Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MMEL1	79258	broad.mit.edu	37	1	2537001	2537001	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2537001C>T	uc001ajy.2	-	9	1026	c.812G>A	c.(811-813)CGG>CAG	p.R271Q	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	271	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		ACCCACCTTCCGGTTGCTGCC	0.647													46	59	---	---	---	---	PASS
CLCN6	1185	broad.mit.edu	37	1	11900256	11900256	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11900256G>A	uc001ate.3	+	23	2699	c.2586G>A	c.(2584-2586)CTG>CTA	p.L862L	CLCN6_uc010oat.1_Silent_p.L578L|CLCN6_uc010oau.1_Silent_p.L840L|CLCN6_uc010oav.1_5'Flank|CLCN6_uc010oaw.1_5'Flank|CLCN6_uc010oax.1_5'Flank|CLCN6_uc010oay.1_5'Flank|CLCN6_uc010oaz.1_5'Flank|CLCN6_uc010oba.1_5'Flank	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	862	CBS 2.|Cytoplasmic (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCCCGGCTGAGGCAGCACT	0.607													81	115	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16256225	16256225	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16256225G>A	uc001axk.1	+	11	3694	c.3490G>A	c.(3490-3492)GAT>AAT	p.D1164N	SPEN_uc010obp.1_Missense_Mutation_p.D1123N	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1164					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CATTGACATCGATCACACGCA	0.393													18	43	---	---	---	---	PASS
EPHA2	1969	broad.mit.edu	37	1	16474972	16474972	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16474972C>T	uc001aya.1	-	3	861	c.724G>A	c.(724-726)GAG>AAG	p.E242K	EPHA2_uc010oca.1_Missense_Mutation_p.E242K	NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor	242	Extracellular (Potential).|Cys-rich.				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	ATACGGGGCTCTTCACCCCCC	0.667													45	130	---	---	---	---	PASS
SERINC2	347735	broad.mit.edu	37	1	31896551	31896551	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31896551C>T	uc010ogh.1	+	2	264	c.63C>T	c.(61-63)CTC>CTT	p.L21L	SERINC2_uc010ogg.1_Silent_p.L18L|SERINC2_uc009vtw.1_Silent_p.L17L|SERINC2_uc001bst.2_Silent_p.L17L|SERINC2_uc001bsu.2_5'UTR|SERINC2_uc001bsv.2_5'UTR	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	17	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CGTCCTGCCTCTGCGGCTCTG	0.677													13	97	---	---	---	---	PASS
ZMYM4	9202	broad.mit.edu	37	1	35824609	35824609	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35824609C>T	uc001byt.2	+	3	249	c.169C>T	c.(169-171)CCG>TCG	p.P57S	ZMYM4_uc009vuu.2_Missense_Mutation_p.P25S|ZMYM4_uc001byu.2_Intron|ZMYM4_uc009vuv.2_5'UTR	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262	57					multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTATGGAATGCCGAATCAAAC	0.383													4	154	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38227478	38227478	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38227478C>T	uc009vvi.2	-	3	535	c.449G>A	c.(448-450)CGC>CAC	p.R150H	EPHA10_uc001cbw.3_Missense_Mutation_p.R150H	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	150	Extracellular (Potential).		R -> H (in a gastric adenocarcinoma sample; somatic mutation).			extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity	p.R150H(1)		breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTCGATTTTGCGGGGCCGGCT	0.667													26	65	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44157218	44157218	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44157218G>A	uc001cjx.2	+	15	2460	c.2294G>A	c.(2293-2295)CGG>CAG	p.R765Q	KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	765	PHD-type 1.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						ATGTGTTCTCGGTGTTCAGCC	0.502													9	212	---	---	---	---	PASS
CCDC163P	126661	broad.mit.edu	37	1	45960843	45960843	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45960843G>C	uc001cnw.2	-						CCDC163P_uc001cnt.2_Intron|CCDC163P_uc001cnu.2_Intron|CCDC163P_uc009vxt.1_Intron|CCDC163P_uc001cnv.2_Intron|CCDC163P_uc009vxu.1_Intron	NM_001102601	NP_001096071			hypothetical protein LOC126661												0						GGGGATCTAAGAGGAAAGAAA	0.488													42	60	---	---	---	---	PASS
FAF1	11124	broad.mit.edu	37	1	50917782	50917782	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50917782C>T	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron|FAF1_uc010onc.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TGATCCAAGTCTTCAGAATGA	0.318													4	67	---	---	---	---	PASS
PDE4B	5142	broad.mit.edu	37	1	66732396	66732396	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66732396G>C	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Intron	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	GAGCTGCAGAGAGGAAGGGCC	0.373													5	15	---	---	---	---	PASS
GBP3	2635	broad.mit.edu	37	1	89479965	89479965	+	Intron	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89479965G>A	uc001dmt.2	-						GBP3_uc010oss.1_Intron|GBP3_uc001dmu.2_Intron|GBP3_uc001dmv.2_Intron	NM_018284	NP_060754	Q9H0R5	GBP3_HUMAN	guanylate binding protein 3							integral to membrane	GTP binding|GTPase activity			ovary(1)|pancreas(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		TCACATAGCTGAGTAGCTAAC	0.408													34	39	---	---	---	---	PASS
HAX1	10456	broad.mit.edu	37	1	154245822	154245822	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154245822C>T	uc001fes.2	+	2	225	c.64C>T	c.(64-66)CCC>TCC	p.P22S	HAX1_uc001fet.2_Intron|HAX1_uc010peo.1_Missense_Mutation_p.P22S|HAX1_uc009wou.2_5'UTR|HAX1_uc009wov.2_5'UTR	NM_006118	NP_006109	O00165	HAX1_HUMAN	HCLS1 associated protein X-1 isoform a	22	Required for localization in mitochondria (By similarity).					actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding				0	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCACAGAGATCCCTTTTTTGG	0.488									Kostmann_syndrome				40	70	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155931936	155931936	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155931936C>T	uc001fmt.2	-	10	1297	c.1179G>A	c.(1177-1179)AAG>AAA	p.K393K	ARHGEF2_uc001fmr.2_Silent_p.K365K|ARHGEF2_uc001fms.2_Silent_p.K392K|ARHGEF2_uc001fmu.2_Silent_p.K437K|ARHGEF2_uc010pgt.1_Silent_p.K366K|ARHGEF2_uc010pgu.1_Silent_p.K438K	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	393	DH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTAACGGGTACTTGGTGATGC	0.642													35	85	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166963303	166963303	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166963303G>A	uc001gdy.1	+	5	591	c.520G>A	c.(520-522)GCA>ACA	p.A174T	MAEL_uc001gdz.1_Missense_Mutation_p.A143T|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	174					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						TTGTCAGGCTGCAAGTAAGTA	0.323													15	18	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167852753	167852753	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167852753G>A	uc001ger.2	-	9	1240	c.942C>T	c.(940-942)ATC>ATT	p.I314I	ADCY10_uc009wvk.2_Silent_p.I222I|ADCY10_uc010plj.1_Silent_p.I161I|ADCY10_uc009wvl.2_Silent_p.I313I|ADCY10_uc009wvm.2_RNA	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	314	Guanylate cyclase 2.				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						AGGCATCCTGGATGGCTGGGC	0.448													25	129	---	---	---	---	PASS
RALGPS2	55103	broad.mit.edu	37	1	178846666	178846666	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178846666C>T	uc001glz.2	+	9	979	c.641C>T	c.(640-642)TCA>TTA	p.S214L	RALGPS2_uc001gly.1_Missense_Mutation_p.S214L|RALGPS2_uc010pnb.1_Missense_Mutation_p.S214L	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	214	Ras-GEF.				small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						TACATCGATTCAGCATACCCA	0.323													9	56	---	---	---	---	PASS
ARPC5	10092	broad.mit.edu	37	1	183604680	183604680	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183604680C>T	uc001gql.2	-	1	306	c.115G>A	c.(115-117)GAG>AAG	p.E39K	RGL1_uc010pof.1_5'Flank|RGL1_uc001gqm.2_5'Flank|RGL1_uc010pog.1_5'Flank|RGL1_uc010poh.1_5'Flank	NM_005717	NP_005708	O15511	ARPC5_HUMAN	actin related protein 2/3 complex subunit 5	39					actin cytoskeleton organization|cellular component movement|regulation of actin filament polymerization	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|structural constituent of cytoskeleton				0						ACCTCGCCCTCGTCGGGCCCG	0.667													3	23	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390187	197390187	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390187G>A	uc001gtz.2	+	6	1364	c.1229G>A	c.(1228-1230)GGT>GAT	p.G410D	CRB1_uc010poz.1_Missense_Mutation_p.G341D|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.G298D|CRB1_uc010ppb.1_Missense_Mutation_p.G410D|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.G59D	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	410	Extracellular (Potential).|EGF-like 10; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CAAAATGGTGGTACTTGTGAG	0.368													54	88	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205074299	205074299	+	Intron	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205074299G>A	uc001hbu.1	-						RBBP5_uc010prd.1_Intron|RBBP5_uc001hbv.1_Intron|RBBP5_uc010pre.1_Intron	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5						histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			GGCTCCAGCTGAGGAAAAAAA	0.433													16	60	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227152739	227152739	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227152739C>T	uc001hqm.1	+	8	3635	c.216C>T	c.(214-216)TTC>TTT	p.F72F	CABC1_uc010pvp.1_Silent_p.F35F|CABC1_uc001hqn.1_Silent_p.F72F|CABC1_uc009xeq.1_Silent_p.F20F|CABC1_uc010pvq.1_Intron|CABC1_uc010pvr.1_5'Flank	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	72					cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CTGAGAACTTCGGCGGCCCAG	0.592													6	52	---	---	---	---	PASS
COG2	22796	broad.mit.edu	37	1	230804495	230804495	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230804495A>G	uc001htw.2	+	6	710	c.559A>G	c.(559-561)AGC>GGC	p.S187G	COG2_uc001htx.2_Missense_Mutation_p.S187G|COG2_uc010pwc.1_Missense_Mutation_p.S60G	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	187					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TGCTGTTCAAAGCAAAGGCAT	0.378													21	129	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27276285	27276285	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27276285C>T	uc002rie.2	+	3	448	c.231C>T	c.(229-231)TTC>TTT	p.F77F	AGBL5_uc002ric.2_Silent_p.F77F|AGBL5_uc002rid.2_Silent_p.F77F|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	77					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTTCTACTTCAGCGTCCGGG	0.522													34	97	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74435860	74435860	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74435860C>T	uc002skk.2	+						MTHFD2_uc002skj.2_Intron|MTHFD2_uc010yro.1_Intron|MTHFD2_uc010ffb.2_Intron|MTHFD2_uc010yrp.1_Intron	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2						folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	TAGGTATATCCCAGAATTGCA	0.398													59	108	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89247277	89247277	+	RNA	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89247277G>A	uc010ytr.1	-	100		c.7907C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GGAGCTGAGCGGGGACCCTCA	0.552													74	150	---	---	---	---	PASS
FER1L5	90342	broad.mit.edu	37	2	97369333	97369333	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97369333C>T	uc010fia.2	+	50	5873	c.5873C>T	c.(5872-5874)TCG>TTG	p.S1958L	FER1L5_uc002sws.3_Missense_Mutation_p.S667L|FER1L5_uc002swt.3_Missense_Mutation_p.S667L|FER1L5_uc010yus.1_Missense_Mutation_p.S666L	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1958						integral to membrane				ovary(1)	1						CGAGGCCAGTCGGAACCCAAC	0.567													13	75	---	---	---	---	PASS
ZC3H8	84524	broad.mit.edu	37	2	112995977	112995977	+	Silent	SNP	T	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112995977T>C	uc002thp.2	-	3	391	c.285A>G	c.(283-285)CAA>CAG	p.Q95Q		NM_032494	NP_115883	Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	95					apoptosis|negative regulation of T cell differentiation in thymus|negative regulation of transcription, DNA-dependent|positive regulation of thymocyte apoptosis|response to antibiotic|T cell homeostasis	nucleus	RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GTATGTACTGTTGAAGCTCTT	0.378													33	138	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113496492	113496492	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113496492C>T	uc002tie.2	-	9	2225	c.2146G>A	c.(2146-2148)GAA>AAA	p.E716K	CKAP2L_uc002tif.2_Missense_Mutation_p.E305K|CKAP2L_uc010yxp.1_Missense_Mutation_p.E551K|uc002tid.2_Intron	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	716						centrosome					0						TCTAACAGTTCATCAAGAGAA	0.438													77	117	---	---	---	---	PASS
TFCP2L1	29842	broad.mit.edu	37	2	121995282	121995282	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121995282G>A	uc002tmx.2	-	10	1013	c.920C>T	c.(919-921)CCA>CTA	p.P307L	TFCP2L1_uc010flr.2_Missense_Mutation_p.P307L	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9	307					female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)					CGAAGCTGATGGGAGCAGGTG	0.602													42	75	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170930076	170930076	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170930076G>A	uc010zdi.1	+	36	5158	c.5158G>A	c.(5158-5160)GAG>AAG	p.E1720K	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Missense_Mutation_p.E541K|UBR3_uc002uft.3_Missense_Mutation_p.E577K|UBR3_uc010zdj.1_Missense_Mutation_p.E411K|UBR3_uc002ufu.3_Missense_Mutation_p.E226K	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1720					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						GTGGTGTTTTGAGATAAAATC	0.388													24	105	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206882465	206882465	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206882465G>T	uc002vaz.3	-	8	1886	c.1481C>A	c.(1480-1482)TCT>TAT	p.S494Y		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	494					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						AACTGGCACAGAGCACTGCTG	0.363													3	21	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215593735	215593735	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215593735G>C	uc002veu.2	-						BARD1_uc010zjm.1_Intron	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1						cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTTGGCAACTGAAATAATGAG	0.333									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				6	23	---	---	---	---	PASS
MOGAT1	116255	broad.mit.edu	37	2	223553201	223553201	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223553201G>T	uc010fws.1	+	2	281	c.233G>T	c.(232-234)TGG>TTG	p.W78L	MOGAT1_uc010fwt.1_Missense_Mutation_p.W38L	NM_058165	NP_477513	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	78					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			breast(1)	1		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		ATCAAAAATTGGACTCTTTGG	0.368													5	38	---	---	---	---	PASS
TMEM43	79188	broad.mit.edu	37	3	14170936	14170936	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14170936G>A	uc003byk.2	+	2	291	c.37G>A	c.(37-39)GAA>AAA	p.E13K	TMEM43_uc003byl.1_5'Flank	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	13	Nuclear (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1						TACCCGGAGAGAACATGTCAA	0.403													16	29	---	---	---	---	PASS
TMEM43	79188	broad.mit.edu	37	3	14170986	14170986	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14170986G>A	uc003byk.2	+	2	341	c.87G>A	c.(85-87)CTG>CTA	p.L29L	TMEM43_uc003byl.1_5'Flank	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	29	Nuclear (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1						TGGAACGGCTGAGCGAGACCT	0.493													13	33	---	---	---	---	PASS
TMEM43	79188	broad.mit.edu	37	3	14170992	14170992	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14170992G>A	uc003byk.2	+	2	347	c.93G>A	c.(91-93)GAG>GAA	p.E31E	TMEM43_uc003byl.1_5'Flank	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	31	Nuclear (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1						GGCTGAGCGAGACCTCGGGTG	0.498													14	30	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	50816135	50816135	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50816135C>G	uc011bds.1	+	2	90	c.67C>G	c.(67-69)CAA>GAA	p.Q23E		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	23	SH3.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATCTGTCCCTCAAGGGTTGGT	0.383													3	1	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74535723	74535723	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74535723C>G	uc003dpm.1	-	3	322	c.242G>C	c.(241-243)GGA>GCA	p.G81A		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	81	Ig-like C2-type 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AAGATTTCCTCCATTCAACTT	0.373													10	64	---	---	---	---	PASS
TIGIT	201633	broad.mit.edu	37	3	114014436	114014436	+	Missense_Mutation	SNP	G	A	A	rs142063959		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114014436G>A	uc003ebg.1	+	2	140	c.106G>A	c.(106-108)GAG>AAG	p.E36K		NM_173799	NP_776160	Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	36	Extracellular (Potential).|Ig-like V-type.				negative regulation of interleukin-12 production|negative regulation of T cell activation|positive regulation of interleukin-10 production	cell surface|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)	1						CATTTCTGCAGAGAAAGGTGG	0.527													71	172	---	---	---	---	PASS
HGD	3081	broad.mit.edu	37	3	120363243	120363243	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120363243A>G	uc003edw.2	-	10	1067	c.697T>C	c.(697-699)TGG>CGG	p.W233R	HGD_uc003edv.2_Missense_Mutation_p.W92R	NM_000187	NP_000178	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	233					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding				0				GBM - Glioblastoma multiforme(114;0.158)		TCCTCATACCAGGCAATGGGT	0.448													31	165	---	---	---	---	PASS
IQCB1	9657	broad.mit.edu	37	3	121527805	121527805	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121527805G>A	uc010hre.1	-	6	660	c.445C>T	c.(445-447)CTC>TTC	p.L149F	IQCB1_uc003eek.2_Missense_Mutation_p.L149F|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	149					cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		AGCCAGAAGAGAGAATCAGTC	0.323													12	40	---	---	---	---	PASS
NCK1	4690	broad.mit.edu	37	3	136664454	136664454	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136664454G>A	uc003erh.2	+	3	363	c.256G>A	c.(256-258)GTG>ATG	p.V86M	NCK1_uc011bme.1_Missense_Mutation_p.V22M	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1	86					axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						AAAACCTAGTGTGCCAGATTC	0.383													9	72	---	---	---	---	PASS
RASA2	5922	broad.mit.edu	37	3	141278739	141278739	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141278739C>G	uc003etz.1	+	9	765	c.765C>G	c.(763-765)ATC>ATG	p.I255M	RASA2_uc010huq.1_Missense_Mutation_p.I255M|RASA2_uc003eua.1_Missense_Mutation_p.I255M|RASA2_uc011bnc.1_Translation_Start_Site	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	255	C2 2.				intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						TTTTCAGGATCGACTTGTGGA	0.373													3	51	---	---	---	---	PASS
TSC22D2	9819	broad.mit.edu	37	3	150127938	150127938	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150127938G>A	uc003exv.2	+	1	1151	c.801G>A	c.(799-801)CAG>CAA	p.Q267Q	TSC22D2_uc003exw.2_RNA|TSC22D2_uc003exx.2_Silent_p.Q267Q	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2	267							sequence-specific DNA binding transcription factor activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCCAGCCGCAGAGTTTTAGCG	0.697													5	13	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197616500	197616500	+	Nonsense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197616500G>C	uc003fyo.2	-	11	1429	c.1283C>G	c.(1282-1284)TCA>TGA	p.S428*	IQCG_uc003fyn.2_Nonsense_Mutation_p.S330*|IQCG_uc003fyp.2_Nonsense_Mutation_p.S428*|IQCG_uc003fym.2_Nonsense_Mutation_p.S129*	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	428											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TTTGCCTTTTGAATCCTTGCT	0.458													35	216	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10446457	10446457	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10446457C>A	uc003gmn.2	-	3	1983	c.1496G>T	c.(1495-1497)GGA>GTA	p.G499V		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	499					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						TGATGCAGCTCCAAGACTACG	0.373													31	38	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48537794	48537794	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537794C>T	uc003gyh.1	-	48	7049	c.6444G>A	c.(6442-6444)ATG>ATA	p.M2148I	FRYL_uc003gyg.1_Missense_Mutation_p.M844I|FRYL_uc003gyi.1_Missense_Mutation_p.M1036I|FRYL_uc003gyj.1_Missense_Mutation_p.M443I	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2148					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TGTACAAACTCATCATGTGTG	0.368													10	14	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84361036	84361036	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84361036C>T	uc003hom.2	-	8	1967	c.1788G>A	c.(1786-1788)ATG>ATA	p.M596I	HELQ_uc010ikb.2_Missense_Mutation_p.M529I|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	596	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						ATTTGCATATCATTTCTGCTA	0.294								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	27	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104035655	104035655	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104035655C>G	uc003hxb.1	-	46	7587	c.7497G>C	c.(7495-7497)TTG>TTC	p.L2499F	CENPE_uc003hxc.1_Missense_Mutation_p.L2378F	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	2499	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GATTTTCTCTCAATAGCCTTA	0.328													12	64	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114267077	114267077	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114267077C>T	uc003ibe.3	+	35	4370	c.4270C>T	c.(4270-4272)CCT>TCT	p.P1424S	ANK2_uc003ibd.3_Missense_Mutation_p.P1415S|ANK2_uc003ibf.3_Missense_Mutation_p.P1424S|ANK2_uc011cgc.1_Missense_Mutation_p.P600S|ANK2_uc003ibg.3_Missense_Mutation_p.P419S|ANK2_uc003ibh.3_Missense_Mutation_p.P98S|ANK2_uc011cgb.1_Missense_Mutation_p.P1439S	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1391					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GACTCAGGAACCTTGCGGACG	0.408													16	86	---	---	---	---	PASS
ADAD1	132612	broad.mit.edu	37	4	123301290	123301290	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123301290G>C	uc003ieo.2	+	3	298	c.66G>C	c.(64-66)AAG>AAC	p.K22N	ADAD1_uc003iep.2_Missense_Mutation_p.K22N|ADAD1_uc003ieq.2_Missense_Mutation_p.K4N	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1	22					multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						TGCTGAAAAAGAACCTGCCAG	0.483													21	38	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144106889	144106889	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144106889C>G	uc003ijb.2	+	1	820	c.286C>G	c.(286-288)CTG>GTG	p.L96V	USP38_uc003ija.3_Missense_Mutation_p.L96V|USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	96					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					CTACCACTCTCTGGACAGGAA	0.557													31	54	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247245	153247245	+	Nonsense_Mutation	SNP	A	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247245A>T	uc003ims.2	-	10	1706	c.1557T>A	c.(1555-1557)TAT>TAA	p.Y519*	FBXW7_uc011cii.1_Nonsense_Mutation_p.Y519*|FBXW7_uc003imt.2_Nonsense_Mutation_p.Y519*|FBXW7_uc011cih.1_Nonsense_Mutation_p.Y343*|FBXW7_uc003imq.2_Nonsense_Mutation_p.Y439*|FBXW7_uc003imr.2_Nonsense_Mutation_p.Y401*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	519	WD 4.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.Y519D(1)|p.Y519C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCATAAAATCATATGCTCCAC	0.438			Mis|N|D|F		colorectal|endometrial|T-ALL								69	113	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153864414	153864414	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153864414G>A	uc003inf.2	+	1	280	c.205G>A	c.(205-207)GAG>AAG	p.E69K		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	69					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					ACTTCCTGGGGAGCCTCCCAT	0.493													12	22	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33947294	33947294	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33947294C>T	uc003jid.2	-	6	1434	c.1342G>A	c.(1342-1344)GAG>AAG	p.E448K	SLC45A2_uc003jie.2_Missense_Mutation_p.E448K	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	448	Cytoplasmic (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CGGTGGTACTCAGTAATGAGG	0.512													7	310	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56531814	56531814	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56531814G>C	uc003jrh.3	+	6	1707	c.433G>C	c.(433-435)GAG>CAG	p.E145Q	GPBP1_uc010iwg.2_Missense_Mutation_p.E145Q|GPBP1_uc003jri.3_5'UTR|GPBP1_uc003jrj.3_Missense_Mutation_p.E152Q|GPBP1_uc003jrk.3_Missense_Mutation_p.E152Q|GPBP1_uc003jrl.3_RNA	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1	145					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TCCTGAGTATGAGAGAGAACC	0.313													8	96	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77524005	77524005	+	Missense_Mutation	SNP	G	T	T	rs62001053		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77524005G>T	uc003kfj.2	-	4	463	c.338C>A	c.(337-339)GCA>GAA	p.A113E		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	113					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GGACAGGAGTGCAAGATCCTG	0.353									Hermansky-Pudlak_syndrome				7	41	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140306841	140306841	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140306841C>A	uc003lih.2	+	1	540	c.364C>A	c.(364-366)CCT>ACT	p.P122T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.P122T	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	122	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAACTCACCTCTCTTTCC	0.607													16	87	---	---	---	---	PASS
RNF14	9604	broad.mit.edu	37	5	141353154	141353154	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141353154A>G	uc003lly.2	+	2	40	c.1A>G	c.(1-3)ATG>GTG	p.M1V	RNF14_uc003llz.2_Missense_Mutation_p.M1V|RNF14_uc003lma.2_Missense_Mutation_p.M1V|RNF14_uc003lmb.2_5'UTR|RNF14_uc003lmc.2_Missense_Mutation_p.M1V|RNF14_uc011dbg.1_Missense_Mutation_p.M1V|RNF14_uc011dbh.1_Missense_Mutation_p.M1V|RNF14_uc003lmd.2_Missense_Mutation_p.M1V	NM_183399	NP_899646	Q9UBS8	RNF14_HUMAN	ring finger protein 14 isoform 1	1					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|protein ubiquitination|regulation of androgen receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|small conjugating protein ligase activity|transcription coactivator activity|zinc ion binding				0		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TCAGGTCCTTATGTCGTCAGA	0.323													3	88	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149506138	149506138	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149506138G>A	uc003lro.2	-	11	2088	c.1619C>T	c.(1618-1620)GCC>GTC	p.A540V	PDGFRB_uc010jhd.2_Missense_Mutation_p.A379V	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	540	Helical; (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CACCACCAGGGCCAGGATGGC	0.572			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								12	56	---	---	---	---	PASS
SYNPO	11346	broad.mit.edu	37	5	150028172	150028172	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150028172C>G	uc003lsn.2	+	3	1441	c.1067C>G	c.(1066-1068)TCT>TGT	p.S356C	SYNPO_uc003lso.3_Missense_Mutation_p.S112C|SYNPO_uc003lsp.2_Missense_Mutation_p.S112C	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	356					positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGCCACTTTCTAGCATCCAA	0.567													73	170	---	---	---	---	PASS
LARP1	23367	broad.mit.edu	37	5	154092620	154092620	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154092620G>A	uc003lvo.2	+	1	159	c.135G>A	c.(133-135)CCG>CCA	p.P45P		NM_015315	NP_056130	Q6PKG0	LARP1_HUMAN	la related protein isoform 1	122							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCTGCCCCGAGGAAGGAGC	0.597													28	40	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	155771677	155771677	+	Missense_Mutation	SNP	A	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155771677A>C	uc003lwd.3	+	2	655	c.179A>C	c.(178-180)AAC>ACC	p.N60T	SGCD_uc003lwa.1_Missense_Mutation_p.N61T|SGCD_uc003lwb.2_Missense_Mutation_p.N61T|SGCD_uc003lwc.3_Missense_Mutation_p.N61T	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	60	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAAGTCATGAACTTCACAATT	0.423													15	86	---	---	---	---	PASS
IL12B	3593	broad.mit.edu	37	5	158745773	158745773	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158745773G>C	uc003lxr.1	-	6	868	c.826C>G	c.(826-828)CAG>GAG	p.Q276E		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	276	Fibronectin type-III.				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCTGGACCTGAACGCAGAAT	0.493													7	109	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27420477	27420477	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27420477G>A	uc003njj.2	-	5	1672	c.861C>T	c.(859-861)TTC>TTT	p.F287F	ZNF184_uc010jqv.2_Silent_p.F287F|ZNF184_uc003nji.2_Silent_p.F287F	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	287	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GACCCTCAATGAAGCCTTTTC	0.378													43	81	---	---	---	---	PASS
SESN1	27244	broad.mit.edu	37	6	109414989	109414989	+	Intron	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109414989C>G	uc003psu.2	-						C6orf182_uc003psv.3_5'Flank|C6orf182_uc003psw.3_5'Flank|C6orf182_uc010kdk.2_5'Flank|C6orf182_uc003psx.3_5'Flank|C6orf182_uc010kdl.2_5'Flank	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		TTAAAATGCTCTTCCTTACCT	0.338													8	62	---	---	---	---	PASS
VNN3	55350	broad.mit.edu	37	6	133048037	133048037	+	3'UTR	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133048037G>A	uc003qdp.2	-	5					VNN3_uc010kfs.2_Intron|VNN3_uc011ecl.1_RNA|VNN3_uc011ecm.1_5'UTR|VNN3_uc011ecn.1_Intron|VNN3_uc010kfu.2_Intron|VNN3_uc010kfv.2_Intron|VNN3_uc010kfw.2_5'UTR|VNN3_uc010kfx.2_Intron|VNN3_uc010kfy.2_Intron|VNN3_uc010kfz.2_Intron	NM_078625	NP_523239			SubName: Full=PAGEL-beta;												0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		GCTGGGTCATGAGAAAAAATG	0.463													25	62	---	---	---	---	PASS
ECT2L	345930	broad.mit.edu	37	6	139206714	139206714	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139206714G>A	uc003qif.1	+	15	2203	c.2100G>A	c.(2098-2100)CTG>CTA	p.L700L	ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	700	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						CCAAAATGCTGAGGTACGTTC	0.493													26	67	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155764498	155764498	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155764498G>C	uc003qqm.2	-	5	498	c.395C>G	c.(394-396)TCC>TGC	p.S132C		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	132	Ferric oxidoreductase.|Extracellular (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GGCCTCCTCGGACTGGCTCCA	0.577													13	41	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155764527	155764527	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155764527G>A	uc003qqm.2	-	5	469	c.366C>T	c.(364-366)TTC>TTT	p.F122F		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	122	Ferric oxidoreductase.|Helical; (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GTTCCAGGTTGAAGAAATGCG	0.537													8	41	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2972191	2972191	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2972191C>T	uc003smv.2	-	11	1952	c.1548G>A	c.(1546-1548)CTG>CTA	p.L516L		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	516					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		ATGTTCGCTTCAGGCTGATGG	0.493			Mis		DLBCL								7	12	---	---	---	---	PASS
IKZF1	10320	broad.mit.edu	37	7	50468081	50468081	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50468081G>A	uc003tow.3	+	9	1484	c.1316G>A	c.(1315-1317)CGC>CAC	p.R439H	IKZF1_uc003tox.3_Missense_Mutation_p.R397H|IKZF1_uc003toy.3_Missense_Mutation_p.R397H|IKZF1_uc011kck.1_Missense_Mutation_p.R352H|IKZF1_uc003toz.3_Missense_Mutation_p.R409H|IKZF1_uc010kyx.2_Missense_Mutation_p.R179H|IKZF1_uc003tpa.3_Missense_Mutation_p.R181H	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	439					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GACCTGCTGCGCGCCGCCTCC	0.672			D		ALL								10	36	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64452419	64452419	+	5'Flank	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64452419G>C	uc003ttr.2	-						ZNF117_uc011kdr.1_Nonsense_Mutation_p.S326*	NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				gctctgacttgatggtgcagg	0.000													14	47	---	---	---	---	PASS
SEMA3A	10371	broad.mit.edu	37	7	83640567	83640567	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83640567A>G	uc003uhz.2	-	8	1172	c.857T>C	c.(856-858)TTC>TCC	p.F286S		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	286	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						AGCTTTGAGGAATGTTGTCCA	0.393													20	34	---	---	---	---	PASS
PON3	5446	broad.mit.edu	37	7	95001611	95001611	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95001611C>T	uc003unt.2	-	4	266	c.241G>A	c.(241-243)GAA>AAA	p.E81K	PON1_uc011kih.1_Intron|PON3_uc011kii.1_Missense_Mutation_p.E129K	NM_000940	NP_000931	Q15166	PON3_HUMAN	paraoxonase 3	81					aromatic compound catabolic process|carboxylic acid catabolic process|response to external stimulus	extracellular space	aryldialkylphosphatase activity|arylesterase activity|metal ion binding|protein homodimerization activity			ovary(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)			TTTCCTGGTTCATCTGGCGCA	0.353													38	82	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126542611	126542611	+	Missense_Mutation	SNP	T	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126542611T>C	uc003vlr.2	-	5	1452	c.1141A>G	c.(1141-1143)ATA>GTA	p.I381V	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.I381V|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.I102V	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	381	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CATTTCTTTATATGACTGTTC	0.358										HNSCC(24;0.065)			23	42	---	---	---	---	PASS
ARF5	381	broad.mit.edu	37	7	127229226	127229226	+	Intron	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127229226G>A	uc003vmb.1	+						ARF5_uc010llb.1_Intron|FSCN3_uc003vmc.1_5'Flank	NM_001662	NP_001653	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1						AGGTGAGCCCGGGGACGAAGC	0.607											OREG0018287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	68	---	---	---	---	PASS
ARF5	381	broad.mit.edu	37	7	127229227	127229227	+	Intron	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127229227G>A	uc003vmb.1	+						ARF5_uc010llb.1_Intron|FSCN3_uc003vmc.1_5'Flank	NM_001662	NP_001653	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1						GGTGAGCCCGGGGACGAAGCA	0.607											OREG0018287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	68	---	---	---	---	PASS
UBE2H	7328	broad.mit.edu	37	7	129474842	129474842	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129474842C>T	uc003vpf.1	-	7	881	c.487G>A	c.(487-489)GAC>AAC	p.D163N	UBE2H_uc003vpg.1_Missense_Mutation_p.D132N|uc003vpe.2_5'Flank	NM_003344	NP_003335	P62256	UBE2H_HUMAN	ubiquitin-conjugating enzyme E2H isoform 1	163					protein K11-linked ubiquitination|protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin-protein ligase activity			skin(1)	1	Melanoma(18;0.0435)					GATGAGCTGTCCCCGGTACCC	0.507													23	108	---	---	---	---	PASS
FBXO25	26260	broad.mit.edu	37	8	400077	400077	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:400077C>G	uc003wox.2	+	6	735	c.469C>G	c.(469-471)CAA>GAA	p.Q157E	FBXO25_uc003woy.2_Missense_Mutation_p.Q157E|FBXO25_uc003woz.2_Missense_Mutation_p.Q90E|FBXO25_uc003wpa.2_5'UTR	NM_183421	NP_904357	Q8TCJ0	FBX25_HUMAN	F-box only protein 25 isoform 1	157						nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TAAAATCGTTCAAAAGGGTAA	0.338													19	86	---	---	---	---	PASS
BMP1	649	broad.mit.edu	37	8	22056829	22056829	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22056829G>C	uc003xbg.2	+						BMP1_uc003xba.2_Missense_Mutation_p.R801T|BMP1_uc003xbb.2_Intron|BMP1_uc003xbe.2_Intron|BMP1_uc003xbc.2_Intron|BMP1_uc003xbd.2_RNA|BMP1_uc003xbf.2_Intron|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_Intron|BMP1_uc003xbi.2_Intron	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCTAAGCCAAGAAGGAGAAGA	0.612													21	86	---	---	---	---	PASS
KIAA1967	57805	broad.mit.edu	37	8	22470619	22470619	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22470619G>A	uc003xch.2	+	8	811	c.674G>A	c.(673-675)CGG>CAG	p.R225Q	KIAA1967_uc003xci.2_Missense_Mutation_p.R225Q|KIAA1967_uc003xcj.1_5'UTR	NM_199205	NP_954675	Q8N163	K1967_HUMAN	p30 DBC protein	225					apoptosis|positive regulation of apoptosis	mitochondrial matrix|nucleus	enzyme binding|enzyme inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00593)|Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		CCTCCTTACCGGGTCCACCTC	0.537													19	38	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25319603	25319603	+	Missense_Mutation	SNP	G	A	A	rs149260399		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25319603G>A	uc003xep.1	+	4	745	c.266G>A	c.(265-267)CGA>CAA	p.R89Q	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.R89Q|CDCA2_uc003xeq.1_Missense_Mutation_p.R74Q	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	89					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		AAATGTAGACGACGTTCTGCA	0.403													29	60	---	---	---	---	PASS
SDCBP	6386	broad.mit.edu	37	8	59493158	59493158	+	Missense_Mutation	SNP	T	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59493158T>C	uc003xtn.2	+	8	983	c.833T>C	c.(832-834)ATT>ACT	p.I278T	SDCBP_uc003xto.2_Missense_Mutation_p.I277T|SDCBP_uc003xtr.2_Missense_Mutation_p.I277T|SDCBP_uc003xtp.2_Missense_Mutation_p.I272T|SDCBP_uc003xtq.2_Missense_Mutation_p.I278T|SDCBP_uc003xts.2_Missense_Mutation_p.I284T|SDCBP_uc011led.1_Missense_Mutation_p.I219T	NM_005625	NP_005616	O00560	SDCB1_HUMAN	syntenin isoform 1	278					actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TTTGAACATATTATTAAGCGG	0.333													22	34	---	---	---	---	PASS
PAG1	55824	broad.mit.edu	37	8	81892678	81892678	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81892678C>T	uc003ybz.2	-	8	1639	c.928G>A	c.(928-930)GAA>AAA	p.E310K		NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid	310	Cytoplasmic (Potential).				epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			ACCTCTTCTTCTGTGAGAGTG	0.378													28	43	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144992837	144992837	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144992837C>T	uc003zaf.1	-	32	11733	c.11563G>A	c.(11563-11565)GAG>AAG	p.E3855K	PLEC_uc003zab.1_Missense_Mutation_p.E3718K|PLEC_uc003zac.1_Missense_Mutation_p.E3722K|PLEC_uc003zad.2_Missense_Mutation_p.E3718K|PLEC_uc003zae.1_Missense_Mutation_p.E3686K|PLEC_uc003zag.1_Missense_Mutation_p.E3696K|PLEC_uc003zah.2_Missense_Mutation_p.E3704K|PLEC_uc003zaj.2_Missense_Mutation_p.E3745K	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3855	Globular 2.|Plectin 17.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CGGGCCACCTCGGCACTCAGC	0.652													31	57	---	---	---	---	PASS
CEP78	84131	broad.mit.edu	37	9	80855103	80855103	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80855103C>T	uc004akx.2	+	2	694	c.418C>T	c.(418-420)CTA>TTA	p.L140L	CEP78_uc004aky.3_Silent_p.L140L|CEP78_uc010mpp.2_Silent_p.L140L|CEP78_uc011lsp.1_Silent_p.L53L	NM_032171	NP_115547	Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa isoform b	140					G2/M transition of mitotic cell cycle	centrosome|cytosol				ovary(1)	1						TTTAACTATTCTAGCAAAGGT	0.353													21	36	---	---	---	---	PASS
HABP4	22927	broad.mit.edu	37	9	99233290	99233290	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99233290C>T	uc010msg.2	+						HABP4_uc010msh.2_Intron	NM_014282	NP_055097	Q5JVS0	HABP4_HUMAN	hyaluronan binding protein 4						platelet activation|platelet degranulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|extracellular region|nucleus	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				TGCTGTTTTTCAGTGATGTGG	0.438													22	106	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115806340	115806340	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115806340C>T	uc004bgm.1	-	4	586	c.558G>A	c.(556-558)CAG>CAA	p.Q186Q	ZFP37_uc011lwz.1_Silent_p.Q201Q|ZFP37_uc011lxa.1_Silent_p.Q187Q	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	186						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AATCTAAATTCTGTTTCAAAA	0.318													46	116	---	---	---	---	PASS
C5	727	broad.mit.edu	37	9	123789559	123789559	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123789559G>C	uc004bkv.2	-						C5_uc010mvm.1_Intron|C5_uc010mvn.1_Intron	NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	ATATCTGTCAGACAATAGCAT	0.294													5	14	---	---	---	---	PASS
URM1	81605	broad.mit.edu	37	9	131150142	131150142	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131150142G>C	uc004buv.2	+	3	216	c.154G>C	c.(154-156)GAG>CAG	p.E52Q	URM1_uc011may.1_Missense_Mutation_p.E52Q|URM1_uc004buw.2_RNA	NM_030914	NP_112176	Q9BTM9	URM1_HUMAN	ubiquitin related modifier 1 homolog isoform a	52					tRNA thio-modification|tRNA wobble uridine modification		protein binding				0						TTTGCTAAAAGAGCGGCCAGA	0.537													46	91	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131344825	131344825	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131344825G>A	uc004bvl.3	+	13	1753	c.1640G>A	c.(1639-1641)CGC>CAC	p.R547H	SPTAN1_uc011mbg.1_Missense_Mutation_p.R547H|SPTAN1_uc011mbh.1_Missense_Mutation_p.R559H|SPTAN1_uc004bvm.3_Missense_Mutation_p.R547H|SPTAN1_uc004bvn.3_Missense_Mutation_p.R547H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	547	Spectrin 6.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						GTGGCCACTCGCCGAGATGCT	0.408													15	82	---	---	---	---	PASS
LCN10	414332	broad.mit.edu	37	9	139637353	139637353	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139637353C>T	uc010nbq.2	-	1	62	c.3G>A	c.(1-3)ATG>ATA	p.M1I	LCN10_uc004civ.2_Missense_Mutation_p.M1I|LCN10_uc011med.1_RNA|LCN10_uc011mee.1_Missense_Mutation_p.M1I|LCN10_uc011mef.1_RNA|LCN10_uc004ciw.2_RNA			Q6JVE6	LCN10_HUMAN	SubName: Full=LCN10 protein;	1					transport	extracellular region	binding			large_intestine(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		gcccctgcctcatcttcaccc	0.423													15	14	---	---	---	---	PASS
SFXN4	119559	broad.mit.edu	37	10	120917551	120917551	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120917551C>T	uc001leb.2	-	7	429	c.384G>A	c.(382-384)CTG>CTA	p.L128L	SFXN4_uc001ldy.2_Silent_p.L12L|SFXN4_uc001ldz.2_Silent_p.L12L|SFXN4_uc001lea.2_RNA	NM_213649	NP_998814	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	128	Helical; (Potential).				iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		TGATCCCTTTCAGTGGCGTCA	0.413													34	51	---	---	---	---	PASS
AP2A2	161	broad.mit.edu	37	11	1011189	1011189	+	3'UTR	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1011189G>A	uc001lss.2	+	22						NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TATTTGTAATGACTTCTGGCA	0.502													27	39	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58980271	58980271	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58980271G>A	uc001nnu.3	-	1	224	c.68C>T	c.(67-69)TCG>TTG	p.S23L		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	23						integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				CATCTCTCCCGAAGGCTTGCC	0.552													34	129	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62491178	62491178	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62491178G>A	uc001nuw.2	-	4	965	c.772C>T	c.(772-774)CAA>TAA	p.Q258*	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	258	B30.2/SPRY.				cell killing	nucleus	ATP binding|nucleic acid binding				0						TTGCTCACTTGAAAATGCAGA	0.458													10	35	---	---	---	---	PASS
BBS1	582	broad.mit.edu	37	11	66298426	66298426	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66298426G>A	uc001oij.1	+	15	1547	c.1535G>A	c.(1534-1536)CGT>CAT	p.R512H	BBS1_uc001oii.1_Missense_Mutation_p.R549H|BBS1_uc010rpg.1_Missense_Mutation_p.R415H|BBS1_uc001oik.1_Missense_Mutation_p.R436H|BBS1_uc001oil.1_Missense_Mutation_p.R383H|ZDHHC24_uc001oim.1_Intron|ZDHHC24_uc009yrg.1_Intron|BBS1_uc010rph.1_Missense_Mutation_p.R180H	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	512					nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						TCAACAACCCGTCCTGTCCTG	0.572									Bardet-Biedl_syndrome				51	81	---	---	---	---	PASS
CCS	9973	broad.mit.edu	37	11	66366699	66366699	+	Silent	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66366699C>G	uc001oir.2	+	3	268	c.225C>G	c.(223-225)CTC>CTG	p.L75L	CCS_uc001ois.2_5'Flank	NM_005125	NP_005116	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	75	HMA.				intracellular copper ion transport|oxidation-reduction process|removal of superoxide radicals	cytosol|mitochondrial inner membrane|nucleus|soluble fraction	copper ion transmembrane transporter activity|protein binding|superoxide dismutase copper chaperone activity|zinc ion binding				0						AGGCGGTACTCAAGGGCATGG	0.607													26	48	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67174345	67174345	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67174345G>A	uc001ola.2	+	8	725	c.696G>A	c.(694-696)CGG>CGA	p.R232R	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_Intron|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	232	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TGCTGCGGCGGCTGCTTCCGC	0.701													3	40	---	---	---	---	PASS
PIWIL4	143689	broad.mit.edu	37	11	94341823	94341823	+	Silent	SNP	C	T	T	rs146415204	byFrequency	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94341823C>T	uc001pfa.2	+	15	2125	c.1914C>T	c.(1912-1914)TGC>TGT	p.C638C	PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_RNA	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4	638	Piwi.				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTTGGATGCGTGGCCAGTG	0.388													35	157	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118498318	118498318	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118498318C>T	uc001ptr.1	+	7	1132	c.779C>T	c.(778-780)TCA>TTA	p.S260L	PHLDB1_uc010ryh.1_Missense_Mutation_p.S259L|PHLDB1_uc001pts.2_Missense_Mutation_p.S260L|PHLDB1_uc001ptt.2_Missense_Mutation_p.S260L|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Missense_Mutation_p.S60L|PHLDB1_uc001ptw.1_5'Flank	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	260											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCACTCTCTTCACCAGCCAGC	0.622													38	160	---	---	---	---	PASS
CLEC4A	50856	broad.mit.edu	37	12	8289509	8289509	+	Intron	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8289509G>C	uc001qtz.1	+						CLEC4A_uc009zga.1_Intron|CLEC4A_uc001qub.1_Intron|CLEC4A_uc001quc.1_Intron|CLEC4A_uc009zgb.1_Intron|uc010sgi.1_5'Flank	NM_016184	NP_057268	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A isoform						cell adhesion|cell surface receptor linked signaling pathway|innate immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0				Kidney(36;0.0915)		CGTGAGTATAGAATGAGATAA	0.408													16	55	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9354941	9354941	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9354941C>T	uc001qvl.2	-	4	483	c.454G>A	c.(454-456)GAA>AAA	p.E152K	PZP_uc009zgl.2_Missense_Mutation_p.E21K	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						CGAAAATTTTCATCCACGGAG	0.443													9	48	---	---	---	---	PASS
REP15	387849	broad.mit.edu	37	12	27849646	27849646	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27849646G>T	uc001rig.1	+	1	219	c.151G>T	c.(151-153)GCT>TCT	p.A51S		NM_001029874	NP_001025045	Q6BDI9	REP15_HUMAN	RAB15 effector protein	51						early endosome membrane				ovary(1)	1	Lung SC(9;0.0873)					ACTCTGCCCAGCTGCAAATAC	0.463													4	118	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57111746	57111746	+	Intron	SNP	A	G	G	rs2958150		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57111746A>G	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Missense_Mutation_p.S1190P|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						CCTTTGGGGGATGGGGTAGCT	0.632			T	BCL6	NHL								10	228	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122991372	122991372	+	Intron	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122991372G>A	uc001ucr.2	-						RSRC2_uc001uco.2_Intron|RSRC2_uc001ucp.2_Intron|RSRC2_uc001ucq.2_Intron|RSRC2_uc001ucs.2_Intron|RSRC2_uc001uct.2_Intron|RSRC2_uc001ucu.2_Intron	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a											ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TGGCACATGTGAAACTCACCT	0.259													21	72	---	---	---	---	PASS
RAN	5901	broad.mit.edu	37	12	131359155	131359155	+	Nonsense_Mutation	SNP	G	A	A	rs11546493		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131359155G>A	uc001uir.2	+	5	377	c.312G>A	c.(310-312)TGG>TGA	p.W104*	RAN_uc010tbk.1_Nonsense_Mutation_p.W16*|RAN_uc010tbl.1_Nonsense_Mutation_p.W16*|RAN_uc001uis.2_Nonsense_Mutation_p.W124*	NM_006325	NP_006316	P62826	RAN_HUMAN	ras-related nuclear protein	104					androgen receptor signaling pathway|cell division|DNA metabolic process|mitosis|mitotic spindle organization|positive regulation of transcription, DNA-dependent|protein export from nucleus|RNA export from nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|melanosome|nuclear pore|nucleoplasm	androgen receptor binding|chromatin binding|GTP binding|GTPase activity|transcription coactivator activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		TGCCTAACTGGCATAGAGATC	0.413													3	74	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133331269	133331269	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133331269G>A	uc001ukx.2	-	2	699	c.632C>T	c.(631-633)GCG>GTG	p.A211V	ANKLE2_uc001uky.3_Missense_Mutation_p.A149V	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	211						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		ACCATTTCTCGCTGGGACGTC	0.542													23	135	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32749764	32749764	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32749764G>C	uc001utx.2	+	20	2912	c.2416G>C	c.(2416-2418)GAT>CAT	p.D806H	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	806					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AGCAGTTTCGGATTCAGTAAG	0.378													28	40	---	---	---	---	PASS
NUFIP1	26747	broad.mit.edu	37	13	45517691	45517691	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45517691C>G	uc001uzp.2	-	9	1299	c.1257G>C	c.(1255-1257)AAG>AAC	p.K419N		NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein	419					box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		GGTTCTCACTCTTGGCTTCTG	0.378													33	126	---	---	---	---	PASS
SETDB2	83852	broad.mit.edu	37	13	50034278	50034278	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50034278G>A	uc001vcz.2	+	3	958	c.52G>A	c.(52-54)GAT>AAT	p.D18N	SETDB2_uc010adg.2_Missense_Mutation_p.D6N|SETDB2_uc001vcy.3_Missense_Mutation_p.D18N|SETDB2_uc010adh.2_Missense_Mutation_p.D18N|SETDB2_uc001vda.2_Missense_Mutation_p.D18N	NM_031915	NP_114121	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2 isoform a	18					cell division|chromosome segregation|heart looping|left/right axis specification|mitosis|negative regulation of transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone methyltransferase activity (H3-K9 specific)|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GCTAGAAGATGATGGAAAAGT	0.343													20	92	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99948184	99948184	+	Missense_Mutation	SNP	A	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99948184A>C	uc001vog.2	-	2	390	c.216T>G	c.(214-216)AAT>AAG	p.N72K	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	72	Cytoplasmic (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						AAATCACCAAATTTGTTGAAT	0.433													13	92	---	---	---	---	PASS
CUL4A	8451	broad.mit.edu	37	13	113909425	113909425	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113909425C>G	uc010tjy.1	+	19	2028	c.2017C>G	c.(2017-2019)CAG>GAG	p.Q673E	CUL4A_uc010tjx.1_Missense_Mutation_p.Q573E|CUL4A_uc010agu.2_Missense_Mutation_p.Q534E|CUL4A_uc010tjz.1_Missense_Mutation_p.Q352E	NM_001008895	NP_001008895	Q13619	CUL4A_HUMAN	cullin 4A isoform 1	673					cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding			central_nervous_system(2)|skin(1)	3	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			CAATCAAATTCAGATGAAGGA	0.338													13	56	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114780743	114780743	+	Silent	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114780743C>G	uc001vui.2	-	14	1478	c.1347G>C	c.(1345-1347)CCG>CCC	p.P449P	RASA3_uc010tkk.1_Silent_p.P417P|RASA3_uc001vuj.2_Silent_p.P66P	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	449	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ACATGACGGTCGGGCAGCTCA	0.617													45	99	---	---	---	---	PASS
RNASE13	440163	broad.mit.edu	37	14	21502046	21502046	+	Silent	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21502046G>C	uc001vzj.2	-	2	540	c.402C>G	c.(400-402)CTC>CTG	p.L134L	NDRG2_uc010tll.1_Intron	NM_001012264	NP_001012264	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 precursor	134						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			upper_aerodigestive_tract(1)	1	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		AGAGTAGGTAGAGCTTCTGGT	0.532													51	236	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23894516	23894516	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894516C>T	uc001wjx.2	-	21	2504	c.2398G>A	c.(2398-2400)GAG>AAG	p.E800K		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	800	IQ.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTTTTGTACTCCATTCTGGCG	0.592													19	115	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23894521	23894521	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894521C>T	uc001wjx.2	-	21	2499	c.2393G>A	c.(2392-2394)AGA>AAA	p.R798K		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	798	IQ.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTACTCCATTCTGGCGAGCAC	0.592													20	115	---	---	---	---	PASS
ABCD4	5826	broad.mit.edu	37	14	74763119	74763119	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74763119G>T	uc001xpr.2	-	5	611	c.459C>A	c.(457-459)TTC>TTA	p.F153L	ABCD4_uc001xps.2_Translation_Start_Site|ABCD4_uc001xpt.2_Translation_Start_Site|ABCD4_uc010tur.1_Missense_Mutation_p.F66L|ABCD4_uc001xpu.2_Translation_Start_Site|ABCD4_uc001xpv.2_RNA	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4	153	ABC transmembrane type-1.					ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GCTGCCGGCAGAATCGCTCCA	0.577													21	117	---	---	---	---	PASS
ZC3H14	79882	broad.mit.edu	37	14	89039043	89039043	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89039043G>A	uc001xww.2	+	6	778	c.553G>A	c.(553-555)GAC>AAC	p.D185N	ZC3H14_uc010twd.1_Missense_Mutation_p.D185N|ZC3H14_uc010twe.1_Missense_Mutation_p.D185N|ZC3H14_uc001xwx.2_Missense_Mutation_p.D185N|ZC3H14_uc010twf.1_Missense_Mutation_p.D30N|ZC3H14_uc001xwy.2_Missense_Mutation_p.D151N|ZC3H14_uc010twg.1_Missense_Mutation_p.D30N	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1	185						cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						CATTGACGAAGACCTCAACTT	0.433													62	155	---	---	---	---	PASS
FAM181A	90050	broad.mit.edu	37	14	94395423	94395423	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94395423G>C	uc001ybz.1	+	3	1285	c.978G>C	c.(976-978)CAG>CAC	p.Q326H	C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Missense_Mutation_p.Q264H|FAM181A_uc001yca.1_Missense_Mutation_p.Q264H	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	326											0						GCCTGGGGCAGAAGGTGTGCA	0.647													28	68	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99865319	99865319	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99865319C>T	uc001ygc.2	-	13	1652	c.1482G>A	c.(1480-1482)GAG>GAA	p.E494E		NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	494					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				GAGCCTTTTCCTCCATCTGTT	0.502													45	227	---	---	---	---	PASS
YY1	7528	broad.mit.edu	37	14	100705962	100705962	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100705962C>T	uc001ygy.1	+	1	861	c.381C>T	c.(379-381)TTC>TTT	p.F127F		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	127					cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				AGGACGGCTTCGAGGATCAGA	0.602													30	126	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102481656	102481656	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102481656C>T	uc001yks.2	+	35	7393	c.7229C>T	c.(7228-7230)TCC>TTC	p.S2410F	DYNC1H1_uc001ykt.1_5'UTR	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2410	AAA 2 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GAGGCCGCTTCCCCCATGCTG	0.517													11	19	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105417015	105417015	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105417015G>A	uc010axc.1	-	7	4893	c.4773C>T	c.(4771-4773)CTC>CTT	p.L1591L	AHNAK2_uc001ypx.2_Silent_p.L1491L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1591						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGGCCCCTTGAGGTCCACTT	0.592													58	374	---	---	---	---	PASS
NUDT14	256281	broad.mit.edu	37	14	105643016	105643016	+	Missense_Mutation	SNP	C	T	T	rs141847132		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105643016C>T	uc010tyn.1	-	4	397	c.283G>A	c.(283-285)GGC>AGC	p.G95S	NUDT14_uc001yqi.2_RNA	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14	95	Nudix hydrolase.					cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CCCGCTGAGCCGGGCAGGGCT	0.677										HNSCC(42;0.11)			15	86	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43527686	43527686	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43527686G>C	uc001zrd.1	-	10	1703	c.1695C>G	c.(1693-1695)ATC>ATG	p.I565M	TGM5_uc001zrc.1_Missense_Mutation_p.I222M|TGM5_uc001zre.1_Missense_Mutation_p.I483M	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	565					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GAGAGAGTGTGATGAACGCTG	0.552													26	58	---	---	---	---	PASS
CATSPER2	117155	broad.mit.edu	37	15	43928408	43928408	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43928408C>T	uc001zsh.2	-	8	1067	c.852G>A	c.(850-852)CCG>CCA	p.P284P	CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Silent_p.P284P|CATSPER2_uc001zsj.2_Silent_p.P284P	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2	284					cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CCAGGGAATTCGGGAGGTCCC	0.418													10	64	---	---	---	---	PASS
FRMD5	84978	broad.mit.edu	37	15	44166325	44166325	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44166325C>T	uc001ztl.2	-	14	1648	c.1471G>A	c.(1471-1473)GAG>AAG	p.E491K	FRMD5_uc001ztj.1_Missense_Mutation_p.E164K|FRMD5_uc001ztk.1_Missense_Mutation_p.E397K|FRMD5_uc010uef.1_Missense_Mutation_p.E164K|FRMD5_uc001ztm.2_Missense_Mutation_p.E164K|FRMD5_uc001ztn.2_Missense_Mutation_p.E257K	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2	491						cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		ACCTGTTCCTCCTCGGGCCCG	0.567													39	111	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51755661	51755661	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51755661C>T	uc002abf.2	-	33	8063	c.7838G>A	c.(7837-7839)CGA>CAA	p.R2613Q	DMXL2_uc002abd.2_Missense_Mutation_p.R684Q|DMXL2_uc010ufy.1_Missense_Mutation_p.R2614Q|DMXL2_uc010bfa.2_Missense_Mutation_p.R1977Q	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2613						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ATGCCAAAGTCGTTTGACTGG	0.303													33	89	---	---	---	---	PASS
MESDC2	23184	broad.mit.edu	37	15	81274372	81274372	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81274372C>T	uc002bfy.1	-	2	438	c.365G>A	c.(364-366)GGA>GAA	p.G122E	MESDC2_uc002bfx.2_RNA|MESDC2_uc010uno.1_Intron	NM_015154	NP_055969	Q14696	MESD_HUMAN	mesoderm development candidate 2	122	Chaperone domain (By similarity).				mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						AGTAGGGCTTCCTGATACAGT	0.468													23	76	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81565555	81565555	+	Intron	SNP	C	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81565555C>A	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						GGTAGGCTTCCCAGCCCTTTT	0.493													3	33	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90903975	90903975	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90903975G>A	uc002bpk.3	+	4	1098	c.912G>A	c.(910-912)TCG>TCA	p.S304S		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	304	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GCCAGAGCTCGGATTTGATTA	0.512													9	196	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	773855	773855	+	Splice_Site	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773855A>G	uc002cjg.2	-	11	1239	c.1133_splice	c.e11+1	p.Q378_splice	CCDC78_uc002cjf.2_Splice_Site_p.Q227_splice|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Splice_Site_p.Q137_splice	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GAGGGCACTCACTGTGGCTCT	0.657													6	18	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2348517	2348517	+	Missense_Mutation	SNP	C	T	T	rs148843652	byFrequency	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2348517C>T	uc002cpy.1	-	15	2478	c.1766G>A	c.(1765-1767)CGG>CAG	p.R589Q	ABCA3_uc010bsk.1_Missense_Mutation_p.R531Q|ABCA3_uc010bsl.1_Missense_Mutation_p.R589Q	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	589	ABC transporter 1.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				GATGTATGCCCGTCCACTGGT	0.592													22	133	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18841063	18841063	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18841063C>T	uc002dfm.2	-	54	9511	c.9148G>A	c.(9148-9150)GAA>AAA	p.E3050K	SMG1_uc010bwb.2_Missense_Mutation_p.E2910K|SMG1_uc010bwa.2_Missense_Mutation_p.E1781K	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	3050					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TTCTGATCTTCAAGTGAACTT	0.328													13	52	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20975107	20975107	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20975107C>G	uc010vbe.1	-	53	10099	c.10099G>C	c.(10099-10101)GAG>CAG	p.E3367Q	DNAH3_uc010vbd.1_Missense_Mutation_p.E802Q	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3367					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TTGTCCTTCTCAAACAGAGAA	0.493													24	83	---	---	---	---	PASS
UQCRC2	7385	broad.mit.edu	37	16	21994417	21994417	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21994417G>A	uc002djx.2	+	14	1423	c.1287G>A	c.(1285-1287)AAG>AAA	p.K429K	UQCRC2_uc002djy.2_Missense_Mutation_p.R378K|UQCRC2_uc010bxa.2_RNA	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	429					aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		AGGCGGCAAAGAAGTTTGTTT	0.338													11	89	---	---	---	---	PASS
LCMT1	51451	broad.mit.edu	37	16	25172470	25172470	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25172470C>T	uc002dnx.1	+	6	672	c.514C>T	c.(514-516)CTC>TTC	p.L172F	LCMT1_uc002dny.1_Intron|LCMT1_uc002dnz.1_Missense_Mutation_p.L72F|LCMT1_uc002doa.1_Intron	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a	172	S-adenosyl-L-methionine binding.						protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	TGGAGCAGATCTCCGAGACCT	0.348													6	19	---	---	---	---	PASS
DPEP2	64174	broad.mit.edu	37	16	68026017	68026017	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68026017C>T	uc010cey.2	-	3	634	c.470G>A	c.(469-471)CGC>CAC	p.R157H	DPEP2_uc002evd.3_Missense_Mutation_p.R157H|DPEP2_uc002eve.2_Missense_Mutation_p.R157H|DPEP2_uc002evf.2_RNA|DPEP2_uc002evg.2_Missense_Mutation_p.A115T	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	157					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		ACACATGCGGCGTATGAGGTC	0.577													26	151	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69727754	69727754	+	Silent	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69727754C>G	uc002exm.1	+	12	5180	c.3972C>G	c.(3970-3972)CCC>CCG	p.P1324P	NFAT5_uc002exi.2_Silent_p.P1248P|NFAT5_uc002exj.1_Silent_p.P1248P|NFAT5_uc002exk.1_Silent_p.P1248P|NFAT5_uc002exl.1_Silent_p.P1342P|NFAT5_uc002exn.1_Silent_p.P1341P|NFAT5_uc002exo.1_RNA	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	1324					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						AGCAACAGCCCATGCAATTTC	0.463													27	49	---	---	---	---	PASS
ACAP1	9744	broad.mit.edu	37	17	7253489	7253489	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7253489C>G	uc002ggd.2	+	20	2211	c.2005C>G	c.(2005-2007)CGA>GGA	p.R669G	KCTD11_uc002gge.3_5'Flank	NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	669	Required for interaction with GULP1.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						TCTGGGGGCTCGAGACTCTGA	0.637													27	75	---	---	---	---	PASS
MED9	55090	broad.mit.edu	37	17	17380479	17380479	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17380479C>G	uc002grh.1	+	1	180	c.124C>G	c.(124-126)CAA>GAA	p.Q42E		NM_018019	NP_060489	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	42	Pro-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		protein binding				0						ccctgcgcctcaaccgcagca	0.289													4	9	---	---	---	---	PASS
CCDC144B	284047	broad.mit.edu	37	17	18528735	18528735	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18528735C>T	uc002gub.1	-	1	111	c.26G>A	c.(25-27)CGG>CAG	p.R9Q	CCDC144B_uc002gua.3_RNA|CCDC144B_uc010vyc.1_RNA|CCDC144B_uc002guc.1_Missense_Mutation_p.R9Q	NM_182568	NP_872374			coiled-coil domain containing 144B											ovary(1)|skin(1)	2						AGCCCCTCCCCGCTTTTCTCC	0.642													4	15	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27430627	27430627	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27430627C>G	uc002hdt.1	-	21	3655	c.3497G>C	c.(3496-3498)GGC>GCC	p.G1166A	MYO18A_uc010wbc.1_Missense_Mutation_p.G708A|MYO18A_uc002hds.2_Missense_Mutation_p.G708A|MYO18A_uc010csa.1_Missense_Mutation_p.G1166A|MYO18A_uc002hdu.1_Missense_Mutation_p.G1166A|MYO18A_uc010wbd.1_Missense_Mutation_p.G835A	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1166	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGGCTCAGGCCCATGCAGCA	0.662													11	67	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29528441	29528441	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29528441C>T	uc002hgg.2	+	11	1531	c.1198C>T	c.(1198-1200)CAG>TAG	p.Q400*	NF1_uc002hge.1_Nonsense_Mutation_p.Q400*|NF1_uc002hgf.1_Nonsense_Mutation_p.Q400*|NF1_uc002hgh.2_Nonsense_Mutation_p.Q400*|NF1_uc010csn.1_Nonsense_Mutation_p.Q260*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	400					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTGCCTGGCTCAGAATTCACC	0.308			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			54	83	---	---	---	---	PASS
DDX52	11056	broad.mit.edu	37	17	35986056	35986056	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35986056C>T	uc002hoi.1	-	8	1059	c.1021G>A	c.(1021-1023)GCC>ACC	p.A341T	DDX52_uc002hoh.1_Missense_Mutation_p.A233T	NM_007010	NP_008941	Q9Y2R4	DDX52_HUMAN	ATP-dependent RNA helicase ROK1 isoform a	341	Helicase ATP-binding.					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|skin(1)	2		Breast(25;0.00637)|Ovarian(249;0.15)				GATGTGCAGGCCAGGAAAATG	0.443													17	69	---	---	---	---	PASS
PSME3	10197	broad.mit.edu	37	17	40991365	40991365	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40991365C>T	uc002ibr.2	+	10	878	c.652C>T	c.(652-654)CGG>TGG	p.R218W	PSME3_uc002ibp.2_Missense_Mutation_p.R157W|PSME3_uc002ibq.2_Missense_Mutation_p.R231W|PSME3_uc002ibs.2_Missense_Mutation_p.R229W|PSME3_uc010whd.1_Missense_Mutation_p.R105W	NM_005789	NP_005780	P61289	PSME3_HUMAN	proteasome activator subunit 3 isoform 1	218					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome activator complex	endopeptidase activator activity|identical protein binding|MDM2 binding|p53 binding				0		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TATCAGCCTTCGGCTCATCAT	0.443													31	41	---	---	---	---	PASS
TMEM100	55273	broad.mit.edu	37	17	53798408	53798408	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53798408C>T	uc002iuj.3	-	2	335	c.24G>A	c.(22-24)GAG>GAA	p.E8E	TMEM100_uc002iuk.3_Silent_p.E8E	NM_018286	NP_060756	Q9NV29	TM100_HUMAN	transmembrane protein 100	8						integral to membrane					0						CTCCCAGGATCTCCTTGATGG	0.498													35	129	---	---	---	---	PASS
SRP68	6730	broad.mit.edu	37	17	74041399	74041399	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74041399G>A	uc002jqk.1	-	12	1403	c.1368C>T	c.(1366-1368)CTC>CTT	p.L456L	SRP68_uc010wsu.1_Silent_p.L355L|SRP68_uc002jql.1_Silent_p.L418L|SRP68_uc002jqj.1_Silent_p.L117L	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	456					response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						CCAGAGTCTTGAGGCCTATCT	0.483													26	109	---	---	---	---	PASS
SPHK1	8877	broad.mit.edu	37	17	74383215	74383215	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74383215G>C	uc002jrf.1	+	8	1512	c.703G>C	c.(703-705)GAT>CAT	p.D235H	SPHK1_uc002jrg.1_Missense_Mutation_p.D184H|SPHK1_uc002jrh.2_Missense_Mutation_p.D249H|SPHK1_uc002jrj.2_Missense_Mutation_p.D321H|SPHK1_uc002jri.2_Missense_Mutation_p.D235H|SPHK1_uc002jrk.3_Missense_Mutation_p.D235H|uc010wtd.1_RNA	NM_001142602	NP_001136074	Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1 isoform 3	235					'de novo' posttranslational protein folding|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|calcium-mediated signaling|positive regulation of angiogenesis|positive regulation of cell growth|positive regulation of cell migration|positive regulation of fibroblast proliferation|positive regulation of mitotic cell cycle|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|positive regulation of smooth muscle contraction|regulation of tumor necrosis factor-mediated signaling pathway|sphingoid catabolic process|sphingosine metabolic process	cytosol|membrane fraction|nucleus|plasma membrane|soluble fraction	ATP binding|calmodulin binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|DNA binding|magnesium ion binding|protein phosphatase 2A binding|sphinganine kinase activity			kidney(1)	1						GGGCCCGGTAGATGCACACCT	0.642													13	47	---	---	---	---	PASS
CBX4	8535	broad.mit.edu	37	17	77807985	77807985	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77807985C>T	uc002jxe.2	-	5	1619	c.1456G>A	c.(1456-1458)GAG>AAG	p.E486K		NM_003655	NP_003646	O00257	CBX4_HUMAN	chromobox homolog 4	486	Interaction with BMI1.				anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity			skin(2)	2			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTGGGCGGCTCCCCGGCCTCG	0.557													5	15	---	---	---	---	PASS
CIRBP	1153	broad.mit.edu	37	19	1270131	1270131	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1270131C>T	uc002lrr.3	+						C19orf23_uc010xgk.1_RNA|CIRBP_uc010dsg.1_Intron|CIRBP_uc002lrt.2_Intron|CIRBP_uc010xgl.1_Intron|CIRBP_uc002lrv.3_Intron|CIRBP_uc002lru.2_Intron	NM_001280	NP_001271	Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization|positive regulation of translation|response to cold|response to UV|stress granule assembly	nucleoplasm|stress granule	mRNA 3'-UTR binding|nucleotide binding|protein binding|SSU rRNA binding|translation repressor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTATCACTTCCGGGGCCATCC	0.602													4	20	---	---	---	---	PASS
PCSK4	54760	broad.mit.edu	37	19	1483434	1483434	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1483434C>T	uc002ltb.1	-	12	1482	c.1420G>A	c.(1420-1422)GAA>AAA	p.E474K	PCSK4_uc002lsz.2_5'UTR|PCSK4_uc002lta.2_Missense_Mutation_p.E286K	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	474					proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATACGTTTTCCCTGATGTAG	0.697													11	36	---	---	---	---	PASS
GADD45B	4616	broad.mit.edu	37	19	2477087	2477087	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2477087C>T	uc002lwb.1	+	3	429	c.207C>T	c.(205-207)ATC>ATT	p.I69I	GADD45B_uc010dtd.1_Silent_p.I54I|GADD45B_uc002lwc.1_Silent_p.I54I	NM_015675	NP_056490	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	69					activation of MAPKKK activity|apoptosis|cell differentiation|multicellular organismal development|response to stress						0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGATGACATCGCCCTGCAAA	0.622											OREG0025141	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	74	---	---	---	---	PASS
JUNB	3726	broad.mit.edu	37	19	12903536	12903536	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12903536C>T	uc002mvc.2	+	1	1227	c.951C>T	c.(949-951)CTC>CTT	p.L317L	JUNB_uc002mvb.2_RNA	NM_002229	NP_002220	P17275	JUNB_HUMAN	jun B proto-oncogene	317	Leucine-zipper.					chromatin|nucleus	protein dimerization activity|transcription coactivator activity|transcription corepressor activity			lung(2)|central_nervous_system(1)	3						CCGGCCTCCTCCGGGAGCAGG	0.652													4	24	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627324	14627324	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627324C>T	uc002myz.1	-	2	786	c.746G>A	c.(745-747)AGA>AAA	p.R249K	DNAJB1_uc010xnr.1_Missense_Mutation_p.R149K	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	249					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		AGAGCCATCTCTCTTAAAGAT	0.498													6	48	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627859	14627859	+	Splice_Site	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627859C>T	uc002myz.1	-	2	252	c.212_splice	c.e2-1	p.G71_splice	DNAJB1_uc010xnr.1_Splice_Site	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1						chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		CCCTTTAGGCCTGAAAAGCAG	0.547													10	47	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17374921	17374921	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17374921G>A	uc002nfs.1	-	3	206	c.93C>T	c.(91-93)GTC>GTT	p.V31V	USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Intron|USHBP1_uc010eam.1_5'UTR	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	31							PDZ domain binding			ovary(1)	1						TGGCTGCCTCGACCTCCTCTG	0.677													15	25	---	---	---	---	PASS
ZNF14	7561	broad.mit.edu	37	19	19823848	19823848	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19823848C>G	uc002nnk.1	-	4	396	c.242G>C	c.(241-243)GGA>GCA	p.G81A		NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14	81					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				AGTGGTTTCTCCACATTTGCT	0.348													47	79	---	---	---	---	PASS
ZNF14	7561	broad.mit.edu	37	19	19825240	19825240	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19825240C>G	uc002nnk.1	-	2	214	c.60G>C	c.(58-60)TTG>TTC	p.L20F		NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14	20	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				AAGAATCCAGCAAAGCCCACT	0.448													32	36	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33647250	33647250	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33647250C>T	uc002nui.2	+							NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing											ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					ACCCCACCATCTGTGTTTCAG	0.478													13	90	---	---	---	---	PASS
ZNF540	163255	broad.mit.edu	37	19	38103818	38103818	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38103818C>T	uc002ogq.2	+	5	1969	c.1637C>T	c.(1636-1638)TCT>TTT	p.S546F	ZNF540_uc002ogu.2_Missense_Mutation_p.S546F|ZNF540_uc010efq.2_Missense_Mutation_p.S514F	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	546					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAATTCATTCTGGTTTAAAA	0.393													22	95	---	---	---	---	PASS
SFRS16	11129	broad.mit.edu	37	19	45571722	45571722	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45571722G>C	uc002pak.2	+	16	1850	c.1752G>C	c.(1750-1752)AAG>AAC	p.K584N	SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Missense_Mutation_p.K522N|SFRS16_uc002pam.2_Intron	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16	584	Arg-rich.				mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGATGCAGAAGGCGCTGAACA	0.602													13	80	---	---	---	---	PASS
IGFL4	444882	broad.mit.edu	37	19	46543814	46543814	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46543814A>G	uc002pdy.1	-	2	86	c.32T>C	c.(31-33)ATT>ACT	p.I11T		NM_001002923	NP_001002923	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4 precursor	11						extracellular region					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		AAGTTCAAAAATGAAGATGGC	0.498													15	64	---	---	---	---	PASS
FGF21	26291	broad.mit.edu	37	19	49260187	49260187	+	Silent	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49260187C>G	uc002pkn.1	+	3	812	c.240C>G	c.(238-240)CTC>CTG	p.L80L	FUT1_uc002pkk.2_5'Flank|FUT1_uc002pkm.1_5'Flank|FGF21_uc002pko.1_Silent_p.L80L	NM_019113	NP_061986	Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21 precursor	80					cell-cell signaling|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import	extracellular region|soluble fraction	growth factor activity			breast(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTTAGGTCTCCTGCAGCTGA	0.597													81	122	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49649197	49649197	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49649197C>T	uc002pmr.2	+						PPFIA3_uc010yai.1_Intron|PPFIA3_uc002pms.2_Intron|PPFIA3_uc002pmt.2_Intron|PPFIA3_uc002pmu.1_5'Flank	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3							cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCCTGCCCCTCAGTCCACAGG	0.637											OREG0025618	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	52	67	---	---	---	---	PASS
AP2A1	160	broad.mit.edu	37	19	50295238	50295238	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50295238C>T	uc002ppn.2	+	5	731	c.520C>T	c.(520-522)CGA>TGA	p.R174*	AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Nonsense_Mutation_p.R174*	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1	174					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GTGCCTCCTTCGACTGTACAA	0.647													3	20	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55497595	55497595	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55497595C>T	uc002qij.2	+	8	2364	c.2278C>T	c.(2278-2280)CTG>TTG	p.L760L	NLRP2_uc010yfp.1_Silent_p.L737L|NLRP2_uc010esn.2_Silent_p.L736L|NLRP2_uc010eso.2_Silent_p.L757L|NLRP2_uc010esp.2_Silent_p.L738L	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	760					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGTAACGTATCTGACCCTTCA	0.458													14	69	---	---	---	---	PASS
U2AF2	11338	broad.mit.edu	37	19	56180459	56180459	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56180459G>T	uc002qlu.2	+	10	2011	c.956G>T	c.(955-957)GGG>GTG	p.G319V	U2AF2_uc002qlt.2_Missense_Mutation_p.G319V	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2	319	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GCCATTGCGGGGCTGAACGGC	0.662													9	31	---	---	---	---	PASS
STX16	8675	broad.mit.edu	37	20	57244413	57244413	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57244413G>C	uc002xzi.2	+	5	1195	c.460G>C	c.(460-462)GAG>CAG	p.E154Q	STX16_uc010zzq.1_Intron|STX16_uc002xzk.2_Missense_Mutation_p.E137Q|STX16_uc002xzm.2_Missense_Mutation_p.E150Q|STX16_uc002xzj.2_Missense_Mutation_p.E133Q|STX16_uc002xzl.2_Intron	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a	154	Cytoplasmic (Potential).				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CTCCGAGCAGGAGGGGCGGCT	0.682													13	24	---	---	---	---	PASS
OSBPL2	9885	broad.mit.edu	37	20	60856904	60856904	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60856904C>G	uc002yck.1	+	9	1043	c.841C>G	c.(841-843)CAC>GAC	p.H281D	OSBPL2_uc002ycl.1_Missense_Mutation_p.H269D|OSBPL2_uc011aah.1_Missense_Mutation_p.H189D|OSBPL2_uc002ycm.1_Missense_Mutation_p.H93D	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform	281					lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			AAAAGAACTTCACAAGGTGGA	0.453													25	69	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61542823	61542823	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61542823G>A	uc002ydr.1	-	3	406	c.142C>T	c.(142-144)CTG>TTG	p.L48L	DIDO1_uc002yds.1_Silent_p.L48L|DIDO1_uc002ydt.1_Silent_p.L48L|DIDO1_uc002ydu.1_Silent_p.L48L|DIDO1_uc002ydv.1_Silent_p.L48L|DIDO1_uc002ydw.1_Silent_p.L48L|DIDO1_uc002ydx.1_Silent_p.L48L|DIDO1_uc011aao.1_Silent_p.L48L	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	48					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					GGCGGCTCCAGTGGGTCAGCC	0.647													6	26	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62195546	62195546	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62195546G>A	uc002yfm.2	-	9	5521	c.4629C>T	c.(4627-4629)AGC>AGT	p.S1543S	PRIC285_uc002yfl.1_Silent_p.S974S	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	1543					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			GCGTGCACTCGCTGCCCACCA	0.652													21	24	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16337230	16337230	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16337230G>A	uc002yjx.2	-	4	3882	c.3284C>T	c.(3283-3285)TCT>TTT	p.S1095F		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1095					androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ACTTTCAGCAGATGAAGCCTC	0.408													92	193	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16338244	16338244	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16338244G>A	uc002yjx.2	-	4	2868	c.2270C>T	c.(2269-2271)TCT>TTT	p.S757F		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	757	Repression domain 3.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ACAAGGCTCAGATTTTATTTT	0.403													44	122	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40587221	40587221	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40587221C>T	uc002yxk.1	-	32	3866	c.3727G>A	c.(3727-3729)GAG>AAG	p.E1243K	BRWD1_uc010goc.1_5'UTR|BRWD1_uc002yxl.2_Missense_Mutation_p.E1243K|BRWD1_uc010god.1_Missense_Mutation_p.E209K	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1243	Bromo 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTACACTCTCAGGTTCGTTA	0.328													6	57	---	---	---	---	PASS
RRP1B	23076	broad.mit.edu	37	21	45104458	45104458	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45104458C>T	uc002zdk.2	+	10	1030	c.916C>T	c.(916-918)CGA>TGA	p.R306*	RRP1B_uc002zdl.2_5'Flank	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	306					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		TGTTGCTGATCGACTCCTGGA	0.483													53	84	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47929216	47929216	+	Silent	SNP	G	C	C			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47929216G>C	uc002zjo.2	+	7	1014	c.831G>C	c.(829-831)CTG>CTC	p.L277L	DIP2A_uc011afy.1_Silent_p.L213L|DIP2A_uc011afz.1_Silent_p.L277L|DIP2A_uc002zjl.2_Silent_p.L277L|DIP2A_uc002zjm.2_Silent_p.L277L|DIP2A_uc010gql.2_Silent_p.L234L|DIP2A_uc002zjn.2_Silent_p.L277L|DIP2A_uc002zjp.1_Silent_p.L22L	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	277					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGCAGCTTCTGAACACCCTGA	0.502													56	136	---	---	---	---	PASS
ZNF74	7625	broad.mit.edu	37	22	20760282	20760282	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20760282A>G	uc010gsm.2	+	6	1171	c.959A>G	c.(958-960)AAC>AGC	p.N320S	ZNF74_uc002zsg.2_Missense_Mutation_p.N249S|ZNF74_uc002zsh.2_Missense_Mutation_p.N320S|ZNF74_uc002zsi.2_Missense_Mutation_p.N249S|ZNF74_uc010gsn.2_Missense_Mutation_p.N249S	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	320	C2H2-type 3.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TCGTCCCTCAACGTGCACCAG	0.662													12	33	---	---	---	---	PASS
MAPK1	5594	broad.mit.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22127164C>T	uc002zvn.2	-	7	1204	c.964G>A	c.(964-966)GAG>AAG	p.E322K	MAPK1_uc002zvo.2_Missense_Mutation_p.E322K|MAPK1_uc010gtk.1_Missense_Mutation_p.E278K	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	GCTCTTACCTCGTCACTCGGG	0.478													12	39	---	---	---	---	PASS
SEC14L3	266629	broad.mit.edu	37	22	30866217	30866217	+	Silent	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30866217C>T	uc003ahy.2	-	3	245	c.156G>A	c.(154-156)TCG>TCA	p.S52S	SEC14L3_uc003ahz.2_5'UTR|SEC14L3_uc003aia.2_5'UTR|SEC14L3_uc003aib.2_5'UTR	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	52						integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	GCAAAGCCTCCGACTTCTGCA	0.522													7	34	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41652027	41652027	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41652027G>A	uc003azs.2	-	9	2541	c.1071C>T	c.(1069-1071)CTC>CTT	p.L357L	RANGAP1_uc003azt.2_Silent_p.L357L|RANGAP1_uc003azu.2_Silent_p.L357L|RANGAP1_uc003azr.2_5'Flank|RANGAP1_uc010gyk.2_5'Flank|RANGAP1_uc011aoz.1_Silent_p.L302L	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	357					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TTCCCTACCTGAGGGACGCCA	0.453													15	46	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50719361	50719361	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50719361C>T	uc003bkv.3	-	24	3911	c.3805G>A	c.(3805-3807)GAG>AAG	p.E1269K	PLXNB2_uc003bkt.1_Missense_Mutation_p.E61K|PLXNB2_uc003bku.1_Missense_Mutation_p.E254K	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1269	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ATGCCGGCCTCGTGCACGTCG	0.647													11	49	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9900723	9900723	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9900723C>A	uc004csu.1	+	6	3490	c.3400C>A	c.(3400-3402)CGT>AGT	p.R1134S	SHROOM2_uc004csv.2_5'UTR|SHROOM2_uc011mic.1_5'UTR|SHROOM2_uc004csw.1_5'UTR	NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	1134					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				TGTCTGTGAGCGTGGAAGCCA	0.652													13	93	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11187767	11187767	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11187767G>T	uc004cup.1	-	9	2540	c.1667C>A	c.(1666-1668)ACC>AAC	p.T556N	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.T556N|ARHGAP6_uc004cum.1_Missense_Mutation_p.T353N|ARHGAP6_uc004cun.1_Missense_Mutation_p.T376N|ARHGAP6_uc010neb.1_Missense_Mutation_p.T378N|ARHGAP6_uc011mif.1_Missense_Mutation_p.T353N	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	556	Rho-GAP.				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						TCCAAATATGGTGGCTAAGTT	0.453													24	114	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18183227	18183227	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18183227C>G	uc004cyj.3	-	14	2456	c.2302G>C	c.(2302-2304)GCT>CCT	p.A768P		NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	768										ovary(3)|kidney(1)|central_nervous_system(1)	5						CTGGCTTCAGCCCTTCTGACG	0.552													13	306	---	---	---	---	PASS
EDA	1896	broad.mit.edu	37	X	69176994	69176994	+	Intron	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69176994C>T	uc004dxs.2	+						EDA_uc004dxr.2_Intron|EDA_uc011mpj.1_Intron|EDA_uc004dxp.1_3'UTR|EDA_uc004dxq.1_Nonsense_Mutation_p.Q172*	NM_001399	NP_001390	Q92838	EDA_HUMAN	ectodysplasin A isoform EDA-A1						cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3						TAAGTCTACTCAGTTGATCCT	0.318													9	43	---	---	---	---	PASS
RGAG4	340526	broad.mit.edu	37	X	71350359	71350359	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71350359G>A	uc010nlh.1	-	1	1393	c.1032C>T	c.(1030-1032)TAC>TAT	p.Y344Y	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	344										ovary(2)|skin(1)	3	Renal(35;0.156)					CATCTTCACTGTAGTACTCTT	0.483													17	84	---	---	---	---	PASS
GLRA4	441509	broad.mit.edu	37	X	102979469	102979469	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102979469C>T	uc011mse.1	-	3	691	c.270G>A	c.(268-270)ATG>ATA	p.M90I	GLRA4_uc010nou.2_Missense_Mutation_p.M90I	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	90	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						GATCCCTTACCATTGTGGTCT	0.547													17	25	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125685755	125685755	+	Silent	SNP	C	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685755C>A	uc004eul.2	-	1	1088	c.837G>T	c.(835-837)GCG>GCT	p.A279A		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	279	WD 3.									skin(3)|ovary(1)	4						CCAAGGACACCGCTCCCAGTT	0.632													60	62	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127185830	127185830	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185830C>G	uc004eum.2	-	1	553	c.356G>C	c.(355-357)CGA>CCA	p.R119P		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	119						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						TAGCTTTTCTCGAATTTCCCT	0.488													8	538	---	---	---	---	PASS
RAB39B	116442	broad.mit.edu	37	X	154490502	154490502	+	Silent	SNP	G	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154490502G>A	uc004fne.2	-	2	507	c.228C>T	c.(226-228)CGC>CGT	p.R76R		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	76					protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGTAGTAGGCGCGAGTGATGG	0.428													6	291	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16945182	16945184	+	RNA	DEL	AAT	-	-	rs71803374		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16945182_16945184delAAT	uc010ocf.1	-	4		c.973_975delATT			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						TACTGATGAAAATAATAACAGAT	0.246													4	2	---	---	---	---	
RCC2	55920	broad.mit.edu	37	1	17736400	17736400	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17736400delA	uc001bal.2	-						RCC2_uc001bam.2_Intron	NM_001136204	NP_001129676	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2						cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		TGCGATGATCAAAATCATGAG	0.498													72	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20952662	20952665	+	IGR	DEL	AAGA	-	-	rs72050492	by1000genomes	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20952662_20952665delAAGA								CDA (7264 upstream) : PINK1 (7283 downstream)																							ggaaggaaggaagaaaggaaggga	0.010													2	4	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242229	67242234	+	Intron	DEL	TATGTG	-	-	rs35979624		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242229_67242234delTATGTG	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						ATTCTACATATAtgtgtgtgtgtggg	0.252													6	3	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114301137	114301137	+	Intron	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114301137delT	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron|PHTF1_uc001edp.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGTACATCTTTTTTTTTTT	0.388													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145559918	145559919	+	Intron	INS	-	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145559918_145559919insA	uc001emp.3	+						ANKRD35_uc010oyx.1_Intron|ANKRD35_uc001eob.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aactccgtctcaaaaaaaaaaa	0.203													5	3	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20169509	20169510	+	Intron	INS	-	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20169509_20169510insT	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTTTCTTGAAttttttttttt	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26362999	26362999	+	IGR	DEL	C	-	-	rs59974708		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26362999delC								RAB10 (2677 upstream) : HADHA (50506 downstream)																							TTTTTTTTTTCTTTTTTACTT	0.308													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28210682	28210682	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28210682delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|uc002rlw.2_5'Flank	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					accctgtctcaaaaaaaaaaa	0.100													5	4	---	---	---	---	
TEX261	113419	broad.mit.edu	37	2	71219277	71219277	+	Intron	DEL	T	-	-	rs112462352		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71219277delT	uc002shn.2	-						TEX261_uc010fdy.2_Intron	NM_144582	NP_653183	Q6UWH6	TX261_HUMAN	testis expressed sequence 261							integral to membrane					0						AAAGGCAACAttttttttttt	0.284													4	2	---	---	---	---	
PRPF40A	55660	broad.mit.edu	37	2	153529199	153529199	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153529199delA	uc002tyi.2	-						PRPF40A_uc002tyg.3_5'Flank|PRPF40A_uc002tyh.3_Intron|PRPF40A_uc010zcd.1_Intron|PRPF40A_uc002tyj.2_Intron	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3						mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TAGTGGTTTGAAAAAAAAAAT	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201160031	201160034	+	IGR	DEL	CCTT	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201160031_201160034delCCTT								C2orf47 (331186 upstream) : SPATS2L (10570 downstream)																							tttctccctcccttccttccttcc	0.093													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	111197863	111197864	+	IGR	DEL	CA	-	-	rs7650195		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111197863_111197864delCA								PVRL3 (285490 upstream) : CD96 (63062 downstream)																							CGAACAGCCTcacacacacaca	0.436													4	3	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132404892	132404893	+	Intron	INS	-	A	A	rs78161722		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132404892_132404893insA	uc003epe.1	-						NPHP3_uc003eoz.1_5'Flank|NPHP3_uc003epd.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						gactccgtctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152634899	152634902	+	IGR	DEL	GGAA	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152634899_152634902delGGAA								P2RY1 (79058 upstream) : RAP2B (245127 downstream)																							agggagggagggaaggaaggaagg	0.029													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32780006	32780006	+	IGR	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32780006delT								None (None upstream) : None (None downstream)																							tttctttttcttttttttttt	0.005													5	3	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48596037	48596037	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48596037delA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AGCGTTCCTTAAAAAAAAAAA	0.169													4	3	---	---	---	---	
ADAD1	132612	broad.mit.edu	37	4	123342283	123342283	+	Intron	DEL	A	-	-	rs35017745		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123342283delA	uc003ieo.2	+						ADAD1_uc003iep.2_Intron|ADAD1_uc003ieq.2_Intron	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1						multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						CCTCTTATGTAAAAAAAAAAT	0.204													4	4	---	---	---	---	
LOC644936	644936	broad.mit.edu	37	5	79596393	79596397	+	5'Flank	DEL	CACGG	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79596393_79596397delCACGG	uc010jai.2	-							NR_004845				Homo sapiens cytoplasmic beta-actin pseudogene, mRNA (cDNA clone IMAGE:30378151).												0						tccctctccccacggtctccctctc	0.215													8	6	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102347083	102347084	+	Intron	DEL	CA	-	-	rs71886397		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102347083_102347084delCA	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_Intron	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	aacacacactcacacacacaca	0.050													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103090919	103090919	+	IGR	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103090919delA								NUDT12 (192429 upstream) : None (None downstream)																							aaaggaaaggaaggaagCTAA	0.144													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115803579	115803590	+	Intron	DEL	GTGGTGGTGGTG	-	-	rs10551961		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115803579_115803590delGTGGTGGTGGTG	uc010jck.2	-						SEMA6A_uc003krx.3_Intron|SEMA6A_uc003krv.3_5'UTR|SEMA6A_uc003krw.3_Intron|SEMA6A_uc010jcj.2_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		ACACGGCTTAgtggtggtggtggtggtggtgg	0.269													8	4	---	---	---	---	
ATG5	9474	broad.mit.edu	37	6	106764250	106764250	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106764250delA	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		TATCCACTTCAAAAAAAAAAA	0.269													3	3	---	---	---	---	
KATNA1	11104	broad.mit.edu	37	6	149959854	149959854	+	5'Flank	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149959854delA	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_5'Flank	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TCACTCCTTTAAAAAAAACAT	0.194													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152786901	152786902	+	Intron	INS	-	AC	AC	rs10549697		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152786901_152786902insAC	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Intron|SYNE1_uc003qoz.2_Intron|SYNE1_uc003qoy.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAAGAacacatacacacacaca	0.297										HNSCC(10;0.0054)			3	3	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158502667	158502668	+	Intron	DEL	TC	-	-	rs149018292	by1000genomes	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502667_158502668delTC	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		tttttttttttctctgagacaa	0.188													4	5	---	---	---	---	
GUSB	2990	broad.mit.edu	37	7	65440836	65440836	+	Intron	DEL	A	-	-	rs112120049		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65440836delA	uc003tun.2	-						GUSB_uc011kdt.1_Intron	NM_000181	NP_000172	P08236	BGLR_HUMAN	glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0						agaccatctcaaaaaaaaaaa	0.229													4	2	---	---	---	---	
PMS2L4	5382	broad.mit.edu	37	7	66762433	66762433	+	Intron	DEL	A	-	-	rs68053451		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66762433delA	uc003tvo.2	-						PMS2L4_uc003tvq.2_Intron|PMS2L4_uc003tvr.3_Intron|PMS2L4_uc003tvs.3_Intron					Homo sapiens cDNA clone IMAGE:4081618.												0						tctcaaaaagaaaaaaaaaaa	0.124													7	4	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86536850	86536850	+	Intron	DEL	A	-	-	rs72283133		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536850delA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CATTCCCTACAAAAAAAAAAA	0.323													3	3	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													4	2	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102815705	102815705	+	3'UTR	DEL	G	-	-	rs7796853		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102815705delG	uc003vbh.3	-	21					DPY19L2P2_uc003vbg.3_RNA|DPY19L2P2_uc010lit.2_RNA	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						ATCAAGttttgtttttttttt	0.199													5	3	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128317558	128317559	+	Intron	INS	-	AAAAA	AAAAA	rs10659136		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317558_128317559insAAAAA	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						gactccgtctcaaaaaaaaaaa	0.223													5	4	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153844580	153844580	+	Intron	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153844580delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ccttcctttcttTTTCTGTcg	0.119													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3909402	3909405	+	Intron	DEL	CTTC	-	-	rs61550073		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3909402_3909405delCTTC	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ttcctcctttcttccttccttcct	0.078													2	4	---	---	---	---	
PFKFB3	5209	broad.mit.edu	37	10	6257402	6257403	+	Intron	INS	-	GGGCTGCG	GGGCTGCG	rs148095189	by1000genomes	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6257402_6257403insGGGCTGCG	uc001ije.2	+						PFKFB3_uc001ijd.2_Intron|PFKFB3_uc009xii.2_Intron|PFKFB3_uc010qaw.1_Intron|PFKFB3_uc001ijf.2_Intron	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						ggaataaggctgggctgcgggg	0.173													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42529341	42529341	+	IGR	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42529341delA								None (None upstream) : LOC441666 (297974 downstream)																							agttgaatacacacaacacaa	0.000													8	5	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25242892	25242893	+	Intron	INS	-	G	G	rs111750448		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25242892_25242893insG	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					TGCTGGGGGGAGAAAGAAATGC	0.455													37	18	---	---	---	---	
CCT2	10576	broad.mit.edu	37	12	69985660	69985662	+	Intron	DEL	AAC	-	-	rs34385564		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69985660_69985662delAAC	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			ctaaaagcaaaacaacaacagaa	0.103													3	4	---	---	---	---	
HVCN1	84329	broad.mit.edu	37	12	111120770	111120770	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111120770delA	uc001trs.1	-						HVCN1_uc001trq.1_Intron|HVCN1_uc001trt.1_Intron|HVCN1_uc010syd.1_Intron	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1						response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						actccatctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118519822	118519823	+	Intron	INS	-	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118519822_118519823insA	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						aactccatcttaaaaaaaaaaa	0.198													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82265214	82265214	+	IGR	DEL	A	-	-	rs34280872		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82265214delA								None (None upstream) : None (None downstream)																							GAGTTGTTCTAAAAAAAAAAA	0.174													9	5	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105694881	105694881	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105694881delA	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		gctgttcctcaaaaaaaaaaa	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31128275	31128275	+	IGR	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31128275delT								ARHGAP11B (150466 upstream) : MTMR15 (67780 downstream)																							TTTGATAAGCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46417205	46417207	+	IGR	DEL	TCT	-	-	rs61108426		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46417205_46417207delTCT								None (None upstream) : ANKRD26P1 (86042 downstream)																							aatggAATCATCTtcgaatggaa	0.054													4	2	---	---	---	---	
CES4	51716	broad.mit.edu	37	16	55794475	55794476	+	5'Flank	INS	-	G	G			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55794475_55794476insG	uc002eik.2	+						CES4_uc010cce.2_5'Flank	NR_003276				RecName: Full=Inactive carboxylesterase 4; AltName: Full=Placental carboxylesterase 3;          Short=PCE-3; Flags: Precursor;												0						GGGGCCAGGGTGGCGCCAGGGC	0.624													4	2	---	---	---	---	
C16orf80	29105	broad.mit.edu	37	16	58163124	58163126	+	5'UTR	DEL	GAA	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58163124_58163126delGAA	uc002enb.1	-	1						NM_013242	NP_037374	Q9Y6A4	CP080_HUMAN	transcription factor IIB						multicellular organismal development						0						GCCCTGTTCCGAAGAAGGGTGGT	0.670													7	8	---	---	---	---	
ACACA	31	broad.mit.edu	37	17	35581888	35581889	+	Intron	DEL	TA	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35581888_35581889delTA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuz.2_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGGAAAGGGTtatatatatata	0.312													4	3	---	---	---	---	
AOC3	8639	broad.mit.edu	37	17	41006868	41006869	+	Intron	INS	-	T	T	rs34666602		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41006868_41006869insT	uc002ibv.2	+							NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor						amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	ttttcttttccttttttttttt	0.267													4	3	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56650881	56650882	+	Intron	INS	-	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56650881_56650882insT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACCAAAGAGACTTTTTTTTGGC	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	76490463	76490463	+	5'Flank	DEL	C	-	-	rs34910684		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76490463delC	uc002jvt.1	+											Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		TTGCCTGAAGCCCCCCCAGCC	0.627													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79639371	79639371	+	Intron	DEL	A	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639371delA	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ctgtgtcaagaaaaaaaaaaa	0.269													4	3	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8113944	8113945	+	Intron	INS	-	TTTT	TTTT	rs71354598		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113944_8113945insTTTT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				ATATACTCATCTTTTTTTTTTT	0.292													4	2	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9576901	9576905	+	Intron	DEL	TAAAG	-	-	rs76696293		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9576901_9576905delTAAAG	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						CAAATGCGCTTAAAGTAAAGCTCTA	0.180													2	5	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29973144	29973144	+	Intron	DEL	T	-	-	rs10708225		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29973144delT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						CTCTGAATTGttttttttttt	0.308													4	2	---	---	---	---	
NRTN	4902	broad.mit.edu	37	19	5824421	5824422	+	Intron	DEL	GT	-	-	rs141994814		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5824421_5824422delGT	uc002mde.2	+							NM_004558	NP_004549	Q99748	NRTN_HUMAN	neurturin preproprotein						axon guidance|MAPKKK cascade|neural crest cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region	growth factor activity				0						GTGGGAGGTGGTGGGGGGGTGT	0.530													2	4	---	---	---	---	
DENND1C	79958	broad.mit.edu	37	19	6469043	6469043	+	Intron	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6469043delT	uc002mfe.2	-						DENND1C_uc002mfb.2_Intron|DENND1C_uc002mfc.2_Intron|DENND1C_uc002mfd.2_Intron|DENND1C_uc010xje.1_Intron	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						TTAGTTAGtcttttttttttt	0.264													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709273	13709274	+	IGR	INS	-	AAAG	AAAG	rs148148215	by1000genomes	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709273_13709274insAAAG								CACNA1A (91999 upstream) : CCDC130 (133300 downstream)																							gaccctgtcaaaaaggaaggaa	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	5	---	---	---	---	
GSK3A	2931	broad.mit.edu	37	19	42741315	42741315	+	Intron	DEL	T	-	-	rs67093459		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42741315delT	uc002otb.1	-						GSK3A_uc002ota.1_Intron|GSK3A_uc002otc.2_Intron	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha						insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				CTTCACCCCAttttttttttt	0.269													4	2	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49409198	49409202	+	Intron	DEL	CACTC	-	-	rs71903082		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49409198_49409202delCACTC	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGGTGGCCTCACTCCCGGCCTCCA	0.659													3	5	---	---	---	---	
SIGLEC14	100049587	broad.mit.edu	37	19	52148952	52148953	+	Intron	INS	-	ACAC	ACAC	rs141777694	by1000genomes	TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52148952_52148953insACAC	uc002pxf.3	-							NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor						cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		CTCTCTCTTCTacacacacaca	0.505													8	4	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35694040	35694040	+	Intron	DEL	T	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35694040delT	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				TGCAAATAACtttttttttta	0.119													4	2	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28146769	28146770	+	3'UTR	INS	-	A	A	rs144435711		TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28146769_28146770insA	uc003adj.2	-	2					MN1_uc010gvg.2_RNA	NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						CCAACCTAGAGAAAAAAAAAAA	0.287			T	ETV6	AML|meningioma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42384500	42384501	+	IGR	INS	-	A	A			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384500_42384501insA								CASK (602213 upstream) : PPP1R2P9 (252118 downstream)																							tttgtctcaggaaaaaaaaaaa	0.149													6	4	---	---	---	---	
RLIM	51132	broad.mit.edu	37	X	73836527	73836528	+	5'Flank	INS	-	T	T			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73836527_73836528insT	uc004ebu.2	-						RLIM_uc004ebw.2_5'Flank	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting						random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ttctttctttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10037863	10037863	+	IGR	DEL	C	-	-			TCGA-DS-A0VN-01	TCGA-DS-A0VN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10037863delC								TTTY22 (387009 upstream) : None (None downstream)																							ATCGACACTTCGAACGCACTT	0.552													7	4	---	---	---	---	
