Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
HMGN2	3151	broad.mit.edu	37	1	26801752	26801752	+	3'UTR	SNP	T	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26801752T>A	uc001bmp.3	+	6					HMGN2_uc009vsk.2_3'UTR|HMGN2_uc001bmq.3_3'UTR	NM_005517	NP_005508	P05204	HMGN2_HUMAN	high-mobility group nucleosomal binding domain						chromatin organization|regulation of transcription, DNA-dependent	chromatin|cytoplasm|nucleus	DNA binding|protein binding				0		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		TTTTTTTTTTTAAAAGCTATG	0.313													9	13	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55521821	55521821	+	Silent	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55521821C>A	uc001cyf.1	+	6	1246	c.955C>A	c.(955-957)CGG>AGG	p.R319R	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	319	Peptidase S8.				cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CGGCAACTTCCGGGACGATGC	0.612													2	5	---	---	---	---	PASS
ANKRD13C	81573	broad.mit.edu	37	1	70801756	70801756	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70801756T>C	uc001dex.3	-	2	783	c.457A>G	c.(457-459)ATG>GTG	p.M153V	ANKRD13C_uc009wbk.2_Missense_Mutation_p.M153V	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	153	ANK 2.				protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						TTTCCTAACATCACAGCAAGG	0.219													4	18	---	---	---	---	PASS
SLC44A3	126969	broad.mit.edu	37	1	95310851	95310851	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95310851G>T	uc001dqv.3	+	9	1010	c.903G>T	c.(901-903)TTG>TTT	p.L301F	SLC44A3_uc001dqx.3_Missense_Mutation_p.L301F|SLC44A3_uc010otq.1_Missense_Mutation_p.L233F|SLC44A3_uc010otr.1_Missense_Mutation_p.L265F|SLC44A3_uc001dqw.3_Missense_Mutation_p.L253F|SLC44A3_uc010ots.1_Missense_Mutation_p.L221F|SLC44A3_uc009wds.2_Missense_Mutation_p.L204F|SLC44A3_uc010ott.1_Missense_Mutation_p.L221F|SLC44A3_uc010otu.1_RNA	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	301	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TGCTCGTCTTGATTTTTGTTC	0.408													67	142	---	---	---	---	PASS
SV2A	9900	broad.mit.edu	37	1	149884960	149884960	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149884960G>A	uc001etg.2	-	2	924	c.433C>T	c.(433-435)CGA>TGA	p.R145*	SV2A_uc001eth.2_Nonsense_Mutation_p.R145*	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	145	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGTTCTTCTCGTTCTTTCCGT	0.637													35	62	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158813911	158813911	+	Missense_Mutation	SNP	C	T	T	rs138480183	byFrequency	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158813911C>T	uc001fsz.1	+	4	769	c.569C>T	c.(568-570)CCG>CTG	p.P190L		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	190					B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					TCGTTTACTCCGGTACACTCT	0.478													54	145	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164789324	164789324	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164789324T>G	uc001gct.2	+	7	1271	c.1013T>G	c.(1012-1014)TTT>TGT	p.F338C	PBX1_uc010pku.1_Missense_Mutation_p.F338C|PBX1_uc010pkv.1_Missense_Mutation_p.F255C|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Missense_Mutation_p.F228C	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	338					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						TCCAGTTCTTTTAACATGTCA	0.473			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								20	131	---	---	---	---	PASS
CCDC121	79635	broad.mit.edu	37	2	27850011	27850011	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27850011G>T	uc002rle.2	-	2	837	c.656C>A	c.(655-657)ACT>AAT	p.T219N	ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_Missense_Mutation_p.T383N|CCDC121_uc002rld.2_Missense_Mutation_p.T381N|GPN1_uc010ezf.2_5'Flank|GPN1_uc010yma.1_5'Flank|GPN1_uc010ymb.1_5'Flank|GPN1_uc010ymc.1_5'Flank|GPN1_uc010ymd.1_5'Flank|GPN1_uc010yme.1_5'Flank|GPN1_uc010ezg.1_5'Flank	NM_024584	NP_078860	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121 isoform 3	219	Potential.										0	Acute lymphoblastic leukemia(172;0.155)					GTGGCTTTGAGTAGCCGTTAG	0.463													5	71	---	---	---	---	PASS
FER1L5	90342	broad.mit.edu	37	2	97369281	97369281	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97369281G>A	uc010fia.2	+	50	5821	c.5821G>A	c.(5821-5823)GAG>AAG	p.E1941K	FER1L5_uc002sws.3_Missense_Mutation_p.E650K|FER1L5_uc002swt.3_Missense_Mutation_p.E650K|FER1L5_uc010yus.1_Missense_Mutation_p.E649K	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1941						integral to membrane				ovary(1)	1						GATGAGCCTGGAGATTCTGTC	0.577													7	57	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167304172	167304172	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167304172G>T	uc002udu.1	-	11	1464	c.1337C>A	c.(1336-1338)ACA>AAA	p.T446K	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	446					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TGATGTGTCTGTGGAAATTGG	0.378													45	149	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238259791	238259791	+	Silent	SNP	G	T	T	rs116541926	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238259791G>T	uc002vwl.2	-	27	7083	c.6798C>A	c.(6796-6798)ACC>ACA	p.T2266T	COL6A3_uc002vwo.2_Silent_p.T2060T|COL6A3_uc010znj.1_Silent_p.T1659T|COL6A3_uc002vwp.1_Silent_p.T87T	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2266	Triple-helical region.|Collagen-like 4.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCAGTGGACCGGTTCTGCCTC	0.577													3	118	---	---	---	---	PASS
VILL	50853	broad.mit.edu	37	3	38048106	38048106	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38048106C>T	uc003chj.2	+	19	2658	c.2372C>T	c.(2371-2373)ACG>ATG	p.T791M	VILL_uc003chl.2_Missense_Mutation_p.T791M	NM_015873	NP_056957	O15195	VILL_HUMAN	villin-like protein	791	HP.				actin filament capping|cytoskeleton organization	actin cytoskeleton	actin binding|structural constituent of cytoskeleton				0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		ACCAGCGCCACGATCAACGGG	0.667													25	52	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47036899	47036899	+	Silent	SNP	A	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47036899A>G	uc003cqp.2	+	13	1853	c.1674A>G	c.(1672-1674)GCA>GCG	p.A558A	NBEAL2_uc003cqq.1_Silent_p.A524A|NBEAL2_uc010hjm.1_Silent_p.A119A	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	558							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCCGACACGCAGGTGCTGTCA	0.632													17	35	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51347719	51347719	+	Silent	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51347719C>T	uc011bds.1	+	28	3002	c.2979C>T	c.(2977-2979)TTC>TTT	p.F993F		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	993						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGAGTGTCTTCCCTCGGGACT	0.463													8	12	---	---	---	---	PASS
RHO	6010	broad.mit.edu	37	3	129247552	129247552	+	Translation_Start_Site	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129247552C>T	uc003emt.2	+	1	71	c.-24C>T	c.(-26--22)CACGG>CATGG			NM_000539	NP_000530	P08100	OPSD_HUMAN	rhodopsin						protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding				0		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	GGAGCAGCCACGGGTCAGCCA	0.602													15	41	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154860109	154860109	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154860109C>A	uc010hvr.1	+	12	1389	c.1178C>A	c.(1177-1179)GCT>GAT	p.A393D	MME_uc003fab.1_Missense_Mutation_p.A393D|MME_uc003fac.1_Missense_Mutation_p.A393D|MME_uc003fad.1_Missense_Mutation_p.A393D|MME_uc003fae.1_Missense_Mutation_p.A393D	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	393	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	TCCAGAAATGCTTTCCGCAAG	0.378													10	166	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510156	195510156	+	Silent	SNP	G	A	A	rs142096300	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510156G>A	uc011bto.1	-	3	8371	c.7911C>T	c.(7909-7911)CAC>CAT	p.H2637H	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	502					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.572													3	7	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511142	195511142	+	Missense_Mutation	SNP	T	C	C	rs430037	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511142T>C	uc011bto.1	-	2	7769	c.7309A>G	c.(7309-7311)AAC>GAC	p.N2437D	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAACGTTGGTGACAGGA	0.597													3	8	---	---	---	---	PASS
TNK2	10188	broad.mit.edu	37	3	195609157	195609157	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195609157G>T	uc003fvu.1	-	6	1195	c.652C>A	c.(652-654)CGT>AGT	p.R218S	TNK2_uc003fvs.1_Missense_Mutation_p.R250S|TNK2_uc003fvt.1_Missense_Mutation_p.R281S|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_Missense_Mutation_p.R48S|TNK2_uc010hzx.1_Missense_Mutation_p.R232S	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	218	Protein kinase.				positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TGGTGCTTACGTAGCCGGTCC	0.627													4	31	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62813870	62813870	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62813870G>A	uc010ihh.2	+	14	2650	c.2477G>A	c.(2476-2478)CGT>CAT	p.R826H	LPHN3_uc003hcq.3_Missense_Mutation_p.R826H|LPHN3_uc003hct.2_Missense_Mutation_p.R219H	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	813	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TACTCCAAGCGTACAATGACA	0.383													27	51	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128608926	128608926	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128608926C>A	uc003ifk.1	+	8	1423	c.1353C>A	c.(1351-1353)AGC>AGA	p.S451R	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	451										ovary(1)	1						TGCATTCCAGCGCCAGTCCCA	0.478													4	176	---	---	---	---	PASS
MTNR1A	4543	broad.mit.edu	37	4	187455565	187455565	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187455565C>T	uc003izd.1	-	2	349	c.331G>A	c.(331-333)GTC>ATC	p.V111I		NM_005958	NP_005949	P48039	MTR1A_HUMAN	melatonin receptor 1A	111	Helical; Name=3; (Potential).				circadian rhythm|G-protein signaling, coupled to cyclic nucleotide second messenger|mating behavior	integral to plasma membrane	melatonin receptor activity			ovary(1)|skin(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Melatonin(DB01065)|Ramelteon(DB00980)	GAGCCGATGACGCTCAGGCCC	0.517													15	92	---	---	---	---	PASS
TRIP13	9319	broad.mit.edu	37	5	908175	908175	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:908175G>A	uc003jbr.2	+	8	855	c.745G>A	c.(745-747)GTG>ATG	p.V249M	TRIP13_uc010ite.1_Missense_Mutation_p.V249M	NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	249					double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			CCTGGTGTTCGTGCTGATTGA	0.453													58	193	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604528	140604528	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604528C>A	uc003ljb.2	+	1	1451	c.1451C>A	c.(1450-1452)GCC>GAC	p.A484D	PCDHB14_uc011dal.1_Missense_Mutation_p.A331D	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	484	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCACCAACGCCCAGGTCAAC	0.642													4	122	---	---	---	---	PASS
HTR4	3360	broad.mit.edu	37	5	147830608	147830608	+	3'UTR	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147830608C>A	uc003lpj.1	-	7					HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_3'UTR	NM_001040169	NP_001035259	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform a						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	ACACTGTCCTCCATGTACCTC	0.388													3	23	---	---	---	---	PASS
SKIV2L	6499	broad.mit.edu	37	6	31930258	31930258	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31930258G>C	uc003nyn.1	+	11	1496	c.1107G>C	c.(1105-1107)AAG>AAC	p.K369N	SKIV2L_uc011dou.1_Missense_Mutation_p.K211N|SKIV2L_uc011dov.1_Missense_Mutation_p.K176N	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	369	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GCAACCAGAAGTTCCGGGACT	0.587													48	93	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524058	51524058	+	Silent	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524058G>A	uc003pah.1	-	61	11142	c.10866C>T	c.(10864-10866)TGC>TGT	p.C3622C		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3622	Extracellular (Potential).		C -> Y (in ARPKD).		cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCACAGTAGGGCAATTGCGCT	0.458													62	151	---	---	---	---	PASS
FOXO3	2309	broad.mit.edu	37	6	108985092	108985092	+	Silent	SNP	C	G	G	rs149158541	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108985092C>G	uc003psk.2	+	3	1372	c.1056C>G	c.(1054-1056)GCC>GCG	p.A352A	FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Silent_p.A352A|FOXO3_uc011ean.1_Silent_p.A132A|FOXO3_uc010kdj.1_Silent_p.A132A	NM_201559	NP_963853	O43524	FOXO3_HUMAN	forkhead box O3A	352				PMLYSSSASLSPSVSKP -> AHALQHVSQPVTFSKQA (in Ref. 5; CAA04860).	antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		GCAGCTCAGCCAGCCTGTCAC	0.572													4	30	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111726773	111726773	+	Silent	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111726773C>T	uc003puy.3	-	4	788	c.465G>A	c.(463-465)GCG>GCA	p.A155A	REV3L_uc003pux.3_Silent_p.A77A|REV3L_uc003puz.3_Silent_p.A77A	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	155					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AGGGAATATGCGCTTCATGAG	0.338								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	343	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	132061380	132061380	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132061380G>A	uc003qcu.3	+	25	2664	c.2317G>A	c.(2317-2319)GAT>AAT	p.D773N	ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.D773N	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	773	Extracellular (Potential).|Nuclease.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AGCCAACACTGATGTTCCCAT	0.388													3	125	---	---	---	---	PASS
SP4	6671	broad.mit.edu	37	7	21469876	21469876	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21469876C>G	uc003sva.2	+	3	1274	c.1093C>G	c.(1093-1095)CCT>GCT	p.P365A	SP4_uc003svb.2_Missense_Mutation_p.P52A	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	365					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						ATCTCAAACACCTGCTGCTAC	0.468													8	144	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42262830	42262830	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42262830G>C	uc011kbh.1	-	2	114	c.23C>G	c.(22-24)TCC>TGC	p.S8C		NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	8					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						AGTGGTCGTGGAGCTGTGGGA	0.453									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				11	161	---	---	---	---	PASS
AUTS2	26053	broad.mit.edu	37	7	70228041	70228041	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70228041C>A	uc003tvw.3	+	7	1671	c.928C>A	c.(928-930)CAG>AAG	p.Q310K	AUTS2_uc003tvx.3_Missense_Mutation_p.Q310K	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	310										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACCCCAGCCGCAGACGGAGCC	0.607													3	38	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106509965	106509965	+	Silent	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106509965C>T	uc003vdv.3	+	2	2044	c.1959C>T	c.(1957-1959)GAC>GAT	p.D653D	PIK3CG_uc003vdu.2_Silent_p.D653D|PIK3CG_uc003vdw.2_Silent_p.D653D	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	653					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						gcttggaggacgatgatgttc	0.328													22	58	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8449746	8449746	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8449746G>A	uc003zkk.2	-	33	4678	c.3967C>T	c.(3967-3969)CGC>TGC	p.R1323C	PTPRD_uc003zkp.2_Missense_Mutation_p.R917C|PTPRD_uc003zkq.2_Missense_Mutation_p.R916C|PTPRD_uc003zkr.2_Missense_Mutation_p.R907C|PTPRD_uc003zks.2_Missense_Mutation_p.R902C|PTPRD_uc003zkl.2_Missense_Mutation_p.R1314C|PTPRD_uc003zkm.2_Missense_Mutation_p.R1310C|PTPRD_uc003zkn.2_Missense_Mutation_p.R912C|PTPRD_uc003zko.2_Missense_Mutation_p.R913C	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1323	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AAGTTAAGGCGCCTCAGTTCT	0.463										TSP Lung(15;0.13)			7	291	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385641	33385641	+	Intron	SNP	C	A	A	rs116511952	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385641C>A	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Missense_Mutation_p.C158F|AQP7_uc010mjt.2_Missense_Mutation_p.C158F|AQP7_uc011lnx.1_Missense_Mutation_p.C250F|AQP7_uc011lny.1_Missense_Mutation_p.C249F|AQP7_uc003zss.3_Missense_Mutation_p.C158F|AQP7_uc011lnz.1_Missense_Mutation_p.C158F|AQP7_uc011loa.1_Silent_p.L118L	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TGGGCAGGGGCAGTACCTGAA	0.602													5	145	---	---	---	---	PASS
SPAG8	26206	broad.mit.edu	37	9	35811495	35811495	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35811495G>C	uc003zye.2	-	2	663	c.548C>G	c.(547-549)TCT>TGT	p.S183C	SPAG8_uc003zyf.2_Missense_Mutation_p.S100C|SPAG8_uc003zyg.2_Missense_Mutation_p.S183C	NM_172312	NP_758516	Q99932	SPAG8_HUMAN	sperm associated antigen 8 isoform 2	183	Gly-rich.					acrosomal vesicle|membrane				ovary(1)	1	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			accaggaccagagccaggacc	0.239													21	16	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43626994	43626994	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43626994A>G	uc011lrb.1	-	4	1722	c.1693T>C	c.(1693-1695)TTT>CTT	p.F565L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	565						integral to membrane					0						GAGACACTAAAGACGTCCTGA	0.488													6	285	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77448965	77448965	+	Silent	SNP	T	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77448965T>C	uc004ajl.1	-	6	856	c.618A>G	c.(616-618)GGA>GGG	p.G206G	TRPM6_uc004ajk.1_Silent_p.G201G|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Silent_p.G206G|TRPM6_uc010mpd.1_Silent_p.G206G|TRPM6_uc010mpe.1_Silent_p.G206G|TRPM6_uc004ajn.1_Silent_p.G206G	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	206	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						AAGGAGGGATTCCAACTGTCC	0.418													60	122	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93606305	93606305	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93606305G>A	uc004aqz.2	+	2	330	c.125G>A	c.(124-126)CGC>CAC	p.R42H	SYK_uc004aqy.2_Missense_Mutation_p.R42H|SYK_uc004ara.2_Missense_Mutation_p.R42H|SYK_uc004arb.2_Missense_Mutation_p.R42H|SYK_uc004arc.2_Missense_Mutation_p.R42H|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	42	SH2 1.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						TATTTGCTGCGCCAGAGCCGC	0.617			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								6	13	---	---	---	---	PASS
SOHLH1	402381	broad.mit.edu	37	9	138586195	138586195	+	Silent	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138586195C>T	uc004cgl.2	-	7	1045	c.984G>A	c.(982-984)GCG>GCA	p.A328A	SOHLH1_uc010nbe.2_Intron	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic	328					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CAGGTGCTTACGCGGGGGGAC	0.647													11	46	---	---	---	---	PASS
CARD9	64170	broad.mit.edu	37	9	139262118	139262118	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139262118T>C	uc004chg.3	-	8	1406	c.1240A>G	c.(1240-1242)AGG>GGG	p.R414G	CARD9_uc011mdw.1_Missense_Mutation_p.R414G|CARD9_uc011mdx.1_Missense_Mutation_p.R310G	NM_052813	NP_434700	Q9H257	CARD9_HUMAN	caspase recruitment domain protein 9 isoform 1	414	Potential.				positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity			pancreas(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		TGCTGCCGCCTGAGCCTGCCC	0.721													2	12	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55110960	55110960	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55110960G>T	uc010rie.1	+	1	284	c.284G>T	c.(283-285)TGC>TTC	p.C95F		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						TTGTCAGCTTGCATGGGTCAG	0.453													10	551	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681278	55681278	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681278G>A	uc010rir.1	-	1	781	c.781C>T	c.(781-783)CGG>TGG	p.R261W		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.R261W(1)		ovary(1)|skin(1)	2						GAACTTGGCCGGAAATACATA	0.443													50	93	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57957991	57957991	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57957991C>T	uc010rka.1	+	1	29	c.29C>T	c.(28-30)ACG>ATG	p.T10M		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				ACCGTAGTGACGGAGTTCTTC	0.463													12	156	---	---	---	---	PASS
SNX15	29907	broad.mit.edu	37	11	64802432	64802432	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64802432C>T	uc001oci.3	+	7	1023	c.370C>T	c.(370-372)CGG>TGG	p.R124W	SNX15_uc009ypy.2_Missense_Mutation_p.R124W|SNX15_uc001ocj.2_Missense_Mutation_p.R124W|SNX15_uc001ock.2_Missense_Mutation_p.R124W	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	124	PX.				cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1						GGAGTTCTTCCGGGTATGTGC	0.582													27	65	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108235812	108235812	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108235812C>T	uc001pkb.1	+	62	9239	c.8854C>T	c.(8854-8856)CTT>TTT	p.L2952F	ATM_uc009yxr.1_Missense_Mutation_p.L2952F|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.L1604F	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2952	PI3K/PI4K.				cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TGTTTAGGTCCTTCTATATGA	0.368			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			4	102	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62688039	62688039	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62688039G>A	uc001src.1	+	2	178	c.169G>A	c.(169-171)GAT>AAT	p.D57N	USP15_uc001srb.1_Missense_Mutation_p.D57N|USP15_uc010ssj.1_Missense_Mutation_p.D57N|USP15_uc010ssk.1_Missense_Mutation_p.D57N|USP15_uc001sra.2_Missense_Mutation_p.D57N	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	57	DUSP.				protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CCAGATGGGAGATCAAAATGT	0.353													57	125	---	---	---	---	PASS
SPIC	121599	broad.mit.edu	37	12	101880128	101880128	+	Missense_Mutation	SNP	A	G	G	rs61748064	byFrequency	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101880128A>G	uc001tid.2	+	6	485	c.326A>G	c.(325-327)AAG>AGG	p.K109R	SPIC_uc009zua.2_5'UTR|SPIC_uc010svp.1_Missense_Mutation_p.K108R	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	109						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						TTAGGCAGGAAGAAGCTCCGA	0.428													4	246	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102067275	102067275	+	Missense_Mutation	SNP	G	A	A	rs151310085		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102067275G>A	uc001tii.2	+	24	2765	c.2663G>A	c.(2662-2664)CGC>CAC	p.R888H	MYBPC1_uc001tig.2_Missense_Mutation_p.R895H|MYBPC1_uc010svq.1_Missense_Mutation_p.R857H|MYBPC1_uc001tih.2_Missense_Mutation_p.R895H|MYBPC1_uc001tij.2_Missense_Mutation_p.R870H|MYBPC1_uc010svr.1_Missense_Mutation_p.R870H|MYBPC1_uc010svs.1_Missense_Mutation_p.R888H|MYBPC1_uc010svt.1_Missense_Mutation_p.R858H|MYBPC1_uc010svu.1_Missense_Mutation_p.R851H|MYBPC1_uc001tik.2_Missense_Mutation_p.R844H|MYBPC1_uc001til.2_5'UTR|MYBPC1_uc001tim.2_5'UTR	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	888	Ig-like C2-type 6.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						ATAAACATTCGCAACTCTGAG	0.383													49	385	---	---	---	---	PASS
KIAA1704	55425	broad.mit.edu	37	13	45594565	45594565	+	Splice_Site	SNP	T	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45594565T>A	uc001uzq.2	+	7	907	c.804_splice	c.e7+2	p.N268_splice	KIAA1704_uc001uzr.1_Splice_Site_p.N268_splice|KIAA1704_uc001uzs.2_Splice_Site_p.N145_splice|KIAA1704_uc001uzt.2_Splice_Site_p.N119_splice	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425											pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		TCATACAATGTAAGTAAGAAA	0.209													5	91	---	---	---	---	PASS
KLC1	3831	broad.mit.edu	37	14	104124043	104124043	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104124043T>C	uc001yno.2	+	3	730	c.422T>C	c.(421-423)CTG>CCG	p.L141P	KLC1_uc010tyd.1_Missense_Mutation_p.L300P|KLC1_uc010tye.1_Missense_Mutation_p.L137P|KLC1_uc001ynm.1_Missense_Mutation_p.L141P|KLC1_uc001ynn.1_Missense_Mutation_p.L137P|KLC1_uc010tyf.1_Missense_Mutation_p.L141P	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2	141					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				GTGGCTCAACTGGAGGAGGAG	0.502													3	77	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405599	105405599	+	Missense_Mutation	SNP	G	C	C	rs3742935	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405599G>C	uc010axc.1	-	7	16309	c.16189C>G	c.(16189-16191)CCT>GCT	p.P5397A	AHNAK2_uc001ypx.2_Missense_Mutation_p.P5297A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5397						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGGGGGCAGGGAAGGAGAAC	0.483													3	109	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106829780	106829780	+	RNA	SNP	G	A	A	rs11546809		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106829780G>A	uc010tyt.1	-	323		c.12725C>T			uc001ysx.1_RNA					Parts of antibodies, mostly variable regions.												0						GGCGGATCCAGCTCCAGTAGT	0.582													4	60	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	C	C	rs1062001		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056021T>C	uc002bkm.2	-	6		c.539A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GTAGCTGCTCTACCTTAGATG	0.502													2	16	---	---	---	---	PASS
PDF	64146	broad.mit.edu	37	16	69364030	69364030	+	Silent	SNP	G	A	A	rs3852691	byFrequency	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69364030G>A	uc002ewx.1	-	1	469	c.444C>T	c.(442-444)TTC>TTT	p.F148F	COG8_uc002ewy.2_Intron	NM_022341	NP_071736	Q9HBH1	DEFM_HUMAN	peptide deformylase precursor	148					N-terminal protein amino acid modification|peptidyl-methionine modification|positive regulation of cell proliferation|translation	mitochondrion	iron ion binding|peptide deformylase activity				0						CGCGCAGGGGGAAGGGCTCCA	0.731													4	5	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72827588	72827588	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72827588C>T	uc002fck.2	-	9	9666	c.8993G>A	c.(8992-8994)CGG>CAG	p.R2998Q	ZFHX3_uc002fcl.2_Missense_Mutation_p.R2084Q	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	2998	Homeobox 4.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TTCTTTTGCCCGGGCATTCTG	0.463													51	220	---	---	---	---	PASS
KIAA0753	9851	broad.mit.edu	37	17	6515454	6515454	+	Missense_Mutation	SNP	C	T	T	rs2289643	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6515454C>T	uc002gde.3	-	8	1689	c.1330G>A	c.(1330-1332)GAT>AAT	p.D444N	KIAA0753_uc010vtd.1_Intron|KIAA0753_uc010clo.2_Missense_Mutation_p.D145N|KIAA0753_uc010vte.1_Missense_Mutation_p.D145N	NM_014804	NP_055619	Q2KHM9	K0753_HUMAN	hypothetical protein LOC9851	444						centrosome					0				COAD - Colon adenocarcinoma(228;0.157)		AGCTCCGTATCGGGCTGATAC	0.398													5	170	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			32	31	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61557835	61557835	+	Missense_Mutation	SNP	C	G	G	rs138873311	byFrequency	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61557835C>G	uc002jau.1	+	5	815	c.793C>G	c.(793-795)CGA>GGA	p.R265G	ACE_uc010wpi.1_Missense_Mutation_p.R265G|ACE_uc010ddu.1_Missense_Mutation_p.R82G	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	265	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	ACTGCATCGCCGATACGGAGA	0.602													65	96	---	---	---	---	PASS
CACNG4	27092	broad.mit.edu	37	17	65021047	65021047	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65021047G>A	uc002jft.1	+	3	391	c.376G>A	c.(376-378)GGT>AGT	p.G126S		NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4	126	Helical; (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			CCTGTGCATCGGTGCTGGCAG	0.672													80	88	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30903561	30903561	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30903561C>T	uc002kxn.2	-	10	1058	c.916G>A	c.(916-918)GAA>AAA	p.E306K	C18orf34_uc010xbr.1_Missense_Mutation_p.E306K|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.E306K|C18orf34_uc002kxp.2_Missense_Mutation_p.E306K	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	306	Potential.									ovary(1)	1						AAAGCTTCTTCAAGTTCTTCA	0.308													9	47	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19625913	19625913	+	Silent	SNP	G	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19625913G>T	uc002nmr.2	-	1	557	c.324C>A	c.(322-324)CCC>CCA	p.P108P	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	108	Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						CCTGAACTCCGGGGATGCGCC	0.637													3	83	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52942423	52942423	+	Missense_Mutation	SNP	T	A	A	rs112113280		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52942423T>A	uc002pzk.2	+	4	1810	c.1749T>A	c.(1747-1749)AAT>AAA	p.N583K	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.N570K	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	583	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACATAGGAATATTCATACTG	0.438													3	23	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640708	57640708	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640708T>C	uc002qny.2	+	4	1021	c.665T>C	c.(664-666)TTG>TCG	p.L222S		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	222					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GATAGAGATTTGAAACTCGGG	0.363													55	139	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20493222	20493222	+	Silent	SNP	G	A	A	rs35039408	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20493222G>A	uc002wrz.2	-	32	4934	c.4791C>T	c.(4789-4791)CCC>CCT	p.P1597P	RALGAPA2_uc010gcx.2_Silent_p.P1301P|RALGAPA2_uc010zsg.1_Silent_p.P1045P|RALGAPA2_uc002wsa.1_Silent_p.P369P	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1597					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						AGGGTCCTCGGGGCTCCACTG	0.458													3	62	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990961	39990961	+	Silent	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990961G>A	uc002xjy.1	-	4	1472	c.1248C>T	c.(1246-1248)GCC>GCT	p.A416A		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	416						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				GCTCATCCCCGGCCGGGGCAC	0.642													49	93	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26688423	26688423	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26688423C>A	uc003acb.2	+	2	302	c.146C>A	c.(145-147)TCA>TAA	p.S49*	SEZ6L_uc003acc.2_Nonsense_Mutation_p.S49*|SEZ6L_uc011akc.1_Nonsense_Mutation_p.S49*|SEZ6L_uc003acd.2_Nonsense_Mutation_p.S49*|SEZ6L_uc011akd.1_Nonsense_Mutation_p.S49*|SEZ6L_uc003ace.2_Nonsense_Mutation_p.S49*|SEZ6L_uc003acf.1_5'UTR|SEZ6L_uc010gvc.1_5'UTR	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	49	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CTCCTGCCCTCAGGAGCCCCG	0.582													31	66	---	---	---	---	PASS
DUSP18	150290	broad.mit.edu	37	22	31059967	31059967	+	Silent	SNP	G	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31059967G>A	uc003aiu.2	-	2	525	c.24C>T	c.(22-24)TTC>TTT	p.F8F	SLC35E4_uc003ait.2_Intron|DUSP18_uc010gwa.1_RNA|DUSP18_uc003aiw.1_Silent_p.F8F	NM_152511	NP_689724	Q8NEJ0	DUS18_HUMAN	dual specificity phosphatase 18	8						cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0						ACTGAACTGGGAAGGCACACG	0.562													16	36	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104463752	104463752	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104463752C>T	uc004ema.2	-	5	1236	c.1124G>A	c.(1123-1125)CGC>CAC	p.R375H	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_3'UTR	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	375						intracellular	zinc ion binding			ovary(2)	2						CCCTGGCCTGCGATATACTGG	0.542													6	197	---	---	---	---	PASS
SSU72	29101	broad.mit.edu	37	1	1510036	1510037	+	5'UTR	DEL	GC	-	-	rs70949599		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1510036_1510037delGC	uc001agd.2	-	1					SSU72_uc009vkg.1_5'UTR|SSU72_uc001age.1_5'UTR	NM_014188	NP_054907	Q9NP77	SSU72_HUMAN	Ssu72 RNA polymerase II CTD phosphatase homolog						mRNA processing	cytoplasm|nucleus	phosphoprotein phosphatase activity				0	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CCGGAAGCGGGCGACGCGAAAC	0.772													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6953876	6953879	+	IGR	DEL	GAGG	-	-	rs112872966		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6953876_6953879delGAGG								LOC400940 (825512 upstream) : CMPK2 (26624 downstream)																							gggagggagagagggagggaggaa	0.005													4	2	---	---	---	---	
FOXN2	3344	broad.mit.edu	37	2	48586020	48586023	+	Intron	DEL	ATCC	-	-	rs138339553		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48586020_48586023delATCC	uc002rwh.1	+							NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CATAGGATGAATCCCTTTTAGTCA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64893259	64893259	+	IGR	DEL	A	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64893259delA								SERTAD2 (12213 upstream) : SLC1A4 (322320 downstream)																							AACTTAAAATAAAAAAAAAAA	0.269													4	4	---	---	---	---	
FBLN7	129804	broad.mit.edu	37	2	112945285	112945285	+	3'UTR	DEL	T	-	-	rs76063207		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112945285delT	uc002tho.1	+	8					FBLN7_uc002thn.2_3'UTR|FBLN7_uc010fki.1_3'UTR|FBLN7_uc010fkj.1_3'UTR	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1						cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						GCCATCACTCTTTTTTTTTTT	0.493													6	5	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172693471	172693472	+	Intron	DEL	CA	-	-	rs3836020		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172693471_172693472delCA	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	cacacacatgcacacacacaca	0.282													4	2	---	---	---	---	
ZC3H15	55854	broad.mit.edu	37	2	187369110	187369111	+	Intron	INS	-	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187369110_187369111insT	uc002upo.2	+							NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response							cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			AAATGTTAACCTAGCCATAAAC	0.302													4	4	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37293117	37293117	+	Intron	DEL	T	-	-	rs112817114		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37293117delT	uc003cgv.2	+						GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgu.1_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ACAATTGGTCTTTTTTTTTTT	0.184													6	4	---	---	---	---	
LIAS	11019	broad.mit.edu	37	4	39471952	39471952	+	Intron	DEL	A	-	-	rs11721979		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39471952delA	uc003guf.2	+						LIAS_uc003gug.2_Intron|LIAS_uc003guh.2_Intron	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor						inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	aatacaagttaaaaaaaaaaa	0.264													4	2	---	---	---	---	
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139865024	139865025	+	Intron	DEL	TA	-	-	rs150399423		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139865024_139865025delTA	uc003lfs.1	+						ANKHD1_uc003lfq.1_Intron|ANKHD1_uc003lfr.2_Intron|ANKHD1_uc003lft.1_Intron|ANKHD1_uc003lfu.1_Intron|ANKHD1_uc003lfv.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein							cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tatgtatgtgtatatatatata	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29769921	29769922	+	IGR	INS	-	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29769921_29769922insG								HCG4 (9071 upstream) : HLA-G (24834 downstream)																							TAGGATCTCATGCCCTGCCTCC	0.510													4	4	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51946933	51946933	+	Intron	DEL	A	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51946933delA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AACTCTTTGCAAAAAAAAACA	0.368													6	4	---	---	---	---	
FAM83B	222584	broad.mit.edu	37	6	54792525	54792526	+	Intron	DEL	GT	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54792525_54792526delGT	uc003pck.2	+							NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TTTCTTAAAAGTaaaaaaaaaa	0.119													43	8	---	---	---	---	
PPIL6	285755	broad.mit.edu	37	6	109740621	109740622	+	Intron	INS	-	A	A	rs79521587		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109740621_109740622insA	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		ccatctcgattaaaaaaaaaaa	0.035													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132083054	132083055	+	IGR	INS	-	TCCT	TCCT	rs4053155		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132083054_132083055insTCCT								ENPP3 (14505 upstream) : ENPP1 (46101 downstream)																							TTTTAAGTAGAtccttccttcc	0.158													6	4	---	---	---	---	
HBS1L	10767	broad.mit.edu	37	6	135303872	135303873	+	Intron	INS	-	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135303872_135303873insT	uc003qez.2	-						HBS1L_uc003qey.2_Intron|HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein						signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		CCACACTTTACTTTTTTTTTTT	0.183													4	2	---	---	---	---	
LFNG	3955	broad.mit.edu	37	7	2566972	2566973	+	3'UTR	DEL	GT	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2566972_2566973delGT	uc003smf.2	+	8					LFNG_uc003smg.2_Intron	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a						organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		gtgcgtgtgcgtgtgtgtgtgt	0.579													5	4	---	---	---	---	
C7orf26	79034	broad.mit.edu	37	7	6631057	6631058	+	Intron	INS	-	T	T	rs11459559		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6631057_6631058insT	uc003sqo.1	+						uc011jwy.1_5'Flank|C7orf26_uc003sqp.1_Intron|C7orf26_uc003sqq.1_Intron	NM_024067	NP_076972	Q96N11	CG026_HUMAN	hypothetical protein LOC79034											ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		gccaccatgccggctaattgtt	0.000													3	4	---	---	---	---	
C7orf26	79034	broad.mit.edu	37	7	6646327	6646328	+	Intron	DEL	TT	-	-	rs67788546		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6646327_6646328delTT	uc003sqo.1	+						C7orf26_uc003sqp.1_Intron|C7orf26_uc003sqq.1_Intron	NM_024067	NP_076972	Q96N11	CG026_HUMAN	hypothetical protein LOC79034											ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CCAGAGGGCCtttttttttttt	0.332													10	5	---	---	---	---	
GARS	2617	broad.mit.edu	37	7	30661990	30661992	+	In_Frame_Del	DEL	AAG	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30661990_30661992delAAG	uc003tbm.2	+	12	1882_1884	c.1525_1527delAAG	c.(1525-1527)AAGdel	p.K510del		NM_002047	NP_002038	P41250	SYG_HUMAN	glycyl-tRNA synthetase	510					cell death|diadenosine tetraphosphate biosynthetic process|glycyl-tRNA aminoacylation	cytosol|mitochondrial matrix|soluble fraction	ATP binding|glycine-tRNA ligase activity|protein dimerization activity			ovary(1)	1					Glycine(DB00145)	TAAGGCATATAAGAAGGATGCAA	0.404													322	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68046478	68046481	+	IGR	DEL	GAAG	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68046478_68046481delGAAG								None (None upstream) : None (None downstream)																							agggagggaagaaggaaggaagga	0.000													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106561787	106561790	+	Intron	DEL	CTTT	-	-	rs67727674		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106561787_106561790delCTTT	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			tccttccttcctttcttccttcca	0.098													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99258675	99258676	+	IGR	INS	-	ACC	ACC	rs142356622	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99258675_99258676insACC								HABP4 (5058 upstream) : CDC14B (3721 downstream)																							GCGCTGTACTTaccaccaccac	0.515													6	3	---	---	---	---	
KIAA0368	23392	broad.mit.edu	37	9	114195316	114195316	+	Intron	DEL	C	-	-	rs11335472		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114195316delC	uc004bfe.1	-						KIAA0368_uc010muc.1_Intron	NM_001080398	NP_001073867			KIAA0368 protein												0						CTATAAACAGCATCTCCACAC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38944608	38944609	+	IGR	DEL	AT	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38944608_38944609delAT								LOC399744 (203528 upstream) : None (None downstream)																							TTATAGTGACATGTATGAAAAC	0.282													4	2	---	---	---	---	
USP54	159195	broad.mit.edu	37	10	75259002	75259002	+	Intron	DEL	C	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75259002delC	uc001juo.2	-						USP54_uc010qkk.1_Intron|USP54_uc001juk.2_Intron|USP54_uc001jul.2_Intron|USP54_uc001jum.2_Intron|USP54_uc001jun.2_Intron	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54						ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					CATTCTCCTTCCCAGAGAGCC	0.463													84	7	---	---	---	---	
SEC31B	25956	broad.mit.edu	37	10	102255417	102255419	+	Intron	DEL	TTG	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102255417_102255419delTTG	uc001krc.1	-						SEC31B_uc010qpo.1_Intron|SEC31B_uc001krd.1_Intron|SEC31B_uc001krf.1_Intron|SEC31B_uc001kre.1_Intron|SEC31B_uc001krg.1_Intron	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		ctgtgttattttgttgttgttgt	0.167													4	2	---	---	---	---	
MYEOV	26579	broad.mit.edu	37	11	69063421	69063425	+	Frame_Shift_Del	DEL	CTTTA	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69063421_69063425delCTTTA	uc001oov.2	+	3	954_958	c.504_508delCTTTA	c.(502-510)GCCTTTAGAfs	p.A168fs	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Frame_Shift_Del_p.A168fs|MYEOV_uc001oow.2_Frame_Shift_Del_p.A110fs	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	168_170											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		TGGGAGAAGCCTTTAGAGTGGGCGT	0.585													356	90	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112332120	112332121	+	IGR	INS	-	T	T	rs111710457		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112332120_112332121insT								PTS (191443 upstream) : NCAM1 (499874 downstream)																							CTGATTTTATGTTTTTTTTTTT	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	130308392	130308393	+	IGR	INS	-	TCCG	TCCG	rs112383828	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130308392_130308393insTCCG								ADAMTS8 (9853 upstream) : ADAMTS15 (10476 downstream)																							ccttccttccttccttcctttt	0.089													0	8	---	---	---	---	
PAH	5053	broad.mit.edu	37	12	103240564	103240565	+	Intron	INS	-	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103240564_103240565insT	uc001tjq.1	-							NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CCACATTCTGATTTTTTTCCCC	0.421													28	11	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53119712	53119713	+	Intron	INS	-	A	A			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53119712_53119713insA	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					gagcctgtctcaaaaaaaaaaa	0.094													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28957730	28957731	+	IGR	INS	-	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28957730_28957731insG								GOLGA8G (320559 upstream) : WHAMML2 (24998 downstream)																							AAGCTGCCCATGCGACCGCTCT	0.545													5	3	---	---	---	---	
ARHGAP11A	9824	broad.mit.edu	37	15	32922143	32922144	+	Intron	DEL	GT	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32922143_32922144delGT	uc001zgy.1	+						ARHGAP11A_uc010ubw.1_Intron|ARHGAP11A_uc001zgw.2_Intron|ARHGAP11A_uc001zgx.2_Intron|ARHGAP11A_uc010ubx.1_Intron	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TTTCAATATAgtgtgtgtgtgt	0.277													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56331675	56331676	+	IGR	DEL	GT	-	-	rs71666684		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56331675_56331676delGT								NEDD4 (45840 upstream) : RFX7 (47803 downstream)																							AATAAAACTGgtgtgtgtgtgt	0.178													3	3	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53301096	53301096	+	Intron	DEL	C	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53301096delC	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_Intron|CHD9_uc010cbw.2_5'Flank|CHD9_uc002ehd.2_Intron	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTAGTTGTTTCTTTTTGTCTG	0.284													4	2	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72197933	72197935	+	Intron	DEL	AAC	-	-	rs112351559		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72197933_72197935delAAC	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				ttactcatgtaacaacaacaaca	0.015													4	3	---	---	---	---	
SERPINF2	5345	broad.mit.edu	37	17	1657979	1657979	+	3'UTR	DEL	T	-	-	rs147557405	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1657979delT	uc002ftk.1	+	10					SERPINF2_uc010vqr.1_3'UTR	NM_000934	NP_000925	P08697	A2AP_HUMAN	alpha-2-antiplasmin isoform a precursor						acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Streptokinase(DB00086)	GAGTTTAGGGTGGGGGGGGGG	0.647													4	2	---	---	---	---	
ZFP3	124961	broad.mit.edu	37	17	4996471	4996472	+	3'UTR	DEL	TT	-	-	rs72184758		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4996471_4996472delTT	uc002gaq.2	+	2						NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GATGAGGCACtttttttttttt	0.203													3	3	---	---	---	---	
RABEP1	9135	broad.mit.edu	37	17	5266070	5266071	+	Intron	INS	-	T	T			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5266070_5266071insT	uc002gbm.3	+						RABEP1_uc010clc.1_Intron|RABEP1_uc010cld.1_Intron|RABEP1_uc010vsw.1_Intron|RABEP1_uc002gbl.3_Intron|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						TATATTGTAACTTTTTGCCGTA	0.396													6	4	---	---	---	---	
NUP88	4927	broad.mit.edu	37	17	5320152	5320153	+	Intron	INS	-	T	T	rs11391160		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5320152_5320153insT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						TAACTCACAAAttttttttttt	0.158													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													6	3	---	---	---	---	
SUZ12	23512	broad.mit.edu	37	17	30322882	30322882	+	Intron	DEL	A	-	-	rs35646011		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30322882delA	uc002hgs.2	+						SUZ12_uc002hgt.2_Intron	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1						negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				AACTTTTTTTAAAAAAAAAAA	0.189			T	JAZF1	endometrial stromal tumours								4	2	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34923771	34923771	+	Intron	DEL	T	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34923771delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AGGCAGTTCCttttttttttt	0.219													4	2	---	---	---	---	
GIP	2695	broad.mit.edu	37	17	47041501	47041504	+	Intron	DEL	GAAA	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47041501_47041504delGAAA	uc002iol.1	-							NM_004123	NP_004114	P09681	GIP_HUMAN	gastric inhibitory polypeptide preproprotein						energy reserve metabolic process|signal transduction	extracellular region|soluble fraction	hormone activity			skin(1)	1						cagcctgggcgaaagagtgagact	0.162													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64799755	64799755	+	Intron	DEL	A	-	-	rs35886735		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64799755delA	uc002jfp.1	+							NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	CCAGCCGTGCAATTCCCACCC	0.582													4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													6	3	---	---	---	---	
MEP1B	4225	broad.mit.edu	37	18	29779631	29779632	+	Intron	INS	-	TTCC	TTCC	rs71177848		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29779631_29779632insTTCC	uc002kxj.3	+							NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor						digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						cctttcgttcgttccttccttc	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65042307	65042307	+	IGR	DEL	T	-	-	rs75002100		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042307delT								CDH19 (771091 upstream) : DSEL (131512 downstream)																							gtcttcttcattttttttttt	0.184													4	2	---	---	---	---	
ATCAY	85300	broad.mit.edu	37	19	3924772	3924772	+	3'UTR	DEL	T	-	-	rs11306255		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3924772delT	uc002lyy.3	+	13					ATCAY_uc010xhz.1_3'UTR|ATCAY_uc010dts.2_3'UTR	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		AAACATTGTATTTTTTTTTTT	0.502													4	2	---	---	---	---	
C19orf59	199675	broad.mit.edu	37	19	7744075	7744076	+	3'UTR	DEL	AC	-	-	rs112807024		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7744075_7744076delAC	uc002mhh.1	+	7					TRAPPC5_uc002mhi.1_5'Flank|TRAPPC5_uc002mhj.1_5'Flank|TRAPPC5_uc002mhk.1_5'Flank	NM_174918	NP_777578	Q8IX19	MCEM1_HUMAN	mast cell-expressed membrane protein 1							integral to membrane				skin(1)	1						ACGGGAAATGACCCCCCCCCCC	0.525											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9001747	9001747	+	Intron	DEL	A	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9001747delA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ctcaaaaaagaaaaaaaagaa	0.189													6	5	---	---	---	---	
BCAM	4059	broad.mit.edu	37	19	45314240	45314241	+	Intron	INS	-	G	G			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45314240_45314241insG	uc002ozu.2	+						BCAM_uc002ozt.1_Intron	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1						cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				gaggaggggctggggcctagac	0.000													4	2	---	---	---	---	
PPP5C	5536	broad.mit.edu	37	19	46850390	46850400	+	Frame_Shift_Del	DEL	GAGCCCCCCCG	-	-	rs150667064	byFrequency	TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46850390_46850400delGAGCCCCCCCG	uc002pem.2	+	1	97_107	c.37_47delGAGCCCCCCCG	c.(37-48)GAGCCCCCCCGGfs	p.E13fs	PPP5C_uc010xya.1_5'UTR|PPP5C_uc002pen.2_Frame_Shift_Del_p.E13fs	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	13_16					mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		TGAGTGTGCTGAGCCCCCCCGGGACGAACCC	0.687											OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	7	---	---	---	---	
LILRB4	11006	broad.mit.edu	37	19	55175598	55175599	+	Intron	INS	-	GGGAGGG	GGGAGGG			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55175598_55175599insGGGAGGG	uc002qgp.2	+						LILRB4_uc002qgq.2_Intron|LILRB4_uc010ers.1_Intron|LILRB4_uc002qgr.2_Intron|LILRB4_uc010ert.2_Intron|LILRB4_uc010eru.2_Intron	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,							integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		GGGGATGATGTGGGAGCCCCAT	0.614													195	7	---	---	---	---	
LBP	3929	broad.mit.edu	37	20	37002386	37002393	+	Intron	DEL	GTTACTTG	-	-	rs11536995		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37002386_37002393delGTTACTTG	uc002xic.1	+							NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor						acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				cctagaacaagttacttggccactctgt	0.048													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37649139	37649141	+	Intron	DEL	AAA	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649139_37649141delAAA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						actccatctcaaaaaaaaaaaaa	0.172													3	3	---	---	---	---	
psiTPTE22	387590	broad.mit.edu	37	22	17131536	17131537	+	Intron	INS	-	CTG	CTG	rs34452519		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17131536_17131537insCTG	uc002zls.1	+						psiTPTE22_uc002zlt.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						TGCCCACTCTTCTGGTCTCATG	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151656	20151657	+	IGR	INS	-	ACC	ACC	rs141600104		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151656_20151657insACC								ZDHHC8 (16127 upstream) : LOC150197 (42198 downstream)																							ccaccatcactaccaccaccac	0.000													4	2	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31976529	31976529	+	Intron	DEL	T	-	-	rs11347645		TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31976529delT	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						ttttcttttcttttttttttt	0.139													3	3	---	---	---	---	
UTY	7404	broad.mit.edu	37	Y	15478111	15478114	+	Intron	DEL	AAAT	-	-			TCGA-EJ-5507-01	TCGA-EJ-5507-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15478111_15478114delAAAT	uc004fsx.1	-						UTY_uc004fsy.2_Intron|UTY_uc004fsz.2_Intron	NM_007125	NP_009056	O14607	UTY_HUMAN	tetratricopeptide repeat protein isoform 3						chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TTTACATTACAAATAAACTCTAGA	0.270													26	32	---	---	---	---	
