Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DFFA	1676	broad.mit.edu	37	1	10521525	10521525	+	3'UTR	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10521525C>A	uc001arj.2	-	6					DFFA_uc001ark.2_3'UTR	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		ACAGAGCTTCCTTGGCACACT	0.542													3	33	---	---	---	---	PASS
PRAMEF1	65121	broad.mit.edu	37	1	12855752	12855752	+	Silent	SNP	G	A	A	rs80197258	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12855752G>A	uc001auj.1	+	4	1135	c.1032G>A	c.(1030-1032)CTG>CTA	p.L344L		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	344											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCTCTGCTGGAGAAAATTG	0.557													7	630	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62614008	62614008	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62614008C>G	uc001dab.2	+	42	5438	c.5324C>G	c.(5323-5325)TCT>TGT	p.S1775C	INADL_uc001dac.2_RNA|INADL_uc009wag.2_Missense_Mutation_p.S559C	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1775					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GAAAACATGTCTACAGGCTAC	0.448													8	301	---	---	---	---	PASS
PSRC1	84722	broad.mit.edu	37	1	109823645	109823645	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109823645C>T	uc001dxg.2	-	5	870	c.748G>A	c.(748-750)GTC>ATC	p.V250I	PSRC1_uc001dxb.2_Missense_Mutation_p.V50I|PSRC1_uc001dxc.2_Missense_Mutation_p.V220I|PSRC1_uc001dxd.2_Missense_Mutation_p.V220I|PSRC1_uc001dxe.2_Missense_Mutation_p.V220I|PSRC1_uc001dxf.2_Intron|PSRC1_uc001dxh.2_Missense_Mutation_p.V220I|PSRC1_uc001dxi.2_Missense_Mutation_p.V220I|PSRC1_uc001dxj.2_Missense_Mutation_p.V250I	NM_001032290	NP_001027461	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1 isoform c	250	Pro/Ser-rich.				cell division|microtubule bundle formation|mitotic metaphase plate congression|negative regulation of cell growth|positive regulation of microtubule polymerization|positive regulation of transcription, DNA-dependent|regulation of mitotic spindle organization	cytosol|midbody|spindle pole	microtubule binding				0		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		GGGGCCAGGACGGATCTGATG	0.612													24	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803302	142803302	+	Intron	SNP	C	A	A	rs79529551		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803302C>A	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		acaacaacaacaaACAGGATG	0.224													3	8	---	---	---	---	PASS
TRAF3IP3	80342	broad.mit.edu	37	1	209948722	209948722	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209948722T>A	uc001hho.2	+	10	1093	c.803T>A	c.(802-804)GTA>GAA	p.V268E	TRAF3IP3_uc001hhl.2_Missense_Mutation_p.V248E|TRAF3IP3_uc001hhm.1_Missense_Mutation_p.V268E|TRAF3IP3_uc001hhn.2_Missense_Mutation_p.V248E|TRAF3IP3_uc009xcr.2_Missense_Mutation_p.V268E	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	268	Cytoplasmic (Potential).|Potential.					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		ATGAAAAAAGTACTACTGGAG	0.313													10	35	---	---	---	---	PASS
OR2M3	127062	broad.mit.edu	37	1	248367150	248367150	+	Missense_Mutation	SNP	C	T	T	rs147728074	byFrequency	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248367150C>T	uc010pzg.1	+	1	781	c.781C>T	c.(781-783)CGG>TGG	p.R261W		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATGTACATACGGCCCACATC	0.502													61	385	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20490511	20490511	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20490511T>C	uc002rds.1	-	9	1216	c.1193A>G	c.(1192-1194)AAT>AGT	p.N398S	PUM2_uc002rdt.1_Missense_Mutation_p.N398S|PUM2_uc002rdr.2_Missense_Mutation_p.N337S|PUM2_uc010yjy.1_Missense_Mutation_p.N398S|PUM2_uc002rdu.1_Missense_Mutation_p.N398S|PUM2_uc010yjz.1_Missense_Mutation_p.N337S	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	398	Ala-rich.|Gln-rich.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGACCCTGATTGGGAGTAAG	0.443													10	123	---	---	---	---	PASS
HADHB	3032	broad.mit.edu	37	2	26508340	26508340	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26508340T>G	uc002rgz.2	+	15	1541	c.1290T>G	c.(1288-1290)TTT>TTG	p.F430L	HADHB_uc010ykv.1_Missense_Mutation_p.F408L|HADHB_uc010ykw.1_Missense_Mutation_p.F415L|HADHB_uc002rha.2_Missense_Mutation_p.F307L|HADHB_uc010ykx.1_Missense_Mutation_p.F356L	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	430					fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACACCCATTTGGAGCCACTG	0.532													9	104	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118771566	118771566	+	Silent	SNP	C	A	A	rs11545372	byFrequency	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118771566C>A	uc002tlj.2	-	1	132	c.6G>T	c.(4-6)GGG>GGT	p.G2G	CCDC93_uc010fld.1_Silent_p.G2G	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	2										large_intestine(1)|ovary(1)	2						CCCTGGGCAACCCCATGATCC	0.692													6	7	---	---	---	---	PASS
EPC2	26122	broad.mit.edu	37	2	149526724	149526724	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149526724T>G	uc010zbt.1	+	8	1172	c.1145T>G	c.(1144-1146)TTG>TGG	p.L382W		NM_015630	NP_056445	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2	382					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)		GTCTAGGTATTGTCCCCAGTA	0.378													5	33	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189918665	189918665	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189918665C>A	uc002uqk.2	-	37	2730	c.2455G>T	c.(2455-2457)GGT>TGT	p.G819C	COL5A2_uc010frx.2_Missense_Mutation_p.G395C	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	819					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTCGAGGACCAGGTTCACCC	0.423													3	50	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198283305	198283305	+	Silent	SNP	T	C	C	rs788023	byFrequency	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198283305T>C	uc002uue.2	-	5	471	c.423A>G	c.(421-423)AAA>AAG	p.K141K	SF3B1_uc010fsk.1_RNA	NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	141					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GATCAGGGGTTTTCCCTCCTG	0.358													3	160	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206050517	206050517	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206050517G>C	uc002var.1	+	14	2161	c.1954G>C	c.(1954-1956)GAG>CAG	p.E652Q	PARD3B_uc010fub.1_Missense_Mutation_p.E652Q|PARD3B_uc002vao.1_Missense_Mutation_p.E652Q|PARD3B_uc002vap.1_Missense_Mutation_p.E590Q|PARD3B_uc002vaq.1_Missense_Mutation_p.E652Q	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	652					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CGGATGGGCCGAGAGTGAAGT	0.443													6	244	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242079323	242079323	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242079323C>G	uc002wao.1	-	4	669	c.577G>C	c.(577-579)GCT>CCT	p.A193P	PASK_uc010zol.1_Intron|PASK_uc010zom.1_Missense_Mutation_p.A193P|PASK_uc010fzl.1_Missense_Mutation_p.A193P|PASK_uc010zon.1_Intron|PASK_uc002waq.2_Missense_Mutation_p.A193P	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	193					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		ACCACCGCAGCGTGGCCGTCG	0.602													18	62	---	---	---	---	PASS
ULK4	54986	broad.mit.edu	37	3	41949428	41949428	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41949428C>A	uc003ckv.3	-	12	1292	c.1091G>T	c.(1090-1092)CGT>CTT	p.R364L	ULK4_uc003ckw.2_Missense_Mutation_p.R364L|ULK4_uc003ckx.1_Missense_Mutation_p.R364L	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	364							ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GGGAGTAGGACGAGAACTGAA	0.408													29	83	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47679997	47679997	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47679997C>T	uc003gxm.2	-	9	1300	c.1207G>A	c.(1207-1209)GAG>AAG	p.E403K	CORIN_uc011bzf.1_Missense_Mutation_p.E264K|CORIN_uc011bzg.1_Missense_Mutation_p.E336K|CORIN_uc011bzh.1_Missense_Mutation_p.E366K|CORIN_uc011bzi.1_Missense_Mutation_p.E366K	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	403	Extracellular (Potential).|LDL-receptor class A 4.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						TTGCAGTCCTCGTCACCATCA	0.512													5	157	---	---	---	---	PASS
DDIT4L	115265	broad.mit.edu	37	4	101108776	101108776	+	3'UTR	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101108776G>A	uc003hvq.2	-	3						NM_145244	NP_660287	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like						negative regulation of signal transduction	cytoplasm				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		GACTTTAGCTGACTAGCTGAA	0.363													8	54	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155242138	155242138	+	Silent	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155242138C>T	uc003inw.2	-	14	3048	c.3048G>A	c.(3046-3048)ACG>ACA	p.T1016T		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1016	Cadherin 8.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AATGAGATGTCGTCTCATAAT	0.378													30	341	---	---	---	---	PASS
DCTD	1635	broad.mit.edu	37	4	183812459	183812459	+	3'UTR	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183812459G>A	uc003ivf.2	-	6					DCTD_uc003ivg.2_3'UTR|DCTD_uc010irw.2_3'UTR|DCTD_uc003ivh.2_3'UTR	NM_001921	NP_001912	P32321	DCTD_HUMAN	dCMP deaminase isoform b						nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)		ATACTGGCTAGTAAGAAGTTA	0.368													15	78	---	---	---	---	PASS
FAM13B	51306	broad.mit.edu	37	5	137277736	137277736	+	Splice_Site	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137277736T>C	uc003lbz.2	-	22	3057	c.2523_splice	c.e22-1	p.M841_splice	FAM13B_uc003lcb.2_Splice_Site_p.M717_splice|FAM13B_uc003lca.2_Splice_Site_p.M813_splice|PKD2L2_uc003lby.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						AATTCAGGCCTAGAATTGAAA	0.294													3	118	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554142	140554142	+	Missense_Mutation	SNP	T	G	G	rs13174866		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554142T>G	uc003lit.2	+	1	1900	c.1726T>G	c.(1726-1728)TTG>GTG	p.L576V		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	576	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGAGCCGTTGCCCCGGGC	0.706													4	118	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140558062	140558062	+	Silent	SNP	T	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558062T>A	uc011dai.1	+	1	633	c.447T>A	c.(445-447)CCT>CCA	p.P149P	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	149	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCAGTCCTCCTGGGACTGCGT	0.413													91	395	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140574103	140574103	+	Missense_Mutation	SNP	T	G	G	rs17844596		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574103T>G	uc003lix.2	+	1	2152	c.1978T>G	c.(1978-1980)TTG>GTG	p.L660V		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	660	Cadherin 6.|Extracellular (Potential).			L -> V (in Ref. 2; AAK51616).	calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACGCTGCACTTGCTCCTGGT	0.701													6	63	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140798265	140798265	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140798265C>T	uc003lkn.1	+	1	984	c.839C>T	c.(838-840)TCC>TTC	p.S280F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.S280F|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	280	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCACTTATTCCTTCTTTGGT	0.493													30	43	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32018029	32018029	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32018029C>T	uc003nzl.2	-	27	9381	c.9179G>A	c.(9178-9180)CGC>CAC	p.R3060H		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3107	Fibronectin type-III 23.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CTCCCCCAGGCGAGGCTTGAT	0.627													42	85	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33135619	33135619	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33135619C>A	uc003ocx.1	-	55	4199	c.3971G>T	c.(3970-3972)GGC>GTC	p.G1324V	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.G1238V|COL11A2_uc003ocz.1_Missense_Mutation_p.G1217V	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1324	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						ACCAGGCGAGCCAGCAGGACC	0.607													3	37	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39828787	39828787	+	Silent	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39828787G>A	uc003oow.2	+	3	408	c.252G>A	c.(250-252)AAG>AAA	p.K84K	DAAM2_uc010jxc.2_Silent_p.K84K|DAAM2_uc003oox.2_Silent_p.K84K|DAAM2_uc003oov.3_Silent_p.K84K|DAAM2_uc003ooy.3_Silent_p.K84K	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	84	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					ACTGCAGCAAGAAGAAGGTGC	0.463													7	22	---	---	---	---	PASS
FIGNL1	63979	broad.mit.edu	37	7	50514034	50514034	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50514034C>A	uc003tpc.2	-	4	1329	c.952G>T	c.(952-954)GGG>TGG	p.G318W	FIGNL1_uc003tpb.2_Missense_Mutation_p.G207W|FIGNL1_uc003tpd.2_Missense_Mutation_p.G318W|FIGNL1_uc003tpe.2_Missense_Mutation_p.G318W|FIGNL1_uc010kyy.2_Missense_Mutation_p.G318W	NM_001042762	NP_001036227	Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	318					ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity			ovary(3)	3	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TATGAAGACCCTGATGCACGC	0.453													4	182	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65222986	65222986	+	Intron	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65222986G>T	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_RNA|CCT6P1_uc003tui.2_RNA|uc003tuk.1_5'Flank					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		GAATTCTGGCGTTTTTTACAA	0.289													3	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100608375	100608375	+	Intron	SNP	G	A	A	rs75592954		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100608375G>A	uc003uxl.1	+						uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					SubName: Full=Intestinal mucin; Flags: Fragment;																		CCCGGAAGGTGAGGGTGGGGT	0.582													7	27	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154667655	154667655	+	Silent	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154667655C>T	uc003wlk.2	+	20	2052	c.1923C>T	c.(1921-1923)TTC>TTT	p.F641F	DPP6_uc003wli.2_Silent_p.F577F|DPP6_uc003wlm.2_Silent_p.F579F|DPP6_uc011kvq.1_Silent_p.F534F	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	641	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTGAGAAGTTCGAGGTGAGCT	0.652													4	19	---	---	---	---	PASS
NKX3-1	4824	broad.mit.edu	37	8	23539003	23539003	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23539003G>C	uc011kzx.1	-	2	484	c.436C>G	c.(436-438)CAG>GAG	p.Q146E	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	146	Homeobox.				negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		AGGTACTTCTGATGGCTGAAC	0.572													5	308	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68007736	68007736	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68007736T>C	uc003xxi.2	+	8	855	c.824T>C	c.(823-825)ATT>ACT	p.I275T	CSPP1_uc003xxg.1_Missense_Mutation_p.I267T|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.I240T|CSPP1_uc003xxk.2_5'UTR	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	275						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AATAGAAGAATTATTAAAAAA	0.373													4	161	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139144752	139144752	+	3'UTR	SNP	A	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139144752A>T	uc003yuy.2	-	20					FAM135B_uc003yux.2_3'UTR|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTCATTCTGAAATGGTGAGGT	0.478										HNSCC(54;0.14)			7	88	---	---	---	---	PASS
ZCCHC6	79670	broad.mit.edu	37	9	88903619	88903619	+	Silent	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88903619T>C	uc004aoq.2	-	27	4676	c.4461A>G	c.(4459-4461)TCA>TCG	p.S1487S	ZCCHC6_uc010mqe.2_Silent_p.S387S|ZCCHC6_uc011ltf.1_RNA|ZCCHC6_uc004aor.2_RNA|ZCCHC6_uc004aos.2_RNA|ZCCHC6_uc004aot.2_Silent_p.S1251S|ZCCHC6_uc004aou.2_Silent_p.S1487S	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1487					RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						TCCTCTTCGCTGAGGCTTTTC	0.438													3	178	---	---	---	---	PASS
EDF1	8721	broad.mit.edu	37	9	139760715	139760715	+	5'UTR	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139760715G>A	uc004cjt.1	-	1					EDF1_uc004cju.1_5'UTR	NM_003792	NP_003783	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1						endothelial cell differentiation|multicellular organismal development|positive regulation of DNA binding|positive regulation of transcription, DNA-dependent|regulation of lipid metabolic process|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleus	calmodulin binding|protein binding|protein binding|sequence-specific DNA binding|transcription coactivator activity				0	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GGCCATGGCGGGCGAAGACGA	0.692													7	27	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75072385	75072385	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75072385C>T	uc009xrc.2	-	11	1260	c.1139G>A	c.(1138-1140)AGC>AAC	p.S380N	TTC18_uc001jty.2_Missense_Mutation_p.S380N|TTC18_uc009xrd.1_Missense_Mutation_p.S188N	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	380							binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					CCGGAACAAGCTCAATAAACA	0.294													9	292	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87406775	87406775	+	Intron	SNP	G	T	T	rs112358471		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87406775G>T	uc001kdl.1	-						GRID1_uc009xsu.1_Intron|GRID1_uc010qmf.1_Intron|uc001kdm.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AAGTTGGAAGGTCCATAAGAA	0.552										Multiple Myeloma(13;0.14)			7	23	---	---	---	---	PASS
ZBTB3	79842	broad.mit.edu	37	11	62519844	62519844	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62519844G>C	uc001nuz.2	-	2	1565	c.1443C>G	c.(1441-1443)TTC>TTG	p.F481L		NM_024784	NP_079060	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	481	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3						AAGAGCATGAGAAGGTCTTCC	0.552													16	106	---	---	---	---	PASS
TAF1D	79101	broad.mit.edu	37	11	93471531	93471531	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93471531G>A	uc001ped.2	-	3	405	c.203C>T	c.(202-204)TCA>TTA	p.S68L	SNORA8_uc001pec.2_5'Flank|TAF1D_uc001pdz.2_RNA|TAF1D_uc001pea.1_RNA	NM_024116	NP_077021	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated	68					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0						TTCAAAAGATGAGTCACTTGA	0.363													93	178	---	---	---	---	PASS
TMPRSS13	84000	broad.mit.edu	37	11	117789386	117789386	+	Silent	SNP	A	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117789386A>C	uc001prs.1	-	2	282	c.189T>G	c.(187-189)GGT>GGG	p.G63G	TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Silent_p.G63G	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	63	4 X 5 AA repeats of T-P-P-G-R.|1-8.|12 X 5 AA repeats of A-S-P-A-[GLQR].|Cytoplasmic (Potential).|Ala-rich.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		CTGGAGGTGTACCAGCTGGAG	0.682													5	90	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8386911	8386911	+	RNA	SNP	G	T	T	rs2968743	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8386911G>T	uc010sgk.1	-	4		c.545C>A				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						TCTGGGTTGCGGACGGTAAAG	0.657													4	66	---	---	---	---	PASS
SSPN	8082	broad.mit.edu	37	12	26384054	26384054	+	3'UTR	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26384054T>C	uc001rhe.2	+	3					SSPN_uc001rhd.2_3'UTR|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077	Q14714	SSPN_HUMAN	sarcospan isoform 1						cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)					ATGGAGTAGCTGAGGTTAAAC	0.348													16	36	---	---	---	---	PASS
KRT6C	286887	broad.mit.edu	37	12	52864359	52864359	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52864359T>A	uc001sal.3	-	6	1181	c.1133A>T	c.(1132-1134)AAG>ATG	p.K378M		NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C	378	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		AATCTCCTGCTTGGTGTTGCG	0.552													18	181	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85266407	85266407	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85266407A>T	uc001szv.2	-	8	1769	c.1276T>A	c.(1276-1278)TGT>AGT	p.C426S	SLC6A15_uc010sul.1_Missense_Mutation_p.C319S|SLC6A15_uc001szw.1_Missense_Mutation_p.C134S	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	426	Extracellular (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						TCAATTTTACAGGAATTGAGA	0.318													4	159	---	---	---	---	PASS
TPCN1	53373	broad.mit.edu	37	12	113733848	113733848	+	Silent	SNP	A	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113733848A>T	uc001tuw.2	+	28	2715	c.2418A>T	c.(2416-2418)CCA>CCT	p.P806P	TPCN1_uc001tux.2_Silent_p.P878P|TPCN1_uc010syu.1_RNA	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	806	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						AGCAGCCCCCAGGCAGCCGCC	0.597													23	41	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126068419	126068419	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126068419C>T	uc001uhe.1	+	5	1309	c.1301C>T	c.(1300-1302)GCC>GTC	p.A434V		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	434	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TTGAACACTGCCATTCTCACT	0.542													8	476	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131471699	131471699	+	Missense_Mutation	SNP	G	A	A	rs61732860	byFrequency	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131471699G>A	uc001uit.3	+	6	1109	c.550G>A	c.(550-552)GTC>ATC	p.V184I	GPR133_uc010tbm.1_Missense_Mutation_p.V216I	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	184	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GAAAGTCTACGTCAACGGGAC	0.517													7	178	---	---	---	---	PASS
COMMD6	170622	broad.mit.edu	37	13	76112056	76112056	+	5'Flank	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76112056G>T	uc001vjo.1	-						COMMD6_uc001vjn.1_5'Flank|COMMD6_uc010aet.1_5'Flank|COMMD6_uc001vjp.1_RNA	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		AGCAGGGGAAGCTGAAAAAAG	0.488													6	32	---	---	---	---	PASS
IRS2	8660	broad.mit.edu	37	13	110436428	110436428	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110436428G>T	uc001vqv.2	-	1	2487	c.1973C>A	c.(1972-1974)CCC>CAC	p.P658H		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	658					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGCCGCGCCGGGCGTCATGGG	0.677													3	14	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23564591	23564591	+	5'UTR	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23564591G>T	uc001wit.3	-	1					ACIN1_uc010akg.2_5'UTR|ACIN1_uc010tnj.1_5'UTR|C14orf119_uc001wiu.2_5'Flank	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GCTTTGAATCGAATATATTCG	0.512													19	38	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106478356	106478356	+	RNA	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106478356C>T	uc010tyt.1	-	1857		c.35930G>A								Parts of antibodies, mostly variable regions.												0						ACAGGGTCTCCGAAGGCTTCA	0.627													5	82	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85447467	85447467	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85447467G>T	uc002blg.2	+	7	803	c.601G>T	c.(601-603)GCA>TCA	p.A201S	SLC28A1_uc010upd.1_Missense_Mutation_p.A123S|SLC28A1_uc010bnb.2_Missense_Mutation_p.A201S|SLC28A1_uc010upe.1_Missense_Mutation_p.A201S|SLC28A1_uc010upf.1_Missense_Mutation_p.A201S|SLC28A1_uc010upg.1_Missense_Mutation_p.A201S	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	201					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCATCATTGCGCAGTGAGTGC	0.582													5	229	---	---	---	---	PASS
AMDHD2	51005	broad.mit.edu	37	16	2570856	2570856	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2570856A>G	uc002cqq.2	+	2	267	c.170A>G	c.(169-171)GAC>GGC	p.D57G	AMDHD2_uc002cqp.2_Missense_Mutation_p.D57G|AMDHD2_uc010uwc.1_Missense_Mutation_p.D57G|AMDHD2_uc010uwd.1_Intron	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2 isoform 1	57					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			skin(2)|large_intestine(1)|breast(1)	4						GAGCGGCGGGACTGCGGGGGC	0.692													5	21	---	---	---	---	PASS
CAPNS2	84290	broad.mit.edu	37	16	55601019	55601019	+	Silent	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55601019C>T	uc002eid.1	+	1	436	c.351C>T	c.(349-351)GAC>GAT	p.D117D	LPCAT2_uc002eie.3_Intron|LPCAT2_uc002eic.2_Intron	NM_032330	NP_115706	Q96L46	CPNS2_HUMAN	calpain small subunit 2	117						cytoplasm|plasma membrane	calcium ion binding				0						TTAAGACTGACGGTTTTAGTC	0.448													7	333	---	---	---	---	PASS
CENPT	80152	broad.mit.edu	37	16	67865092	67865092	+	Intron	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67865092G>C	uc002eun.3	-						CENPT_uc002eum.3_Intron|CENPT_uc010vkc.1_Intron|CENPT_uc010vkd.1_Intron|CENPT_uc010vke.1_Missense_Mutation_p.L141V	NM_025082	NP_079358	Q96BT3	CENPT_HUMAN	centromere protein T						mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus	DNA binding				0		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		TTTCCCCAAAGGCCAGCAGGG	0.592													29	259	---	---	---	---	PASS
BCMO1	53630	broad.mit.edu	37	16	81298375	81298375	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81298375T>C	uc002fgn.1	+	5	820	c.602T>C	c.(601-603)ATC>ACC	p.I201T	BCMO1_uc010vnp.1_Missense_Mutation_p.I132T	NM_017429	NP_059125	Q9HAY6	BCDO1_HUMAN	beta-carotene 15,15'-monooxygenase	201					retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0						ATTTTTAAGATCCCTGCCACA	0.438													10	92	---	---	---	---	PASS
NXN	64359	broad.mit.edu	37	17	725622	725622	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:725622C>A	uc002fsa.2	-	4	780	c.688G>T	c.(688-690)GAG>TAG	p.E230*	NXN_uc002fsb.1_Nonsense_Mutation_p.E117*|NXN_uc010vqd.1_5'UTR|NXN_uc002frz.2_5'UTR|NXN_uc010vqe.1_Nonsense_Mutation_p.E122*	NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin	230	Thioredoxin.				cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		AAGATGATCTCGAAGTTCTGG	0.512													3	107	---	---	---	---	PASS
TUBG2	27175	broad.mit.edu	37	17	40818592	40818592	+	Intron	SNP	C	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40818592C>T	uc010wgr.1	+						TUBG2_uc002iaq.2_3'UTR|TUBG2_uc002iar.2_Intron|TUBG2_uc002ias.2_Intron|TUBG2_uc002iap.2_Intron	NM_016437	NP_057521	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2						G2/M transition of mitotic cell cycle|microtubule-based process|protein polymerization	cytosol	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		CCCCCTGGCTCGCATTTTGGA	0.498													4	102	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43262359	43262359	+	Missense_Mutation	SNP	G	A	A	rs3745009	byFrequency	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43262359G>A	uc010dnj.2	+	21	2959	c.2638G>A	c.(2638-2640)GCC>ACC	p.A880T	SLC14A2_uc002lbe.2_Missense_Mutation_p.A880T	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	880						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CAATAACCCCGCCATCTACAA	0.527													6	333	---	---	---	---	PASS
FAM108A1	81926	broad.mit.edu	37	19	1881408	1881408	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1881408A>G	uc002lug.2	-	2	564	c.158T>C	c.(157-159)TTG>TCG	p.L53S	FAM108A1_uc002lud.2_Missense_Mutation_p.L53S|FAM108A1_uc002lue.2_Missense_Mutation_p.L53S|FAM108A1_uc002luf.2_Missense_Mutation_p.L53S	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2	53						extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGGTCCCCAAGGGGGCGGC	0.736													4	47	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9063353	9063353	+	Silent	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9063353G>A	uc002mkp.2	-	3	24297	c.24093C>T	c.(24091-24093)AGC>AGT	p.S8031S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8033	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGAGGTGCTGCTCAAATTTG	0.468													4	181	---	---	---	---	PASS
LRFN3	79414	broad.mit.edu	37	19	36430858	36430858	+	Silent	SNP	C	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36430858C>A	uc002oco.2	+	2	983	c.531C>A	c.(529-531)GGC>GGA	p.G177G		NM_024509	NP_078785	Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III	177	Extracellular (Potential).|LRR 5.				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGGCCCTGGGCCGCCTGGGCA	0.677													13	172	---	---	---	---	PASS
FOXA3	3171	broad.mit.edu	37	19	46375689	46375689	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46375689A>T	uc002pdr.2	+	2	623	c.426A>T	c.(424-426)GAA>GAT	p.E142D		NM_004497	NP_004488	P55318	FOXA3_HUMAN	forkhead box A3	142	Fork-head.				brain development|cellular glucose homeostasis|cellular response to starvation|chromatin modification|embryo development|endocrine pancreas development|negative regulation of cell proliferation|neural plate anterior/posterior regionalization|neuron fate specification|positive regulation of hepatocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|spermatogenesis	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(1)	1		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CCTTGAGTGAAATCTACCAGT	0.567													18	257	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52937267	52937267	+	Silent	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52937267G>A	uc002pzk.2	+	2	136	c.75G>A	c.(73-75)CTG>CTA	p.L25L	ZNF534_uc002pzj.1_Silent_p.L25L|ZNF534_uc010epo.1_Silent_p.L25L|ZNF534_uc002pzl.2_Silent_p.L25L	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	25	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGAAATGCCTGGACCCTGGGC	0.478													57	116	---	---	---	---	PASS
HSPA12B	116835	broad.mit.edu	37	20	3732820	3732820	+	3'UTR	SNP	G	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3732820G>T	uc002wjd.2	+	13					HSPA12B_uc010zqi.1_3'UTR|HSPA12B_uc002wje.2_3'UTR|HSPA12B_uc010zqj.1_3'UTR	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding				0						CTGAGGGCGCGCCGGCGCGGT	0.662													6	15	---	---	---	---	PASS
FOXA2	3170	broad.mit.edu	37	20	22562683	22562683	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22562683G>C	uc002wsn.2	-	3	1369	c.1179C>G	c.(1177-1179)CAC>CAG	p.H393Q	FOXA2_uc002wsm.2_Missense_Mutation_p.H399Q	NM_153675	NP_710141	Q9Y261	FOXA2_HUMAN	forkhead box A2 isoform 2	393	Transactivation domain 2 (By similarity).				cell differentiation in hindbrain|central nervous system myelin formation|chromatin modification|dorsal/ventral neural tube patterning|ectoderm formation|endocrine pancreas development|endoderm development|epithelial tube branching involved in lung morphogenesis|in utero embryonic development|lung epithelial cell differentiation|negative regulation of neuron differentiation|neuron fate specification|oligodendrocyte cell fate commitment|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of neuron differentiation|primitive streak formation|regulation of blood coagulation|regulation of sequence-specific DNA binding transcription factor activity|response to interleukin-6	cytoplasm|transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4	Lung NSC(19;0.188)					GTtggtggtggtggtggctgt	0.532													3	91	---	---	---	---	PASS
FAM182B	728882	broad.mit.edu	37	20	25848606	25848606	+	RNA	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25848606G>A	uc002wvd.1	-	1		c.181C>T								Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						atcaccgtccgggcaggcctg	0.000													4	8	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10908828	10908828	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10908828T>G	uc002yip.1	-	23	1885	c.1517A>C	c.(1516-1518)AAC>ACC	p.N506T	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.N488T|TPTE_uc002yir.1_Missense_Mutation_p.N468T|TPTE_uc010gkv.1_Missense_Mutation_p.N368T	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	506	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCATACCTGTTATTTTCAAT	0.294													4	129	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659809	24659809	+	RNA	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659809G>A	uc002zzs.3	+	7		c.3541G>A			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						CCCTATCTGCGCACCCGGAGG	0.612													3	13	---	---	---	---	PASS
KREMEN1	83999	broad.mit.edu	37	22	29534804	29534804	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29534804G>A	uc011akm.1	+	7	1170	c.1157G>A	c.(1156-1158)GGA>GAA	p.G386E	KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Missense_Mutation_p.G269E	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1	384	Extracellular (Potential).				cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						ATGGGGGCTGGAAGCCACAGA	0.552													11	45	---	---	---	---	PASS
DDX17	10521	broad.mit.edu	37	22	38881836	38881836	+	3'UTR	SNP	G	A	A	rs34004602		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38881836G>A	uc003avy.3	-	13					DDX17_uc003avw.3_3'UTR|DDX17_uc010gxp.2_3'UTR|DDX17_uc003avx.3_3'UTR	NM_001098504	NP_001091974	Q92841	DDX17_HUMAN	DEAD box polypeptide 17 isoform 3						RNA processing	nucleus	ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity|RNA-dependent ATPase activity			skin(3)|upper_aerodigestive_tract(1)	4	Melanoma(58;0.0286)					aaaaaaaaaagaaaaaaggaa	0.284													5	7	---	---	---	---	PASS
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45128196	45128196	+	Silent	SNP	G	C	C			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45128196G>C	uc003bfd.2	+	6	752	c.480G>C	c.(478-480)GTG>GTC	p.V160V	PRR5_uc003bew.1_Silent_p.V151V|PRR5_uc003bex.1_Silent_p.V65V|PRR5_uc010gzt.1_Silent_p.V183V|PRR5_uc010gzu.1_Silent_p.V124V|PRR5_uc003bey.1_Silent_p.V151V|PRR5_uc003bez.1_Silent_p.V65V|PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|PRR5_uc003bfa.1_Silent_p.V53V|PRR5_uc003bfb.1_Silent_p.V160V|PRR5_uc003bfe.1_RNA|PRR5-ARHGAP8_uc003bfg.1_Intron|PRR5_uc003bfh.1_Silent_p.V59V	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						CCCTCAGTGTGAAGCTAGAGG	0.682													3	120	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41000651	41000651	+	Silent	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41000651G>A	uc004dfb.2	+	9	1761	c.1128G>A	c.(1126-1128)GAG>GAA	p.E376E	USP9X_uc004dfc.2_Silent_p.E376E	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	376					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						GTAATCCTGAGGAGGAAGAGT	0.363													13	36	---	---	---	---	PASS
FAM127A	8933	broad.mit.edu	37	X	134166693	134166693	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134166693T>A	uc004eyd.2	+	1	361	c.280T>A	c.(280-282)TAC>AAC	p.Y94N	uc004eye.1_RNA	NM_001078171	NP_001071639	A6ZKI3	F127A_HUMAN	family with sequence similarity 127, member A	94											0	Acute lymphoblastic leukemia(192;0.000127)					CCTCAATGATTACCGGGGCTT	0.642													29	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3061	3061	+	5'Flank	SNP	G	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3061G>A	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		TTAAAGTCCTACGTGATCTGA	0.443													2	1	---	---	---	---	PASS
LZIC	84328	broad.mit.edu	37	1	9992160	9992163	+	Intron	DEL	GGGG	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9992160_9992163delGGGG	uc001aqm.2	-						LZIC_uc001aqn.2_Intron|LZIC_uc001aqo.2_Intron|LZIC_uc009vmr.2_Intron|LZIC_uc010oah.1_Intron	NM_032368	NP_115744	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing								beta-catenin binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		tgggaggcgtgggggggggggggg	0.103													4	2	---	---	---	---	
VPS13D	55187	broad.mit.edu	37	1	12408688	12408688	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12408688delT	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTTTTTAGAATTTTTTTTTTT	0.299													4	2	---	---	---	---	
NTNG1	22854	broad.mit.edu	37	1	107866732	107866732	+	Intron	DEL	T	-	-	rs75220872		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107866732delT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ACCATATTGCTTTTTTTTTTT	0.303													73	8	---	---	---	---	
AIM2	9447	broad.mit.edu	37	1	159033322	159033322	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159033322delT	uc001ftj.1	-	5	1204	c.959delA	c.(958-960)AATfs	p.N320fs		NM_004833	NP_004824	O14862	AIM2_HUMAN	absent in melanoma 2	320	HIN-200.				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus				ovary(2)|pancreas(1)	3	all_hematologic(112;0.0429)					TTTTTCTCCATTTTTTGACAG	0.408													379	209	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169207732	169207733	+	Intron	INS	-	AT	AT	rs142163172		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169207732_169207733insAT	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					cacacacacacacacacacaca	0.243													2	4	---	---	---	---	
TPR	7175	broad.mit.edu	37	1	186307316	186307316	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186307316delT	uc001grv.2	-	31	4508	c.4211delA	c.(4210-4212)AATfs	p.N1404fs		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1404	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCTTACTTTATTTAGATCTTC	0.294			T	NTRK1	papillary thyroid								195	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240148045	240148048	+	IGR	DEL	AGGA	-	-	rs74342196		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240148045_240148048delAGGA								CHRM3 (75330 upstream) : FMN2 (107137 downstream)																							ggagggagggaggaaggaaggaag	0.142													6	3	---	---	---	---	
GPN1	11321	broad.mit.edu	37	2	27852150	27852151	+	Intron	INS	-	G	G	rs146892484	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27852150_27852151insG	uc010ymc.1	+						ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Intron|GPN1_uc010ezg.1_5'UTR	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						GCATGGCTTTCGGGGGCTTCCC	0.589													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39728670	39728670	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39728670delT	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																		CCCCCCCCCCttttttttttt	0.109													4	2	---	---	---	---	
PNPT1	87178	broad.mit.edu	37	2	55914573	55914574	+	Intron	INS	-	A	A	rs11386711		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55914573_55914574insA	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			gagtccacctcaaaaaaaaaaa	0.158													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64602783	64602785	+	IGR	DEL	CAT	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64602783_64602785delCAT								PELI1 (231178 upstream) : HSPC159 (78542 downstream)																							ccaccatcaccatcaccatcacc	0.059													2	4	---	---	---	---	
NFU1	27247	broad.mit.edu	37	2	69627837	69627838	+	Intron	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69627837_69627838insT	uc002sfk.2	-						NFU1_uc002sfj.2_Intron|NFU1_uc002sfl.2_Intron|NFU1_uc002sfm.2_Intron|NFU1_uc010fdi.2_Intron|NFU1_uc002sfn.1_Intron	NM_001002755	NP_001002755	Q9UMS0	NFU1_HUMAN	HIRA interacting protein 5 isoform 2						iron-sulfur cluster assembly	cytosol|mitochondrion|nucleus	4 iron, 4 sulfur cluster binding|iron ion binding|protein binding				0						ttagaattaaattttttttttt	0.257													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129098917	129098919	+	IGR	DEL	GTG	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129098917_129098919delGTG								HS6ST1 (22746 upstream) : None (None downstream)																							ggtattggtagtggtggtgatgg	0.103													7	4	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													3	3	---	---	---	---	
USP40	55230	broad.mit.edu	37	2	234398195	234398196	+	5'UTR	INS	-	A	A	rs146443538	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234398195_234398196insA	uc002vul.2	-	1					USP40_uc010zmr.1_Intron|USP40_uc010zms.1_Intron|USP40_uc002vun.2_Intron			Q9NVE5	UBP40_HUMAN	Homo sapiens mRNA for ubiquitin specific proteinase 40 (USP40 gene).						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TACTGTTTTAGAAAAAAAAAAT	0.366													4	6	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1262421	1262422	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1262421_1262422insT	uc003boz.2	+	3	373_374	c.106_107insT	c.(106-108)ATTfs	p.I36fs	CNTN6_uc010hbo.2_Frame_Shift_Ins_p.I31fs|CNTN6_uc011asj.1_5'UTR|CNTN6_uc003bpa.2_Frame_Shift_Ins_p.I36fs	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	36	Ig-like C2-type 1.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		ACATGATGTCATTTTTCCTTTG	0.401													324	8	---	---	---	---	
TWF2	11344	broad.mit.edu	37	3	52272945	52272946	+	Intron	INS	-	G	G	rs140204155	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52272945_52272946insG	uc003ddd.2	-						TWF2_uc010hmc.2_Intron|uc003dde.2_5'Flank	NM_007284	NP_009215	Q6IBS0	TWF2_HUMAN	twinfilin-like protein							cytoskeleton|perinuclear region of cytoplasm	actin binding|ATP binding			stomach(1)|ovary(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCCGAGAGCCGGGGGGGGGCG	0.718													13	6	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119128712	119128712	+	Intron	DEL	T	-	-	rs149651758		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119128712delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TGAAAAAAAATTTTTTTTTGA	0.378													6	3	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142774049	142774049	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142774049delT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						TTGGCATACATTTTTTTTTTT	0.318													4	2	---	---	---	---	
NOP14	8602	broad.mit.edu	37	4	2952613	2952616	+	Intron	DEL	GAGT	-	-	rs3832272		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952613_2952616delGAGT	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						cagagagagagagtgagaaagaga	0.245													2	4	---	---	---	---	
AMBN	258	broad.mit.edu	37	4	71469349	71469350	+	Intron	DEL	AC	-	-	rs112130724		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71469349_71469350delAC	uc003hfl.2	+							NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor						bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			TCTTGGCCAGacacacacacac	0.267													4	4	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80515744	80515744	+	Intron	DEL	A	-	-	rs34019036		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80515744delA	uc003kha.1	+						RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		tagtctgattaaaaaaaaaaa	0.000													5	6	---	---	---	---	
SLC22A4	6583	broad.mit.edu	37	5	131676278	131676278	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131676278delC	uc003kwq.2	+	9	1630	c.1465delC	c.(1465-1467)CCCfs	p.P489fs	uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	489	Helical; Name=12; (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	CAGAATGCTGCCCTACATCGT	0.458													665	15	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142421288	142421289	+	Intron	DEL	AA	-	-	rs66720832		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142421288_142421289delAA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGAAAATGAAAAAAAAAAAA	0.411													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170261080	170261082	+	IGR	DEL	CAT	-	-	rs111380690		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261080_170261082delCAT								GABRP (20032 upstream) : RANBP17 (27940 downstream)																							ccaccatcaccatcaccaccacc	0.118													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8323263	8323264	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs139963481	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323263_8323264insTTCCTTCT								EEF1E1 (220435 upstream) : SLC35B3 (88469 downstream)																							tctttctttccttccttctttc	0.000													5	7	---	---	---	---	
MRPL2	51069	broad.mit.edu	37	6	43023098	43023098	+	Intron	DEL	A	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43023098delA	uc003ots.1	-						CUL7_uc011dvb.1_5'Flank|CUL7_uc003otq.2_5'Flank|CUL7_uc010jyh.2_5'Flank|KLC4_uc003otr.1_Intron	NM_015950	NP_057034	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome				0		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ctctgtctcgaaaaaaaaaaa	0.204													7	4	---	---	---	---	
OOEP	441161	broad.mit.edu	37	6	74082632	74082632	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74082632delT	uc003pgv.3	-							NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ttttctttccttttttttttt	0.378													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108326821	108326821	+	IGR	DEL	T	-	-	rs112205315		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108326821delT								SEC63 (47339 upstream) : OSTM1 (35794 downstream)																							TCATCAATGAttttttttttt	0.264													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145029205	145029206	+	Intron	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145029205_145029206insT	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGAAAATTAACTTTTTTTTTTT	0.282													5	6	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151203866	151203867	+	Intron	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151203866_151203867insT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron|MTHFD1L_uc003qoa.1_Intron|MTHFD1L_uc010kil.1_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CACAAAACTAATTTTTATTTTG	0.312													39	12	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158502667	158502668	+	Intron	DEL	TC	-	-	rs149018292	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502667_158502668delTC	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		tttttttttttctctgagacaa	0.188													3	5	---	---	---	---	
PMS2L4	5382	broad.mit.edu	37	7	66762432	66762432	+	Intron	DEL	G	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66762432delG	uc003tvo.2	-						PMS2L4_uc003tvq.2_Intron|PMS2L4_uc003tvr.3_Intron|PMS2L4_uc003tvs.3_Intron					Homo sapiens cDNA clone IMAGE:4081618.												0						gtctcaaaaagaaaaaaaaaa	0.124													9	4	---	---	---	---	
ZNF804B	219578	broad.mit.edu	37	7	88483836	88483837	+	Intron	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88483836_88483837insT	uc011khi.1	+							NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ctttcctttccttcctttcctt	0.050										HNSCC(36;0.09)			4	2	---	---	---	---	
ZNF777	27153	broad.mit.edu	37	7	149148380	149148381	+	Intron	DEL	GT	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149148380_149148381delGT	uc003wfv.2	-							NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGGGGTGTGGGTGTGTGTGTGT	0.520													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151902481	151902481	+	Intron	DEL	A	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151902481delA	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAAAACGACCAAAAAAAAAAA	0.294			N		medulloblastoma								5	3	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													13	7	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104922219	104922220	+	Intron	DEL	TA	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922219_104922220delTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGCACTCACTATATATATATA	0.282										HNSCC(12;0.0054)			9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93505261	93505261	+	IGR	DEL	A	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93505261delA								DIRAS2 (100153 upstream) : SYK (58751 downstream)																							AAAGACTGAGAAAAAAAAAAA	0.423													4	2	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101751305	101751306	+	Intron	INS	-	ACAC	ACAC	rs139982096		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101751305_101751306insACAC	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GTCTCTCATAGacacacacaca	0.292													4	2	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27421035	27421036	+	Intron	INS	-	T	T	rs148340744	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27421035_27421036insT	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						ttctgGAtttctttttttttct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													6	5	---	---	---	---	
DDB2	1643	broad.mit.edu	37	11	47251370	47251370	+	Intron	DEL	T	-	-	rs35972351		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47251370delT	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						atggctcttcttttttttttt	0.000			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594093	69594102	+	IGR	DEL	AGAAAGAGAT	-	-	rs80081772		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594093_69594102delAGAAAGAGAT								CPM (237073 upstream) : CPSF6 (39215 downstream)																							ataagagataagaaagagataagagataag	0.024													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77054687	77054687	+	IGR	DEL	T	-	-	rs2369296	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054687delT								OSBPL8 (101098 upstream) : ZDHHC17 (103167 downstream)																							aaaaaaaaaataaataaaGGA	0.358													6	7	---	---	---	---	
SOCS2	8835	broad.mit.edu	37	12	93968379	93968379	+	Intron	DEL	T	-	-	rs35259505		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93968379delT	uc001tcw.1	+						uc001tcv.1_5'Flank|uc001tcu.2_5'Flank|SOCS2_uc001tcx.1_Intron|SOCS2_uc009zsu.2_3'UTR|SOCS2_uc001tcy.1_Intron|SOCS2_uc001tcz.2_3'UTR	NM_003877	NP_003868	O14508	SOCS2_HUMAN	suppressor of cytokine signaling-2						anti-apoptosis|growth hormone receptor signaling pathway|JAK-STAT cascade|negative regulation of signal transduction|regulation of cell growth|response to estradiol stimulus	cytoplasm	growth hormone receptor binding|insulin-like growth factor receptor binding|JAK pathway signal transduction adaptor activity|prolactin receptor binding|SH3/SH2 adaptor activity			lung(1)	1						ACACACCACCTTTTTTTTTTT	0.328													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127562422	127562425	+	IGR	DEL	TTTC	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127562422_127562425delTTTC								LOC100128554 (605092 upstream) : None (None downstream)																							cttcctttcttttctttctttctc	0.025													3	3	---	---	---	---	
KIAA0564	23078	broad.mit.edu	37	13	42465337	42465338	+	Intron	INS	-	A	A	rs11422492		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42465337_42465338insA	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		ttagactgaccaaaaaaaaaaa	0.144													5	4	---	---	---	---	
HOMEZ	57594	broad.mit.edu	37	14	23764732	23764733	+	Intron	INS	-	A	A			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23764732_23764733insA	uc001wjb.2	-							NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ACTTCATTCTTAAAAAAAAAAA	0.406													4	2	---	---	---	---	
FOXG1	2290	broad.mit.edu	37	14	29238048	29238048	+	3'UTR	DEL	C	-	-	rs71805792		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29238048delC	uc001wqe.2	+	1						NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1						axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		TTTTATTAAGCCCCCCCCTCC	0.388													20	7	---	---	---	---	
C14orf28	122525	broad.mit.edu	37	14	45372705	45372706	+	Intron	INS	-	C	C	rs34247817		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45372705_45372706insC	uc001wvo.2	+						C14orf28_uc001wvp.1_Intron	NM_001017923	NP_001017923	Q4W4Y0	CN028_HUMAN	hypothetical protein LOC122525											ovary(1)	1						TTTTCTTTTTTCCCCCCCCACT	0.371													3	3	---	---	---	---	
MAP2K5	5607	broad.mit.edu	37	15	67923206	67923207	+	Intron	INS	-	T	T			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67923206_67923207insT	uc002aqu.2	+						MAP2K5_uc002aqt.1_Intron|MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						AAATGATTTTGTTTTTTTTTCT	0.342													135	7	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15702138	15702141	+	Intron	DEL	AAAC	-	-	rs79940556		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15702138_15702141delAAAC	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						aaaaaaaaaaaaaCATTTACCTTC	0.353													127	7	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74499447	74499449	+	Intron	DEL	TGC	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74499447_74499449delTGC	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						tcccagggggtgctgctgctgct	0.143													71	7	---	---	---	---	
SPOP	8405	broad.mit.edu	37	17	47696765	47696765	+	Intron	DEL	A	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47696765delA	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						AAACAGATAGAAAAAAAAAAT	0.378										Prostate(2;0.17)			79	8	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2418252	2418253	+	Intron	INS	-	CTTCCCTCCTGTTT	CTTCCCTCCTGTTT	rs145501466	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418252_2418253insCTTCCCTCCTGTTT	uc010xgx.1	+							NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttccccccctccttccctcctt	0.183													18	9	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													3	4	---	---	---	---	
RAB3A	5864	broad.mit.edu	37	19	18308684	18308685	+	Intron	DEL	TT	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18308684_18308685delTT	uc002nie.2	-							NM_002866	NP_002857	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family						glutamate secretion|protein transport|small GTPase mediated signal transduction	clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|plasma membrane|synaptic vesicle	GTP binding|GTPase activity				0						CATTTCCTGCTTTttttttttt	0.144													4	2	---	---	---	---	
LIG1	3978	broad.mit.edu	37	19	48636047	48636048	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48636047_48636048insAAAAAAAAAAA	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	gactctgtctcaaaaaaaaaaa	0.218								NER					14	7	---	---	---	---	
ISOC2	79763	broad.mit.edu	37	19	55966141	55966142	+	Intron	INS	-	C	C	rs150445230	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55966141_55966142insC	uc002qlb.2	-						ISOC2_uc002qla.2_Intron|ISOC2_uc002qlc.2_Intron	NM_001136201	NP_001129673	Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2 isoform 1						protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		cctctggattgcctcccccatt	0.153											OREG0025682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													7	4	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074724	62074726	+	Intron	DEL	CAC	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074724_62074726delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	tcaccatcatcaccaccatcatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19618654	19618654	+	IGR	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19618654delT								LOC150185 (64292 upstream) : SEPT5 (83333 downstream)																							AGTCCATCCCttttttttttt	0.204													20	7	---	---	---	---	
ASCC2	84164	broad.mit.edu	37	22	30218612	30218612	+	Intron	DEL	T	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30218612delT	uc003agr.2	-						ASCC2_uc003ags.2_Intron|ASCC2_uc003agt.2_Intron|ASCC2_uc011akr.1_Intron	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			CCCCCCGCCCTTTTTTTTTTT	0.373													9	4	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37469387	37469390	+	Intron	DEL	GATG	-	-	rs111916270		TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37469387_37469390delGATG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GAGACCAGAAgatggatggatgga	0.162													3	3	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42180891	42180892	+	Intron	INS	-	TGAG	TGAG	rs141083399	by1000genomes	TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42180891_42180892insTGAG	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_Intron|MEI1_uc003bbb.1_Intron|MEI1_uc003bbc.1_Intron|MEI1_uc010gym.1_Intron|MEI1_uc003bbd.1_Intron|MEI1_uc010gyn.1_Intron|MEI1_uc003bbe.1_Intron|MEI1_uc011apf.1_Intron|MEI1_uc010gyo.1_Intron|MEI1_uc003bbf.2_Intron|MEI1_uc003bbg.2_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						GGAGGGTGGATTAAGACTTTTT	0.317													2	4	---	---	---	---	
REPS2	9185	broad.mit.edu	37	X	17086437	17086437	+	Intron	DEL	A	-	-			TCGA-EJ-5517-01	TCGA-EJ-5517-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17086437delA	uc004cxv.1	+						REPS2_uc004cxw.1_Intron|REPS2_uc011miw.1_Intron	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					actctgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
