Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL2	114819	broad.mit.edu	37	1	16812982	16812982	+	Intron	SNP	A	C	C	rs139388756	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16812982A>C	uc001ays.2	-						CROCCL2_uc001ayt.2_RNA					Homo sapiens mRNA for KIAA1922 protein, partial cds.												0						AGGTCCTTCTAGTGGAGCACC	0.667													2	4	---	---	---	---	PASS
NASP	4678	broad.mit.edu	37	1	46073803	46073803	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46073803G>T	uc001coi.1	+	6	1322	c.1220G>T	c.(1219-1221)GGC>GTC	p.G407V	NASP_uc010olq.1_Missense_Mutation_p.G370V|NASP_uc001coh.1_Missense_Mutation_p.G409V|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Missense_Mutation_p.G343V|NASP_uc001cok.1_Missense_Mutation_p.G290V	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2	407	Glu-rich (acidic).				blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					ACAAAAGATGGCTCAGGACTA	0.488													6	154	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157551405	157551405	+	Missense_Mutation	SNP	C	T	T	rs143188744	byFrequency	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157551405C>T	uc001fqw.2	-	7	1301	c.1165G>A	c.(1165-1167)GCC>ACC	p.A389T	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	389	Helical; (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GCTCCCGCGGCGACAAGGCCA	0.572													5	44	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186147655	186147655	+	Missense_Mutation	SNP	G	A	A	rs144069476	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186147655G>A	uc001grq.1	+	104	16280	c.16051G>A	c.(16051-16053)GGG>AGG	p.G5351R	HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5351	EGF-like 6; calcium-binding (Potential).				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ATTAGGGGACGGGAAATCTTG	0.483													11	333	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214781719	214781719	+	Intron	SNP	A	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214781719A>G	uc001hkm.2	+						uc001hkn.1_Silent_p.G155G	NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CGGAAGGCCTACCCGAGCTGG	0.647													3	28	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222717002	222717002	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222717002C>T	uc001hnh.1	-	2	909	c.851G>A	c.(850-852)CGC>CAC	p.R284H		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	284					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GCGATTGTGGCGGAATTTGGG	0.483													8	236	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170930058	170930058	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170930058A>G	uc010zdi.1	+	36	5140	c.5140A>G	c.(5140-5142)ATA>GTA	p.I1714V	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Missense_Mutation_p.I535V|UBR3_uc002uft.3_Missense_Mutation_p.I571V|UBR3_uc010zdj.1_Missense_Mutation_p.I405V|UBR3_uc002ufu.3_Missense_Mutation_p.I220V	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1714					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						ATTTGATATTATAACTCAGTG	0.418													90	137	---	---	---	---	PASS
CXCR1	3577	broad.mit.edu	37	2	219028938	219028938	+	Missense_Mutation	SNP	G	A	A	rs140349292	byFrequency	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219028938G>A	uc002vhc.2	-	2	1116	c.997C>T	c.(997-999)CGT>TGT	p.R333C		NM_000634	NP_000625	P25024	CXCR1_HUMAN	interleukin 8 receptor alpha	333	Cytoplasmic (Potential).				dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity			lung(2)	2						ACACGATGACGTGCCAAGAAC	0.468													8	107	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	T	T	rs121913396		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266098A>T	uc010hia.1	+	4	251	c.95A>T	c.(94-96)GAC>GTC	p.D32V	CTNNB1_uc003ckp.2_Missense_Mutation_p.D32V|CTNNB1_uc003ckq.2_Missense_Mutation_p.D32V|CTNNB1_uc003ckr.2_Missense_Mutation_p.D32V|CTNNB1_uc011azf.1_Missense_Mutation_p.D25V|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	32			Missing (in hepatocellular carcinoma).|D -> A (in hepatocellular carcinoma).|D -> G (in PTR and hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.D32Y(110)|p.A5_A80del(63)|p.D32N(58)|p.D32G(53)|p.D32H(37)|p.D32V(20)|p.D32A(12)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.WQQQSYLD25?(5)|p.Q28_H134del(5)|p.W25_D32del(4)|p.W25_I140del(4)|p.S23_S33del(3)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32E(2)|p.D32_S47del(2)|p.W25_H36del(2)|p.Y30_S33del(2)|p.V22_S33del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.W25_I35del(1)|p.V22_G80>NNNNN(1)|p.A5_I35del(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.D32del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.D32_H36>D(1)|p.P16_K133del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.E9_I140del(1)|p.D32_S33insS(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.A5_Q143>E(1)|p.A5_Q72del(1)|p.Q28_D32>H(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.S23_I35del(1)|p.V22_S71>A(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				5	52	---	---	---	---	PASS
FHIT	2272	broad.mit.edu	37	3	59999869	59999869	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59999869A>G	uc003dkx.3	-	6	484	c.113T>C	c.(112-114)GTG>GCG	p.V38A	FHIT_uc003dky.2_Missense_Mutation_p.V38A|FHIT_uc010hnn.1_Missense_Mutation_p.V38A	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene	38	HIT.				nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		CAGCGGGCACACAAGGACATC	0.542			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				6	84	---	---	---	---	PASS
LIMCH1	22998	broad.mit.edu	37	4	41621299	41621299	+	Silent	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41621299G>A	uc003gvu.3	+	8	831	c.777G>A	c.(775-777)GAG>GAA	p.E259E	LIMCH1_uc003gvt.1_Silent_p.E100E|LIMCH1_uc003gvv.3_Silent_p.E259E|LIMCH1_uc003gvw.3_Silent_p.E259E|LIMCH1_uc003gvx.3_Silent_p.E259E|LIMCH1_uc003gwe.3_Silent_p.E259E|LIMCH1_uc003gvy.3_Silent_p.E100E|LIMCH1_uc003gwa.3_Silent_p.E100E|LIMCH1_uc003gvz.3_Silent_p.E100E|LIMCH1_uc011byu.1_Silent_p.E105E|LIMCH1_uc003gwc.3_Silent_p.E105E|LIMCH1_uc003gwd.3_Silent_p.E105E|LIMCH1_uc011byv.1_Silent_p.E10E|LIMCH1_uc003gwb.1_Silent_p.E107E	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	259					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CCCATGGTGAGCCGAAATCAG	0.547													18	261	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52861922	52861922	+	Silent	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52861922G>A	uc003gzi.2	-	4	1279	c.1266C>T	c.(1264-1266)AAC>AAT	p.N422N		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	422						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						AGAAGCCCTCGTTTGAATACG	0.537													11	168	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100544012	100544012	+	3'UTR	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100544012C>T	uc003hvc.3	+	19					MTTP_uc011cej.1_3'UTR	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large						lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	TTGAAACTGACCTGTGATATT	0.453													45	101	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140188929	140188929	+	Silent	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188929C>T	uc003lhi.2	+	1	2258	c.2157C>T	c.(2155-2157)ACC>ACT	p.T719T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.T719T|PCDHA4_uc011daa.1_Silent_p.T719T	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	719	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGTACACCGCGCTGCGGT	0.657													6	93	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554610	140554610	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554610C>T	uc003lit.2	+	1	2368	c.2194C>T	c.(2194-2196)CGA>TGA	p.R732*	PCDHB8_uc011dai.1_5'Flank	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	732	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.R732*(1)		ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCCTTTCCACGACATCTGGT	0.637													21	525	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50740477	50740477	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50740477C>T	uc003paf.2	+	8	1771	c.1259C>T	c.(1258-1260)GCG>GTG	p.A420V	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	420							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					AACGGCGGAGCGGCGGATTCT	0.507													12	73	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85446536	85446536	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85446536G>A	uc003pkl.1	-	8	1691	c.1691C>T	c.(1690-1692)ACG>ATG	p.T564M	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	564					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CTGCCGATCCGTCATGGTCCC	0.527													10	102	---	---	---	---	PASS
CDK19	23097	broad.mit.edu	37	6	110948346	110948346	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110948346T>C	uc003puh.1	-	7	722	c.649A>G	c.(649-651)ATA>GTA	p.I217V	CDK19_uc003pui.1_Missense_Mutation_p.I157V|CDK19_uc011eax.1_Missense_Mutation_p.I93V	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)	217	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						ATTGCCCATATATCTGGGAAG	0.318													45	80	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31378446	31378446	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31378446A>G	uc003tch.2	-	2	790	c.437T>C	c.(436-438)CTT>CCT	p.L146P		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	146	Helix-loop-helix motif.				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						AATTTCAGAAAGTGCCCAGAT	0.443													42	94	---	---	---	---	PASS
CA1	759	broad.mit.edu	37	8	86249177	86249177	+	Silent	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86249177G>A	uc003ydh.2	-	5	551	c.351C>T	c.(349-351)GCC>GCT	p.A117A	CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Silent_p.A117A|CA1_uc003ydi.2_Silent_p.A117A	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I	117					one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	ACATTACCTCGGCAGAATATT	0.413													16	196	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120569893	120569893	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120569893C>T	uc003yot.1	-	25	2546	c.2460G>A	c.(2458-2460)ATG>ATA	p.M820I	ENPP2_uc011lic.1_Missense_Mutation_p.M358I|ENPP2_uc003yor.1_Missense_Mutation_p.M455I|ENPP2_uc003yos.1_Missense_Mutation_p.M872I|ENPP2_uc010mdd.1_Missense_Mutation_p.M845I	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	820					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGTGCATCTTCATGAGTTCTT	0.463													7	228	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	14665	14665	+	3'UTR	SNP	G	A	A	rs149305563	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14665G>A	uc010mgm.1	-	11					WASH5P_uc003zfr.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAGCCTTCCGCTCCTTGAAG	0.617													3	15	---	---	---	---	PASS
CRB2	286204	broad.mit.edu	37	9	126132707	126132707	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126132707C>A	uc004bnx.1	+	7	1467	c.1375C>A	c.(1375-1377)CTG>ATG	p.L459M	CRB2_uc004bnw.1_Missense_Mutation_p.L459M	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN	crumbs homolog 2 precursor	459	Extracellular (Potential).|Laminin G-like 1.					extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						TGGTGGCCCCCTGGGTCTGGC	0.617													5	56	---	---	---	---	PASS
CRB2	286204	broad.mit.edu	37	9	126132708	126132708	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126132708T>A	uc004bnx.1	+	7	1468	c.1376T>A	c.(1375-1377)CTG>CAG	p.L459Q	CRB2_uc004bnw.1_Missense_Mutation_p.L459Q	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN	crumbs homolog 2 precursor	459	Extracellular (Potential).|Laminin G-like 1.					extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GGTGGCCCCCTGGGTCTGGCA	0.612													5	55	---	---	---	---	PASS
SH3GLB2	56904	broad.mit.edu	37	9	131772101	131772101	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131772101T>C	uc004bwv.2	-	9	934	c.788A>G	c.(787-789)TAC>TGC	p.Y263C	SH3GLB2_uc004bww.2_Missense_Mutation_p.Y267C|SH3GLB2_uc004bwx.1_Missense_Mutation_p.Y263C|SH3GLB2_uc011mbm.1_Missense_Mutation_p.Y267C	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	263	BAR.				filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0						CTGTGCGTAGTAGGTTGTCTG	0.622													9	13	---	---	---	---	PASS
CUL2	8453	broad.mit.edu	37	10	35351967	35351967	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35351967G>A	uc001ixv.2	-	3	353	c.143C>T	c.(142-144)GCC>GTC	p.A48V	CUL2_uc009xma.2_5'UTR|CUL2_uc010qer.1_Missense_Mutation_p.A67V|CUL2_uc001ixw.2_Missense_Mutation_p.A48V|CUL2_uc010qes.1_Missense_Mutation_p.A48V	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	48					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						TTCAGGATAGGCCACACATAA	0.313													11	118	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1268402	1268402	+	Intron	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1268402G>A	uc009ycr.1	+						MUC5B_uc001ltb.2_Missense_Mutation_p.S3434N	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		gccaccagcagcacAGTGACT	0.338													2	3	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606581	55606581	+	Silent	SNP	G	A	A	rs139231893	byFrequency	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606581G>A	uc010rio.1	+	1	354	c.354G>A	c.(352-354)GCG>GCA	p.A118A		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.A118V(1)		ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TTCTATTTGCGGTGATGGCCT	0.423													7	305	---	---	---	---	PASS
MEN1	4221	broad.mit.edu	37	11	64572284	64572284	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64572284C>T	uc001obj.2	-	10	1443	c.1370G>A	c.(1369-1371)CGG>CAG	p.R457Q	MAP4K2_uc001obh.2_5'Flank|MAP4K2_uc001obi.2_5'Flank|MAP4K2_uc010rnp.1_5'Flank|MEN1_uc001obk.2_Missense_Mutation_p.R457Q|MEN1_uc001obl.2_Missense_Mutation_p.R417Q|MEN1_uc001obm.2_Missense_Mutation_p.R452Q|MEN1_uc001obn.2_Missense_Mutation_p.R457Q|MEN1_uc001obo.2_Missense_Mutation_p.R457Q|MEN1_uc001obp.2_Missense_Mutation_p.R452Q|MEN1_uc001obq.2_Missense_Mutation_p.R457Q|MEN1_uc001obr.2_Missense_Mutation_p.R457Q	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	457					DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding			parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						CACCTTCTGCCGCACCTGGGC	0.726			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				21	119	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													3	34	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													3	36	---	---	---	---	PASS
KRT1	3848	broad.mit.edu	37	12	53071120	53071120	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53071120C>T	uc001sau.1	-	5	1167	c.1108G>A	c.(1108-1110)GAG>AAG	p.E370K	KRT1_uc001sav.1_Missense_Mutation_p.E370K	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	370	Rod.|Coil 2.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						TACAAGGACTCGGCCTCAGCT	0.522													9	125	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111652018	111652018	+	Silent	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111652018C>T	uc001tsa.1	+	2	231	c.78C>T	c.(76-78)TCC>TCT	p.S26S	CUX2_uc001tsb.1_Silent_p.S81S	NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	26						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						AGCTTAATTCCGTCGCTTCTG	0.318													7	130	---	---	---	---	PASS
ACADS	35	broad.mit.edu	37	12	121176678	121176678	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121176678G>A	uc001tza.3	+	8	1107	c.989G>A	c.(988-990)CGC>CAC	p.R330H	ACADS_uc010szl.1_Missense_Mutation_p.R326H|ACADS_uc001tzb.3_Missense_Mutation_p.R211H	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	330						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	CTGACCTGGCGCGCTGCCATG	0.642													5	113	---	---	---	---	PASS
CAMKK2	10645	broad.mit.edu	37	12	121735597	121735597	+	5'Flank	SNP	T	G	G	rs2686367	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121735597T>G	uc001tzu.2	-						CAMKK2_uc001tzt.2_5'Flank|CAMKK2_uc001tzv.2_5'UTR|CAMKK2_uc001tzw.2_5'UTR|CAMKK2_uc001tzx.2_5'UTR|CAMKK2_uc001tzy.2_5'UTR|CAMKK2_uc001uab.2_5'UTR|CAMKK2_uc001uac.2_5'UTR|CAMKK2_uc001uad.1_5'Flank	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GTGCTTCTCTTGTATTTCTAG	0.413													5	3	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130935764	130935764	+	Silent	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130935764G>A	uc001uil.2	-	5	593	c.429C>T	c.(427-429)AGC>AGT	p.S143S	RIMBP2_uc001uim.2_Silent_p.S51S	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	143						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGCATCTTGCGCTACCGGATC	0.637													5	80	---	---	---	---	PASS
FOXA1	3169	broad.mit.edu	37	14	38060569	38060569	+	3'UTR	SNP	G	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38060569G>T	uc001wuf.2	-	2					FOXA1_uc010tpz.1_3'UTR	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1						chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		AGTCCCGGGAGCTAGGAAGTG	0.552													4	80	---	---	---	---	PASS
FOXA1	3169	broad.mit.edu	37	14	38060572	38060572	+	Nonstop_Mutation	SNP	A	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38060572A>C	uc001wuf.2	-	2	1729	c.1417T>G	c.(1417-1419)TAG>GAG	p.*473E	FOXA1_uc010tpz.1_Nonstop_Mutation_p.*440E	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	473					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CCCGGGAGCTAGGAAGTGTTT	0.562													4	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102304631	102304631	+	5'Flank	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102304631C>T	uc002cbx.1	-						uc002ccc.1_RNA|uc002ccd.2_RNA|uc002ccf.3_5'Flank|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		GCGTCGGAACCTGCAGACACT	0.602													2	7	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51173899	51173899	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51173899G>A	uc010vgs.1	-	2	2265	c.2234C>T	c.(2233-2235)ACG>ATG	p.T745M	SALL1_uc010vgr.1_Missense_Mutation_p.T648M|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	745	C2H2-type 4.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATTCCCTTTCGTGGTGAAAGC	0.547													6	97	---	---	---	---	PASS
DPH1	1801	broad.mit.edu	37	17	1939852	1939852	+	Missense_Mutation	SNP	C	T	T	rs36104739		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1939852C>T	uc002fts.2	+	5	463	c.445C>T	c.(445-447)CGG>TGG	p.R149W	DPH1_uc002ftr.1_RNA|DPH1_uc002ftt.2_Missense_Mutation_p.R144W|DPH1_uc010cjx.2_Missense_Mutation_p.R9W|DPH1_uc010vqs.1_Missense_Mutation_p.R159W|DPH1_uc002ftu.2_5'Flank|DPH1_uc002ftv.2_5'Flank	NM_001383	NP_001374	Q9BZG8	DPH1_HUMAN	diptheria toxin resistance protein required for	149					peptidyl-diphthamide biosynthetic process from peptidyl-histidine|translation	cytoplasm|nucleus				pancreas(1)	1						CCAAGACTTCCGGGTGCTGTA	0.627													11	148	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5035597	5035597	+	Intron	SNP	G	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5035597G>T	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Missense_Mutation_p.R82M|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						GAGCTGGATAGGGACAGAGCC	0.652			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								3	44	---	---	---	---	PASS
TOM1L2	146691	broad.mit.edu	37	17	17772648	17772648	+	Intron	SNP	T	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17772648T>C	uc002grz.3	-						TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Intron|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc010vxb.1_Missense_Mutation_p.E256G|TOM1L2_uc002grv.3_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3						intracellular protein transport	intracellular					0	all_neural(463;0.228)					GAAATCCGGCTCCCACCTCTC	0.468													6	31	---	---	---	---	PASS
RPL19	6143	broad.mit.edu	37	17	37360425	37360425	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37360425G>A	uc002hrq.1	+	5	514	c.452G>A	c.(451-453)CGC>CAC	p.R151H	RPL19_uc002hrr.1_Missense_Mutation_p.R149H	NM_000981	NP_000972	P84098	RL19_HUMAN	ribosomal protein L19	151					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0						GACAAGGCCCGCAAGAAGCTC	0.453													3	51	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21426327	21426327	+	Silent	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21426327C>T	uc002kuq.2	+	31	3872	c.3786C>T	c.(3784-3786)GGC>GGT	p.G1262G	LAMA3_uc002kur.2_Silent_p.G1262G	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1262	Domain IV 1 (domain IV B).				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACCACAAGGGCGCCCTGCCTT	0.632													7	189	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13423526	13423526	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13423526G>A	uc010dze.2	-	12	1864	c.1628C>T	c.(1627-1629)ACG>ATG	p.T543M	CACNA1A_uc010dzc.2_Missense_Mutation_p.T68M|CACNA1A_uc002mwy.3_Missense_Mutation_p.T542M|CACNA1A_uc010xne.1_Missense_Mutation_p.T68M	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	543	Cytoplasmic (Potential).|II.				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GTAAGGCCGCGTCCCAAGCCC	0.438													8	93	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38572930	38572930	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38572930T>C	uc002ohk.2	+	3	1234	c.725T>C	c.(724-726)CTC>CCC	p.L242P		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	242					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACCGAGCTCCTCCGGGCAGAT	0.701													3	58	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47878858	47878858	+	Missense_Mutation	SNP	C	T	T	rs61751860	byFrequency	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47878858C>T	uc010xyn.1	+	10	2541	c.2200C>T	c.(2200-2202)CGC>TGC	p.R734C	DHX34_uc010xyo.1_5'Flank	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	734						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GGGCGCGGGGCGCAGGCGCAA	0.736													2	1	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33875234	33875234	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33875234G>A	uc010zux.1	-	4	1466	c.1348C>T	c.(1348-1350)CGG>TGG	p.R450W	EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Missense_Mutation_p.R105W	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	450										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGGAGGGGCCGGGAGCGAGGA	0.647													5	60	---	---	---	---	PASS
CEP250	11190	broad.mit.edu	37	20	34091637	34091637	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34091637C>G	uc002xcm.2	+	31	6111	c.5440C>G	c.(5440-5442)CAG>GAG	p.Q1814E	CEP250_uc010zve.1_Missense_Mutation_p.Q1182E	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	1814	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGCCCTAGCCCAGAGGGACCA	0.607													5	100	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3242966	3242966	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3242966C>A	uc004crg.3	-	5	917	c.760G>T	c.(760-762)GCA>TCA	p.A254S		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	254	LRRCT.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AAGCACATTGCACACAACTGA	0.408													9	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	51150821	51150821	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51150821C>T	uc004dpj.2	+	1	1055	c.953C>T	c.(952-954)GCG>GTG	p.A318V		NM_203407	NP_981952			hypothetical protein LOC340602																		CGCGATTCTGCGCCAGGCCCT	0.736													9	4	---	---	---	---	PASS
NXF3	56000	broad.mit.edu	37	X	102337712	102337712	+	Silent	SNP	G	A	A	rs146732324		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102337712G>A	uc004eju.2	-	8	827	c.756C>T	c.(754-756)GAC>GAT	p.D252D	NXF3_uc010noi.1_Silent_p.D102D|NXF3_uc011mrw.1_Silent_p.D252D|NXF3_uc011mrx.1_Silent_p.D163D	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	252						cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3						CTTCATGGACGTCCAGGGAGG	0.478													21	159	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2205	2205	+	5'Flank	SNP	T	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2205T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		TTAAGAAAGCGTTCAAGCTCA	0.388													6	2	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1633002	1633003	+	Intron	INS	-	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1633002_1633003insC	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|MMP23A_uc001ahi.1_Intron|MMP23A_uc009vko.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GGGGCAGGCAGCGGGGGGGGGC	0.728													4	2	---	---	---	---	
KCNAB2	8514	broad.mit.edu	37	1	6066179	6066179	+	Intron	DEL	C	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6066179delC	uc009vlv.1	+							NM_003636	NP_003627	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		gctcccacgtccccccactcc	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33445601	33445601	+	IGR	DEL	C	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33445601delC								RNF19B (15315 upstream) : AK2 (27985 downstream)																							TGCCTGCCCACCCCCAAATGC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38733363	38733364	+	IGR	INS	-	CCTTCCTCCTT	CCTTCCTCCTT	rs142813208	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38733363_38733364insCCTTCCTCCTT								POU3F1 (220913 upstream) : RRAGC (571651 downstream)																							tttcctccctcctctctcttcc	0.000													4	2	---	---	---	---	
LYSMD1	388695	broad.mit.edu	37	1	151133973	151133973	+	Intron	DEL	A	-	-	rs33999172		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151133973delA	uc001ewy.2	-						LYSMD1_uc010pcr.1_Intron	NM_212551	NP_997716	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			accccgtctcaaaaaaaaaaa	0.209													5	4	---	---	---	---	
ASH1L	55870	broad.mit.edu	37	1	155448689	155448689	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155448689delA	uc009wqq.2	-	3	4452	c.3972delT	c.(3970-3972)TTTfs	p.F1324fs	ASH1L_uc001fkt.2_Frame_Shift_Del_p.F1324fs|ASH1L_uc009wqr.1_Frame_Shift_Del_p.F1324fs	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1324					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGAAACTATTAAAGTTGATTC	0.408													268	7	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179310672	179310672	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179310672delT	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	TACGTTGAACttttttttttt	0.149													6	3	---	---	---	---	
NENF	29937	broad.mit.edu	37	1	212617910	212617911	+	Intron	DEL	TA	-	-	rs71644492		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212617910_212617911delTA	uc001hjd.2	+						NENF_uc010ptf.1_Intron	NM_013349	NP_037481	Q9UMX5	NENF_HUMAN	neuron derived neurotrophic factor precursor							extracellular space	heme binding				0				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		tgtgtgtgtgtATCTGGGCAAG	0.163													4	2	---	---	---	---	
C1orf31	388753	broad.mit.edu	37	1	234519320	234519321	+	Intron	DEL	AC	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234519320_234519321delAC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GTTACAGCTGacacacacacac	0.124													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20169510	20169510	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20169510delT	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTCTTGAAttttttttttt	0.144													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57947617	57947628	+	IGR	DEL	GAAAGAAAGAAA	-	-	rs72434332	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57947617_57947628delGAAAGAAAGAAA								None (None upstream) : VRK2 (187158 downstream)																							aggaaggaaggaaagaaagaaagaaagaaaga	0.132													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156340380	156340381	+	IGR	INS	-	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156340380_156340381insT								KCNJ3 (627366 upstream) : NR4A2 (840565 downstream)																							AAGTTGCAGTCTTTTTTTTTCT	0.337													4	2	---	---	---	---	
COL5A2	1290	broad.mit.edu	37	2	189953661	189953664	+	Intron	DEL	TTGA	-	-	rs75422763		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189953661_189953664delTTGA	uc002uqk.2	-							NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TTAAGTTGCTTTGATTGTTTGTGC	0.343													11	6	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225664783	225664785	+	Intron	DEL	AAA	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225664783_225664785delAAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATAAATAATTAAAAAAAACCATG	0.281													5	5	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11685144	11685144	+	Intron	DEL	A	-	-	rs72268569		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11685144delA	uc003bwf.2	-						VGLL4_uc010hdx.1_5'UTR|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		TGCAAAAGTTAAAAAAAAAAA	0.408													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													9	4	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142774048	142774049	+	Intron	INS	-	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142774048_142774049insT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						GTTGGCATACATTTTTTTTTTT	0.317													4	2	---	---	---	---	
FIP1L1	81608	broad.mit.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54319248_54319249delAG	uc003gzy.2	+	16	1633_1634	c.1447_1448delAG	c.(1447-1449)AGAfs	p.R483fs	PDGFRA_uc003haa.2_Intron|FIP1L1_uc011bzu.1_Frame_Shift_Del_p.R477fs|FIP1L1_uc003gzz.2_Frame_Shift_Del_p.R409fs|FIP1L1_uc003hab.2_Frame_Shift_Del_p.R448fs|FIP1L1_uc003hac.2_Frame_Shift_Del_p.R237fs|FIP1L1_uc010ign.2_RNA|FIP1L1_uc003had.2_Frame_Shift_Del_p.P67fs|FIP1L1_uc003hae.2_Frame_Shift_Del_p.P67fs	NM_030917	NP_112179	Q6UN15	FIP1_HUMAN	FIP1 like 1 isoform 1	483	Arg-rich.|Sufficient for interaction with CPSF1 and CSTF3.|Glu-rich.				mRNA processing	nucleus	RNA binding			ovary(1)|skin(1)	2			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.292			T	PDGFRA	idiopathic hypereosinophilic syndrome								124	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	69362551	69362552	+	3'UTR	INS	-	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69362551_69362552insT	uc003hdz.3	+	10						NM_014058	NP_054777			transmembrane protease, serine 11E																		AACAGATAACATTTTTTTTTGT	0.391													297	7	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186180379	186180379	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186180379delT	uc003ixh.2	+							NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TGGTAGAGTATTTTTTTTTTT	0.289													4	2	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190882936	190882937	+	Intron	DEL	AG	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190882936_190882937delAG	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATGTATAATCAGAGTTTGAGGT	0.203													114	7	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10424069	10424069	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10424069delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ATATATAACCTTTTTTTTTTT	0.214													7	4	---	---	---	---	
UTP15	84135	broad.mit.edu	37	5	72874391	72874391	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72874391delT	uc003kcw.1	+						UTP15_uc011cso.1_Intron|UTP15_uc011csp.1_Intron|UTP15_uc010ize.1_Intron	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,						rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		AAGTTACTCCTTTTTTTTTTT	0.289													4	3	---	---	---	---	
FAM151B	167555	broad.mit.edu	37	5	79794833	79794833	+	Intron	DEL	A	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79794833delA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		TGGCAGATGGAAAAAAAAAAA	0.408													5	4	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127713243	127713244	+	Intron	INS	-	A	A	rs111488675		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127713243_127713244insA	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCTCCACCACCAAAAAAAAAAA	0.312													4	3	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140031160	140031161	+	Intron	INS	-	A	A	rs75532104		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140031160_140031161insA	uc003lgq.2	+						IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gactccgtctcaaaaaaaaaaa	0.104													4	3	---	---	---	---	
FAM114A2	10827	broad.mit.edu	37	5	153382738	153382738	+	Intron	DEL	T	-	-	rs555490	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153382738delT	uc003lvb.2	-						FAM114A2_uc003lvc.2_Intron|FAM114A2_uc003lvd.2_Intron|FAM114A2_uc003lve.2_Intron|FAM114A2_uc011dda.1_Intron	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827								purine nucleotide binding				0						TAATTGGTAGTAttttttttt	0.194													4	2	---	---	---	---	
C1QTNF2	114898	broad.mit.edu	37	5	159797454	159797456	+	Intron	DEL	TCC	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159797454_159797456delTCC	uc003lyd.2	-							NM_031908	NP_114114	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2							collagen				skin(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCAGTGCGAGTCCTCCTCCTCCT	0.734													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171749435	171749436	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs113959773		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171749435_171749436insTTCCTTCC								UBTD2 (38640 upstream) : SH3PXD2B (11069 downstream)																							tcctccttcctttccttccttc	0.059													4	2	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179442490	179442491	+	Intron	INS	-	G	G			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442490_179442491insG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ggaaaggagtaggaaaggagta	0.114													8	5	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65288491	65288492	+	Intron	DEL	TG	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65288491_65288492delTG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						tctctctctttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145075667	145075668	+	Intron	INS	-	T	T	rs138545895		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145075667_145075668insT	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CAGAAGGAGTCttttttttttt	0.223													2	5	---	---	---	---	
KATNA1	11104	broad.mit.edu	37	6	149959866	149959866	+	5'Flank	DEL	G	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149959866delG	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_5'Flank	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		AAAAAACATTGtttttttttt	0.189													3	3	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2032464	2032469	+	Intron	DEL	GGCAGG	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2032464_2032469delGGCAGG	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GGAggcaggcggcaggggcaggggca	0.466													4	3	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38530598	38530598	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38530598delT	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						CATGTTTCAATAACTACATGA	0.373													242	26	---	---	---	---	
TRY6	154754	broad.mit.edu	37	7	142481996	142481997	+	Intron	INS	-	C	C			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481996_142481997insC	uc011ksq.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						TCCCAAGGTGGGGGGCTGAGGA	0.564													21	9	---	---	---	---	
CTSB	1508	broad.mit.edu	37	8	11711114	11711114	+	Intron	DEL	T	-	-	rs34504234		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11711114delT	uc003wum.2	-						CTSB_uc011kxl.1_Intron|CTSB_uc003wun.2_Intron|CTSB_uc003wuo.2_Intron|CTSB_uc003wup.2_Intron|CTSB_uc003wuq.2_Intron|CTSB_uc010lsc.2_Intron|CTSB_uc003wur.2_Intron|CTSB_uc003wus.1_Intron|CTSB_uc003wut.1_Intron	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CGGAGAACTCTTAAGGAGCTG	0.667													4	2	---	---	---	---	
C10orf4	118924	broad.mit.edu	37	10	95458333	95458333	+	Intron	DEL	T	-	-	rs77388743		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95458333delT	uc001kiz.1	-						C10orf4_uc001kiv.1_Intron|C10orf4_uc001kja.1_Intron|C10orf4_uc001kjb.1_Intron|C10orf4_uc009xuh.1_Intron	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein							nucleus	protein binding				0		Colorectal(252;0.122)				CTTAACATTATTTTAATACCT	0.174													2	4	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	654161	654163	+	Intron	DEL	CCC	-	-	rs66594327		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:654161_654163delCCC	uc001lqq.1	-						DEAF1_uc009ycf.1_Intron	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CCCCATTGGACCCCCtttttttt	0.350													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9652950	9652950	+	IGR	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9652950delT								WEE1 (41639 upstream) : SWAP70 (32678 downstream)																							TTGTAtttccttttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43283606	43283606	+	RNA	DEL	A	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43283606delA	uc001mxe.1	-	2		c.1330delT								Homo sapiens cDNA FLJ44864 fis, clone BRALZ2013621, moderately similar to Heterogeneous nuclear ribonucleoprotein K.																		AAGCAAATGTAAAAAAAAAAA	0.388													7	5	---	---	---	---	
IFFO1	25900	broad.mit.edu	37	12	6658357	6658357	+	Intron	DEL	A	-	-	rs72489368		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6658357delA	uc001qpd.1	-						IFFO1_uc001qoy.2_Intron|IFFO1_uc001qpa.1_5'Flank|IFFO1_uc001qpb.1_Intron|IFFO1_uc001qpe.1_Intron|IFFO1_uc010sfe.1_Intron|IFFO1_uc001qpf.1_Intron|IFFO1_uc001qoz.1_5'Flank|IFFO1_uc001qpc.1_Intron|IFFO1_uc001qpg.2_5'Flank	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2							intermediate filament					0						TGACTCAACTAAAAAAAAAAA	0.428													4	3	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224950	78224957	+	5'Flank	DEL	AGAGAGAG	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224950_78224957delAGAGAGAG	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagacagagagagagagagagag	0.226										HNSCC(70;0.22)			3	5	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25450983	25450994	+	Intron	DEL	TTTTATCTGATT	-	-	rs145646662		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25450983_25450994delTTTTATCTGATT	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		atttttctcattttatctgatttttctcatgc	0.000													3	5	---	---	---	---	
NAA16	79612	broad.mit.edu	37	13	41941416	41941416	+	Intron	DEL	T	-	-	rs6560981	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41941416delT	uc001uyf.2	+						NAA16_uc010tfg.1_Intron	NM_024561	NP_078837	Q6N069	NAA16_HUMAN	NMDA receptor regulated 1-like protein isoform						N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding			central_nervous_system(1)	1						ATGCCAAAAATAATTCATATC	0.308													4	2	---	---	---	---	
C14orf21	161424	broad.mit.edu	37	14	24772593	24772593	+	Intron	DEL	T	-	-	rs112529240		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772593delT	uc001wol.1	+						C14orf21_uc001wom.1_Intron	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424								RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		ACCCAGCTAAttttttttttt	0.313													8	4	---	---	---	---	
FOXA1	3169	broad.mit.edu	37	14	38060721	38060721	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38060721delG	uc001wuf.2	-	2	1580	c.1268delC	c.(1267-1269)GCAfs	p.A423fs	FOXA1_uc010tpz.1_Frame_Shift_Del_p.A390fs	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	423					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GTATTGCAGTGCCTGTTCGTA	0.612													66	12	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31373682	31373683	+	Intron	INS	-	G	G	rs146732773		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31373682_31373683insG	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron|ITGAX_uc010vfk.1_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GGTGGGTTCCAGGTTCTGGGGA	0.708													4	3	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58572304	58572305	+	Intron	INS	-	C	C	rs146715386	by1000genomes	TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58572304_58572305insC	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc010vik.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AAATTTAAAAACAGCCAGTAAT	0.347													3	3	---	---	---	---	
SLC7A6	9057	broad.mit.edu	37	16	68334930	68334931	+	3'UTR	INS	-	T	T			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68334930_68334931insT	uc002evt.1	+	12					SLC7A6_uc002evu.1_3'UTR|SLC7A6_uc002evv.1_RNA|SLC7A6_uc010cfc.1_RNA|SLC7A6OS_uc002evw.1_3'UTR	NM_001076785	NP_001070253	Q92536	YLAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|antiporter activity			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)		TTTTTTCAACGTTTTTTTTTCT	0.436													4	2	---	---	---	---	
ZCCHC14	23174	broad.mit.edu	37	16	87500638	87500638	+	Intron	DEL	A	-	-	rs11313581		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87500638delA	uc002fjz.1	-						ZCCHC14_uc002fka.1_Intron	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GTTTTTCATGAAAAAAAAAAA	0.219													3	3	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8464961	8464962	+	Intron	INS	-	A	A	rs71359702		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8464961_8464962insA	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron|MYH10_uc010cny.1_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						AAATTGTACTTAAAAAAAAAAA	0.371													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42626341	42626342	+	IGR	INS	-	C	C	rs72265911		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42626341_42626342insC								GPATCH8 (45539 upstream) : FZD2 (8583 downstream)																							cttccttccttccttccttcct	0.134													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68974494	68974497	+	IGR	DEL	AGGA	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68974494_68974497delAGGA								KCNJ2 (798313 upstream) : None (None downstream)																							ggagggagggaggaaggaaggaag	0.000													1	5	---	---	---	---	
SKA1	220134	broad.mit.edu	37	18	47918723	47918723	+	3'UTR	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47918723delT	uc002let.2	+	7					SKA1_uc002leu.2_3'UTR|SKA1_uc010xdl.1_3'UTR	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						ttttgtttccttttttttttt	0.095													4	2	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67818117	67818120	+	Intron	DEL	CTGT	-	-	rs146554691		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67818117_67818120delCTGT	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AAAGATTCTCCTGTCTAACAGTTT	0.294													10	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7816083	7816084	+	IGR	DEL	AA	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7816083_7816084delAA								CD209 (3619 upstream) : CLEC4M (11951 downstream)																							CTGGATTGTgaaaaaaaaaaaa	0.208													4	2	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													6	3	---	---	---	---	
CEACAM16	388551	broad.mit.edu	37	19	45207037	45207037	+	Intron	DEL	A	-	-	rs71364503		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207037delA	uc010xxd.1	+						CEACAM16_uc002ozq.2_Intron	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion											ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TCttttttttaaaaaaaaaaa	0.468													4	2	---	---	---	---	
GPCPD1	56261	broad.mit.edu	37	20	5545874	5545874	+	Intron	DEL	T	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5545874delT	uc002wme.3	-						GPCPD1_uc002wmd.3_Intron	NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN	hypothetical protein LOC56261						glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0						CTGAGATCCCttttttttttt	0.219													11	5	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37182420	37182421	+	Intron	INS	-	AA	AA	rs11472819		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37182420_37182421insAA	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						agcccagtctcaaaaaaaaaaa	0.104													6	3	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18976301	18976308	+	Intron	DEL	TATTTATT	-	-	rs111433751		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18976301_18976308delTATTTATT	uc002zom.1	+						DGCR5_uc002zon.1_Intron	NR_002733				Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						TGGCTGGACAtatttatttatttattta	0.236													3	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33411227	33411228	+	Intron	INS	-	T	T	rs74280322		TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33411227_33411228insT	uc003amz.2	-							NM_001135774	NP_001129246	O14994	SYN3_HUMAN	synapsin III isoform IIIg						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						aaaaaaaaaaaCTACTGTATCT	0.188													3	3	---	---	---	---	
ARSH	347527	broad.mit.edu	37	X	2942330	2942330	+	Intron	DEL	A	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2942330delA	uc011mhj.1	+							NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H							integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGCTAGACCGAAAAAAAAAAA	0.373													4	2	---	---	---	---	
UBE2A	7319	broad.mit.edu	37	X	118716913	118716913	+	Intron	DEL	A	-	-			TCGA-EJ-5494-01	TCGA-EJ-5494-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118716913delA	uc004erl.2	+						UBE2A_uc004erm.2_Intron|UBE2A_uc004ern.2_Intron|UBE2A_uc004ero.2_Intron|UBE2A_uc004erp.2_Intron	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						cttctcccttaaaaaaaaaaa	0.169								Direct_reversal_of_damage|Rad6_pathway					4	2	---	---	---	---	
