Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16957420	16957420	+	RNA	SNP	G	C	C	rs11589767		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16957420G>C	uc009vov.1	-	1		c.185C>G			CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						AGGGCGGAGAGAATCAGGGCA	0.701													3	12	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17271936	17271936	+	Intron	SNP	C	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17271936C>G	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ATGGGCCACCCACCCACCCTT	0.622													4	20	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21808232	21808232	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21808232G>A	uc001ber.2	+	13	1926	c.1576G>A	c.(1576-1578)GAA>AAA	p.E526K	NBPF3_uc001bes.2_Missense_Mutation_p.E470K|NBPF3_uc009vqb.2_Missense_Mutation_p.E514K|NBPF3_uc010odm.1_Missense_Mutation_p.E456K	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	526	NBPF 4.					cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ATTGGAGGAAGAACACGTTGG	0.458													16	39	---	---	---	---	PASS
COL9A2	1298	broad.mit.edu	37	1	40778048	40778048	+	Intron	SNP	G	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40778048G>C	uc001cfh.1	-						COL9A2_uc001cfi.1_5'UTR	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor						axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TTCCCATGGTGGCCATTCCCT	0.597													4	15	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244													4	106	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046826	175046826	+	Missense_Mutation	SNP	G	A	A	rs41266078	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046826G>A	uc001gkl.1	+	2	385	c.272G>A	c.(271-273)CGC>CAC	p.R91H	TNN_uc010pmx.1_Missense_Mutation_p.R91H	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	91					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CACAACATCCGCCTTCAGACG	0.602													3	54	---	---	---	---	PASS
TRAF3IP3	80342	broad.mit.edu	37	1	209950760	209950760	+	Missense_Mutation	SNP	C	G	G	rs669694	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209950760C>G	uc001hho.2	+	12	1407	c.1117C>G	c.(1117-1119)CAA>GAA	p.Q373E	TRAF3IP3_uc001hhl.2_Missense_Mutation_p.Q353E|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Missense_Mutation_p.Q353E|TRAF3IP3_uc009xcr.2_Missense_Mutation_p.Q373E	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	373	Cytoplasmic (Potential).|Potential.					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		TGAGCACCAGCAACTGCAGGC	0.527													4	86	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25467186	25467186	+	Silent	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25467186C>T	uc002rgc.2	-	15	1946	c.1689G>A	c.(1687-1689)GTG>GTA	p.V563V	DNMT3A_uc002rgd.2_Silent_p.V563V|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Silent_p.V374V	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	563	PHD-type; atypical.|Interaction with the PRC2/EED-EZH2 complex (By similarity).|ADD.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAAGAGGTCCACACACTCCA	0.627			Mis|F|N|S		AML								8	27	---	---	---	---	PASS
CD8A	925	broad.mit.edu	37	2	87015654	87015654	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87015654G>A	uc002srt.2	-	5	1544	c.655C>T	c.(655-657)CGG>TGG	p.R219W	RMND5A_uc002srs.3_Intron|CD8A_uc002srv.2_Missense_Mutation_p.R219W|CD8A_uc010ytn.1_Missense_Mutation_p.R260W|CD8A_uc002sru.2_Missense_Mutation_p.R182W	NM_001768	NP_001759	P01732	CD8A_HUMAN	CD8 antigen alpha polypeptide isoform 1	219	Cytoplasmic (Potential).				antigen processing and presentation|regulation of immune response|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			ovary(1)	1						GAGACTCACCGGGGACATTTG	0.507													5	21	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114356239	114356239	+	Silent	SNP	T	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114356239T>C	uc002tkh.2	+	6	775	c.717T>C	c.(715-717)CGT>CGC	p.R239R	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCTTTGCCCGTGTGTCAGACT	0.642													3	8	---	---	---	---	PASS
INHBB	3625	broad.mit.edu	37	2	121107482	121107482	+	3'UTR	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121107482C>T	uc002tmn.2	+	2						NM_002193	NP_002184	P09529	INHBB_HUMAN	inhibin beta B subunit preproprotein						activin receptor signaling pathway|cellular response to insulin stimulus|cellular response to starvation|defense response|fat cell differentiation|growth|negative regulation of follicle-stimulating hormone secretion|negative regulation of hepatocyte growth factor biosynthetic process|negative regulation of insulin secretion|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation	extracellular region|perinuclear region of cytoplasm	cytokine activity|growth factor activity|hormone activity|host cell surface receptor binding|protein homodimerization activity			pancreas(2)|skin(1)	3		Prostate(154;0.122)				TGGTGGGGCACGGAGGGCAGT	0.632													3	24	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121746685	121746685	+	Silent	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121746685C>T	uc010flp.2	+	13	3225	c.3195C>T	c.(3193-3195)GAC>GAT	p.D1065D	GLI2_uc002tmq.1_Silent_p.D737D|GLI2_uc002tmr.1_Silent_p.D720D|GLI2_uc002tmt.3_Silent_p.D737D|GLI2_uc002tmu.3_Silent_p.D720D	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1065					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TTCCAGACGACGTGGTGCAGT	0.687													7	93	---	---	---	---	PASS
HS6ST1	9394	broad.mit.edu	37	2	129026419	129026419	+	Nonsense_Mutation	SNP	G	A	A	rs139541363	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129026419G>A	uc002tpt.3	-	2	587	c.553C>T	c.(553-555)CGA>TGA	p.R185*		NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	185	Lumenal (Potential).|3'-phosphate binding (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity	p.R185*(1)		pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		ACGGGGTCTCGTAGCAGGGTG	0.627													5	79	---	---	---	---	PASS
TUBA3D	113457	broad.mit.edu	37	2	132237011	132237011	+	Silent	SNP	G	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132237011G>C	uc002tsu.3	+	3	464	c.357G>C	c.(355-357)CTG>CTC	p.L119L		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	119					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		ACCTAGTCCTGGACCGGATCC	0.498													30	190	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49723687	49723687	+	Intron	SNP	T	C	C	rs2087731		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723687T>C	uc003cxg.2	-						MST1_uc011bcs.1_Silent_p.E357E|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGTGACTACCTTCCTCCCGTC	0.657													3	12	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8584289	8584289	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8584289C>T	uc003glk.2	+	2	1119	c.700C>T	c.(700-702)CGG>TGG	p.R234W	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	234	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CCAGCAGAAGCGGCGCCGCCA	0.637													25	112	---	---	---	---	PASS
CCDC127	133957	broad.mit.edu	37	5	205601	205601	+	Silent	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:205601G>A	uc003jam.1	-	3	694	c.594C>T	c.(592-594)CCC>CCT	p.P198P		NM_145265	NP_660308	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	198											0			all cancers(22;0.0236)|Lung(60;0.113)			CAGCGGCGACGGGGTCGACGG	0.522													16	82	---	---	---	---	PASS
IRX2	153572	broad.mit.edu	37	5	2749500	2749500	+	Silent	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2749500G>A	uc003jda.2	-	2	893	c.651C>T	c.(649-651)GAC>GAT	p.D217D	C5orf38_uc003jdc.2_5'Flank|C5orf38_uc011cmg.1_5'Flank|C5orf38_uc011cmh.1_5'Flank|C5orf38_uc011cmi.1_5'Flank|C5orf38_uc011cmj.1_5'Flank|IRX2_uc003jdb.2_Silent_p.D217D	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	217						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		GCTCACCTTCGTCCTCTGCCG	0.682													5	61	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14711313	14711313	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14711313T>C	uc003jfm.3	-	12	1803	c.1472A>G	c.(1471-1473)AAT>AGT	p.N491S	ANKH_uc003jfl.3_Missense_Mutation_p.N204S	NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	491	Cytoplasmic (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						GCCTTATTCATTCTCCTCTCT	0.532													51	176	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44809374	44809374	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44809374C>G	uc003joh.2	+	1	348	c.310C>G	c.(310-312)CGC>GGC	p.R104G	MRPS30_uc003joi.1_5'Flank	NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	104					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					GAATGCCGACCGCTGGTACCA	0.493													5	26	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80409729	80409729	+	Silent	SNP	T	C	C	rs10942942	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80409729T>C	uc003kha.1	+	15	2460	c.2460T>C	c.(2458-2460)AGT>AGC	p.S820S	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	820					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TAAAACGAAGTATTCAAAAAG	0.478													3	55	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112478967	112478967	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112478967C>T	uc003kqj.3	-	3	792	c.262G>A	c.(262-264)GTC>ATC	p.V88I	MCC_uc003kqk.3_RNA|MCC_uc003kql.3_Missense_Mutation_p.V278I|MCC_uc011cwb.1_Missense_Mutation_p.V88I|MCC_uc010jcd.1_Missense_Mutation_p.V50I	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2	88					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TCCGCAATGACGCTGTGGAGC	0.547													10	34	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112824166	112824166	+	5'UTR	SNP	G	C	C	rs348941	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112824166G>C	uc003kql.3	-	1						NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TGGAATCCGCGCGGCGCGCAA	0.552													4	12	---	---	---	---	PASS
FAM170A	340069	broad.mit.edu	37	5	118969960	118969960	+	Missense_Mutation	SNP	C	T	T	rs328694	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118969960C>T	uc003ksm.2	+	3	727	c.517C>T	c.(517-519)CCC>TCC	p.P173S	FAM170A_uc003ksl.2_Intron|FAM170A_uc003ksn.2_Missense_Mutation_p.P173S|FAM170A_uc003kso.2_Missense_Mutation_p.P126S	NM_182761	NP_877438	A1A519	F170A_HUMAN	family with sequence similarity 170, member A	173						intracellular	zinc ion binding			skin(1)	1						AGGTACTCCCCCCTCTGATGT	0.542													4	104	---	---	---	---	PASS
FAM153A	285596	broad.mit.edu	37	5	177163583	177163583	+	Missense_Mutation	SNP	C	T	T	rs143733594		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177163583C>T	uc010jkp.1	-	13	851	c.430G>A	c.(430-432)GAA>AAA	p.E144K	FAM153A_uc011dgd.1_Intron|FAM153A_uc003mib.1_RNA|FAM153A_uc003mic.2_Missense_Mutation_p.E144K	NM_173663	NP_775934	Q9UHL3	F153A_HUMAN	hypothetical protein LOC285596	144								p.E144K(1)		skin(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACGTACATTCGGCCAGTGTG	0.458													17	64	---	---	---	---	PASS
RASA4P	401331	broad.mit.edu	37	7	44080405	44080405	+	5'Flank	SNP	A	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44080405A>G	uc011kbk.1	-						RASA4P_uc003tji.2_5'Flank|RASA4P_uc010kxx.2_5'Flank|FLJ35390_uc003tjk.2_RNA|FLJ35390_uc003tjl.3_RNA|FLJ35390_uc011kbl.1_RNA	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1												0						AGAGGAGGTCACGGTCAGCGC	0.672													3	13	---	---	---	---	PASS
PMS2L5	5383	broad.mit.edu	37	7	74306898	74306898	+	5'UTR	SNP	G	T	T	rs2523288		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74306898G>T	uc003ubl.2	+	1					PMS2L5_uc003ubk.2_RNA|PMS2L5_uc010lbw.2_RNA|PMS2L5_uc003ubm.3_RNA|STAG3L2_uc011kfj.1_5'Flank|STAG3L2_uc003ubj.3_5'Flank	NR_027775				SubName: Full=Postmeiotic segregation increased 2-like 5;												0						TGGGAACCGTGGAGGGCACTT	0.662													3	14	---	---	---	---	PASS
C7orf52	375607	broad.mit.edu	37	7	100817676	100817676	+	Intron	SNP	A	G	G	rs740107	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100817676A>G	uc003uxy.1	-						C7orf52_uc003uxz.1_Intron|C7orf52_uc003uya.1_3'UTR|C7orf52_uc003uyb.1_3'UTR	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607								N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					CGCAGCCTCCAGAGGAAGGCT	0.622													6	8	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111503371	111503371	+	Intron	SNP	C	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111503371C>A	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Missense_Mutation_p.V449L	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCAATGGCTACAAAATATACA	0.373													4	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	66455023	66455023	+	RNA	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455023G>A	uc010mng.1	-	2		c.274C>T			uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		GCAGGAAACAGGAATCCATCA	0.483													2	4	---	---	---	---	PASS
OR13D1	286365	broad.mit.edu	37	9	107456763	107456763	+	Missense_Mutation	SNP	T	C	C	rs10991359	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107456763T>C	uc011lvs.1	+	1	61	c.61T>C	c.(61-63)TTC>CTC	p.F21L		NM_001004484	NP_001004484	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TCATGTCCTTTTCTATACTAC	0.368													3	55	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111735029	111735029	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111735029C>T	uc004bdo.1	-	9	1315	c.1273G>A	c.(1273-1275)GGA>AGA	p.G425R	CTNNAL1_uc010mts.1_Intron|CTNNAL1_uc010mtt.1_Missense_Mutation_p.G425R|CTNNAL1_uc004bdp.1_Missense_Mutation_p.G425R|CTNNAL1_uc004bdq.1_5'UTR	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	425					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		CCTTCTACTCCAGTAAGTTTT	0.398													29	107	---	---	---	---	PASS
SEC61A2	55176	broad.mit.edu	37	10	12200105	12200105	+	Splice_Site	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12200105G>A	uc001ile.2	+	9	1122	c.975_splice	c.e9+1	p.A325_splice	SEC61A2_uc010qbq.1_Splice_Site_p.A303_splice|SEC61A2_uc001ilf.3_Splice_Site|SEC61A2_uc001ilh.3_Splice_Site|SEC61A2_uc001ilg.3_Splice_Site_p.A325_splice	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				ACAGTGGGCCGTGAGTATTAT	0.368													10	45	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72500856	72500856	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72500856G>A	uc001jrh.2	+	12	1862	c.1862G>A	c.(1861-1863)CGC>CAC	p.R621H	ADAMTS14_uc001jrg.2_Missense_Mutation_p.R624H|ADAMTS14_uc001jri.1_Missense_Mutation_p.R144H	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	621	Cys-rich.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						TGTGCCAAGCGCAACTCCTAC	0.627													9	74	---	---	---	---	PASS
KCTD21	283219	broad.mit.edu	37	11	77884782	77884782	+	3'UTR	SNP	C	T	T	rs230661	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77884782C>T	uc001ozb.2	-	2						NM_001029859	NP_001025030	Q4G0X4	KCD21_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			CATGAGCTTCCTGGGACTCCC	0.478													6	187	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133790980	133790980	+	Silent	SNP	G	A	A	rs114264751	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133790980G>A	uc001qgx.3	-	18	2871	c.2640C>T	c.(2638-2640)GCC>GCT	p.A880A		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	880	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCGTCTCCTCGGCGAAGGGGA	0.657													26	100	---	---	---	---	PASS
AKAP3	10566	broad.mit.edu	37	12	4736294	4736294	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4736294T>C	uc001qnb.3	-	4	2003	c.1774A>G	c.(1774-1776)AGT>GGT	p.S592G		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	592					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						AAGAAAACACTCCTTAGGTCC	0.468													21	92	---	---	---	---	PASS
MYL6	4637	broad.mit.edu	37	12	56552380	56552380	+	Intron	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56552380G>A	uc001sjw.1	+						MYL6_uc001sjv.2_Intron|MYL6_uc001sjx.1_Intron|MYL6_uc010sqd.1_Silent_p.Q65Q|MYL6_uc001sjz.2_Intron|MYL6_uc010sqe.1_5'Flank	NM_021019	NP_066299	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and						axon guidance|muscle filament sliding|skeletal muscle tissue development	cytosol|unconventional myosin complex	actin-dependent ATPase activity|calcium ion binding|motor activity|structural constituent of muscle			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			TTGTGGGTCAGAGTTTGTGGG	0.562													31	142	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23932103	23932103	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23932103G>T	uc001ywk.2	-	1	348	c.262C>A	c.(262-264)CCG>ACG	p.P88T		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	88					negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GCCGGGCCCGGCTGGGCCGCG	0.726									Prader-Willi_syndrome				8	41	---	---	---	---	PASS
FAM103A1	83640	broad.mit.edu	37	15	83658665	83658665	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83658665A>G	uc002bjl.1	+	4	388	c.203A>G	c.(202-204)GAC>GGC	p.D68G	C15orf40_uc010uon.1_Intron	NM_031452	NP_113640	Q9BTL3	F103A_HUMAN	hypothetical protein LOC83640	68											0						AGAGGCAGGGACAACAGATGG	0.433													6	19	---	---	---	---	PASS
EIF3CL	728689	broad.mit.edu	37	16	28734242	28734242	+	5'UTR	SNP	G	A	A	rs143319913	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28734242G>A	uc002dqv.3	+	1					uc010vct.1_Intron|EIF3CL_uc010byi.2_Intron|EIF3CL_uc002dqs.3_Intron|EIF3C_uc002dqt.3_Intron|EIF3CL_uc010vcy.1_Intron|EIF3CL_uc010byj.2_Intron|EIF3C_uc002dqu.3_Intron	NM_003752	NP_003743	B5ME19	B5ME19_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	translation initiation factor activity				0						gattcctgacgtcaagtgatc	0.174													2	3	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74455141	74455141	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74455141G>A	uc002fct.2	-	1	228	c.28C>T	c.(28-30)CGG>TGG	p.R10W	CLEC18B_uc002fcu.2_Missense_Mutation_p.R10W|CLEC18B_uc010vmu.1_Missense_Mutation_p.R10W|CLEC18B_uc010vmw.1_Missense_Mutation_p.R10W	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	10						extracellular region	sugar binding				0						AGATGCCCCCGGCCAGGGGAG	0.677													12	115	---	---	---	---	PASS
TUSC5	286753	broad.mit.edu	37	17	1198837	1198837	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1198837G>T	uc002fsi.1	+	2	779	c.440G>T	c.(439-441)CGC>CTC	p.R147L		NM_172367	NP_758955	Q8IXB3	TUSC5_HUMAN	LOST1	147					response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGGCTGGGCCGCCTGGCTCGG	0.622													33	136	---	---	---	---	PASS
CCDC144C	348254	broad.mit.edu	37	17	20242934	20242934	+	RNA	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20242934G>A	uc010cqy.1	+	5		c.1023G>A				NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						ATTAAAACTCGTCATAAATGA	0.368													17	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	25783779	25783779	+	IGR	SNP	C	A	A	rs143611966	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25783779C>A								WSB1 (143134 upstream) : KSR1 (15257 downstream)																							GCCAGCCGGGCGCTGCAGCAG	0.741													3	26	---	---	---	---	PASS
C17orf56	146705	broad.mit.edu	37	17	79207799	79207799	+	Silent	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79207799C>T	uc002jzu.1	-	5	379	c.357G>A	c.(355-357)AAG>AAA	p.K119K	C17orf56_uc002jzr.1_5'Flank|C17orf56_uc002jzs.1_5'UTR|C17orf56_uc002jzt.1_5'UTR|C17orf56_uc002jzv.1_5'UTR	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705	119						integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCGCGCGAACCTTCTGGTACA	0.662													4	39	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47692015	47692015	+	Silent	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47692015C>T	uc002xty.2	+	12	1427	c.1293C>T	c.(1291-1293)ATC>ATT	p.I431I	CSE1L_uc010zyg.1_Silent_p.I214I|CSE1L_uc010ghx.2_Silent_p.I375I|CSE1L_uc010ghy.2_Silent_p.I80I|CSE1L_uc010zyh.1_Silent_p.I80I	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	431					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ATGCAGCCATCTACCTAGTGA	0.403													4	100	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011170	46011170	+	3'UTR	SNP	T	C	C	rs233302	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011170T>C	uc002zfm.2	-	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6							keratin filament					0						GCCTGCCCCATCTTCTGAGGG	0.607													5	19	---	---	---	---	PASS
psiTPTE22	387590	broad.mit.edu	37	22	17178853	17178853	+	RNA	SNP	C	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17178853C>G	uc002zls.1	+	3		c.935C>G								Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						AACTCAGCCTCGGACAGCCTG	0.567													9	19	---	---	---	---	PASS
DERL3	91319	broad.mit.edu	37	22	24179922	24179922	+	Missense_Mutation	SNP	G	C	C	rs3177243	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24179922G>C	uc002zyh.2	-	5	472	c.447C>G	c.(445-447)TTC>TTG	p.F149L	DERL3_uc002zyk.3_Missense_Mutation_p.F149L|DERL3_uc002zyi.2_Missense_Mutation_p.F149L|DERL3_uc002zyj.2_Intron	NM_001002862	NP_001002862	Q96Q80	DERL3_HUMAN	derlin 3 isoform 2	149	Lumenal (Potential).				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process	integral to endoplasmic reticulum membrane	protein binding			ovary(1)	1						ACGGTGCCTGGAAAGTGAGCA	0.642													4	53	---	---	---	---	PASS
PICK1	9463	broad.mit.edu	37	22	38467745	38467745	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38467745C>T	uc003auq.2	+	8	940	c.550C>T	c.(550-552)CAC>TAC	p.H184Y	PICK1_uc003aur.2_Missense_Mutation_p.H184Y|PICK1_uc003aus.2_Missense_Mutation_p.H184Y|PICK1_uc003aut.2_Missense_Mutation_p.H184Y	NM_012407	NP_036539	Q9NRD5	PICK1_HUMAN	protein interacting with C kinase 1	184	AH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|DNA methylation involved in embryo development|DNA methylation involved in gamete generation|monoamine transport|neuronal ion channel clustering|protein phosphorylation|receptor clustering|retrograde vesicle-mediated transport, Golgi to ER|synaptic transmission	cell junction|endocytic vesicle membrane|Golgi apparatus|perinuclear region of cytoplasm|presynaptic membrane	ATPase activity|metal ion binding|protein C-terminus binding|protein kinase C binding|receptor binding				0	Melanoma(58;0.045)					GTCGCAGACTCACCGGGGTAA	0.617													17	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3063	3063	+	5'Flank	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3063G>A	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AAAGTCCTACGTGATCTGAGT	0.448													9	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12773	12773	+	RNA	SNP	G	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12773G>A	uc004cox.3	+	1		c.437G>A			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CGGCTGAGAGGGCGTAGGAAT	0.418													6	20	---	---	---	---	PASS
AGTRAP	57085	broad.mit.edu	37	1	11796169	11796173	+	5'UTR	DEL	GGGCG	-	-	rs112965832		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11796169_11796173delGGGCG	uc001asv.2	+	1					AGTRAP_uc001ast.2_5'UTR|AGTRAP_uc001asu.2_5'UTR|AGTRAP_uc001asw.2_5'UTR|AGTRAP_uc001asx.2_5'UTR	NM_020350	NP_065083	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein							cytoplasmic vesicle membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein binding		AGTRAP/BRAF(2)	stomach(2)	2	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCCGCAACgggcggggcggggcg	0.600													3	8	---	---	---	---	
EPHA8	2046	broad.mit.edu	37	1	22913274	22913275	+	Intron	INS	-	GGGT	GGGT	rs66713995		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22913274_22913275insGGGT	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGTCTGAGGTGGGGGGGGTGAC	0.658													5	6	---	---	---	---	
MYSM1	114803	broad.mit.edu	37	1	59148358	59148372	+	Intron	DEL	TTTTTTTTCTTTTCT	-	-	rs71046303		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59148358_59148372delTTTTTTTTCTTTTCT	uc009wab.1	-						MYSM1_uc001czc.2_Intron	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					TGCGCTTTTCttttttttcttttcttttttttttt	0.126													4	2	---	---	---	---	
OVGP1	5016	broad.mit.edu	37	1	111959290	111959290	+	Intron	DEL	A	-	-	rs34687982		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111959290delA	uc001eba.2	-						OVGP1_uc001eaz.2_Intron|OVGP1_uc010owb.1_Intron	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		ctcatttgtgaaaaaaaaaaa	0.065													8	4	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148252218	148252218	+	Intron	DEL	A	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148252218delA	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|uc010pah.1_Intron|uc010pai.1_Intron|uc001eqz.2_Intron|uc001erb.2_Intron|uc001erd.3_Intron|uc001erc.3_Intron|uc010paj.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GTTAGAAAAGAAAAAGGATAG	0.343													143	7	---	---	---	---	
RIT1	6016	broad.mit.edu	37	1	155874314	155874314	+	Intron	DEL	T	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155874314delT	uc001fmh.1	-						RIT1_uc010pgr.1_Intron	NM_006912	NP_008843	Q92963	RIT1_HUMAN	Ras-like without CAAX 1						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			ACAAGGGTCATTATGTATTGA	0.443													32	8	---	---	---	---	
ASXL2	55252	broad.mit.edu	37	2	26079232	26079233	+	Intron	INS	-	TTTTTT	TTTTTT	rs143352675		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26079232_26079233insTTTTTT	uc002rgs.2	-							NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctggccTATACttttttttttt	0.218													6	4	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86682418	86682418	+	Intron	DEL	T	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86682418delT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						TTCTTttttcttttttttttt	0.179													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133025753	133025753	+	IGR	DEL	C	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133025753delC								NCRNA00164 (10211 upstream) : GPR39 (148394 downstream)																							GACCGTGCCACCCCCATCTTC	0.632													4	2	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44893954	44893954	+	Intron	DEL	A	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44893954delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTCCTGAATTAAAAAAAAAAA	0.294													9	4	---	---	---	---	
FLJ10213	55096	broad.mit.edu	37	3	73111481	73111482	+	Frame_Shift_Ins	INS	-	A	A	rs147131789	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73111481_73111482insA	uc003dpj.2	+	1	672_673	c.249_250insA	c.(247-252)AACAGAfs	p.N83fs	PPP4R2_uc003dph.1_Intron|PPP4R2_uc003dpi.1_Intron	NM_018029	NP_060499	Q6P2I7	EBLN2_HUMAN	hypothetical protein LOC55096	83_84							protein binding				0		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;3.9e-05)|BRCA - Breast invasive adenocarcinoma(55;7.72e-05)|LUSC - Lung squamous cell carcinoma(21;0.00156)|Lung(16;0.00487)|KIRC - Kidney renal clear cell carcinoma(39;0.012)|Kidney(39;0.0139)		CTGGGAAAAACAGACAGTATCC	0.480													13	8	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541861	81541868	+	Intron	DEL	TTCCTTCC	-	-	rs67220037		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541861_81541868delTTCCTTCC	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ctttcttcctttccttccttccttcctt	0.000									Glycogen_Storage_Disease_type_IV				3	3	---	---	---	---	
TRAT1	50852	broad.mit.edu	37	3	108557700	108557701	+	Intron	INS	-	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108557700_108557701insC	uc003dxi.1	+						TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule						cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						GAGGCTAAACTCCCCTCAGAAC	0.371													31	8	---	---	---	---	
KIAA1257	57501	broad.mit.edu	37	3	128707385	128707386	+	Intron	INS	-	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128707385_128707386insA	uc003elj.3	-						KIAA1257_uc003elg.1_Intron|KIAA1257_uc003eli.3_Intron	NM_020741	NP_065792	Q9ULG3	K1257_HUMAN	hypothetical protein LOC57501												0						tctgactcaacaaaaaaaaaaa	0.054													5	3	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2130784	2130785	+	Intron	DEL	AA	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2130784_2130785delAA	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			ctcttgtctcaaaaaaaaaaaa	0.104								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
GRK4	2868	broad.mit.edu	37	4	2965874	2965875	+	Intron	INS	-	C	C	rs142156088	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2965874_2965875insC	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron|NOP14_uc003ggj.1_5'Flank|NOP14_uc003ggk.3_5'Flank|NOP14_uc003ggl.2_5'Flank|NOP14_uc010icq.1_5'Flank|GRK4_uc003ggm.2_Intron	NM_182982	NP_892027	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGCGCCCCCGACCCCCCCCCCA	0.708													6	7	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3416752	3416764	+	Intron	DEL	CGTGTGAGAGGGA	-	-	rs145348636	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3416752_3416764delCGTGTGAGAGGGA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc010ict.1_Intron|RGS12_uc003ggz.2_Intron|RGS12_uc010icu.1_Intron|RGS12_uc011bvs.1_Intron|RGS12_uc003gha.2_Intron|RGS12_uc010icv.2_Intron|RGS12_uc003ghb.2_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gtgagaggggcgtgtgagagggacgtgtgagag	0.070													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49652780	49652781	+	IGR	INS	-	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49652780_49652781insA								CWH43 (588687 upstream) : None (None downstream)																							gaatggaatggatcaacccgag	0.000													7	5	---	---	---	---	
HERC6	55008	broad.mit.edu	37	4	89360994	89360994	+	Intron	DEL	C	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89360994delC	uc011cdi.1	+						HERC6_uc011cdj.1_Intron|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		tccttcctttctttttttttt	0.249													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35086663	35086664	+	Intron	DEL	GT	-	-	rs73767508	byFrequency	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35086663_35086664delGT	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CATTTTGCTGgtgtgtgtgtgt	0.386													7	4	---	---	---	---	
LARP1	23367	broad.mit.edu	37	5	154173389	154173390	+	Frame_Shift_Ins	INS	-	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154173389_154173390insC	uc003lvp.2	+	6	1327_1328	c.898_899insC	c.(898-900)GCCfs	p.A300fs	LARP1_uc003lvo.2_Frame_Shift_Ins_p.A223fs|LARP1_uc010jie.1_Frame_Shift_Ins_p.A95fs	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	300							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGTGCCCGTGGCCCCCCCCACC	0.644													345	7	---	---	---	---	
REV3L	5980	broad.mit.edu	37	6	111650546	111650546	+	Intron	DEL	T	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111650546delT	uc003puy.3	-						REV3L_uc003pux.3_Intron|REV3L_uc003puz.3_Intron|REV3L_uc003pva.1_Intron	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta						DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		atgcctggccttttttttttt	0.000								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142927997	142927998	+	IGR	INS	-	CA	CA	rs148944811	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142927997_142927998insCA								TAS2R40 (7855 upstream) : GSTK1 (32524 downstream)																							acactcacattcacacacacac	0.000													2	4	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125034095	125034096	+	Intron	INS	-	T	T	rs138450142	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125034095_125034096insT	uc003yqw.2	+						uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGCTTTATTCATTTTTTTTTCA	0.386													3	4	---	---	---	---	
C9orf24	84688	broad.mit.edu	37	9	34382582	34382582	+	Intron	DEL	A	-	-	rs35997251		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34382582delA	uc003zuh.1	-						C9orf24_uc003zug.1_5'Flank|C9orf24_uc003zuf.1_5'Flank|C9orf24_uc003zui.1_5'Flank	NM_032596	NP_115985	Q8NCR6	CI024_HUMAN	testes development-related NYD-SP22 isoform 1											ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		gactctatctaaaaaaaaaaa	0.184													6	3	---	---	---	---	
GSN	2934	broad.mit.edu	37	9	123976450	123976450	+	Intron	DEL	T	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123976450delT	uc004bld.1	+							NM_198252	NP_937895	P06396	GELS_HUMAN	gelsolin isoform b						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3						tttttctcccttctctcctcc	0.000													4	2	---	---	---	---	
TBC1D13	54662	broad.mit.edu	37	9	131553912	131553912	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131553912delG	uc010myj.2	+	5	363	c.240delG	c.(238-240)CAGfs	p.Q80fs	TBC1D13_uc010myk.2_Frame_Shift_Del_p.Q80fs|TBC1D13_uc010myl.2_Intron	NM_018201	NP_060671	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	80	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0						TGATCATCCAGCCTGGCATTG	0.552													67	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82009414	82009415	+	IGR	INS	-	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82009414_82009415insC								ANXA11 (43981 upstream) : MAT1A (22162 downstream)																							TGCAAGAAAGGCCTCAACAACT	0.460													4	2	---	---	---	---	
UBTD1	80019	broad.mit.edu	37	10	99327655	99327657	+	Intron	DEL	CTT	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99327655_99327657delCTT	uc001knv.1	+							NM_024954	NP_079230	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1												0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		TGAGCCTCTCCTTCTGTCCTGCC	0.611													57	8	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105159972	105159973	+	Intron	INS	-	G	G			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105159972_105159973insG	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAACATTGGCGGCCCCCCCCC	0.480													4	2	---	---	---	---	
FADS1	3992	broad.mit.edu	37	11	61580507	61580508	+	Intron	INS	-	G	G	rs143226787	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61580507_61580508insG	uc010rlm.1	-						FADS1_uc001nsh.2_Intron|FADS1_uc010rln.1_Intron	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1						cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGGTAGTGGCAGCCTTGGGGGA	0.401													5	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881161	109881166	+	Intron	DEL	ACACAC	-	-	rs10545297		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881161_109881166delACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						gtgtgtatatacacacacacacacac	0.112													4	3	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111992032	111992032	+	Intron	DEL	A	-	-	rs144235483		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111992032delA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						CTGGAATATTAAAAAAAAAAA	0.164													4	2	---	---	---	---	
TBX3	6926	broad.mit.edu	37	12	115114119	115114120	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115114119_115114120delTT	uc001tvt.1	-	6	2061_2062	c.1097_1098delAA	c.(1096-1098)AAAfs	p.K366fs	TBX3_uc001tvu.1_Frame_Shift_Del_p.K346fs	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	366					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		ATGGTTTACCTTTGAGGTTCGA	0.545													91	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145492	119145494	+	IGR	DEL	GTG	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145492_119145494delGTG								SUDS3 (289653 upstream) : SRRM4 (273902 downstream)																							tggtggtgatgtggtggtgatgg	0.000													4	2	---	---	---	---	
CAMKK2	10645	broad.mit.edu	37	12	121735661	121735661	+	5'Flank	DEL	T	-	-	rs63715862		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121735661delT	uc001tzu.2	-						CAMKK2_uc001tzt.2_5'Flank|CAMKK2_uc001tzv.2_5'UTR|CAMKK2_uc001tzw.2_5'UTR|CAMKK2_uc001tzx.2_5'UTR|CAMKK2_uc001tzy.2_5'UTR|CAMKK2_uc001uab.2_5'UTR|CAMKK2_uc001uac.2_5'UTR|CAMKK2_uc001uad.1_5'Flank	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCCGACTCCCttttttttttt	0.279													4	2	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124923784	124923785	+	Intron	INS	-	AC	AC			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923784_124923785insAC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gacagagggagacagagacCCa	0.030													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	65734530	65734531	+	IGR	DEL	GT	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65734530_65734531delGT								MAX (165303 upstream) : LOC645431 (142782 downstream)																							GTGTTGGCGGGTGTGTGTGTGT	0.495													4	2	---	---	---	---	
ACOT2	10965	broad.mit.edu	37	14	74036674	74036675	+	Intron	INS	-	C	C	rs139052625	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036674_74036675insC	uc001xon.3	+						ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2						acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTATGTGTATgcccccccgccg	0.272													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56038814	56038815	+	IGR	DEL	AA	-	-	rs146726406		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56038814_56038815delAA								PRTG (3637 upstream) : NEDD4 (80316 downstream)																							actccatctcaaaaaaaaaaaa	0.238													4	2	---	---	---	---	
VPS13C	54832	broad.mit.edu	37	15	62214732	62214734	+	In_Frame_Del	DEL	ACA	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62214732_62214734delACA	uc002agz.2	-	54	6911_6913	c.6837_6839delTGT	c.(6835-6840)GTTGTA>GTA	p.2279_2280VV>V	VPS13C_uc002aha.2_In_Frame_Del_p.2236_2237VV>V|VPS13C_uc002ahb.1_In_Frame_Del_p.2279_2280VV>V|VPS13C_uc002ahc.1_In_Frame_Del_p.2236_2237VV>V	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	2279_2280					protein localization					ovary(2)	2						AATGGATTCTACAACAACACCAC	0.365													165	25	---	---	---	---	
PARP16	54956	broad.mit.edu	37	15	65563598	65563598	+	Intron	DEL	T	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65563598delT	uc002aoo.2	-						PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Intron	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16							integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						atctgaaaggttttttttttg	0.095													4	2	---	---	---	---	
PMM2	5373	broad.mit.edu	37	16	8906791	8906792	+	Intron	INS	-	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8906791_8906792insT	uc002czf.3	+						PMM2_uc010uyf.1_Intron|PMM2_uc010uyg.1_Intron|PMM2_uc010uyh.1_Intron|PMM2_uc010buj.2_Intron|PMM2_uc010uyi.1_Intron	NM_000303	NP_000294	O15305	PMM2_HUMAN	phosphomannomutase 2						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	phosphomannomutase activity			ovary(1)	1						TTTCAGTGACATATCATTAGCC	0.441													56	8	---	---	---	---	
ARL6IP1	23204	broad.mit.edu	37	16	18812649	18812649	+	Intron	DEL	G	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18812649delG	uc002dfl.1	-						ARL6IP1_uc010van.1_5'UTR|ARL6IP1_uc010bvz.1_Intron	NM_015161	NP_055976	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting							integral to membrane	protein binding				0						AGGGAGAGAAGGGCCGGGCCC	0.716													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33239805	33239806	+	IGR	INS	-	T	T			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33239805_33239806insT								SLC6A10P (343342 upstream) : MIR1826 (725702 downstream)																							ggctgggtggcttggctgggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33944572	33944572	+	IGR	DEL	T	-	-	rs111472633		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33944572delT								None (None upstream) : MIR1826 (20936 downstream)																							atgattaagcttactgaagat	0.030													4	2	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70566193	70566194	+	Intron	INS	-	A	A			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70566193_70566194insA	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				aactccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83984410	83984411	+	Intron	DEL	GT	-	-	rs72371417		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984410_83984411delGT	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						actggcacacgtacacacatgc	0.030													4	3	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1387740	1387754	+	Intron	DEL	GGGCCTGGGTGCTGA	-	-	rs71886519		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1387740_1387754delGGGCCTGGGTGCTGA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGGTGCGGGGGGCCTGGGTGCTGAGGGCCTGGGT	0.698													5	4	---	---	---	---	
CWC25	54883	broad.mit.edu	37	17	36962874	36962874	+	Intron	DEL	A	-	-	rs78213578		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36962874delA	uc002hqu.2	-						CWC25_uc010wdv.1_Intron|CWC25_uc010wdw.1_Intron	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49												0						ATTGAGGTGGAAAAAAAAAAT	0.428													4	2	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72437119	72437120	+	Intron	INS	-	T	T	rs141781708		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72437119_72437120insT	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						TAATTTAAAGATTTTTTTTTTT	0.198													4	3	---	---	---	---	
TBC1D16	125058	broad.mit.edu	37	17	77998154	77998155	+	Intron	INS	-	CAC	CAC	rs144518941		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77998154_77998155insCAC	uc002jxj.2	-							NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			accataccacacacaacacaca	0.208													4	2	---	---	---	---	
FN3KRP	79672	broad.mit.edu	37	17	80674840	80674840	+	Intron	DEL	G	-	-	rs76609961		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80674840delG	uc002kfu.2	+						FN3KRP_uc010wvr.1_Intron	NM_024619	NP_078895	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein								kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GCCTCGGCGCGGGGCGCGGCC	0.756													22	11	---	---	---	---	
DUS3L	56931	broad.mit.edu	37	19	5789039	5789040	+	Intron	INS	-	ACCAGAGTGGG	ACCAGAGTGGG	rs140764504	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5789039_5789040insACCAGAGTGGG	uc002mdc.2	-						DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_Intron|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1						tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						TTTCTGTCCCCACCTCCTGAGG	0.381													6	3	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37903316	37903317	+	3'UTR	INS	-	T	T	rs142272008	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37903316_37903317insT	uc002ogi.2	-	6					ZNF569_uc002ogh.2_3'UTR|ZNF569_uc002ogj.2_3'UTR	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gtttctggtaacagctttttCA	0.144													8	7	---	---	---	---	
PLAUR	5329	broad.mit.edu	37	19	44160413	44160413	+	Intron	DEL	T	-	-	rs4239527		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44160413delT	uc002oxf.1	-						PLAUR_uc002oxd.1_Intron|PLAUR_uc002oxe.1_Intron|PLAUR_uc002oxg.1_Intron	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor						attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	tctcaaaaaataaataaataa	0.000													5	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074452	62074453	+	Intron	INS	-	CAC	CAC	rs139636562	by1000genomes	TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074452_62074453insCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	atcaccaccatcaccatcacca	0.000													3	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11080670	11080673	+	Intron	DEL	AGAG	-	-	rs150300831		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11080670_11080673delAGAG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTAAAGACACAGAGAGAGAGACTT	0.152													5	3	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41505545	41505545	+	Intron	DEL	A	-	-	rs67478168		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41505545delA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				aacaaaaaacaaaaaaaaaga	0.264													4	6	---	---	---	---	
PIWIL3	440822	broad.mit.edu	37	22	25153626	25153627	+	Intron	INS	-	AC	AC			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25153626_25153627insAC	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						atgtatatattacacacacaca	0.000													4	3	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28706160	28706163	+	Intron	DEL	ACAA	-	-	rs72207474		TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28706160_28706163delACAA	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						acacacacacacaAAAAACAAGAC	0.304													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50151432	50151432	+	IGR	DEL	C	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50151432delC								C22orf34 (100242 upstream) : BRD1 (15506 downstream)																							CATGAGCtttctttttttttt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	155260047	155260047	+	5'Flank	DEL	A	-	-			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155260047delA	uc011nad.1	-											Homo sapiens partial mRNA for DEAD/H box polypeptide 11 like (DDX11L1 gene).																		ggttagggttagggttagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	10946	10947	+	RNA	INS	-	C	C			TCGA-EJ-5501-01	TCGA-EJ-5501-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:10946_10947insC	uc004cov.3	+	1		c.369_370insC			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		ACCCCCTAACAACCCCCCTCCT	0.455													50	14	---	---	---	---	
