Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974919	16974919	+	RNA	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974919C>T	uc010och.1	+	7		c.1379C>T			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						TGCTCCCGGCCCCGCCAGGGC	0.677													10	73	---	---	---	---	PASS
TCEB3	6924	broad.mit.edu	37	1	24086127	24086127	+	3'UTR	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24086127G>T	uc001bho.2	+	11						NM_003198	NP_003189	Q14241	ELOA1_HUMAN	elongin A						positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TGGGGGTTGGGGAATGGAATT	0.517													3	70	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34015923	34015923	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34015923G>A	uc001bxn.1	-	55	8368	c.8339C>T	c.(8338-8340)CCG>CTG	p.P2780L	CSMD2_uc001bxm.1_Missense_Mutation_p.P2924L	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2780	Sushi 19.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGAGTGAGGCGGGGAGCCCGG	0.572													23	92	---	---	---	---	PASS
WDR65	149465	broad.mit.edu	37	1	43675874	43675874	+	3'UTR	SNP	C	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43675874C>A	uc001cip.1	+	11					EBNA1BP2_uc001cio.2_Intron|WDR65_uc001ciq.1_3'UTR	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65											skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ccgtagctgccgtgagtgtgg	0.055													2	6	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732100	152732100	+	Silent	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732100G>A	uc001fal.1	+	2	94	c.36G>A	c.(34-36)CCG>CCA	p.P12P		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	12	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCGCCTGCCGCTCCAACAGT	0.582													28	92	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1133461	1133461	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1133461G>A	uc002qwq.2	+	6	505	c.377G>A	c.(376-378)GGC>GAC	p.G126D	SNTG2_uc002qwp.2_RNA|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	126	PDZ.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CAGGTTAATGGCATACATGTA	0.269													19	157	---	---	---	---	PASS
RPL23AP32	56969	broad.mit.edu	37	2	54756736	54756736	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54756736T>C	uc010yot.1	+	1	378	c.254T>C	c.(253-255)TTT>TCT	p.F85S	SPTBN1_uc002rxu.2_Intron|SPTBN1_uc002rxv.1_Intron	NR_002229				SubName: Full=Putative uncharacterized protein DKFZp547I014;												0						ACCACTGAGTTTGCCATGAAG	0.483													5	78	---	---	---	---	PASS
RPL23AP32	56969	broad.mit.edu	37	2	54756737	54756737	+	Silent	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54756737T>C	uc010yot.1	+	1	379	c.255T>C	c.(253-255)TTT>TTC	p.F85F	SPTBN1_uc002rxu.2_Intron|SPTBN1_uc002rxv.1_Intron	NR_002229				SubName: Full=Putative uncharacterized protein DKFZp547I014;												0						CCACTGAGTTTGCCATGAAGA	0.478													5	76	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95464613	95464613	+	RNA	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95464613T>C	uc010fhp.2	-	17		c.2777A>G				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						ATTTCTTCTTTCAACATCTTT	0.303													3	84	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97883087	97883087	+	Silent	SNP	A	G	G	rs62156175	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97883087A>G	uc010yva.1	+	64	4075	c.3831A>G	c.(3829-3831)ACA>ACG	p.T1277T	ANKRD36_uc002sxr.1_Silent_p.T102T	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1277											0						CAAGAATAACAGGCGGTTGGA	0.328													2	6	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97883094	97883094	+	Missense_Mutation	SNP	T	G	G	rs62156176	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97883094T>G	uc010yva.1	+	64	4082	c.3838T>G	c.(3838-3840)TGG>GGG	p.W1280G	ANKRD36_uc002sxr.1_Missense_Mutation_p.W105G	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1280											0						AACAGGCGGTTGGAAATCTGG	0.338													2	3	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166165901	166165901	+	Silent	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166165901G>A	uc002udc.2	+	6	935	c.645G>A	c.(643-645)GCG>GCA	p.A215A	SCN2A_uc002udd.2_Silent_p.A215A|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	215	Helical; Voltage-sensor; Name=S4 of repeat I; (Potential).|I.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ATGTCTCAGCGTTGAGAACAT	0.438													7	114	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218679689	218679689	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218679689A>C	uc002vgt.2	-	25	4761	c.4363T>G	c.(4363-4365)TTT>GTT	p.F1455V	TNS1_uc002vgr.2_Missense_Mutation_p.F1442V|TNS1_uc002vgs.2_Missense_Mutation_p.F1434V|TNS1_uc002vgq.2_5'Flank	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1455						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCCTGGACAAACTTCACTTTA	0.423													16	34	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	118974959	118974959	+	5'UTR	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118974959G>T	uc003ibx.2	+	2					NDST3_uc011cgf.1_5'UTR|NDST3_uc003ibw.2_5'UTR	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						GAGCTGCAATGGTGACATAAA	0.363													3	62	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155254246	155254246	+	Silent	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155254246G>A	uc003inw.2	-	9	1617	c.1617C>T	c.(1615-1617)AAC>AAT	p.N539N	DCHS2_uc003inx.2_Silent_p.N1038N	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	539	Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCAGGCTGCCGTTGAGGAACA	0.672													4	49	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175898106	175898106	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175898106A>G	uc003iuc.2	+	5	2100	c.1430A>G	c.(1429-1431)GAT>GGT	p.D477G	ADAM29_uc003iud.2_Missense_Mutation_p.D477G|ADAM29_uc010irr.2_Missense_Mutation_p.D477G|ADAM29_uc011cki.1_Missense_Mutation_p.D477G	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	477	Disintegrin.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AAGTGCCCAGATGACTTTTAT	0.448													40	159	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140563550	140563550	+	Silent	SNP	C	T	T	rs56237941	byFrequency	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140563550C>T	uc003liv.2	+	1	2571	c.1416C>T	c.(1414-1416)AGC>AGT	p.S472S	PCDHB16_uc010jfw.1_Silent_p.S144S	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	472	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGGCAGCGTCAGCGCCA	0.627													18	90	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140573541	140573541	+	Silent	SNP	C	T	T	rs17844565	byFrequency	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140573541C>T	uc003lix.2	+	1	1590	c.1416C>T	c.(1414-1416)AGC>AGT	p.S472S		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	472	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGGCAGCGTCAGCGCCA	0.662													6	111	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140870417	140870417	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140870417G>A	uc003lla.1	+	1	1610	c.1610G>A	c.(1609-1611)CGA>CAA	p.R537Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.R537Q	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	537	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGGGTTCGAGACTCCGGC	0.537													37	109	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149460527	149460527	+	Missense_Mutation	SNP	G	A	A	rs139635308		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149460527G>A	uc003lrl.2	-	2	305	c.110C>T	c.(109-111)ACG>ATG	p.T37M	CSF1R_uc011dcd.1_Translation_Start_Site|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.T37M|CSF1R_uc011dce.1_Missense_Mutation_p.T37M|CSF1R_uc011dcf.1_Missense_Mutation_p.T37M	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	37	Ig-like C2-type 1.|Extracellular (Potential).				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CAAGGTCACCGTTGCTCCTGG	0.597													14	43	---	---	---	---	PASS
SAP30L	79685	broad.mit.edu	37	5	153835716	153835716	+	3'UTR	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153835716A>G	uc003lvk.2	+	4					SAP30L_uc003lvm.3_RNA|SAP30L_uc011ddc.1_3'UTR|SAP30L_uc011ddd.1_3'UTR	NM_024632	NP_078908	Q9HAJ7	SP30L_HUMAN	SAP30-like isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|metal ion binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			AATACTGTAAATCTTTTTGGT	0.294													4	10	---	---	---	---	PASS
FKBP5	2289	broad.mit.edu	37	6	35588018	35588018	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35588018G>A	uc011dte.1	-	4	487	c.284C>T	c.(283-285)GCT>GTT	p.A95V	FKBP5_uc003okx.2_Missense_Mutation_p.A95V|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Missense_Mutation_p.A95V|FKBP5_uc003okz.2_Missense_Mutation_p.A95V	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1	95	PPIase FKBP-type 1.				protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						CTTCATGGTAGCCACCCCAAT	0.423													45	137	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38816530	38816530	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38816530C>T	uc003ooe.1	+	35	5101	c.4501C>T	c.(4501-4503)CTT>TTT	p.L1501F		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTGGGTTTATCTTGAAGCCGT	0.358													16	177	---	---	---	---	PASS
AKAP7	9465	broad.mit.edu	37	6	131490307	131490307	+	Silent	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131490307A>G	uc003qck.2	+	5	516	c.483A>G	c.(481-483)GGA>GGG	p.G161G	AKAP7_uc011ebz.1_Silent_p.G139G|AKAP7_uc003qcl.1_Silent_p.G42G	NM_016377	NP_057461	O43687	AKA7A_HUMAN	A-kinase anchor protein 7 isoform gamma	Error:Variant_position_missing_in_O43687_after_alignment					intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		TCCTCCAGGGAAAACATTTGA	0.353													61	211	---	---	---	---	PASS
FBXO5	26271	broad.mit.edu	37	6	153292428	153292428	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153292428T>C	uc003qpg.2	-	5	1323	c.1214A>G	c.(1213-1215)TAT>TGT	p.Y405C	FBXO5_uc003qph.2_Missense_Mutation_p.Y359C	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN	F-box only protein 5 isoform a	405	IBR-type.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CTTCGTACAATAATCAAATCC	0.418													18	148	---	---	---	---	PASS
WBSCR27	155368	broad.mit.edu	37	7	73249237	73249237	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73249237T>C	uc003tzj.2	-	6	614	c.574A>G	c.(574-576)ATG>GTG	p.M192V	RFC2_uc011kfa.1_Intron	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN	Williams-Beuren syndrome chromosome region 27	192										central_nervous_system(1)	1		Lung NSC(55;0.159)				CCTTCCCACATCCCAGCCTGC	0.642													7	46	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106811063	106811063	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106811063C>T	uc003ymd.2	+	7	874	c.851C>T	c.(850-852)TCA>TTA	p.S284L	ZFPM2_uc011lhs.1_Missense_Mutation_p.S15L|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	284					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GCTCCGGTGTCAGAGGAAAAT	0.527													47	133	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8485768	8485768	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8485768C>G	uc003zkk.2	-	27	3760	c.3049G>C	c.(3049-3051)GAT>CAT	p.D1017H	PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.D1008H|PTPRD_uc003zkm.2_Missense_Mutation_p.D1004H|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1017	Fibronectin type-III 8.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTACCTTGATCCACAGGCAGT	0.448										TSP Lung(15;0.13)			17	44	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49457141	49457141	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49457141G>T	uc001jgi.2	-	3	339	c.232C>A	c.(232-234)CAT>AAT	p.H78N	FRMPD2_uc001jgh.2_Missense_Mutation_p.H69N|FRMPD2_uc001jgj.2_Missense_Mutation_p.H78N	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	78	KIND.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		GCCTCTATATGAGAAACACGG	0.532													17	45	---	---	---	---	PASS
MMP27	64066	broad.mit.edu	37	11	102562466	102562466	+	3'UTR	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102562466A>G	uc001phd.1	-	10						NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		ATATTAAAAGACCTGTTGAGG	0.279													22	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92018	92018	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92018T>C	uc010sdi.1	-	2	320	c.292A>G	c.(292-294)AGT>GGT	p.S98G	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		GACTCCACACTCTCCTGGGTT	0.592													3	7	---	---	---	---	PASS
LTBR	4055	broad.mit.edu	37	12	6495568	6495568	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6495568A>G	uc001qny.1	+	6	793	c.625A>G	c.(625-627)ACC>GCC	p.T209A	LTBR_uc010sfc.1_Missense_Mutation_p.T190A|LTBR_uc001qnz.1_Missense_Mutation_p.T204A	NM_002342	NP_002333	P36941	TNR3_HUMAN	lymphotoxin beta receptor precursor	209	Extracellular (Potential).|TNFR-Cys 4.				apoptosis|cellular response to mechanical stimulus|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	protein binding|receptor activity			lung(2)	2						GTCCGACACAACCTGCAAAAA	0.577													11	29	---	---	---	---	PASS
CLEC1A	51267	broad.mit.edu	37	12	10234003	10234003	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10234003T>A	uc001qxb.2	-	3	308	c.224A>T	c.(223-225)TAC>TTC	p.Y75F	CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Missense_Mutation_p.Y32F|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	75	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						GAGCTGGTAGTACTGAAAAAC	0.348													30	103	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15067511	15067511	+	3'UTR	SNP	T	C	C	rs148149515	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15067511T>C	uc001rco.2	-	7						NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor							endoplasmic reticulum lumen				breast(1)	1						tgtgtgtgtgtgcgtgtgtgt	0.254													5	8	---	---	---	---	PASS
ARHGDIB	397	broad.mit.edu	37	12	15102816	15102816	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15102816G>A	uc001rcq.1	-	3	289	c.185C>T	c.(184-186)CCG>CTG	p.P62L	ARHGDIB_uc001rcp.1_5'Flank	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	62					actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0						GGGGGCTTTCGGATCTGCAGG	0.483													28	109	---	---	---	---	PASS
KRT6C	286887	broad.mit.edu	37	12	52863634	52863634	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52863634C>T	uc001sal.3	-	7	1292	c.1244G>A	c.(1243-1245)CGT>CAT	p.R415H		NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C	415	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		CATCTCCCCACGCTGCTCAGC	0.602													19	75	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112717041	112717041	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112717041A>G	uc009zwc.2	-	3	514	c.496T>C	c.(496-498)TCT>CCT	p.S166P		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						CTTTTTAAAGATGACAAACCA	0.398													25	92	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113321125	113321125	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113321125C>T	uc010syl.1	+	16	1716	c.1354C>T	c.(1354-1356)CGG>TGG	p.R452W	RPH3A_uc001ttz.2_Missense_Mutation_p.R452W|RPH3A_uc001tty.2_Missense_Mutation_p.R448W|RPH3A_uc009zwe.1_Missense_Mutation_p.R448W|RPH3A_uc010sym.1_Missense_Mutation_p.R403W|RPH3A_uc001tua.2_Missense_Mutation_p.R212W	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	452	C2 1.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AAAAACTCTGCGGAATACCCG	0.562													14	67	---	---	---	---	PASS
EP400NL	347918	broad.mit.edu	37	12	132588940	132588940	+	Silent	SNP	C	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132588940C>G	uc001ujv.2	+	1	399	c.375C>G	c.(373-375)CCC>CCG	p.P125P	EP400NL_uc001ujr.2_Intron|EP400NL_uc001ujs.3_Silent_p.P56P|EP400NL_uc009zyq.2_Intron|EP400NL_uc001ujt.2_Intron|EP400NL_uc001ujw.1_5'Flank					RecName: Full=EP400 N-terminal-like protein;												0						CCCAGAGTCCCACGCAGCCCA	0.662													3	11	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49089864	49089864	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49089864G>T	uc001vch.2	-	5	427	c.56C>A	c.(55-57)ACT>AAT	p.T19N	RCBTB2_uc010tgg.1_Missense_Mutation_p.T24N|RCBTB2_uc001vci.2_5'UTR|RCBTB2_uc010tgh.1_5'UTR|RCBTB2_uc001vcj.2_Missense_Mutation_p.T23N|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_5'UTR	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	19							Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		AGATGACAGAGTAGCCTGTAC	0.388													14	163	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65239589	65239589	+	Silent	SNP	G	T	T	rs142168941		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65239589G>T	uc001xht.2	-	25	5316	c.5262C>A	c.(5260-5262)ATC>ATA	p.I1754I	SPTB_uc001xhr.2_Silent_p.I1754I|SPTB_uc001xhs.2_Silent_p.I1754I|SPTB_uc001xhu.2_Silent_p.I1754I|SPTB_uc010aqi.2_Silent_p.I415I	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1754	Spectrin 14.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGAGTCGCTCGATGAAGGCAT	0.637													18	52	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73719443	73719443	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73719443C>T	uc010ttx.1	+	10	1217	c.1054C>T	c.(1054-1056)CGG>TGG	p.R352W	PAPLN_uc001xnw.3_Missense_Mutation_p.R325W|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.R352W	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	352	TSP type-1 2.					proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCCAGCTGACCGGCGTTCCTG	0.642													39	125	---	---	---	---	PASS
YY1	7528	broad.mit.edu	37	14	100728720	100728720	+	Silent	SNP	A	G	G	rs74784003	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100728720A>G	uc001ygy.1	+	2	1239	c.759A>G	c.(757-759)GAA>GAG	p.E253E		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	253					cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				ATTATTCAGAATATATGACAG	0.383													6	214	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106208714	106208714	+	RNA	SNP	A	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106208714A>T	uc010tyt.1	-	3626		c.58618T>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_5'UTR|uc001ysf.2_5'UTR					Parts of antibodies, mostly variable regions.												0						TTGTCACAAGATTTGGGCTCT	0.582													6	245	---	---	---	---	PASS
WHAMML1	339005	broad.mit.edu	37	15	23191911	23191911	+	RNA	SNP	C	T	T	rs147199465	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23191911C>T	uc001yvg.2	-	9		c.1726G>A			WHAMML1_uc010ayc.2_RNA|WHAMML1_uc010ayd.2_RNA	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						TGATTTTCTTCGCACTGATCC	0.408													3	72	---	---	---	---	PASS
SLC24A1	9187	broad.mit.edu	37	15	65917480	65917480	+	Silent	SNP	A	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65917480A>G	uc010ujf.1	+	2	1349	c.1062A>G	c.(1060-1062)GTA>GTG	p.V354V	SLC24A1_uc010ujd.1_Silent_p.V354V|SLC24A1_uc010uje.1_Silent_p.V354V|SLC24A1_uc010ujg.1_Silent_p.V354V|SLC24A1_uc010ujh.1_Silent_p.V354V	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24	354	Extracellular (Potential).				response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						GGACCAGTGTATCAGCCATCA	0.552													13	35	---	---	---	---	PASS
IQCH	64799	broad.mit.edu	37	15	67547205	67547205	+	5'UTR	SNP	C	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67547205C>G	uc002aqo.1	+	1					AAGAB_uc002aql.2_5'Flank|AAGAB_uc002aqk.3_5'Flank|AAGAB_uc010uju.1_Intron|IQCH_uc010ujv.1_5'UTR|IQCH_uc002aqn.1_5'UTR|IQCH_uc002aqq.1_5'UTR|IQCH_uc002aqp.1_5'UTR|IQCH_uc002aqm.2_5'UTR	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1											skin(3)|ovary(1)	4				Colorectal(3;0.0856)		AACCGCGCCTCCGCGGAGGTA	0.642													2	21	---	---	---	---	PASS
WDR61	80349	broad.mit.edu	37	15	78587329	78587329	+	Intron	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78587329G>A	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron|WDR61_uc010blc.1_3'UTR	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						AAAAAGAACAGAAGCCACATT	0.428													8	124	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85345691	85345691	+	3'UTR	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85345691G>T	uc002bld.2	+	11					ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592						cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCTGCGGACCGTGGAAAATAA	0.612													6	18	---	---	---	---	PASS
MEF2A	4205	broad.mit.edu	37	15	100211780	100211780	+	Missense_Mutation	SNP	A	G	G	rs144113916	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100211780A>G	uc010urw.1	+	4	673	c.314A>G	c.(313-315)TAT>TGT	p.Y105C	MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Missense_Mutation_p.Y105C|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	105					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GATACTTCATATGTGCTAACT	0.343													3	51	---	---	---	---	PASS
MEF2A	4205	broad.mit.edu	37	15	100211794	100211794	+	Missense_Mutation	SNP	C	T	T	rs75248193	byFrequency	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100211794C>T	uc010urw.1	+	4	687	c.328C>T	c.(328-330)CAT>TAT	p.H110Y	MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Missense_Mutation_p.H110Y|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	110					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GCTAACTCCACATACAGAAGA	0.353													3	45	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30495266	30495266	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30495266C>T	uc002dyi.3	+	8	1017	c.841C>T	c.(841-843)CGC>TGC	p.R281C	ITGAL_uc010veu.1_RNA|ITGAL_uc002dyj.3_Missense_Mutation_p.R198C|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	281	VWFA.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	AGACATCATCCGCTACATCAT	0.587													31	252	---	---	---	---	PASS
RRAD	6236	broad.mit.edu	37	16	66956073	66956073	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66956073G>T	uc002eqn.2	-	5	985	c.833C>A	c.(832-834)GCG>GAG	p.A278E	RRAD_uc002eqo.2_Missense_Mutation_p.A278E	NM_001128850	NP_001122322	P55042	RAD_HUMAN	Ras-related associated with diabetes	278	Calmodulin-binding.				small GTPase mediated signal transduction	plasma membrane	calmodulin binding|GTP binding|GTPase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GAAGCGCTTCGCCTTTTTGCC	0.612													5	62	---	---	---	---	PASS
DDX28	55794	broad.mit.edu	37	16	68056489	68056489	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68056489C>A	uc002evh.1	-	1	1471	c.617G>T	c.(616-618)GGC>GTC	p.G206V	DUS2L_uc002evi.2_5'Flank|DUS2L_uc002evj.2_5'Flank|DUS2L_uc010vkk.1_5'Flank	NM_018380	NP_060850	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	206	Helicase ATP-binding.					mitochondrial nucleoid|nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		AAGGACCAGGCCTCGGGGCGC	0.662													6	69	---	---	---	---	PASS
LOC90586	90586	broad.mit.edu	37	17	41020769	41020769	+	3'UTR	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41020769G>A	uc002ibw.1	+	1					LOC90586_uc002ibx.2_Missense_Mutation_p.G62S	NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						CCACACCACCGGCTACATCAG	0.527													17	27	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45216149	45216149	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45216149C>A	uc002ild.3	-	13	1787	c.1660G>T	c.(1660-1662)GTT>TTT	p.V554F	CDC27_uc002ile.3_Missense_Mutation_p.V560F|CDC27_uc002ilf.3_Missense_Mutation_p.V553F|CDC27_uc010wkp.1_Missense_Mutation_p.V493F|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	554					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TTTGACAGAACTGAAAGAGCA	0.353													5	187	---	---	---	---	PASS
TBC1D3P2	440452	broad.mit.edu	37	17	60342186	60342186	+	RNA	SNP	T	C	C	rs79096325		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60342186T>C	uc010woz.1	-	14		c.1943A>G				NR_027486				Homo sapiens cDNA FLJ60189 complete cds, highly similar to TBC1 domain family member 3.												0						GCTGGGGGTGTTGGGAGGGGC	0.493													2	10	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55024179	55024179	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55024179A>T	uc002lgn.2	+	3	695	c.338A>T	c.(337-339)AAT>ATT	p.N113I		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	113	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GTAATAAAAAATTTTTCTTTG	0.318													35	146	---	---	---	---	PASS
GNG7	2788	broad.mit.edu	37	19	2514986	2514986	+	3'UTR	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2514986G>A	uc002lwd.2	-	5					GNG7_uc010dte.1_Intron	NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gagagagaaagagagagagag	0.308													3	53	---	---	---	---	PASS
TM6SF2	53345	broad.mit.edu	37	19	19375452	19375452	+	3'UTR	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19375452G>A	uc002nmd.1	-	10					HAPLN4_uc002nmb.2_5'Flank|HAPLN4_uc002nmc.2_Intron	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2							integral to membrane					0			Epithelial(12;0.0151)			CAGAGTCCTGGGTCCTGAGTC	0.592													4	26	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	22001955	22001955	+	Silent	SNP	T	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22001955T>G	uc002nqj.2	-	2	202	c.72A>C	c.(70-72)GCA>GCC	p.A24A	ZNF43_uc010ecv.2_Silent_p.A18A|ZNF43_uc002nql.2_Silent_p.A18A|ZNF43_uc002nqm.2_Silent_p.A18A|ZNF43_uc002nqk.2_Intron	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	24	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AATTCTGCTGTGCAATGTCCA	0.398													74	236	---	---	---	---	PASS
CEACAM3	1084	broad.mit.edu	37	19	42301582	42301582	+	Silent	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42301582G>A	uc002orn.1	+	2	202	c.126G>A	c.(124-126)CCG>CCA	p.P42P	CEACAM3_uc010eia.1_Silent_p.P42P|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion	42	Ig-like V-type.|Extracellular (Potential).					integral to membrane				skin(1)	1						AATCCATGCCGCTCAGTGTCG	0.522													62	174	---	---	---	---	PASS
LILRA1	11024	broad.mit.edu	37	19	55106788	55106788	+	Silent	SNP	G	A	A	rs112681015	byFrequency	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55106788G>A	uc002qgh.1	+	5	764	c.582G>A	c.(580-582)TCG>TCA	p.S194S	LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Silent_p.S194S	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	194	Ig-like C2-type 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		GCAGGTGGTCGTACAGGTGCT	0.572													52	186	---	---	---	---	PASS
CCDC106	29903	broad.mit.edu	37	19	56160335	56160335	+	Intron	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56160335G>A	uc002qlr.2	+						CCDC106_uc002qls.2_5'UTR	NM_013301	NP_037433	Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106							nucleus					0		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GTCCATCTGCGTCTCTCCATT	0.652													4	57	---	---	---	---	PASS
A1BG	1	broad.mit.edu	37	19	58862934	58862934	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58862934G>A	uc002qsd.3	-	5	795	c.733C>T	c.(733-735)CGC>TGC	p.R245C	NCRNA00181_uc002qse.2_Intron|A1BG_uc002qsf.1_RNA|NCRNA00181_uc002qsg.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	245	Ig-like V-type 3.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		TTCTCCCCGCGCCGTAGCTGG	0.627													10	47	---	---	---	---	PASS
CHMP4B	128866	broad.mit.edu	37	20	32441420	32441420	+	3'UTR	SNP	C	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32441420C>A	uc002xaa.2	+	5						NM_176812	NP_789782	Q9H444	CHM4B_HUMAN	chromatin modifying protein 4B						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(1)|central_nervous_system(1)	2						GCGCAGCGAGCAGGCGTGTGC	0.612													3	35	---	---	---	---	PASS
DGCR14	8220	broad.mit.edu	37	22	19121828	19121828	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19121828G>A	uc002zou.2	-	10	1349	c.1312C>T	c.(1312-1314)CCC>TCC	p.P438S	DGCR14_uc002zot.2_Missense_Mutation_p.P359S|DGCR14_uc002zov.2_RNA	NM_022719	NP_073210	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region protein 14	438					nervous system development	catalytic step 2 spliceosome				ovary(1)	1	Colorectal(54;0.0993)					GTGCTTGTGGGGGTCTGCAGC	0.692													16	35	---	---	---	---	PASS
DGCR14	8220	broad.mit.edu	37	22	19132152	19132152	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19132152A>T	uc002zou.2	-	1	39	c.2T>A	c.(1-3)ATG>AAG	p.M1K	DGCR14_uc002zot.2_5'Flank|DGCR14_uc002zov.2_RNA	NM_022719	NP_073210	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region protein 14	1					nervous system development	catalytic step 2 spliceosome				ovary(1)	1	Colorectal(54;0.0993)					CGGCGTCTCCATCGCTATCCC	0.682													3	9	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1407464	1407464	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1407464G>T	uc010nct.2	+	6	594	c.272G>T	c.(271-273)GGA>GTA	p.G91V	CSF2RA_uc011mhb.1_Missense_Mutation_p.G91V|CSF2RA_uc004cpq.2_Missense_Mutation_p.G91V|CSF2RA_uc004cpn.2_Missense_Mutation_p.G91V|CSF2RA_uc004cpo.2_Missense_Mutation_p.G91V|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_5'UTR|CSF2RA_uc004cpp.2_Missense_Mutation_p.G91V|CSF2RA_uc010ncv.2_Missense_Mutation_p.G91V|CSF2RA_uc004cpr.2_Missense_Mutation_p.G91V	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	91	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CTGCATGAAGGAGTCACATTT	0.418													146	521	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50378349	50378349	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378349G>A	uc004dpe.2	-	4	750	c.724C>T	c.(724-726)CGC>TGC	p.R242C	SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.R126C	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	242					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					CCATTGGTGCGCCGACTACCT	0.637													3	9	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106064139	106064139	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106064139G>T	uc004emo.2	+	3	439	c.274G>T	c.(274-276)GAT>TAT	p.D92Y	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emm.2_Missense_Mutation_p.D92Y|TBC1D8B_uc004emn.2_Missense_Mutation_p.D92Y	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	92						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CAAGCATTGGGATTGGTTGGA	0.308													48	55	---	---	---	---	PASS
ST7L	54879	broad.mit.edu	37	1	113126863	113126864	+	Intron	INS	-	A	A	rs76579294		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113126863_113126864insA	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCATCTTTAGAAAAAAAAAAA	0.317													4	2	---	---	---	---	
WDR3	10885	broad.mit.edu	37	1	118483353	118483355	+	Intron	DEL	ACA	-	-	rs114162187	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118483353_118483355delACA	uc010oxe.1	+						WDR3_uc001ehi.2_Intron|WDR3_uc001ehh.2_Intron	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3							nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		tctgtctcCGacaacaacaacaa	0.094													73	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153215728	153215739	+	IGR	DEL	TGGTGATGGTGG	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153215728_153215739delTGGTGATGGTGG								LELP1 (38134 upstream) : LOR (16440 downstream)																							agattggtgctggtgatggtggtggtgatggt	0.033													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189961345	189961346	+	IGR	DEL	GG	-	-	rs112920414		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189961345_189961346delGG								None (None upstream) : FAM5C (105451 downstream)																							ttttttttttggtttttttttt	0.292													4	4	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73830582	73830582	+	Intron	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73830582delA	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjh.1_3'UTR	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TATGGCACTGAAAAAAAAAAA	0.353													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91924711	91924712	+	IGR	INS	-	GGTCTGAGAA	GGTCTGAGAA	rs60861855		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91924711_91924712insGGTCTGAGAA								LOC654342 (76736 upstream) : GGT8P (38656 downstream)																							CTTTGCATTTTGTAAGTGAGCA	0.470													43	9	---	---	---	---	
MYO1B	4430	broad.mit.edu	37	2	192273057	192273060	+	Intron	DEL	AGTT	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192273057_192273060delAGTT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002usu.2_Intron|MYO1B_uc002usv.2_Intron	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TGACACTGAGAGTTAGTTATCTTT	0.304													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	63618083	63618094	+	IGR	DEL	GAAGGAAGGGAA	-	-	rs34586903		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63618083_63618094delGAAGGAAGGGAA								SYNPR (15487 upstream) : SNTN (20250 downstream)																							agggaagaaggaaggaagggaagaaggaagga	0.094													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75133402	75133402	+	IGR	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75133402delA								CNTN3 (563059 upstream) : FAM86D (337303 downstream)																							TTCCAAAAGGAAAAAAAAATG	0.393													5	3	---	---	---	---	
C3orf15	89876	broad.mit.edu	37	3	119459682	119459683	+	Intron	INS	-	TG	TG	rs57901016		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119459682_119459683insTG	uc003ede.3	+						C3orf15_uc010hqz.2_Intron|C3orf15_uc011bjd.1_Intron|C3orf15_uc011bje.1_Intron	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha							mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		CTGTCAGCATTtgtgtgtgtgt	0.168													4	2	---	---	---	---	
BFSP2	8419	broad.mit.edu	37	3	133156474	133156477	+	Intron	DEL	AAAG	-	-	rs141969388		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133156474_133156477delAAAG	uc003epn.1	+						uc003epo.2_Intron	NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0						agaaagagaaaaagaaagaagaga	0.108													4	2	---	---	---	---	
CEP70	80321	broad.mit.edu	37	3	138227578	138227579	+	Intron	INS	-	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138227578_138227579insT	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						GTTAAAAAAAAttttttttttt	0.054													7	4	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84339019	84339020	+	Intron	INS	-	T	T			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84339019_84339020insT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TTCCTGTTATGTTTTTTTTTTC	0.401								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	2	---	---	---	---	
HPGD	3248	broad.mit.edu	37	4	175443425	175443426	+	Intron	INS	-	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175443425_175443426insG	uc003itu.2	-						HPGD_uc003itv.2_Intron|HPGD_uc011ckf.1_Intron|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Intron|HPGD_uc011ckg.1_Intron|HPGD_uc011ckh.1_Intron|HPGD_uc003itw.2_Intron|HPGD_uc003itx.2_Intron	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)						female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	GCGGCCTCCCTGTCTCCGCCAG	0.644													4	2	---	---	---	---	
C5orf33	133686	broad.mit.edu	37	5	36197929	36197930	+	Intron	INS	-	A	A	rs138853300	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36197929_36197930insA	uc003jkf.3	-						C5orf33_uc003jke.3_Intron|C5orf33_uc010iux.2_Intron|C5orf33_uc003jkg.3_Intron|C5orf33_uc011cov.1_Intron	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1								NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			aacacagtaacaaaaaacctta	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172178243	172178244	+	IGR	INS	-	AAGG	AAGG	rs28532090		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172178243_172178244insAAGG								NEURL1B (59712 upstream) : DUSP1 (16858 downstream)																							agaaggaaagaaaggaaggaag	0.099													4	2	---	---	---	---	
RIPK1	8737	broad.mit.edu	37	6	3110841	3110842	+	Intron	INS	-	TT	TT	rs34063767		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3110841_3110842insTT	uc010jni.2	+						RIPK1_uc003muv.3_Intron|RIPK1_uc003muw.3_Intron|RIPK1_uc011dhs.1_Intron|RIPK1_uc003mux.2_Intron	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine						activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				tgtgttatttcttttttttttt	0.084													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								4	2	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104973281	104973285	+	Intron	DEL	TTTAC	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104973281_104973285delTTTAC	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATTGCTATTGTTTACTTTATAGGGT	0.288										HNSCC(12;0.0054)			232	14	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110473966	110473967	+	Intron	INS	-	T	T	rs140313571	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110473966_110473967insT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GATTCCGACAATTTTTTTAATG	0.267										HNSCC(38;0.096)			22	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	111044530	111044533	+	IGR	DEL	ACAC	-	-	rs71564064		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111044530_111044533delACAC								KCNV1 (56454 upstream) : None (None downstream)																							TGAAGGCTAAacacacacacacac	0.304													4	2	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18474353	18474354	+	Intron	DEL	GT	-	-	rs41305317		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18474353_18474354delGT	uc003zne.3	+						ADAMTSL1_uc003znb.2_Intron|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		GCTGTTGGGGgtgtgtgtgtgt	0.342													126	7	---	---	---	---	
FAM166B	730112	broad.mit.edu	37	9	35562329	35562332	+	Intron	DEL	ACAA	-	-	rs148268907		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35562329_35562332delACAA	uc010mkr.2	-						FAM166B_uc011lov.1_Intron|FAM166B_uc011low.1_Intron|FAM166B_uc003zwy.2_Intron	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1												0						CCATACCCATACAAACAAACATTC	0.505													5	4	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140268130	140268132	+	Intron	DEL	TTT	-	-	rs66959515		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140268130_140268132delTTT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CGCAGAGAGGTTTTTTAAAATTT	0.571													4	3	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32307648	32307649	+	Intron	INS	-	A	A	rs144717631	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32307648_32307649insA	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TGCTGTCTTTCaaaaaaaaaat	0.178													9	5	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94715142	94715147	+	Intron	DEL	TGTGTA	-	-	rs147711804	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94715142_94715147delTGTGTA	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_Intron|EXOC6_uc001kii.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				tgtgtgtgtgtgtgtatatatatata	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	105010827	105010829	+	Intron	DEL	ACG	-	-	rs140015106	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105010827_105010829delACG	uc001kwr.2	-											Homo sapiens, clone IMAGE:5199023, mRNA.																		cacctccaccacgatcaccacca	0.000													4	2	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1276555	1276575	+	Intron	DEL	GCACGCACGCAGCTCCCTGGG	-	-	rs55964404		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1276555_1276575delGCACGCACGCAGCTCCCTGGG	uc009ycr.1	+						MUC5B_uc001ltb.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ccgcATGCACGCACGCACGCAGCTCCCTGGGGCTGGGGGCC	0.593													4	3	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199650	120199655	+	Intron	DEL	TGTGTT	-	-	rs72412112		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199650_120199655delTGTGTT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		tgtgtgtgtgtgtgtttgtgtatgtT	0.049													5	3	---	---	---	---	
C12orf63	374467	broad.mit.edu	37	12	97093817	97093817	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97093817delA	uc001tet.1	+	13	1773	c.1695delA	c.(1693-1695)GGAfs	p.G565fs		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	565										skin(6)|ovary(1)	7						TTTTCTATGGAAAAAACATGC	0.343													247	56	---	---	---	---	
RXFP2	122042	broad.mit.edu	37	13	32355769	32355770	+	Intron	INS	-	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32355769_32355770insA	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ATGATTTGTACAAAAAATATTA	0.312													58	14	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109859345	109859354	+	3'UTR	DEL	TGTGTGTGTT	-	-	rs71670580		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109859345_109859354delTGTGTGTGTT	uc001vqt.1	+	35					MYO16_uc010agk.1_3'UTR	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			Cgtgtgtgtgtgtgtgtgtttgtgtgtgtg	0.390													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106881532	106881533	+	Intron	INS	-	TAGA	TAGA	rs149406887	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106881532_106881533insTAGA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						tgattgacacttagattatttg	0.089													9	4	---	---	---	---	
SPINT1	6692	broad.mit.edu	37	15	41145073	41145073	+	Intron	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145073delA	uc001zna.2	+						SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Intron	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1							extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		catctctaataaaaaaaaaaa	0.139													10	5	---	---	---	---	
FAM81A	145773	broad.mit.edu	37	15	59806474	59806474	+	Intron	DEL	T	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59806474delT	uc002agc.2	+							NM_152450	NP_689663	Q8TBF8	FA81A_HUMAN	hypothetical protein LOC145773											ovary(1)	1						TAACTTGCAATTTTTTTTTTT	0.209													56	7	---	---	---	---	
CLK3	1198	broad.mit.edu	37	15	74911465	74911466	+	Intron	INS	-	AGCCCCAGC	AGCCCCAGC			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74911465_74911466insAGCCCCAGC	uc010uln.1	+						CLK3_uc002ayg.3_Intron|CLK3_uc002ayh.3_Intron|CLK3_uc010ulm.1_Intron|CLK3_uc002ayj.3_Intron|CLK3_uc002ayk.3_5'Flank	NM_001130028	NP_001123500	P49761	CLK3_HUMAN	CDC-like kinase 3 isoform a							acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2						AGCAACCGGGAAGCCCCAGCAG	0.569													165	13	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19020932	19020932	+	Intron	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19020932delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						cttAAAAAAGAAAAAAAAAAA	0.159													4	2	---	---	---	---	
CPNE2	221184	broad.mit.edu	37	16	57181273	57181274	+	Intron	DEL	AG	-	-	rs10580446		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57181273_57181274delAG	uc002eks.1	+						CPNE2_uc010cct.1_Intron|CPNE2_uc010ccu.1_Intron|CPNE2_uc002ekt.1_3'UTR	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				CACTGCGATCAGGGGGAATTTC	0.559													4	5	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57946015	57946016	+	Intron	DEL	TG	-	-	rs72502422		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57946015_57946016delTG	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						AGAGGGGAAATGTGTGTGTGTG	0.584													4	2	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16623498	16623498	+	Intron	DEL	T	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16623498delT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						AAAGGAATTGTTTTTTTTTTT	0.249													5	3	---	---	---	---	
SEPT4	5414	broad.mit.edu	37	17	56603935	56603936	+	Intron	DEL	AC	-	-	rs112819371		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56603935_56603936delAC	uc002iwm.1	-						SEPT4_uc002iwk.1_Intron|SEPT4_uc010wnw.1_Intron|SEPT4_uc002iwl.1_5'UTR|SEPT4_uc002iwn.1_Intron|SEPT4_uc002iwo.1_Intron|SEPT4_uc002iwp.1_Intron|SEPT4_uc010wnx.1_Intron|SEPT4_uc010wny.1_Intron|SEPT4_uc010dcy.1_Intron	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1						apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					acacacacaaacacacacacac	0.421													6	4	---	---	---	---	
TRIM37	4591	broad.mit.edu	37	17	57128666	57128666	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57128666delA	uc002iwy.3	-	14	1667	c.1223delT	c.(1222-1224)TTCfs	p.F408fs	TRIM37_uc002iwz.3_Frame_Shift_Del_p.F408fs|TRIM37_uc002ixa.3_Frame_Shift_Del_p.F286fs|TRIM37_uc010woc.1_Frame_Shift_Del_p.F374fs	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	408						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTTTGAAAGAAAGTTGGTGA	0.338									Mulibrey_Nanism				127	32	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79418983	79418984	+	Intron	INS	-	C	C	rs147840370	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79418983_79418984insC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			AGGCCCCTGTGCCCCCCCCACC	0.723													4	4	---	---	---	---	
ARRDC5	645432	broad.mit.edu	37	19	4903031	4903032	+	5'Flank	INS	-	TCACTGGTTCTTTT	TCACTGGTTCTTTT	rs144459964	by1000genomes	TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4903031_4903032insTCACTGGTTCTTTT	uc002mbm.2	-							NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5						signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		ACCTGTAGTCCTCACTGGttct	0.302													5	4	---	---	---	---	
ADAMTS10	81794	broad.mit.edu	37	19	8657127	8657128	+	Intron	DEL	AG	-	-	rs35800262		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8657127_8657128delAG	uc002mkj.1	-						ADAMTS10_uc002mki.1_5'Flank|ADAMTS10_uc002mkk.1_Intron	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						ACATGCGAACAGAGTCAGGTTA	0.619													5	4	---	---	---	---	
JUNB	3726	broad.mit.edu	37	19	12903424	12903425	+	Frame_Shift_Ins	INS	-	G	G			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12903424_12903425insG	uc002mvc.2	+	1	1115_1116	c.839_840insG	c.(838-840)CTGfs	p.L280fs	JUNB_uc002mvb.2_RNA	NM_002229	NP_002220	P17275	JUNB_HUMAN	jun B proto-oncogene	280	Basic motif.					chromatin|nucleus	protein dimerization activity|transcription coactivator activity|transcription corepressor activity			lung(2)|central_nervous_system(1)	3						CGGAACCGGCTGGCGGCCACCA	0.688													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9590549	9590550	+	IGR	INS	-	A	A			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9590549_9590550insA								None (None upstream) : None (None downstream)																							CCCTCaaatttaaaaaattata	0.322													4	3	---	---	---	---	
BACH1	571	broad.mit.edu	37	21	30693967	30693967	+	Intron	DEL	T	-	-			TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30693967delT	uc002ynj.2	+						BACH1_uc002ynk.2_Intron|BACH1_uc002ynl.2_Intron	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor							nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						GTGCAACCCCttttttttttt	0.299													6	3	---	---	---	---	
C21orf59	56683	broad.mit.edu	37	21	33954884	33954885	+	Intron	INS	-	TTCT	TTCT	rs71971113		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33954884_33954885insTTCT	uc002ypy.1	-						TCP10L_uc002ypw.3_Intron|C21orf59_uc002ypx.1_Intron|C21orf59_uc002ypz.1_Intron	NM_021254	NP_067077	P57076	CU059_HUMAN	hypothetical protein LOC56683							cytosol|nucleus					0						CTTtttctttcttctttctttc	0.193													5	7	---	---	---	---	
DMC1	11144	broad.mit.edu	37	22	38964457	38964458	+	Intron	DEL	TG	-	-	rs11570378		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38964457_38964458delTG	uc003avz.1	-						DMC1_uc011anv.1_5'Flank|DMC1_uc003awa.1_Intron	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog						reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					CATTATTTCTtgtgtgtgtgtg	0.366								Homologous_recombination					4	2	---	---	---	---	
ARFGAP3	26286	broad.mit.edu	37	22	43219494	43219508	+	Intron	DEL	ACATTAATCTCTTTG	-	-	rs11272578		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43219494_43219508delACATTAATCTCTTTG	uc003bdd.2	-						ARFGAP3_uc010gzf.2_Intron|ARFGAP3_uc011apu.1_Intron	NM_014570	NP_055385	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating						intracellular protein transport|protein secretion|regulation of ARF GTPase activity|vesicle-mediated transport	cytosol|Golgi membrane	ARF GTPase activator activity|protein transporter activity|zinc ion binding			breast(1)	1						AATAAGTATAACATTAATCTCTTTGACATTAATCT	0.274													3	3	---	---	---	---	
DOCK11	139818	broad.mit.edu	37	X	117761299	117761299	+	Intron	DEL	T	-	-	rs78788801		TCGA-EJ-5499-01	TCGA-EJ-5499-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117761299delT	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						TGCTAGTAGCTTTTTTTTTTT	0.318													5	3	---	---	---	---	
