.3_Silent_p.G329G|ADD3_uc001kyu.2_Silent_p.G329G|ADD3_uc001kyv.2_Silent_p.G329G|ADD3_uc001kyw.2_Silent_p.G329G|ADD3_uc001kyx.2_5'Flank	NM_016824	NP_058432	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma) isoform a	329						cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton			ovary(2)|skin(2)|large_intestine(1)	5		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GTGCAGGTGGAGTAGACAATC	0.413													31	112	---	---	---	---	PASS
SVIP	258010	broad.mit.edu	37	11	22849396	22849396	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22849396C>A	uc001mqp.3	-	2	167	c.79G>T	c.(79-81)GAG>TAG	p.E27*	uc001mqq.1_5'Flank	NM_148893	NP_683691	Q8NHG7	SVIP_HUMAN	small VCP/p97-interacting protein	27						Golgi membrane|plasma membrane|smooth endoplasmic reticulum membrane					0						TCTGCAGCCTCTGCAAGCTTT	0.269													12	44	---	---	---	---	PASS
C11orf83	790955	broad.mit.edu	37	11	62439422	62439422	+	Intron	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62439422C>G	uc001nui.3	+						C11orf48_uc001nue.2_5'Flank|C11orf48_uc001nuf.2_5'Flank|C11orf48_uc010rmd.1_5'Flank	NM_001085372	NP_001078841	Q6UW78	CK083_HUMAN	hypothetical protein LOC790955 precursor							extracellular region					0						TTCCTGCCCTCAGGAGATGCC	0.637													14	40	---	---	---	---	PASS
SIK2	23235	broad.mit.edu	37	11	111571629	111571629	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111571629C>G	uc001plt.2	+	5	616	c.498C>G	c.(496-498)TTC>TTG	p.F166L		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	166	Protein kinase.				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						TTGGAAATTTCTTTAAAAGTG	0.398													25	52	---	---	---	---	PASS
APOA1	335	broad.mit.edu	37	11	116708092	116708092	+	Silent	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116708092C>A	uc001ppu.1	-	2	91	c.12G>T	c.(10-12)GCG>GCT	p.A4A	APOA1_uc001ppv.1_Silent_p.A4A	NM_000039	NP_000030	P02647	APOA1_HUMAN	apolipoprotein A-I preproprotein	4					Cdc42 protein signal transduction|cholesterol efflux|cholesterol homeostasis|cholesterol import|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|negative regulation of cytokine secretion involved in immune response|negative regulation of interleukin-1 beta secretion|negative regulation of very-low-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|phospholipid efflux|platelet activation|platelet degranulation|positive regulation of cholesterol esterification|positive regulation of hydrolase activity|protein stabilization|reverse cholesterol transport	endocytic vesicle|endoplasmic reticulum lumen|plasma membrane|spherical high-density lipoprotein particle|stored secretory granule|very-low-density lipoprotein particle	apolipoprotein A-I receptor binding|beta-amyloid binding|cholesterol binding|cholesterol transporter activity|enzyme binding|high-density lipoprotein particle receptor binding|identical protein binding|phosphatidylcholine-sterol O-acyltransferase activator activity|phospholipid binding				0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		AGGTCAGCACCGCAGCTTTCA	0.642													2	5	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14577421	14577421	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14577421C>G	uc001rbw.2	+	2	730	c.572C>G	c.(571-573)TCT>TGT	p.S191C	ATF7IP_uc010shs.1_Missense_Mutation_p.S191C|ATF7IP_uc001rbu.2_Missense_Mutation_p.S191C|ATF7IP_uc001rbv.1_Missense_Mutation_p.S191C|ATF7IP_uc001rbx.2_Missense_Mutation_p.S191C|ATF7IP_uc010sht.1_Missense_Mutation_p.S191C|ATF7IP_uc001rby.3_Missense_Mutation_p.S191C|ATF7IP_uc001rbz.1_Missense_Mutation_p.S191C|ATF7IP_uc001rca.2_Missense_Mutation_p.S191C|ATF7IP_uc001rcb.2_5'Flank	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	191					DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						GATGCCACCTCTGGTGATGCC	0.562													48	137	---	---	---	---	PASS
OVCH1	341350	broad.mit.edu	37	12	29649141	29649141	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29649141G>A	uc001rix.1	-	3	254	c.254C>T	c.(253-255)GCA>GTA	p.A85V		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	85	Peptidase S1 1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GCAGTGTGCTGCTGTAACAAC	0.463													5	10	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48528576	48528576	+	Silent	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48528576C>T	uc001rrc.2	+	8	881	c.711C>T	c.(709-711)GAC>GAT	p.D237D	PFKM_uc001rra.1_Translation_Start_Site|PFKM_uc001rrb.1_Silent_p.D308D|PFKM_uc001rrd.2_Translation_Start_Site|PFKM_uc001rre.1_Silent_p.D237D|PFKM_uc001rrg.1_Silent_p.D237D	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	237					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						CACCAGATGACGACTGGGAGG	0.512													31	81	---	---	---	---	PASS
ERP29	10961	broad.mit.edu	37	12	112460369	112460369	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112460369G>A	uc001ttk.1	+	3	817	c.699G>A	c.(697-699)ATG>ATA	p.M233I	ERP29_uc001ttl.1_3'UTR	NM_006817	NP_006808	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29 isoform 1	233					intracellular protein transport|protein folding|protein secretion	endoplasmic reticulum lumen|melanosome	protein disulfide isomerase activity				0						AGAACAAGATGAGTGACGGGA	0.507													57	133	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	130015677	130015677	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130015677G>A	uc009zyl.1	-	3	1370	c.1042C>T	c.(1042-1044)CGC>TGC	p.R348C		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	348	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TAATCCGTGCGCTCCTTGACA	0.527													5	61	---	---	---	---	PASS
CPB2	1361	broad.mit.edu	37	13	46658397	46658397	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46658397C>T	uc001vaw.2	-	3	299	c.232G>A	c.(232-234)GAC>AAC	p.D78N	uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Missense_Mutation_p.D78N	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a	78					blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		TTCACATTGTCGACATCAGAT	0.388													39	95	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60545227	60545227	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60545227G>A	uc001vht.2	-	16	1937	c.1718C>T	c.(1717-1719)TCA>TTA	p.S573L	DIAPH3_uc001vhu.2_Missense_Mutation_p.S310L|DIAPH3_uc001vhv.2_Missense_Mutation_p.S151L	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	573	FH1.|Pro-rich.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGGAAGTGCTGAGTGGCCAGT	0.537													3	24	---	---	---	---	PASS
RNF219	79596	broad.mit.edu	37	13	79189884	79189884	+	Missense_Mutation	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79189884G>C	uc001vkw.1	-	6	2071	c.2012C>G	c.(2011-2013)TCT>TGT	p.S671C	uc001vku.1_RNA|RNF219_uc010afb.1_Missense_Mutation_p.S481C|RNF219_uc010afc.2_Intron	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219	671	Ser-rich.						zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		CTTAAACAAAGATGACCCAAA	0.403													51	105	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101728269	101728269	+	Silent	SNP	G	A	A	rs143218624		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101728269G>A	uc001vox.1	-	35	4098	c.3909C>T	c.(3907-3909)GGC>GGT	p.G1303G		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1303	Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCACACAAGCGCCCATCATGT	0.318													46	116	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21871345	21871345	+	Missense_Mutation	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21871345C>A	uc001was.1	-	18	2802	c.2708G>T	c.(2707-2709)CGA>CTA	p.R903L	CHD8_uc001war.1_Missense_Mutation_p.R799L|CHD8_uc001wav.1_Missense_Mutation_p.R345L	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1182	Helicase C-terminal.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GCCTCTAACTCGCCCATCAAT	0.488													3	61	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24795105	24795105	+	Intron	SNP	T	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24795105T>C	uc001wov.2	-						ADCY4_uc001wow.2_Intron|ADCY4_uc010toh.1_Intron|ADCY4_uc001wox.2_Intron|ADCY4_uc001woy.2_Intron	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		TGGTGGGAGGTGGGAGGGTGG	0.587													5	15	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58827643	58827643	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58827643G>A	uc001xdp.2	+	19	2217	c.1963G>A	c.(1963-1965)GAA>AAA	p.E655K	ARID4A_uc001xdo.2_Missense_Mutation_p.E655K|ARID4A_uc001xdq.2_Missense_Mutation_p.E655K|ARID4A_uc010apg.1_Missense_Mutation_p.E333K	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	655					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TGAAAAGGACGAAAAGAGAGA	0.393													5	103	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73566412	73566412	+	Missense_Mutation	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73566412G>C	uc001xno.2	+	9	1029	c.821G>C	c.(820-822)AGA>ACA	p.R274T	RBM25_uc001xnn.3_Missense_Mutation_p.R274T|RBM25_uc010ttu.1_Missense_Mutation_p.R274T|RBM25_uc001xnp.2_Missense_Mutation_p.R69T	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	274					apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		GAAGACAAAAGAGACCTGATA	0.353													32	131	---	---	---	---	PASS
COPS2	9318	broad.mit.edu	37	15	49420152	49420152	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49420152C>T	uc001zxf.2	-	13	1406	c.1327G>A	c.(1327-1329)GCT>ACT	p.A443T	COPS2_uc001zxh.2_Missense_Mutation_p.A450T|COPS2_uc010ufa.1_Missense_Mutation_p.A379T	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog	443					cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		CTCTGTTAAGCCAGTTTACTG	0.428													14	126	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52664329	52664329	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52664329C>G	uc002aby.2	-	21	3053	c.2809G>C	c.(2809-2811)GAT>CAT	p.D937H	MYO5A_uc002abx.3_Missense_Mutation_p.D937H|MYO5A_uc010uge.1_Missense_Mutation_p.D806H	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	937	Potential.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ACCTGCTCATCAACTTTGCGC	0.458													16	127	---	---	---	---	PASS
PLEKHO2	80301	broad.mit.edu	37	15	65157935	65157935	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65157935G>A	uc002anv.2	+	6	1455	c.1321G>A	c.(1321-1323)GAA>AAA	p.E441K	PLEKHO2_uc010bgz.2_Missense_Mutation_p.E117K|PLEKHO2_uc002anw.2_Missense_Mutation_p.E391K	NM_025201	NP_079477	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O	441	Potential.									ovary(1)|lung(1)	2						TGTTAGTGCCGAAACATTGCT	0.602													33	49	---	---	---	---	PASS
GLIS2	84662	broad.mit.edu	37	16	4383433	4383433	+	Silent	SNP	A	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4383433A>G	uc002cwc.1	+	2	315	c.258A>G	c.(256-258)CCA>CCG	p.P86P		NM_032575	NP_115964	Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	86	Transcription activation (By similarity).|Interaction with CTNND1 (By similarity).				cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development	cytoplasm|nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|transcription regulatory region DNA binding|zinc ion binding				0						TGTCACCACCATCTGGGCTGG	0.657													11	47	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22122307	22122307	+	Silent	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22122307C>T	uc010vbq.1	+	8	777	c.681C>T	c.(679-681)AGC>AGT	p.S227S	VWA3A_uc010bxc.2_Silent_p.S214S	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	227						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		TGGAAGTCAGCGCCTCCACGT	0.522													3	28	---	---	---	---	PASS
TAT	6898	broad.mit.edu	37	16	71605524	71605524	+	Missense_Mutation	SNP	C	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71605524C>G	uc002fap.2	-	7	843	c.744G>C	c.(742-744)GAG>GAC	p.E248D		NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	248					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	CTCCATAGATCTCATCAGCTA	0.363													23	78	---	---	---	---	PASS
ZBTB4	57659	broad.mit.edu	37	17	7369409	7369409	+	Missense_Mutation	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7369409G>T	uc002ghc.3	-	3	962	c.712C>A	c.(712-714)CAG>AAG	p.Q238K	ZBTB4_uc002ghd.3_Missense_Mutation_p.Q238K	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	238	C2H2-type 1; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		TTTCCACACTGGGGGCAGGGG	0.711													3	31	---	---	---	---	PASS
SARM1	23098	broad.mit.edu	37	17	26723045	26723045	+	Missense_Mutation	SNP	A	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26723045A>T	uc010crl.1	+	11	2112	c.2045A>T	c.(2044-2046)AAG>ATG	p.K682M	SARM1_uc010waj.1_RNA|SARM1_uc002hbe.1_Missense_Mutation_p.K226M|SLC46A1_uc002hbf.1_3'UTR|SLC46A1_uc002hbg.1_3'UTR	NM_015077	NP_055892	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	682					innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AACGGTATCAAGTGAGCCCCA	0.587													8	173	---	---	---	---	PASS
ZNF830	91603	broad.mit.edu	37	17	33288808	33288808	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33288808C>T	uc002hih.3	+	1	260	c.223C>T	c.(223-225)CAC>TAC	p.H75Y	CCT6B_uc002hig.2_5'Flank|CCT6B_uc010ctg.2_5'Flank|CCT6B_uc010wcc.1_5'Flank	NM_052857	NP_443089	Q96NB3	ZN830_HUMAN	coiled-coil domain containing 16	75	C2H2-type.				cell division|mitosis	cytoplasm|nucleus	metal ion binding			breast(1)	1		Ovarian(249;0.17)				GGGAAAGCAGCACCGAGAGAA	0.597													24	107	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34182754	34182754	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34182754C>T	uc002hke.1	-	14	1428	c.1279G>A	c.(1279-1281)GGT>AGT	p.G427S	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.G387S	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	427							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCCAGGACACCCTGGCAGAGG	0.522													10	106	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61886910	61886910	+	Intron	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61886910G>T	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron|DDX42_uc002jbx.2_Intron|DDX42_uc002jby.2_5'Flank	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						TCATTTTGTTGATCTTATAGG	0.373													32	64	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62290374	62290374	+	Silent	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62290374G>A	uc002jec.2	-	2	1377	c.1204C>T	c.(1204-1206)CTG>TTG	p.L402L	TEX2_uc002jed.2_Silent_p.L402L|TEX2_uc002jee.2_Silent_p.L402L	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	402					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CATTTCTCCAGAACTAGAGAA	0.463													36	133	---	---	---	---	PASS
DAPK3	1613	broad.mit.edu	37	19	3964677	3964677	+	Silent	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3964677G>A	uc002lzc.1	-	2	468	c.375C>T	c.(373-375)GAC>GAT	p.D125D	DAPK3_uc002lzb.1_5'Flank|DAPK3_uc002lzd.1_Silent_p.D125D	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3	125	Protein kinase.				apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTGAACGCCGTCCAGGATCT	0.637													31	188	---	---	---	---	PASS
CLEC4G	339390	broad.mit.edu	37	19	7795902	7795902	+	Intron	SNP	G	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7795902G>T	uc002mhp.3	-							NM_198492	NP_940894	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G							integral to membrane	protein binding|sugar binding				0						cctcgaccgcgcccccTCACA	0.313													13	39	---	---	---	---	PASS
ZSWIM4	65249	broad.mit.edu	37	19	13910663	13910663	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13910663G>A	uc002mxh.1	+	2	472	c.283G>A	c.(283-285)GAT>AAT	p.D95N		NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	95							zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GGGCGAGCACGATGCCCGGGT	0.637													33	106	---	---	---	---	PASS
NR2C2AP	126382	broad.mit.edu	37	19	19313670	19313670	+	Missense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19313670C>T	uc002nlx.2	-	2	428	c.59G>A	c.(58-60)CGC>CAC	p.R20H	NR2C2AP_uc010xqq.1_5'Flank|NR2C2AP_uc002nly.2_Missense_Mutation_p.R20H	NM_176880	NP_795361	Q86WQ0	NR2CA_HUMAN	TR4 orphan receptor associated protein TRA16	20					cell adhesion|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm				ovary(1)	1			Epithelial(12;0.00235)			CCGAGTGTTGCGATTCAGCAC	0.572													13	66	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19327835	19327835	+	Missense_Mutation	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19327835G>C	uc002nlz.2	+	2	172	c.73G>C	c.(73-75)GGC>CGC	p.G25R		NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	25					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			TGGGGAACAGGGTGAGTTGGT	0.562													6	212	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544539	23544539	+	Silent	SNP	A	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544539A>T	uc002nre.2	-	4	1355	c.1242T>A	c.(1240-1242)GCT>GCA	p.A414A	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Silent_p.A382A	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	414	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ATCGATTAAAAGCTTTGCCAC	0.343													7	68	---	---	---	---	PASS
ZNF175	7728	broad.mit.edu	37	19	52084764	52084764	+	Missense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52084764G>A	uc002pxb.2	+	3	571	c.193G>A	c.(193-195)GCA>ACA	p.A65T		NM_007147	NP_009078	Q9Y473	ZN175_HUMAN	zinc finger protein 175	65	KRAB.				response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CCATCTCTTCGCAGTGGGTGA	0.547													23	60	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55331284	55331284	+	Missense_Mutation	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55331284G>C	uc002qhk.3	+	4	535	c.472G>C	c.(472-474)GAG>CAG	p.E158Q	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.E100Q|KIR3DL1_uc010esf.2_Missense_Mutation_p.E63Q|KIR3DL1_uc010yfo.1_Missense_Mutation_p.E100Q|KIR3DL1_uc002qhl.3_Missense_Mutation_p.E158Q	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	158	Extracellular (Potential).|Ig-like C2-type 2.				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		TCTGCACAAAGAGGGGATCTC	0.537													63	279	---	---	---	---	PASS
KRTAP11-1	337880	broad.mit.edu	37	21	32253432	32253432	+	Missense_Mutation	SNP	A	G	G			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32253432A>G	uc002yov.2	-	1	443	c.412T>C	c.(412-414)TCT>CCT	p.S138P		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	138	3.|4 X 10 AA approximate repeats.					keratin filament	structural molecule activity			pancreas(1)	1						CAGACAGTAGAGACTCCTCCC	0.592													5	97	---	---	---	---	PASS
APOBEC3D	140564	broad.mit.edu	37	22	39417539	39417539	+	Intron	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39417539C>A	uc011aoe.1	+						APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Silent_p.I5I|APOBEC3D_uc003awt.3_Silent_p.I5I|APOBEC3D_uc010gxu.2_5'UTR	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					ATCCACAGATCAGGTACCGCT	0.463													12	43	---	---	---	---	PASS
TBL1X	6907	broad.mit.edu	37	X	9677371	9677371	+	Intron	SNP	G	C	C			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9677371G>C	uc010ndq.2	+						TBL1X_uc004csq.3_Intron|TBL1X_uc010ndr.2_Intron|TBL1X_uc004csr.2_Intron|TBL1X_uc004css.2_Intron	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN	transducin beta-like 1X isoform a						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)				AGGTAGAGTCGGCATGGCAAG	0.507											OREG0019658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	46	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30686131	30686131	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30686131G>A	uc004dch.3	+	3	334	c.155G>A	c.(154-156)TGG>TAG	p.W52*	GK_uc010ngj.2_Nonsense_Mutation_p.W52*|GK_uc004dci.3_Nonsense_Mutation_p.W52*|GK_uc011mjz.1_5'UTR|GK_uc011mka.1_Intron|GK_uc010ngk.2_Intron	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	52					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						GTTCAAAGATGGGTGGAACAG	0.353													19	69	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50378576	50378576	+	Missense_Mutation	SNP	C	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378576C>A	uc004dpe.2	-	4	523	c.497G>T	c.(496-498)GGC>GTC	p.G166V	SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.G50V	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	166					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GGTGGCTTGGCCTGGTTGCTC	0.552													11	65	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109696778	109696778	+	Missense_Mutation	SNP	C	T	T	rs146399635	byFrequency	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109696778C>T	uc004eor.1	+	3	3179	c.2933C>T	c.(2932-2934)CCG>CTG	p.P978L	RGAG1_uc011msr.1_Missense_Mutation_p.P978L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	978										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						ATGTCTATGCCGCTAATGGAA	0.498													88	251	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	114082600	114082600	+	Silent	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114082600C>T	uc004epu.1	+	5	1112	c.384C>T	c.(382-384)CCC>CCT	p.P128P	HTR2C_uc010nqc.1_Silent_p.P128P|HTR2C_uc004epv.1_Silent_p.P128P	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	128	Helical; Name=3; (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	ATTTGTGCCCCGTCTGGATTT	0.408													22	262	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117752608	117752608	+	Missense_Mutation	SNP	A	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117752608A>T	uc004eqp.2	+	31	3451	c.3388A>T	c.(3388-3390)AAT>TAT	p.N1130Y	DOCK11_uc004eqq.2_Missense_Mutation_p.N909Y	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1130					blood coagulation	cytosol	GTP binding			ovary(3)	3						TCTTCAGGACAATTATGAGAT	0.363													7	144	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649493	136649493	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649493C>T	uc004fak.2	+	1	1148	c.643C>T	c.(643-645)CAG>TAG	p.Q215*		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	215					cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GGCCGGCGCTCAGTTTCCTAA	0.657													25	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	48209043	48209044	+	IGR	INS	-	GGA	GGA	rs143555360	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48209043_48209044insGGA								FOXD2 (302681 upstream) : SKINTL (358343 downstream)																							gtggtggtggtagtggtggtgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94871896	94871896	+	IGR	DEL	G	-	-	rs12091363		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94871896delG								ARHGAP29 (131272 upstream) : ABCD3 (12037 downstream)																							aTTTTGTTTTGTTTTTTTTTT	0.184													6	4	---	---	---	---	
POGZ	23126	broad.mit.edu	37	1	151384339	151384339	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151384339delA	uc001eyd.1	-						POGZ_uc001eye.1_Intron|POGZ_uc010pdb.1_Intron|POGZ_uc001eyf.1_Intron|POGZ_uc010pdc.1_Intron|POGZ_uc009wmv.1_Intron|POGZ_uc010pdd.1_Intron	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain						cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding			ovary(3)	3	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			tttttaaattaaaaaaaaaaa	0.299													6	4	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800932	153800933	+	Intron	DEL	AC	-	-	rs71677766		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800932_153800933delAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTcacacatacacacacacac	0.233													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801335	91801336	+	IGR	INS	-	CAATG	CAATG	rs56326147		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801335_91801336insCAATG								None (None upstream) : LOC654342 (3856 downstream)																							tcatgactaccattagctccca	0.000													3	5	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113596306	113596308	+	5'Flank	DEL	TTC	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113596306_113596308delTTC	uc002tii.1	-							NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	tttcttttctttctttctttctt	0.084													4	2	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44887009	44887009	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44887009delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TCTGGCACCTAAAAAAAAAAG	0.378													4	2	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132404892	132404893	+	Intron	INS	-	A	A	rs78161722		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132404892_132404893insA	uc003epe.1	-						NPHP3_uc003eoz.1_5'Flank|NPHP3_uc003epd.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						gactccgtctcaaaaaaaaaaa	0.144													5	3	---	---	---	---	
KLHL6	89857	broad.mit.edu	37	3	183245488	183245489	+	Intron	DEL	GT	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183245488_183245489delGT	uc003flr.2	-						KLHL6_uc003fls.1_Intron|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6											haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			AGGGgtgtgcgtgtgtgtgtgt	0.371													8	4	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83785931	83785932	+	Intron	INS	-	T	T			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83785931_83785932insT	uc003hnf.2	-						SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				tggttttttggttttttttttt	0.163													4	2	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237576	31237577	+	Intron	DEL	CA	-	-	rs72558156		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237576_31237577delCA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						CCTTCATTGTCACATGTGCTTC	0.520													6	5	---	---	---	---	
CCDC28A	25901	broad.mit.edu	37	6	139109706	139109717	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs7349837	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139109706_139109717delTTTTTTTTTTTT	uc003qie.2	+							NM_015439	NP_056254	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A												0				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		ttttcttttctttttttttttttttttttttt	0.132													6	4	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7557619	7557619	+	Intron	DEL	A	-	-	rs67184564		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7557619delA	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_5'Flank	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CAATCTAGGCAAAAAAAAAAA	0.368													5	3	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43375383	43375386	+	Intron	DEL	CTTC	-	-	rs78981700		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43375383_43375386delCTTC	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						ttcttcctttcttccttccttcct	0.010													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975181	64975184	+	IGR	DEL	TTTG	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975181_64975184delTTTG								ZNF92 (109184 upstream) : INTS4L2 (137593 downstream)																							CACATTCTGATTTGTTTTTTGTAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8776968	8776979	+	IGR	DEL	TGTGTGTGTGTG	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8776968_8776979delTGTGTGTGTGTG								MFHAS1 (25837 upstream) : ERI1 (83335 downstream)																							catactcctttgtgtgtgtgtgtgtgtgtgtg	0.000													3	3	---	---	---	---	
ADHFE1	137872	broad.mit.edu	37	8	67357335	67357336	+	Intron	INS	-	A	A	rs143198813	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67357335_67357336insA	uc003xwb.3	+						ADHFE1_uc003xwd.3_Intron|ADHFE1_uc003xwc.3_Intron|ADHFE1_uc003xwe.3_Intron|ADHFE1_uc003xwf.3_Intron|ADHFE1_uc011les.1_Intron|ADHFE1_uc011leq.1_Intron|ADHFE1_uc011ler.1_Intron	NM_144650	NP_653251	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1						2-oxoglutarate metabolic process|molecular hydrogen transport	mitochondrial matrix	hydroxyacid-oxoacid transhydrogenase activity|metal ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			gactccgtctcaaaaaaaaaac	0.129													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													5	3	---	---	---	---	
SCRIB	23513	broad.mit.edu	37	8	144874132	144874133	+	Intron	INS	-	C	C	rs149884795	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874132_144874133insC	uc003yzp.1	-						SCRIB_uc003yzn.1_Intron|SCRIB_uc003yzo.1_Intron	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b						activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CGGCAGGCTGACCCCCCCGACC	0.738													9	4	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36080539	36080539	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36080539delA	uc003zyv.2	+						RECK_uc010mld.2_Intron|RECK_uc003zyu.3_Intron|RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CATAAAGTGGAATTAAATTAC	0.274													19	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	26958525	26958527	+	IGR	DEL	AAG	-	-	rs138608083		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26958525_26958527delAAG								LOC731789 (16143 upstream) : PDSS1 (28068 downstream)																							aagaaaagaaaagaagaaGAATC	0.133													4	6	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70392593	70392593	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70392593delA	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TTTAAGTTGTaaaaaaaaaaa	0.264													17	8	---	---	---	---	
TNKS2	80351	broad.mit.edu	37	10	93582313	93582314	+	Intron	INS	-	TGTTT	TGTTT	rs139143201	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93582313_93582314insTGTTT	uc001khp.2	+							NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				GAGATACCATAtgttttgtttt	0.149													3	4	---	---	---	---	
BTRC	8945	broad.mit.edu	37	10	103292507	103292508	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103292507_103292508insTGTGTG	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTGAAGCTATAtgtgtgtgtgt	0.317													6	3	---	---	---	---	
CPXM2	119587	broad.mit.edu	37	10	125540252	125540255	+	Intron	DEL	CCTT	-	-	rs66915589		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125540252_125540255delCCTT	uc001lhk.1	-						CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CATTCATTCCccttccttccttcc	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30925317	30925317	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30925317delA	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		TAAAAATCTGAAAAAAAAAAT	0.318													4	2	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67829386	67829387	+	Intron	INS	-	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829386_67829387insA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	GGAGTAGGAAGAAAAAAAAAAA	0.406													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80765684	80765686	+	Intron	DEL	GAA	-	-	rs56017107		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80765684_80765686delGAA	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																		ATTTTTCTATGAAGGCTTTGTGG	0.246													4	3	---	---	---	---	
UHRF1BP1L	23074	broad.mit.edu	37	12	100443929	100443930	+	Intron	INS	-	A	A	rs150785024		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100443929_100443930insA	uc001tgq.2	-						UHRF1BP1L_uc001tgp.2_Intron	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						Gaaaaataattaaaaaaaaaaa	0.317													5	3	---	---	---	---	
CDK2AP1	8099	broad.mit.edu	37	12	123750055	123750055	+	Intron	DEL	A	-	-	rs146967934		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123750055delA	uc001ueq.2	-						CDK2AP1_uc001uep.2_Intron	NM_004642	NP_004633	O14519	CDKA1_HUMAN	CDK2-associated protein  1						DNA-dependent DNA replication|protein phosphorylation|S phase of mitotic cell cycle	cytoplasm|nucleus	DNA binding|protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000554)|Epithelial(86;0.00178)		atctcgggggaaaaaaaaaaa	0.303													4	2	---	---	---	---	
SPATA13	221178	broad.mit.edu	37	13	24853068	24853071	+	Intron	DEL	TTCC	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24853068_24853071delTTCC	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc010tcy.1_Intron|SPATA13_uc010tcz.1_Intron|SPATA13_uc010tda.1_Intron|SPATA13_uc001uph.2_Intron|SPATA13_uc010tdb.1_Intron	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		ccttccctctttccttccttcctt	0.093													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	41869698	41869699	+	IGR	INS	-	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41869698_41869699insA								MTRF1 (31956 upstream) : NAA16 (15642 downstream)																							taacaggtctgaaaaaaaaaag	0.000													4	2	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123118	100123123	+	Intron	DEL	GAAAAG	-	-	rs72341366		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123118_100123123delGAAAAG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				tctgcaaaaagaaaagaaaagaaaga	0.000													5	5	---	---	---	---	
ALDH1A2	8854	broad.mit.edu	37	15	58471708	58471709	+	Intron	INS	-	TG	TG	rs147605496	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58471708_58471709insTG	uc010ugw.1	-						AQP9_uc010ugx.1_Intron|AQP9_uc002aez.2_Intron	NM_170697	NP_733798	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TTGTGGTATGAtgtgtgtgtgt	0.307													4	2	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													3	3	---	---	---	---	
IGDCC3	9543	broad.mit.edu	37	15	65623124	65623125	+	Intron	INS	-	TCTA	TCTA	rs150339477	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623124_65623125insTCTA	uc002aos.2	-						IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule											ovary(3)	3						CCAGTGGAAGCTCTATCTTTCT	0.569													3	5	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21142757	21142758	+	Intron	INS	-	AAGA	AAGA	rs147176563	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21142757_21142758insAAGA	uc010vbe.1	-						DNAH3_uc002die.2_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		gaaaagaaaggaagaaagaaag	0.035													6	5	---	---	---	---	
HSDL1	83693	broad.mit.edu	37	16	84165089	84165092	+	Intron	DEL	TCTA	-	-	rs36192181	by1000genomes	TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84165089_84165092delTCTA	uc002fhk.2	-						HSDL1_uc010vnv.1_Intron	NM_031463	NP_113651	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1 isoform a							mitochondrion	oxidoreductase activity|protein binding				0						ACAGTTTCAGtctatctatctatc	0.206													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7642926	7642926	+	Intron	DEL	T	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7642926delT	uc002giu.1	+						DNAH2_uc002git.2_Intron|DNAH2_uc010vuk.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTTCTTCTTCTTTTTTTTTTT	0.413													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	65772734	65772734	+	IGR	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65772734delA								NOL11 (32468 upstream) : BPTF (49046 downstream)																							actccatctcaaaaaaaaaaa	0.229													9	4	---	---	---	---	
KIAA0195	9772	broad.mit.edu	37	17	73467795	73467795	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73467795delA	uc002jnz.3	+							NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			actccgtctcaaaaaaaaaaa	0.189													4	5	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1046580	1046580	+	Intron	DEL	G	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1046580delG	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGTCTGGTGGGGGGGGGGA	0.652													4	5	---	---	---	---	
PRDX2	7001	broad.mit.edu	37	19	12908143	12908143	+	Intron	DEL	T	-	-	rs112459805		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12908143delT	uc002mvd.2	-							NM_005809	NP_005800	P32119	PRDX2_HUMAN	peroxiredoxin 2 isoform a						anti-apoptosis|cell redox homeostasis|hydrogen peroxide catabolic process|removal of superoxide radicals		thioredoxin peroxidase activity				0						GTAttttttcttttttttttt	0.224													4	2	---	---	---	---	
HKR1	284459	broad.mit.edu	37	19	37852826	37852827	+	Intron	DEL	AC	-	-	rs11344990		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37852826_37852827delAC	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaaaacaaaaaaacaa	0.144													5	4	---	---	---	---	
PPP1R12C	54776	broad.mit.edu	37	19	55604787	55604788	+	Intron	INS	-	C	C	rs74182550		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55604787_55604788insC	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		aggagtccaggccccagcccct	0.000													6	3	---	---	---	---	
TGM6	343641	broad.mit.edu	37	20	2376286	2376286	+	Intron	DEL	G	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2376286delG	uc002wfy.1	+						TGM6_uc010gal.1_Intron	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6						cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	AGAGGACCCAGTGGGCAAGAG	0.338													6	4	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26761678	26761678	+	Intron	DEL	A	-	-	rs675083		TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26761678delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						catctctaccaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1352193	1352194	+	IGR	INS	-	A	A			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1352193_1352194insA								CRLF2 (20663 upstream) : CSF2RA (35499 downstream)																							aactccgtcagaaaaaaaaaag	0.054													5	7	---	---	---	---	
ARHGEF9	23229	broad.mit.edu	37	X	62864048	62864048	+	Intron	DEL	A	-	-			TCGA-DR-A0ZL-01	TCGA-DR-A0ZL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62864048delA	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						cttgaaatacaaaaaaaaaaa	0.015													4	3	---	---	---	---	
