Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12336133	12336133	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12336133C>T	uc001atv.2	+	19	2629	c.2488C>T	c.(2488-2490)CGA>TGA	p.R830*	VPS13D_uc001atw.2_Nonsense_Mutation_p.R830*|VPS13D_uc001atx.2_Nonsense_Mutation_p.R18*	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	830					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CATGGTTGGACGAGTGAAAGA	0.438											OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	70	---	---	---	---	PASS
L1TD1	54596	broad.mit.edu	37	1	62672762	62672762	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62672762T>A	uc001dae.3	+	3	764	c.462T>A	c.(460-462)AGT>AGA	p.S154R		NM_019079	NP_061952	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	154										ovary(1)|skin(1)	2						aatacaatagtaatgatggta	0.000													4	42	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91843738	91843738	+	Silent	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91843738T>A	uc001doa.3	-	11	1339	c.1239A>T	c.(1237-1239)GTA>GTT	p.V413V	HFM1_uc010osu.1_Silent_p.V92V|HFM1_uc010osv.1_Silent_p.V97V|HFM1_uc001doc.1_Silent_p.V413V	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	413	DEAH box.|Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTACAATATGTACCTAAGCAG	0.259													5	89	---	---	---	---	PASS
SPRR3	6707	broad.mit.edu	37	1	152975765	152975765	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152975765G>T	uc001fax.3	+	3	419	c.269G>T	c.(268-270)TGT>TTT	p.C90F	SPRR3_uc001faz.3_Missense_Mutation_p.C90F|SPRR3_uc001fay.2_Missense_Mutation_p.C82F	NM_005416	NP_005407	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	90	6.|14 X 8 AA approximate tandem repeats.				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity			skin(1)	1	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGCCAGGCTGTACCAAGGTC	0.602													21	82	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158325255	158325255	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158325255G>T	uc001fse.2	+	3	760	c.521G>T	c.(520-522)CGC>CTC	p.R174L	CD1E_uc010pid.1_Missense_Mutation_p.R172L|CD1E_uc010pie.1_Missense_Mutation_p.R75L|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.R174L|CD1E_uc001fsk.2_Intron|CD1E_uc001fsj.2_Intron|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.R174L|CD1E_uc001fry.2_Missense_Mutation_p.R174L|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.R174L|CD1E_uc009wsv.2_Missense_Mutation_p.R75L|CD1E_uc001frz.2_Intron|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	174					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					GTGCTCAATCGCTACCTAGAT	0.507													38	140	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809593	48809593	+	Missense_Mutation	SNP	G	T	T	rs3792234	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48809593G>T	uc010yol.1	+	1	1868	c.1821G>T	c.(1819-1821)CAG>CAT	p.Q607H	STON1_uc002rwo.3_Missense_Mutation_p.Q607H|STON1_uc010fbm.2_Missense_Mutation_p.Q607H|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.Q607H|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.Q607H	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	607					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGAGTTTACAGGAACTTGAAT	0.498													4	107	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86705343	86705343	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86705343C>T	uc002sri.3	+	14	2470	c.2143C>T	c.(2143-2145)CAT>TAT	p.H715Y	KDM3A_uc010ytj.1_Missense_Mutation_p.H715Y|KDM3A_uc010ytk.1_Missense_Mutation_p.H663Y	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	715					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						GAGTCAGATACATGAACCAGA	0.408													27	159	---	---	---	---	PASS
IL1RL2	8808	broad.mit.edu	37	2	102842427	102842427	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102842427A>T	uc002tbs.2	+	9	1187	c.1061A>T	c.(1060-1062)TAC>TTC	p.Y354F	IL1RL2_uc002tbt.2_Missense_Mutation_p.Y236F	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	354	Helical; (Potential).				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						TCTGTTGTGTACATATACAAC	0.383													5	82	---	---	---	---	PASS
ERCC3	2071	broad.mit.edu	37	2	128047706	128047706	+	Intron	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128047706G>A	uc002toh.1	-						ERCC3_uc002toe.1_5'UTR|ERCC3_uc002tof.1_Intron|ERCC3_uc002tog.1_Intron|ERCC3_uc010flx.1_Intron|ERCC3_uc010yzh.1_Intron|ERCC3_uc010fly.2_3'UTR	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AGAAAAGACAGCATAAACATC	0.483			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				3	59	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160688257	160688257	+	Silent	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160688257C>T	uc002ubc.3	-	28	3951	c.3882G>A	c.(3880-3882)GAG>GAA	p.E1294E	LY75_uc002ubb.3_Silent_p.E1294E|LY75_uc010fos.2_Silent_p.E1294E	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1294	Extracellular (Potential).|C-type lectin 8.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		CAAAGTTATTCTCCTTTTCAT	0.294													6	165	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160710869	160710869	+	Splice_Site	SNP	A	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160710869A>T	uc002ubc.3	-	18	2664	c.2595_splice	c.e18+1	p.N865_splice	LY75_uc002ubb.3_Splice_Site_p.N865_splice|LY75_uc010fos.2_Splice_Site_p.N865_splice	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		cttttaaattaCATTTGCTAT	0.224													5	66	---	---	---	---	PASS
FASTKD2	22868	broad.mit.edu	37	2	207638988	207638988	+	Missense_Mutation	SNP	C	G	G	rs118203917		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207638988C>G	uc002vbu.2	+	7	1704	c.1294C>G	c.(1294-1296)CGA>GGA	p.R432G	FASTKD2_uc002vbv.2_Missense_Mutation_p.R432G|FASTKD2_uc002vbx.2_Missense_Mutation_p.R432G|FASTKD2_uc002vbw.1_Missense_Mutation_p.R432G	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	432					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|skin(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CCTTGGCTTTCGACCTGTTGG	0.303													8	171	---	---	---	---	PASS
TMEM198	130612	broad.mit.edu	37	2	220414063	220414063	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220414063A>G	uc002vme.2	+	5	1517	c.932A>G	c.(931-933)GAC>GGC	p.D311G	TMEM198_uc002vmf.2_Missense_Mutation_p.D311G|hsa-mir-3132|MI0014152_5'Flank	NM_001005209	NP_001005209	Q66K66	TM198_HUMAN	transmembrane protein 198	311						integral to membrane				ovary(1)	1		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		TTCAATGGAGACGTCCTCTCC	0.632													3	61	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882892	228882892	+	Missense_Mutation	SNP	C	T	T	rs137871355	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882892C>T	uc002vpq.2	-	7	2725	c.2678G>A	c.(2677-2679)CGC>CAC	p.R893H	SPHKAP_uc002vpp.2_Missense_Mutation_p.R893H|SPHKAP_uc010zlx.1_Missense_Mutation_p.R893H	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	893						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCGTTGATGCGAGATGTGGC	0.507													19	926	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	403423	403423	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:403423G>A	uc003bou.2	+	12	1571	c.1300G>A	c.(1300-1302)GCT>ACT	p.A434T	CHL1_uc003bot.2_Missense_Mutation_p.A450T|CHL1_uc003bow.1_Missense_Mutation_p.A434T|CHL1_uc011asi.1_Missense_Mutation_p.A450T	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	434	Ig-like C2-type 5.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AGAAAATTACGCTACAGTGGT	0.398													10	348	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1427451	1427451	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1427451C>T	uc003boz.2	+	20	2941	c.2674C>T	c.(2674-2676)CCC>TCC	p.P892S	CNTN6_uc011asj.1_Missense_Mutation_p.P820S|CNTN6_uc003bpa.2_Missense_Mutation_p.P892S	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	892	Fibronectin type-III 3.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GCCCTCAAGCCCCCCAGTCAA	0.453													7	240	---	---	---	---	PASS
DAG1	1605	broad.mit.edu	37	3	49570280	49570280	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49570280G>A	uc003cxc.3	+	3	2754	c.2336G>A	c.(2335-2337)CGG>CAG	p.R779Q		NM_004393	NP_004384	Q14118	DAG1_HUMAN	dystroglycan 1 preproprotein	779	Nuclear localization signal.|Cytoplasmic (Potential).			KKRKGK->AARKGA: About 50% reduction in nuclear accumulation.|KKRK->NPGE: Abolishes nuclear translocation.|RKKRKGK->AKKRKGA: Moderate reduction in nuclear accumulation.|KKRKGK->RKKAAGA: Drastic reduction in nuclear accumulation.|R->A: Significant reduction in nuclear accumulation.	cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CGCAAGAAGCGGAAGGGCAAG	0.572													3	62	---	---	---	---	PASS
TMEM110	375346	broad.mit.edu	37	3	52867695	52867695	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52867695C>A	uc003dgc.3	-	9	1031	c.950G>T	c.(949-951)CGA>CTA	p.R317L	ITIH4_uc010hmp.1_5'Flank|MUSTN1_uc010hmq.1_RNA|MUSTN1_uc003dga.3_Missense_Mutation_p.R27L|MUSTN1_uc003dgb.3_Silent_p.P130P	NM_198563	NP_940965	Q86TL2	TM110_HUMAN	transmembrane protein 110	Error:Variant_position_missing_in_Q86TL2_after_alignment						integral to membrane				large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		CAGGTTTCCTCGGGCCCCCTT	0.577													2	8	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113152410	113152410	+	Splice_Site	SNP	A	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113152410A>T	uc003eae.1	-	2	146	c.100_splice	c.e2+1	p.S34_splice		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2											central_nervous_system(1)	1						ATCTTTACTTACATCTTGATT	0.299													8	206	---	---	---	---	PASS
SLC41A3	54946	broad.mit.edu	37	3	125725915	125725915	+	Intron	SNP	G	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125725915G>T	uc003eij.2	-						SLC41A3_uc003eii.2_Missense_Mutation_p.L444M|SLC41A3_uc003eil.2_Missense_Mutation_p.L470M|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_Missense_Mutation_p.L353M	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		TTGCTCTTCAGTAGCCAGTCA	0.577													6	80	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141161343	141161343	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141161343T>C	uc003etw.2	+	8	1095	c.113T>C	c.(112-114)ATT>ACT	p.I38T	ZBTB38_uc010hun.2_Missense_Mutation_p.I35T|ZBTB38_uc010huo.2_Missense_Mutation_p.I38T|ZBTB38_uc003ety.2_Missense_Mutation_p.I38T|ZBTB38_uc010hup.2_Missense_Mutation_p.I39T	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	38	BTB.				positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GTCACTATCATTGTGGAAGAT	0.428													10	387	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515387	195515387	+	Missense_Mutation	SNP	T	C	C	rs13065584	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515387T>C	uc011bto.1	-	2	3524	c.3064A>G	c.(3064-3066)ACC>GCC	p.T1022A	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1023	Repeat.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTGACCTGTG	0.567													3	1	---	---	---	---	PASS
SLC2A9	56606	broad.mit.edu	37	4	9828063	9828063	+	Silent	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9828063G>A	uc003gmc.2	-	12	1642	c.1581C>T	c.(1579-1581)ATC>ATT	p.I527I	SLC2A9_uc003gmd.2_Silent_p.I498I	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	527	Cytoplasmic (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						CAGCTGAGTCGATTTTCTCTT	0.423													13	306	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66356112	66356112	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66356112A>T	uc003hcy.2	-	5	1578	c.1385T>A	c.(1384-1386)GTA>GAA	p.V462E	EPHA5_uc003hcx.2_Missense_Mutation_p.V393E|EPHA5_uc003hcz.2_Missense_Mutation_p.V462E|EPHA5_uc011cah.1_Missense_Mutation_p.V462E|EPHA5_uc011cai.1_Missense_Mutation_p.V462E|EPHA5_uc003hda.2_Missense_Mutation_p.V462E	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	462	Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						ATTTGTGGTTACATTTACAGA	0.473										TSP Lung(17;0.13)			6	91	---	---	---	---	PASS
CSN1S1	1446	broad.mit.edu	37	4	70798273	70798273	+	5'UTR	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70798273C>A	uc003hep.1	+	2					CSN1S1_uc003heq.1_5'UTR|CSN1S1_uc003her.1_5'UTR	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						CTCTGATAACCATGAGGCTTC	0.353													4	21	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158257612	158257612	+	Silent	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158257612C>T	uc003ipm.3	+	11	2016	c.1557C>T	c.(1555-1557)CTC>CTT	p.L519L	GRIA2_uc011cit.1_Silent_p.L472L|GRIA2_uc003ipl.3_Silent_p.L519L|GRIA2_uc003ipk.3_Silent_p.L472L|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	519	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	TCATGAGCCTCGGGATATCTA	0.408													80	422	---	---	---	---	PASS
RIOK1	83732	broad.mit.edu	37	6	7403001	7403001	+	Intron	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7403001T>A	uc003mxn.2	+						RIOK1_uc003mxm.1_Intron|RIOK1_uc003mxo.2_5'UTR	NM_031480	NP_113668	Q9BRS2	RIOK1_HUMAN	RIO kinase 1 isoform 1								ATP binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|skin(1)	4	Ovarian(93;0.0418)					CCTAAAACATTAAAATAATAA	0.299													7	134	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30954963	30954963	+	Silent	SNP	G	A	A	rs55956203		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30954963G>A	uc003nsh.2	+	2	1262	c.1011G>A	c.(1009-1011)ACG>ACA	p.T337T	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	337	Ser-rich.|28 X 15 AA approximate tandem repeats.|21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						AGTCCAGCACGACCTCCAGTG	0.627													8	231	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57393160	57393160	+	Silent	SNP	G	A	A	rs76686926		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57393160G>A	uc003pdx.2	+	9	897	c.810G>A	c.(808-810)AAG>AAA	p.K270K		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	270					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATGTTGGGAAGATTTCTTTAG	0.279													6	4	---	---	---	---	PASS
VNN3	55350	broad.mit.edu	37	6	133046105	133046105	+	3'UTR	SNP	G	A	A	rs45581831	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133046105G>A	uc003qdp.2	-	6					VNN3_uc010kfs.2_Translation_Start_Site|VNN3_uc011ecl.1_RNA|VNN3_uc011ecm.1_Silent_p.Y23Y|VNN3_uc011ecn.1_Silent_p.Y23Y|VNN3_uc010kfu.2_Silent_p.Y23Y|VNN3_uc010kfv.2_RNA|VNN3_uc010kfw.2_Silent_p.Y23Y|VNN3_uc010kfx.2_Translation_Start_Site|VNN3_uc010kfy.2_Translation_Start_Site|VNN3_uc010kfz.2_Translation_Start_Site	NM_078625	NP_523239			SubName: Full=PAGEL-beta;												0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		CTTCTGGGGCGTAGATTCCAC	0.443													10	111	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137322646	137322646	+	3'UTR	SNP	T	G	G			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137322646T>G	uc003qhj.2	-	7					IL20RA_uc011edl.1_3'UTR|IL20RA_uc003qhk.2_3'UTR|IL20RA_uc003qhi.2_3'UTR	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor							integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		ATCAAAGGGGTGACTCACTTG	0.403													19	96	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152536125	152536125	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152536125G>A	uc010kiw.2	-	122	22864	c.22262C>T	c.(22261-22263)CCC>CTC	p.P7421L	SYNE1_uc010kiv.2_Missense_Mutation_p.P1945L|SYNE1_uc003qos.3_Missense_Mutation_p.P1945L|SYNE1_uc003qot.3_Missense_Mutation_p.P7350L|SYNE1_uc003qou.3_Missense_Mutation_p.P7421L|SYNE1_uc003qor.3_Missense_Mutation_p.P321L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7421	Spectrin 24.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATCATTCAAGGGTAACCTATA	0.398										HNSCC(10;0.0054)			13	269	---	---	---	---	PASS
SYNJ2	8871	broad.mit.edu	37	6	158505088	158505088	+	Silent	SNP	A	G	G	rs1744173	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158505088A>G	uc003qqx.1	+	22	3165	c.3090A>G	c.(3088-3090)GGA>GGG	p.G1030G	SYNJ2_uc003qqw.1_Silent_p.G1030G|SYNJ2_uc003qqy.1_Silent_p.G743G|SYNJ2_uc003qqz.1_Silent_p.G647G|SYNJ2_uc003qra.1_Silent_p.G373G|SYNJ2_uc010kjp.1_5'Flank	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	1030	Catalytic (By similarity).						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		ATCAGCCTGGAGTCTCGGACA	0.522													13	629	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161032668	161032668	+	Silent	SNP	A	G	G	rs113727842	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161032668A>G	uc003qtl.2	-	17	2649	c.2529T>C	c.(2527-2529)ACT>ACC	p.T843T		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3351	Kringle 30.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AGGTTCTTCCAGTGACAGTGG	0.498													6	276	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43548483	43548483	+	Intron	SNP	A	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43548483A>C	uc003tid.1	+						HECW1_uc011kbi.1_Intron|uc003tig.1_RNA	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CCAACTCTGAAAGGGCACACT	0.527													23	137	---	---	---	---	PASS
LOC643955	643955	broad.mit.edu	37	7	62752443	62752443	+	3'UTR	SNP	G	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62752443G>C	uc011kdj.1	-	3						NR_003952				Homo sapiens cDNA clone IMAGE:30377995, containing frame-shift errors.												0						CTTATGTCTAGTAAGGTTTGA	0.438													4	53	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127637865	127637865	+	Intron	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127637865C>A	uc003vmi.2	+						SND1_uc010lle.2_Intron|C7orf54_uc003vmj.1_RNA	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						ggtagacttacactttcggcc	0.000													80	412	---	---	---	---	PASS
ATP6V0A4	50617	broad.mit.edu	37	7	138437474	138437474	+	Silent	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138437474G>A	uc003vuf.2	-	10	1163	c.925C>T	c.(925-927)CTG>TTG	p.L309L	ATP6V0A4_uc003vug.2_Silent_p.L309L|ATP6V0A4_uc003vuh.2_Silent_p.L309L	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	309	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						CACATGTTCAGGATGTGGTAG	0.572													4	137	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630697	140630697	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630697C>T	uc003yvf.1	-	2	993	c.929G>A	c.(928-930)CGC>CAC	p.R310H	KCNK9_uc003yvg.1_Missense_Mutation_p.R310H|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	310	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			TGCCACCGAGCGGCCGCCATA	0.622													7	50	---	---	---	---	PASS
EXOSC4	54512	broad.mit.edu	37	8	145135356	145135356	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145135356C>A	uc003zau.2	+	3	700	c.590C>A	c.(589-591)GCG>GAG	p.A197E	GPAA1_uc003zav.1_5'Flank|GPAA1_uc003zaw.1_5'Flank|GPAA1_uc003zax.2_5'Flank	NM_019037	NP_061910	Q9NPD3	EXOS4_HUMAN	exosome component 4	197					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear mRNA surveillance|positive regulation of cell growth	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGACAGATTGCGCTGCTTGAG	0.662													20	106	---	---	---	---	PASS
TUBAL3	79861	broad.mit.edu	37	10	5435918	5435918	+	Silent	SNP	G	A	A	rs7097775	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5435918G>A	uc001ihy.2	-	4	943	c.903C>T	c.(901-903)GCC>GCT	p.A301A	TUBAL3_uc001ihz.2_Silent_p.A261A	NM_024803	NP_079079	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	301					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1						ACTCAAAGCAGGCAGTGGTGA	0.537													5	145	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	21962615	21962615	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21962615T>A	uc001iqs.2	+	11	1736	c.1388T>A	c.(1387-1389)GTA>GAA	p.V463E	MLLT10_uc001iqt.2_Missense_Mutation_p.V463E|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Missense_Mutation_p.V463E|MLLT10_uc001ira.2_5'UTR|MLLT10_uc001irb.2_RNA|MLLT10_uc001iqz.2_Missense_Mutation_p.V218E	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	463	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						GAAGAAACTGTAAAGGAAAAG	0.398			T	MLL|PICALM|CDK6	AL								14	325	---	---	---	---	PASS
CC2D2B	387707	broad.mit.edu	37	10	97779281	97779281	+	Intron	SNP	G	A	A	rs4918984	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97779281G>A	uc001kll.2	+						uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Intron|uc009xvb.1_RNA	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B isoform											ovary(1)	1		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		gatgagaaccgttgAGGTAGT	0.209													6	146	---	---	---	---	PASS
BTBD10	84280	broad.mit.edu	37	11	13424827	13424827	+	Splice_Site	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13424827T>A	uc001mkz.2	-	8	1264	c.1007_splice	c.e8-1	p.I336_splice	BTBD10_uc010rcl.1_Splice_Site_p.I344_splice|BTBD10_uc001mla.2_Splice_Site_p.I320_splice|BTBD10_uc009ygn.2_Splice_Site|BTBD10_uc010rcm.1_Splice_Site_p.I288_splice	NM_032320	NP_115696	Q9BSF8	BTBDA_HUMAN	K+ channel tetramerization protein							nucleus					0				Epithelial(150;0.0214)		TATAAATAACTAGAAACAAAA	0.294													8	192	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195494	18195494	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195494C>T	uc001mnv.1	+	1	1111	c.691C>T	c.(691-693)CCC>TCC	p.P231S		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	231	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CTGCGGCCTGCCCTTCGGCAT	0.532													21	99	---	---	---	---	PASS
UEVLD	55293	broad.mit.edu	37	11	18579845	18579845	+	Silent	SNP	G	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18579845G>C	uc001mot.2	-	7	725	c.645C>G	c.(643-645)CTC>CTG	p.L215L	UEVLD_uc001mou.2_Silent_p.L215L|UEVLD_uc010rde.1_Silent_p.L85L|UEVLD_uc010rdf.1_Silent_p.L193L|UEVLD_uc010rdg.1_Silent_p.L85L|UEVLD_uc001mov.2_Silent_p.L193L	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	215	NAD (By similarity).				cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						TCCCTTCTGAGAGGTCTAAGA	0.413													7	106	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46322640	46322640	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46322640T>A	uc001rox.2	-	11	1131	c.844A>T	c.(844-846)ACT>TCT	p.T282S	SFRS2IP_uc001row.2_5'UTR|SFRS2IP_uc001roy.1_Missense_Mutation_p.T356S	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	282					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTGCAAGAAGTACCtaataat	0.303													6	123	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50570610	50570610	+	3'UTR	SNP	T	C	C	rs1044370	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50570610T>C	uc001rwj.3	-	11					LIMA1_uc001rwg.3_3'UTR|LIMA1_uc001rwh.3_3'UTR|LIMA1_uc001rwi.3_3'UTR|LIMA1_uc001rwk.3_3'UTR|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						ACAGCACTTATGCATATCATC	0.308													8	9	---	---	---	---	PASS
TIMELESS	8914	broad.mit.edu	37	12	56811998	56811998	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56811998T>C	uc001slf.2	-	27	3542	c.3374A>G	c.(3373-3375)CAC>CGC	p.H1125R		NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	1125					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						CTCTTTACAGTGCTCCTCATC	0.582													90	562	---	---	---	---	PASS
NR2C1	7181	broad.mit.edu	37	12	95424436	95424436	+	Intron	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95424436T>A	uc001tdm.3	-						NR2C1_uc010suu.1_Intron|NR2C1_uc001tdo.3_3'UTR|NR2C1_uc001tdn.3_Intron	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						GCAAATGATTTAAAAATTATA	0.318													6	132	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25376711	25376711	+	Splice_Site	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25376711T>A	uc001upr.2	+	14	1990	c.1949_splice	c.e14+2	p.K650_splice	RNF17_uc010tdd.1_Splice_Site_p.K509_splice|RNF17_uc010aab.2_Splice_Site|RNF17_uc010tde.1_Splice_Site_p.K650_splice|RNF17_uc001ups.2_Splice_Site_p.K589_splice	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ACTAGCAAAGTAAGTAACTTA	0.323													8	170	---	---	---	---	PASS
KBTBD7	84078	broad.mit.edu	37	13	41767606	41767606	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41767606T>C	uc001uxw.1	-	1	1097	c.788A>G	c.(787-789)AAG>AGG	p.K263R	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	263							protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GCGCACGCACTTGAAGACTTC	0.537													4	114	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88945824	88945824	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88945824G>A	uc001xwv.3	-	13	2282	c.1951C>T	c.(1951-1953)CGG>TGG	p.R651W	PTPN21_uc010twc.1_Missense_Mutation_p.R447W	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	651						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						TCCTTGAGCCGCAGGCCCTCC	0.721													3	51	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936671	21936671	+	RNA	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936671C>A	uc010tzj.1	-	1		c.4069G>T				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						TGGCTGAACCCCTTTTTTCCA	0.393													22	384	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													4	61	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39874829	39874829	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39874829A>G	uc001zkh.2	+	3	682	c.503A>G	c.(502-504)TAC>TGC	p.Y168C		NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	168	TSP N-terminal.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	GCCCAGCTGTACATCGACTGT	0.562													5	84	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43827082	43827082	+	Silent	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43827082G>A	uc001zrw.2	-	31	4275	c.4092C>T	c.(4090-4092)ACC>ACT	p.T1364T	PPIP5K1_uc001zrx.1_Silent_p.T1337T|PPIP5K1_uc001zru.2_Silent_p.T1339T|PPIP5K1_uc001zry.3_Silent_p.T1339T|PPIP5K1_uc001zrv.2_Silent_p.T1125T	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	1364					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						CTTCTACAAGGGTTTCCTGGA	0.577													8	217	---	---	---	---	PASS
COMMD4	54939	broad.mit.edu	37	15	75630562	75630562	+	Intron	SNP	C	T	T	rs143588533	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75630562C>T	uc002azy.2	+						COMMD4_uc010umf.1_Intron|COMMD4_uc002azz.2_Intron|COMMD4_uc002baa.2_Intron|COMMD4_uc010umg.1_Silent_p.L55L|COMMD4_uc010umh.1_Intron	NM_017828	NP_060298	Q9H0A8	COMD4_HUMAN	COMM domain containing 4							cytoplasm	protein binding				0						TTCTCTGGGGCTAGGGCCTCA	0.597													3	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	76074694	76074694	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76074694G>A	uc010umm.1	+	9	766	c.689G>A	c.(688-690)CGG>CAG	p.R230Q	uc002bba.1_5'Flank					SubName: Full=cDNA FLJ59077, highly similar to Golgin subfamily A member 6;																		GAGAGGGCCCGGTGGCAGGAG	0.403													4	113	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101464915	101464915	+	Silent	SNP	T	C	C	rs11630691	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101464915T>C	uc002bwr.2	+	2	397	c.78T>C	c.(76-78)CGT>CGC	p.R26R	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Silent_p.R26R	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	26					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTCCAGAACGTGCCATGGAGA	0.577													4	102	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2503242	2503242	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2503242C>A	uc002cqd.1	+	14	1607	c.1519C>A	c.(1519-1521)CAA>AAA	p.Q507K	CCNF_uc002cqe.1_Missense_Mutation_p.Q199K	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	507					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				GGACTACAGGCAAGTCTCTCT	0.572													11	92	---	---	---	---	PASS
EEF2K	29904	broad.mit.edu	37	16	22278045	22278045	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22278045C>T	uc002dki.2	+	15	2097	c.1612C>T	c.(1612-1614)CGC>TGC	p.R538C	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	538					insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		CGAGGGTGGGCGCTTCTGCGA	0.682													9	88	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51174335	51174335	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51174335A>G	uc010vgs.1	-	2	1829	c.1798T>C	c.(1798-1800)TCA>CCA	p.S600P	SALL1_uc010vgr.1_Missense_Mutation_p.S503P|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	600					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CTTGTGGCTGACTCAGGGCCC	0.602													5	71	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10310244	10310244	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10310244A>G	uc002gmm.2	-	18	2113	c.2018T>C	c.(2017-2019)GTA>GCA	p.V673A	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	673	Actin-binding.|Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GATACACCGTACGAAGTGAGG	0.383									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				22	126	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18586746	18586746	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18586746T>A	uc002kte.2	-	15	2493	c.1552A>T	c.(1552-1554)ACA>TCA	p.T518S		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	518	Interaction with FHOD1.|Potential.|REM.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TCCTTTAATGTAGAAACTAGA	0.308													7	202	---	---	---	---	PASS
ZNRF4	148066	broad.mit.edu	37	19	5456787	5456787	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5456787C>T	uc002mca.3	+	1	1362	c.1285C>T	c.(1285-1287)CAG>TAG	p.Q429*		NM_181710	NP_859061	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4 precursor	429	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			large_intestine(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		GGCCCCTGGTCAGTAAAGATC	0.582													9	37	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12492036	12492036	+	Missense_Mutation	SNP	A	T	T	rs10417283	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12492036A>T	uc002mts.3	-	4	506	c.40T>A	c.(40-42)TGC>AGC	p.C14S				Q96GE5	ZN799_HUMAN	Homo sapiens cDNA clone IMAGE:30340957, **** WARNING: chimeric clone ****.	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						CTGATGTGGCAATGAAGGGAT	0.443													3	26	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12492039	12492039	+	Missense_Mutation	SNP	G	T	T	rs10414984	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12492039G>T	uc002mts.3	-	4	503	c.37C>A	c.(37-39)CAT>AAT	p.H13N				Q96GE5	ZN799_HUMAN	Homo sapiens cDNA clone IMAGE:30340957, **** WARNING: chimeric clone ****.	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						ATGTGGCAATGAAGGGATGAA	0.448													3	25	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17091465	17091465	+	Missense_Mutation	SNP	G	T	T	rs75941961	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17091465G>T	uc002nfb.2	-	14	1600	c.1568C>A	c.(1567-1569)TCC>TAC	p.S523Y		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	476						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GGGACATGTGGACTTCACAGA	0.577													5	105	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49812329	49812329	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49812329G>T	uc002pmz.2	-	7	1267	c.1033C>A	c.(1033-1035)CAA>AAA	p.Q345K	SLC6A16_uc002pna.2_Missense_Mutation_p.Q345K|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	345	Helical; Name=6; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GACAAAACTTGACCCCCTGCT	0.483													8	279	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898587	30898587	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898587G>A	uc002wxq.2	+	2	1174	c.1007G>A	c.(1006-1008)CGT>CAT	p.R336H	KIF3B_uc010ztv.1_Missense_Mutation_p.R336H|KIF3B_uc010ztw.1_Missense_Mutation_p.R336H	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	336	Kinesin-motor.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TATGCCAACCGTGCCAAAAAC	0.532													12	91	---	---	---	---	PASS
CBFA2T2	9139	broad.mit.edu	37	20	32212690	32212690	+	Silent	SNP	C	T	T	rs3803939	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32212690C>T	uc002wzg.1	+	7	1377	c.840C>T	c.(838-840)CCC>CCT	p.P280P	CBFA2T2_uc010zug.1_Silent_p.P54P|CBFA2T2_uc002wze.1_Silent_p.P271P|CBFA2T2_uc002wzf.1_RNA|CBFA2T2_uc002wzh.1_Silent_p.P251P|CBFA2T2_uc002wzi.1_RNA|CBFA2T2_uc002wzj.1_RNA	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit	280						nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						TCATGAATCCCGGGGGCCAAT	0.532													5	150	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37547207	37547207	+	Silent	SNP	G	A	A	rs34350985	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37547207G>A	uc002xje.2	+	11	1791	c.1602G>A	c.(1600-1602)TCG>TCA	p.S534S	PPP1R16B_uc010ggc.2_Silent_p.S492S	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	534	ANK 5.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				ATGGGACCTCGGTATATTACA	0.577													11	82	---	---	---	---	PASS
COL9A3	1299	broad.mit.edu	37	20	61471946	61471946	+	Silent	SNP	C	T	T			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61471946C>T	uc002ydm.2	+	32	1920	c.1917C>T	c.(1915-1917)GGC>GGT	p.G639G	COL9A3_uc002ydn.2_Silent_p.G133G	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor	639	Triple-helical region 1 (COL1).				axon guidance	collagen type IX					0	Breast(26;5.68e-08)					GTGCTCCCGGCGAGCCTGGGC	0.672													5	56	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641252	33641252	+	3'UTR	SNP	T	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641252T>C	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						tttttttttcttttttttttt	0.159													3	36	---	---	---	---	PASS
IFNAR2	3455	broad.mit.edu	37	21	34634878	34634878	+	Intron	SNP	G	A	A	rs1131668	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34634878G>A	uc002yrd.2	+						IFNAR2_uc002yrb.2_Missense_Mutation_p.A285T|IFNAR2_uc002yrc.2_Missense_Mutation_p.A285T|IFNAR2_uc002yre.2_Intron|IFNAR2_uc002yrf.2_Intron|IFNAR2_uc002yrg.2_Missense_Mutation_p.A154T|IL10RB_uc002yrh.1_Intron|IL10RB_uc002yri.1_Intron	NM_207585	NP_997468	P48551	INAR2_HUMAN	interferon alpha/beta receptor 2 isoform a						JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to interferon-alpha|response to virus|type I interferon-mediated signaling pathway	extracellular region|extracellular space|integral to plasma membrane	protein kinase binding|type I interferon binding|type I interferon receptor activity				0					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	gcaaggtctcgctaagggctg	0.080													5	11	---	---	---	---	PASS
CSTB	1476	broad.mit.edu	37	21	45194208	45194208	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45194208G>A	uc002zdr.2	-	3	281	c.172C>T	c.(172-174)CAC>TAC	p.H58Y		NM_000100	NP_000091	P04080	CYTB_HUMAN	cystatin B	58						cytoplasm|nucleolus	cysteine-type endopeptidase inhibitor activity|protease binding				0				STAD - Stomach adenocarcinoma(101;0.168)		TCGCCGACGTGCACCTGGGAA	0.537													21	118	---	---	---	---	PASS
CPT1B	1375	broad.mit.edu	37	22	51008809	51008809	+	Silent	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51008809G>A	uc003bmk.3	-	16	2217	c.2055C>T	c.(2053-2055)TCC>TCT	p.S685S	CPT1B_uc003bml.2_Silent_p.S685S|CPT1B_uc003bmm.2_Silent_p.S685S|CPT1B_uc003bmo.2_Silent_p.S685S|CPT1B_uc011asa.1_Silent_p.S651S|CPT1B_uc003bmn.2_Silent_p.S685S|CPT1B_uc011asb.1_Silent_p.S604S|CHKB-CPT1B_uc003bmp.2_Silent_p.S480S|uc003bmr.1_5'Flank	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	685	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TCTGGCTGGTGGAGAGACGCC	0.617													8	116	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028425	37028425	+	Missense_Mutation	SNP	A	G	G	rs145580328	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028425A>G	uc004ddl.1	+	1	1956	c.1942A>G	c.(1942-1944)AAT>GAT	p.N648D		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	648										ovary(3)	3						GGAGCCTCCCAATACTGGAGT	0.642													4	69	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65252421	65252421	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65252421T>C	uc004dwh.2	-	3	710	c.583A>G	c.(583-585)ACC>GCC	p.T195A	VSIG4_uc004dwi.2_Intron|VSIG4_uc010nkq.1_Missense_Mutation_p.T195A|VSIG4_uc004dwj.2_Missense_Mutation_p.T195A|VSIG4_uc011moy.1_Intron|VSIG4_uc004dwk.2_Missense_Mutation_p.T195A|VSIG4_uc004dwl.2_Missense_Mutation_p.T91A	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	195	Ig-like 2.|Extracellular (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						AAGAGTAAGGTACTTAGGGTT	0.498													6	66	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73811648	73811648	+	Missense_Mutation	SNP	G	A	A	rs147508371	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73811648G>A	uc004ebu.2	-	5	1792	c.1502C>T	c.(1501-1503)TCA>TTA	p.S501L	RLIM_uc004ebw.2_Missense_Mutation_p.S501L	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	501	Ser-rich.|Poly-Ser.				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding	p.S501L(1)		ovary(2)	2						GCCTGATGATGAGCTTCCTTC	0.378													4	40	---	---	---	---	PASS
MAMLD1	10046	broad.mit.edu	37	X	149671652	149671652	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149671652G>A	uc004fee.1	+	5	2225	c.2149G>A	c.(2149-2151)GGC>AGC	p.G717S	MAMLD1_uc011mxu.1_Intron|MAMLD1_uc011mxv.1_Missense_Mutation_p.G692S|MAMLD1_uc011mxw.1_Missense_Mutation_p.G603S	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	717					male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCCTGCCCGGCAGCTCCTT	0.617													34	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	19314274	19314277	+	IGR	DEL	GAAA	-	-	rs72498264		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19314274_19314277delGAAA								IFFO2 (31448 upstream) : UBR4 (84327 downstream)																							aggaaggaaggaaagaaggaagga	0.191													4	5	---	---	---	---	
HSPG2	3339	broad.mit.edu	37	1	22161636	22161636	+	Intron	DEL	T	-	-	rs71569850		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22161636delT	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGTCCACttcttttttttttt	0.040													4	2	---	---	---	---	
PLK3	1263	broad.mit.edu	37	1	45270777	45270778	+	Intron	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45270777_45270778insA	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					gactccatctcaaaaaaaaaaa	0.193													9	4	---	---	---	---	
XCL2	6846	broad.mit.edu	37	1	168513367	168513367	+	5'Flank	DEL	A	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168513367delA	uc001gfn.3	-							NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2 precursor						blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)					TATTTTTCTTAAAAAAAAAAA	0.423													4	2	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645816	45645816	+	Intron	DEL	A	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645816delA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAGGGAGTTTaaaaaaaaaaa	0.199													9	6	---	---	---	---	
ACSL3	2181	broad.mit.edu	37	2	223806194	223806194	+	Intron	DEL	C	-	-	rs1550426	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223806194delC	uc002vni.2	+						ACSL3_uc002vnj.2_Intron|ACSL3_uc002vnk.2_5'Flank	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3						long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TTCTTCTTTTCTTTTTTTTTA	0.373			T	ETV1	prostate								91	7	---	---	---	---	
CCDC80	151887	broad.mit.edu	37	3	112329034	112329034	+	Intron	DEL	A	-	-	rs146699705		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112329034delA	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						CTGTGCCCAGAAAAAAAAAAA	0.363													5	3	---	---	---	---	
IGSF11	152404	broad.mit.edu	37	3	118623658	118623659	+	Intron	DEL	TT	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118623658_118623659delTT	uc003ebw.2	-						IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Intron|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						GCAAAATATATTTAAGATATAT	0.347													227	8	---	---	---	---	
FIP1L1	81608	broad.mit.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54319248_54319249delAG	uc003gzy.2	+	16	1633_1634	c.1447_1448delAG	c.(1447-1449)AGAfs	p.R483fs	PDGFRA_uc003haa.2_Intron|FIP1L1_uc011bzu.1_Frame_Shift_Del_p.R477fs|FIP1L1_uc003gzz.2_Frame_Shift_Del_p.R409fs|FIP1L1_uc003hab.2_Frame_Shift_Del_p.R448fs|FIP1L1_uc003hac.2_Frame_Shift_Del_p.R237fs|FIP1L1_uc010ign.2_RNA|FIP1L1_uc003had.2_Frame_Shift_Del_p.P67fs|FIP1L1_uc003hae.2_Frame_Shift_Del_p.P67fs	NM_030917	NP_112179	Q6UN15	FIP1_HUMAN	FIP1 like 1 isoform 1	483	Arg-rich.|Sufficient for interaction with CPSF1 and CSTF3.|Glu-rich.				mRNA processing	nucleus	RNA binding			ovary(1)|skin(1)	2			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.292			T	PDGFRA	idiopathic hypereosinophilic syndrome								142	7	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						TTAATTCTTATTAATTAATTCT	0.282													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7207157	7207158	+	IGR	INS	-	TCC	TCC			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7207157_7207158insTCC								PAPD7 (449996 upstream) : ADCY2 (189185 downstream)																							cctcccttccttttcttccttc	0.089													3	4	---	---	---	---	
RAD17	5884	broad.mit.edu	37	5	68669513	68669514	+	Intron	DEL	AT	-	-	rs60134751		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68669513_68669514delAT	uc003jwo.2	+						RAD17_uc003jwg.2_Intron|RAD17_uc003jwh.2_Intron|RAD17_uc003jwi.2_Intron|RAD17_uc003jwj.2_Intron|RAD17_uc003jwk.2_Intron|RAD17_uc003jwl.2_Intron|RAD17_uc003jwm.2_Intron|RAD17_uc003jwn.2_Intron	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2						cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		tctcaaaaaaattttttttttt	0.104								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					2	4	---	---	---	---	
FAM151B	167555	broad.mit.edu	37	5	79794832	79794833	+	Intron	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79794832_79794833insA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		ATGGCAGATGGAAAAAAAAAAA	0.406													6	3	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7562606	7562607	+	Intron	INS	-	TTT	TTT	rs77312649	byFrequency	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7562606_7562607insTTT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTAGATTTGGTTTTTTTTTTT	0.356													3	3	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149196	44149197	+	Intron	INS	-	CG	CG			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149196_44149197insCG	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			Tcacacacacacacacacactc	0.228													5	3	---	---	---	---	
OOEP	441161	broad.mit.edu	37	6	74082632	74082633	+	Intron	DEL	TT	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74082632_74082633delTT	uc003pgv.3	-							NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ttttctttcctttttttttttt	0.381													4	2	---	---	---	---	
EPHA7	2045	broad.mit.edu	37	6	93974262	93974263	+	Intron	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93974262_93974263insA	uc003poe.2	-						EPHA7_uc003pof.2_Intron|EPHA7_uc011eac.1_Intron	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ACATAATTCTTAAAAAACAATA	0.297													28	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62609193	62609194	+	IGR	INS	-	T	T	rs78233785		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62609193_62609194insT								None (None upstream) : LOC643955 (142478 downstream)																							TTATCTTACTCTTTTTTTTTTT	0.213													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65269067	65269070	+	IGR	DEL	AATC	-	-	rs113086758		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65269067_65269070delAATC								CCT6P1 (40406 upstream) : VKORC1L1 (69187 downstream)																							TTAATTAATTAATCAATCAGAGAT	0.304													4	2	---	---	---	---	
ATAD2	29028	broad.mit.edu	37	8	124373557	124373557	+	Intron	DEL	A	-	-	rs113505749		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124373557delA	uc003yqh.3	-						ATAD2_uc011lii.1_Intron|ATAD2_uc003yqi.3_Intron|ATAD2_uc003yqj.2_Intron	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			gccctgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
HSPA5	3309	broad.mit.edu	37	9	128002003	128002003	+	Intron	DEL	A	-	-	rs146133716		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128002003delA	uc004bpn.2	-							NM_005347	NP_005338	P11021	GRP78_HUMAN	heat shock 70kDa protein 5						anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding			ovary(3)|skin(1)	4					Antihemophilic Factor(DB00025)	actgaaaattaaaaaaaaaaa	0.000										Prostate(1;0.17)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42681216	42681216	+	IGR	DEL	T	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42681216delT								None (None upstream) : LOC441666 (146099 downstream)																							CTTATTACTGTCAACAGAGTG	0.488													253	8	---	---	---	---	
GRIA4	2893	broad.mit.edu	37	11	105481598	105481601	+	Intron	DEL	TTTT	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105481598_105481601delTTTT	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc001piv.2_5'UTR|GRIA4_uc009yxk.1_5'UTR|GRIA4_uc001pit.2_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ctttcttttctttttttttttttt	0.343													7	4	---	---	---	---	
NCAPD2	9918	broad.mit.edu	37	12	6640678	6640678	+	3'UTR	DEL	A	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6640678delA	uc001qoo.2	+	32					NCAPD2_uc010sfd.1_3'UTR|GAPDH_uc001qop.1_5'Flank|GAPDH_uc009zep.1_5'Flank|GAPDH_uc001qoq.1_5'Flank|GAPDH_uc001qor.1_5'Flank	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						TCTTTTTTTTAAAAAAAAAAA	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56014150	56014151	+	IGR	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56014150_56014151insA								TBPL2 (106887 upstream) : C14orf33 (10539 downstream)																							aacactgtctcaaaaaaaaaaa	0.178													6	4	---	---	---	---	
CCDC102B	79839	broad.mit.edu	37	18	66541698	66541699	+	Intron	INS	-	T	T	rs145239563	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66541698_66541699insT	uc002lkk.2	+						CCDC102B_uc002lki.2_Intron|CCDC102B_uc002lkj.1_Intron	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AGATTTGCTGATTTTTTTTTAC	0.342													6	3	---	---	---	---	
WDR88	126248	broad.mit.edu	37	19	33637339	33637342	+	Intron	DEL	TTCC	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33637339_33637342delTTCC	uc002nui.2	+							NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing											ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					TAGGTCCTATttccttccttcctt	0.221													4	4	---	---	---	---	
HNRNPUL1	11100	broad.mit.edu	37	19	41797884	41797885	+	Intron	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41797884_41797885insA	uc002oqb.3	+						CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_Intron|HNRNPUL1_uc010eho.2_Intron|HNRNPUL1_uc010xvy.1_Intron|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1						nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						gaccctgtctcaaaaaaaaaaa	0.178													5	3	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49845484	49845485	+	Intron	INS	-	CCACATCAGTT	CCACATCAGTT	rs149352076	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49845484_49845485insCCACATCAGTT	uc002pnj.2	-						uc002pnb.1_5'Flank|TEAD2_uc002png.2_Intron|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		TGACATCCCCACCCTGGGTGAA	0.327													6	4	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54671789	54671790	+	Intron	INS	-	A	A	rs76608555		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54671789_54671790insA	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					aactccgtctcaaaaaaaaaaa	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5513437	5513437	+	IGR	DEL	A	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5513437delA								LOC149837 (28195 upstream) : GPCPD1 (11644 downstream)																							ctctgtctctaaaaaaaaaaa	0.194													4	2	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243449	20243449	+	Intron	DEL	T	-	-	rs35241025		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243449delT	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TGTTTTTGTGTTTTTTTTTTT	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961024	23961025	+	IGR	INS	-	AC	AC	rs146633246	by1000genomes	TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961024_23961025insAC								CST5 (100644 upstream) : GGTLC1 (4666 downstream)																							cactcacacatacacacacaaa	0.000													6	3	---	---	---	---	
NFS1	9054	broad.mit.edu	37	20	34284028	34284029	+	Intron	INS	-	A	A			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34284028_34284029insA	uc002xdw.1	-						NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron|NFS1_uc002xdx.2_Intron	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	AACTGCCAGACAAAAAAAAAAC	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20114718	20114718	+	IGR	DEL	T	-	-	rs143470990		TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20114718delT								RANBP1 (14 upstream) : ZDHHC8 (4647 downstream)																							ATTCAGGTTGTTTTTTTTTTT	0.313													4	2	---	---	---	---	
UBE2A	7319	broad.mit.edu	37	X	118716913	118716913	+	Intron	DEL	A	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118716913delA	uc004erl.2	+						UBE2A_uc004erm.2_Intron|UBE2A_uc004ern.2_Intron|UBE2A_uc004ero.2_Intron|UBE2A_uc004erp.2_Intron	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						cttctcccttaaaaaaaaaaa	0.169								Direct_reversal_of_damage|Rad6_pathway					4	2	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-EJ-5516-01	TCGA-EJ-5516-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCTGAACttcttttttttttt	0.139													6	3	---	---	---	---	
