Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	981931	981931	+	Silent	SNP	A	G	G	rs2465128	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:981931A>G	uc001ack.1	+	18	3116	c.3066A>G	c.(3064-3066)TCA>TCG	p.S1022S		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	1022	Ser/Thr-rich.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CGCCCTCATCACGACCTCGGA	0.746													3	29	---	---	---	---	PASS
C1orf174	339448	broad.mit.edu	37	1	3807511	3807511	+	Silent	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3807511G>A	uc001alf.2	-	3	347	c.240C>T	c.(238-240)AGC>AGT	p.S80S	C1orf174_uc009vls.2_RNA	NM_207356	NP_997239	Q8IYL3	CA174_HUMAN	hypothetical protein LOC339448	80											0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		GCAAAGAAGCGCTGTCATTCT	0.498													71	144	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	17949669	17949669	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17949669C>T	uc001ban.2	+	12	1358	c.1199C>T	c.(1198-1200)TCG>TTG	p.S400L	ARHGEF10L_uc009vpe.1_Missense_Mutation_p.S361L|ARHGEF10L_uc001bao.2_Missense_Mutation_p.S361L|ARHGEF10L_uc001bap.2_Missense_Mutation_p.S361L|ARHGEF10L_uc010ocr.1_Missense_Mutation_p.S158L|ARHGEF10L_uc001baq.2_Missense_Mutation_p.S166L|ARHGEF10L_uc010ocs.1_Missense_Mutation_p.S178L|ARHGEF10L_uc001bar.2_Missense_Mutation_p.S178L|ARHGEF10L_uc009vpf.2_5'Flank	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	400	DH.				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		TTCGTGGCCTCGGTAAGTGTC	0.602													30	71	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86916415	86916415	+	Silent	SNP	C	T	T	rs140158852		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86916415C>T	uc001dlr.3	+	12	2316	c.2154C>T	c.(2152-2154)AAC>AAT	p.N718N		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	718	Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ACACAGCAAACGGTAAGAACC	0.448													31	203	---	---	---	---	PASS
HMGCS2	3158	broad.mit.edu	37	1	120302609	120302609	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120302609C>T	uc001eid.2	-	3	614	c.563G>A	c.(562-564)CGT>CAT	p.R188H	HMGCS2_uc010oxj.1_Intron|HMGCS2_uc001eie.2_Missense_Mutation_p.R96H	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	188					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CATGGCATAACGACCTGTAAA	0.378													26	72	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145304616	145304616	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145304616C>T	uc001end.3	+	10	1584	c.1549C>T	c.(1549-1551)CAT>TAT	p.H517Y	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Missense_Mutation_p.H448Y|NBPF9_uc010oyg.1_Missense_Mutation_p.H482Y|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Missense_Mutation_p.H56Y|NBPF10_uc001emq.1_Missense_Mutation_p.H246Y	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTCATCCTCTCATGTTGAATG	0.433													12	410	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151105861	151105861	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151105861C>T	uc001ewu.2	-	19	2192	c.1892G>A	c.(1891-1893)CGC>CAC	p.R631H	SEMA6C_uc001ewv.2_Missense_Mutation_p.R663H|SEMA6C_uc001eww.2_Missense_Mutation_p.R623H|SEMA6C_uc010pcq.1_Intron	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	631	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCGGTGGGCGCGGCGACAAGC	0.716													3	24	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185880818	185880818	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185880818A>C	uc001grq.1	+	6	1035	c.806A>C	c.(805-807)AAA>ACA	p.K269T		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	269					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAGCTGATAAAAAAGGGATTT	0.393													24	389	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72359460	72359460	+	Missense_Mutation	SNP	C	T	T	rs148075682		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72359460C>T	uc002sih.1	-	6	1435	c.1435G>A	c.(1435-1437)GTC>ATC	p.V479I	CYP26B1_uc010yra.1_Missense_Mutation_p.V462I|CYP26B1_uc010yrb.1_Missense_Mutation_p.V404I	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	479			V -> I.		cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						GGGTGCAGGACGGGGACCAAG	0.642													3	27	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125660643	125660643	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125660643T>A	uc002tno.2	+	22	3982	c.3618T>A	c.(3616-3618)GAT>GAA	p.D1206E	CNTNAP5_uc010flu.2_Missense_Mutation_p.D1207E	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1206	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGACTCAGATGTGAATGCAG	0.532													15	15	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160706545	160706545	+	Silent	SNP	C	T	T	rs114924959	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160706545C>T	uc002ubc.3	-	23	3165	c.3096G>A	c.(3094-3096)ACG>ACA	p.T1032T	LY75_uc002ubb.3_Silent_p.T1032T|LY75_uc010fos.2_Silent_p.T1032T	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1032	Extracellular (Potential).|C-type lectin 6.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		AGTTACTGTACGTCAGCTCTC	0.383													20	274	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211421556	211421556	+	Silent	SNP	A	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211421556A>G	uc002vee.3	+	1	231	c.99A>G	c.(97-99)AGA>AGG	p.R33R	CPS1_uc010fur.2_Silent_p.R39R	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	33					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		AATTTTCAAGACCTGGCATCA	0.403													13	235	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215914419	215914419	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215914419G>T	uc002vew.2	-	6	844	c.624C>A	c.(622-624)AAC>AAA	p.N208K	ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	208					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGCAAAATTTGTTAAAAACAT	0.383													28	103	---	---	---	---	PASS
PDCD1	5133	broad.mit.edu	37	2	242794944	242794944	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242794944G>T	uc002wcq.3	-	2	333	c.265C>A	c.(265-267)CCC>ACC	p.P89T	PDCD1_uc010fzs.2_Missense_Mutation_p.P20T|PDCD1_uc010fzt.2_Intron	NM_005018	NP_005009	Q15116	PDCD1_HUMAN	programmed cell death 1 precursor	89	Ig-like V-type.|Extracellular (Potential).				apoptosis|humoral immune response|multicellular organismal development|T cell costimulation	integral to membrane	protein tyrosine phosphatase activity|signal transducer activity			ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		TCCTGGCCGGGCTGGCTGCGG	0.642													7	38	---	---	---	---	PASS
CAV3	859	broad.mit.edu	37	3	8787220	8787220	+	Silent	SNP	T	C	C	rs13087941	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8787220T>C	uc003bra.2	+	2	190	c.123T>C	c.(121-123)TTT>TTC	p.F41F	C3orf32_uc003bqz.2_5'Flank|CAV3_uc003brb.2_Silent_p.F41F	NM_001234	NP_001225	P56539	CAV3_HUMAN	caveolin 3	41	Cytoplasmic (Potential).				cell growth|elevation of cytosolic calcium ion concentration|muscle organ development|negative regulation of cardiac muscle hypertrophy|negative regulation of cell size|negative regulation of MAP kinase activity|negative regulation of sarcomere organization|positive regulation of microtubule polymerization|regulation of skeletal muscle contraction|regulation of ventricular cardiomyocyte membrane repolarization|T-tubule organization	caveola|dystrophin-associated glycoprotein complex|Golgi membrane|neuromuscular junction|T-tubule	protein C-terminus binding|protein complex binding|protein complex scaffold|sodium channel regulator activity			lung(1)|breast(1)	2						AGGTGGATTTTGAAGACGTGA	0.507													4	51	---	---	---	---	PASS
ULK4	54986	broad.mit.edu	37	3	41996136	41996136	+	Missense_Mutation	SNP	T	C	C	rs2272007	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41996136T>C	uc003ckv.3	-	2	317	c.116A>G	c.(115-117)AAA>AGA	p.K39R	ULK4_uc003ckw.2_Missense_Mutation_p.K39R|ULK4_uc003ckx.1_Missense_Mutation_p.K39R	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	39	Protein kinase.						ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TTCAGGCCTTTTGCACTTATC	0.433													11	349	---	---	---	---	PASS
ARGFX	503582	broad.mit.edu	37	3	121303769	121303769	+	Missense_Mutation	SNP	C	T	T	rs149102809		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121303769C>T	uc003eef.2	+	4	321	c.226C>T	c.(226-228)CGG>TGG	p.R76W		NM_001012659	NP_001012677	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	76						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(114;0.152)		TGAAGCAATACGGAGAAGGCA	0.423													111	338	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	131082221	131082221	+	Intron	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131082221C>T	uc003eoc.1	-						NUDT16P1_uc003eod.2_RNA|NUDT16P1_uc003eoe.2_RNA					Homo sapiens hypothetical LOC339874, mRNA (cDNA clone IMAGE:5271589).																		GGTGTGAGTGCCCCTGTACCC	0.542													3	53	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197401767	197401767	+	3'UTR	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197401767G>A	uc003fyc.2	-	20					KIAA0226_uc003fyd.3_3'UTR|MIR922_hsa-mir-922|MI0005714_5'Flank	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.						autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		aaaaaaaaaagatgatgataa	0.428													3	5	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3138037	3138037	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3138037G>A	uc011bvq.1	+	22	2933	c.2788G>A	c.(2788-2790)GCA>ACA	p.A930T		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	928	HEAT 5.				establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACATGTTGCCGCAGCATCACT	0.378													5	105	---	---	---	---	PASS
HPSE	10855	broad.mit.edu	37	4	84230619	84230619	+	Missense_Mutation	SNP	T	C	C	rs11099592	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84230619T>C	uc003hoj.3	-	7	1019	c.920A>G	c.(919-921)AAG>AGG	p.K307R	HPSE_uc010ika.2_Missense_Mutation_p.K249R|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.K50R|HPSE_uc011cct.1_Missense_Mutation_p.K307R|HPSE_uc003hok.3_Missense_Mutation_p.K307R	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	307				K -> R (in Ref. 1; AAD45669, 2; AAD54941, 3; AAD41342, 4; AAD45379, 5; AAD54516, 8; AAX47106, 9; BAD96706 and 11; AAH51321).	carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	AAAATCTTCCTTGGTAGCAGT	0.294													5	135	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85719250	85719250	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85719250C>T	uc003hpd.2	-	18	3242	c.2834G>A	c.(2833-2835)CGT>CAT	p.R945H		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	945						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ACTTGCCAAACGTAAAAACTC	0.313													60	145	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483619	19483619	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483619C>T	uc003jgc.2	-	11	2050	c.1673G>A	c.(1672-1674)CGA>CAA	p.R558Q	CDH18_uc003jgd.2_Missense_Mutation_p.R558Q|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	558	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTGAACAGTTCGACTAAATCT	0.458													20	81	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140182101	140182101	+	Missense_Mutation	SNP	G	T	T	rs7701755	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140182101G>T	uc003lhf.2	+	1	1319	c.1319G>T	c.(1318-1320)AGC>ATC	p.S440I	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.S440I	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	440	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCACGGCCAGCGTGTCCGTG	0.662													6	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	29231318	29231318	+	IGR	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29231318G>A								OR2J2 (88968 upstream) : OR14J1 (43149 downstream)																							GACCATTGCAGATATTTCACA	0.338													48	118	---	---	---	---	PASS
MICB	4277	broad.mit.edu	37	6	31477560	31477560	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31477560G>T	uc003ntn.3	+	6	1142	c.1026G>T	c.(1024-1026)GAG>GAT	p.E342D	MICB_uc011dnm.1_Missense_Mutation_p.E310D|MICB_uc003nto.3_Missense_Mutation_p.E299D	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	342	Cytoplasmic (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						CTTCTCCAGAGCTTGTGAGCC	0.522													30	136	---	---	---	---	PASS
TEAD3	7005	broad.mit.edu	37	6	35444194	35444194	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35444194G>A	uc003oku.3	-	9	847	c.611C>T	c.(610-612)CCG>CTG	p.P204L	TEAD3_uc003okt.2_Missense_Mutation_p.P93L|TEAD3_uc010jvx.2_Missense_Mutation_p.P144L	NM_003214	NP_003205	Q99594	TEAD3_HUMAN	TEA domain family member 3	204	Pro-rich.|Transcriptional activation (Potential).				female pregnancy|hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGAGGGGAGCGGGGCCAGGGG	0.607													12	164	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38781866	38781866	+	Silent	SNP	C	G	G	rs1678690	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38781866C>G	uc003ooe.1	+	23	3243	c.2643C>G	c.(2641-2643)TCC>TCG	p.S881S		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ATATTATTTCCTTTATAAAAA	0.313													9	357	---	---	---	---	PASS
POLH	5429	broad.mit.edu	37	6	43554942	43554942	+	Intron	SNP	A	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43554942A>G	uc003ovq.3	+						POLH_uc010jyu.2_Intron|POLH_uc011dvl.1_Intron|POLH_uc003ovr.3_5'UTR	NM_006502	NP_006493	Q9Y253	POLH_HUMAN	DNA-directed DNA polymerase eta						DNA replication|DNA synthesis involved in DNA repair|regulation of DNA repair|response to UV-C	cytoplasm|nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			breast(2)	2	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GCAGGGTGGGAGTGGAGCAGA	0.373								DNA_polymerases_(catalytic_subunits)	Xeroderma_Pigmentosum				6	34	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54735357	54735357	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54735357G>A	uc003pck.2	+	2	429	c.313G>A	c.(313-315)GAC>AAC	p.D105N		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	105										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TCCAAATCTTGACTTAGGCTG	0.463													114	216	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	56035897	56035897	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56035897C>A	uc003pcs.2	-	4	902	c.670G>T	c.(670-672)GCA>TCA	p.A224S	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.A224S|COL21A1_uc003pcu.1_Missense_Mutation_p.A224S	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	224					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TCACGAGCTGCCACTGGAATT	0.318													36	92	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1522175	1522175	+	Intron	SNP	A	G	G	rs10224038	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1522175A>G	uc003skn.2	-						INTS1_uc003skp.1_3'UTR	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCCAGCCTGGACCGTACCGGC	0.672													3	55	---	---	---	---	PASS
TTYH3	80727	broad.mit.edu	37	7	2698620	2698620	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2698620C>G	uc003smp.2	+	13	1658	c.1471C>G	c.(1471-1473)CTC>GTC	p.L491V	TTYH3_uc010ksn.2_Missense_Mutation_p.L211V|TTYH3_uc003smq.2_Missense_Mutation_p.L320V	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN	tweety 3	491	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		GAACACCCCACTCATTGGGCG	0.647													16	175	---	---	---	---	PASS
RASA4	10156	broad.mit.edu	37	7	102257011	102257011	+	Intron	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102257011C>A	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc010lig.2_5'UTR|RASA4_uc003vaf.2_Intron|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_Intron|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						AAAGGTCAGGCGTCCTGGGGG	0.677													5	9	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149522366	149522366	+	Intron	SNP	T	G	G	rs2074697	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149522366T>G	uc010lpk.2	+						SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTCGTCAGGTTAGAGCTGCGA	0.617													6	102	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151845693	151845693	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151845693T>C	uc003wla.2	-	52	13538	c.13319A>G	c.(13318-13320)TAT>TGT	p.Y4440C	MLL3_uc003wkz.2_Missense_Mutation_p.Y3558C|MLL3_uc003wkx.2_Missense_Mutation_p.Y598C|MLL3_uc003wky.2_Missense_Mutation_p.Y2004C	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4440					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CTGAGTCTCATAGACCTCCGT	0.507			N		medulloblastoma								70	195	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10464755	10464755	+	Missense_Mutation	SNP	C	T	T	rs55642448	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10464755C>T	uc003wtc.2	-	4	7082	c.6853G>A	c.(6853-6855)GGA>AGA	p.G2285R		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2285					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GGAGTGTCTCCACCTGGGGAA	0.597													10	349	---	---	---	---	PASS
BMP1	649	broad.mit.edu	37	8	22058722	22058722	+	Intron	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22058722G>T	uc003xbg.2	+						BMP1_uc003xba.2_3'UTR|BMP1_uc003xbb.2_3'UTR|BMP1_uc003xbe.2_RNA|BMP1_uc003xbc.2_3'UTR|BMP1_uc003xbd.2_RNA|BMP1_uc003xbf.2_3'UTR|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_RNA|BMP1_uc003xbi.2_RNA	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		AGTGAGGCCTGCCAGGCCTCC	0.627													45	150	---	---	---	---	PASS
TACC1	6867	broad.mit.edu	37	8	38705654	38705654	+	3'UTR	SNP	A	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38705654A>T	uc010lwp.2	+	13					TACC1_uc003xma.2_3'UTR|TACC1_uc003xlz.2_3'UTR|TACC1_uc003xmc.3_3'UTR|TACC1_uc011lbz.1_3'UTR|TACC1_uc003xmb.3_3'UTR|TACC1_uc003xmf.3_3'UTR|TACC1_uc011lca.1_3'UTR|TACC1_uc011lcb.1_3'UTR|TACC1_uc011lcd.1_RNA|TACC1_uc003xmh.3_3'UTR|TACC1_uc010lwq.2_3'UTR	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			AAAAAAACTTAAAAAAAGCAC	0.448													3	16	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134488007	134488007	+	Silent	SNP	G	A	A	rs2230542	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134488007G>A	uc003yuk.2	-	5	1090	c.261C>T	c.(259-261)ACC>ACT	p.T87T	ST3GAL1_uc003yum.2_Silent_p.T87T	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	87	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			CGTTCTGGGCGGTCAGCAGCG	0.498													3	49	---	---	---	---	PASS
C9orf100	84904	broad.mit.edu	37	9	35662634	35662634	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35662634G>T	uc003zxm.1	-	7	890	c.778C>A	c.(778-780)CCT>ACT	p.P260T	C9orf100_uc003zxl.2_RNA	NM_032818	NP_116207	Q8N4T4	CI100_HUMAN	hypothetical protein LOC84904	260	PH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGAGGCCGAGGCTTGGCCATG	0.632													21	23	---	---	---	---	PASS
C9orf100	84904	broad.mit.edu	37	9	35662635	35662635	+	Silent	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35662635C>T	uc003zxm.1	-	7	889	c.777G>A	c.(775-777)AAG>AAA	p.K259K	C9orf100_uc003zxl.2_RNA	NM_032818	NP_116207	Q8N4T4	CI100_HUMAN	hypothetical protein LOC84904	259	PH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGGCCGAGGCTTGGCCATGA	0.632													20	23	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73442724	73442724	+	Intron	SNP	C	T	T	rs1034538	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73442724C>T	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aie.2_Intron|TRPM3_uc004aif.2_Intron|TRPM3_uc004aig.2_Intron|TRPM3_uc004aii.2_3'UTR	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TTCAGCATACCTCCTACGAGC	0.408													10	203	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94486051	94486051	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94486051C>T	uc004arj.1	-	9	2924	c.2725G>A	c.(2725-2727)GTG>ATG	p.V909M	ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	909	Cytoplasmic (Potential).				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GCTTCCTGCACGGTGCTCTGG	0.637													39	185	---	---	---	---	PASS
TTLL11	158135	broad.mit.edu	37	9	124752018	124752018	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124752018C>A	uc004blt.1	-	4	1183	c.995G>T	c.(994-996)TGG>TTG	p.W332L	TTLL11_uc011lyl.1_Missense_Mutation_p.W332L|TTLL11_uc004blr.2_RNA|TTLL11_uc011lym.1_Missense_Mutation_p.W9L|TTLL11_uc004blu.1_3'UTR	NM_194252	NP_919228	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	332	TTL.				protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						AGTGGGCTTCCAGGAGGGGTC	0.388													66	240	---	---	---	---	PASS
C10orf107	219621	broad.mit.edu	37	10	63520698	63520698	+	Silent	SNP	T	C	C	rs1992625	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63520698T>C	uc010qik.1	+	6	794	c.489T>C	c.(487-489)TTT>TTC	p.F163F		NM_173554	NP_775825	Q8IVU9	CJ107_HUMAN	hypothetical protein LOC219621	163											0	Prostate(12;0.016)					TAGTTGGTTTTACCATTGAAG	0.388													5	146	---	---	---	---	PASS
TMEM180	79847	broad.mit.edu	37	10	104235832	104235832	+	3'UTR	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104235832G>T	uc001kvt.2	+	10					TMEM180_uc010qql.1_3'UTR|TMEM180_uc010qqm.1_Intron	NM_024789	NP_079065	Q14CX5	TM180_HUMAN	transmembrane protein 180							integral to membrane				ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGATTTCATAGtttttttttt	0.244													3	8	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129900972	129900972	+	Silent	SNP	G	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129900972G>C	uc001lke.2	-	13	9327	c.9132C>G	c.(9130-9132)CCC>CCG	p.P3044P	MKI67_uc001lkf.2_Silent_p.P2684P|MKI67_uc009yav.1_Silent_p.P2619P|MKI67_uc009yaw.1_Silent_p.P2194P	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	3044					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGATGACCACGGGTTCGGATG	0.517													10	296	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57983162	57983162	+	Missense_Mutation	SNP	A	G	G	rs7103026	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57983162A>G	uc010rkc.1	+	1	946	c.946A>G	c.(946-948)AAG>GAG	p.K316E		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	316	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				TGCCCTGAGAAAGCTCATCAA	0.423													11	424	---	---	---	---	PASS
SSSCA1	10534	broad.mit.edu	37	11	65339161	65339161	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65339161G>A	uc001oek.2	+	4	576	c.556G>A	c.(556-558)GCA>ACA	p.A186T	FAM89B_uc001oen.2_5'Flank|FAM89B_uc001oem.2_5'Flank|FAM89B_uc001oel.2_5'Flank	NM_006396	NP_006387	O60232	SSA27_HUMAN	Sjogren syndrome/scleroderma autoantigen 1	186					cell division|mitosis		protein binding			ovary(1)|skin(1)	2						CCTTATCCGCGCATGTGCGGA	0.572													3	48	---	---	---	---	PASS
WNT11	7481	broad.mit.edu	37	11	75907610	75907610	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75907610G>T	uc001oxe.2	-	2	359	c.236C>A	c.(235-237)GCC>GAC	p.A79D	WNT11_uc001oxf.1_Missense_Mutation_p.A79D	NM_004626	NP_004617	O96014	WNT11_HUMAN	wingless-type MMTV integration site family,	79					adrenal gland development|anterior/posterior pattern formation|artery morphogenesis|axis specification|bone mineralization|cellular response to retinoic acid|cloacal septation|embryonic skeletal system development|endoderm development|lung-associated mesenchyme development|mesonephric duct development|negative regulation of apoptosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell migration|negative regulation of transcription, DNA-dependent|neuroendocrine cell differentiation|neuron differentiation|osteoblast differentiation|outflow tract morphogenesis|palate development|positive regulation of cell migration|positive regulation of protein kinase C signaling cascade|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor-beta2 production|protein localization at cell surface|protein phosphorylation|tight junction assembly|ureteric bud morphogenesis|ventricular septum morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|protein kinase activator activity|Ras GTPase activator activity|transcription regulatory region DNA binding			lung(1)|skin(1)	2						CCGGCGACAGGCCTTCATGAC	0.637													14	162	---	---	---	---	PASS
EED	8726	broad.mit.edu	37	11	85968564	85968564	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85968564T>G	uc001pbp.2	+	6	1017	c.560T>G	c.(559-561)GTT>GGT	p.V187G	EED_uc010rtm.1_Missense_Mutation_p.V187G|EED_uc001pbq.2_Missense_Mutation_p.V187G|EED_uc001pbr.2_Missense_Mutation_p.V187G|EED_uc001pbs.2_Missense_Mutation_p.V187G|EED_uc010rtn.1_RNA	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a	187	Interaction with EZH2 (By similarity).|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				TAGCACTATGTTGGCCATGGA	0.303													4	90	---	---	---	---	PASS
TMEM225	338661	broad.mit.edu	37	11	123756180	123756180	+	5'UTR	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123756180C>A	uc001pzi.2	-	1						NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225							integral to membrane				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						TTTTGTAGATCTCTTCCTTGA	0.388													15	59	---	---	---	---	PASS
GLB1L3	112937	broad.mit.edu	37	11	134158745	134158745	+	Silent	SNP	A	G	G	rs3824995	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134158745A>G	uc009zdf.2	+	7	1050	c.690A>G	c.(688-690)TCA>TCG	p.S230S	GLB1L3_uc010scs.1_Silent_p.S230S|GLB1L3_uc010sct.1_Silent_p.S82S	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3	230					carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		AGTATGGCTCATTCAATAAGG	0.502													3	37	---	---	---	---	PASS
C12orf77	196415	broad.mit.edu	37	12	25148935	25148935	+	Silent	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25148935C>T	uc001rgf.2	-	3	418	c.213G>A	c.(211-213)ACG>ACA	p.T71T		NM_001101339	NP_001094809	C9JDV5	CL097_HUMAN	hypothetical protein LOC196415	71											0						TGCTGTCCAGCGTCTGCACGT	0.478													29	55	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242218	31242218	+	Intron	SNP	A	G	G	rs4081648		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242218A>G	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCCCTCCCTGACCTGGCCGGC	0.597										Multiple Myeloma(12;0.14)			4	24	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32975445	32975445	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32975445T>C	uc001rlj.3	-	9	2042	c.1927A>G	c.(1927-1929)AAA>GAA	p.K643E	PKP2_uc001rlk.3_Missense_Mutation_p.K599E|PKP2_uc010skj.1_Missense_Mutation_p.K599E	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	643					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCAATACTTTTGTTGTTGTCA	0.403													11	125	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124395093	124395093	+	Silent	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124395093G>A	uc001uft.3	+	58	9679	c.9654G>A	c.(9652-9654)AAG>AAA	p.K3218K		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3218	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCCTCTTGAAGACTCTTAATA	0.388													12	219	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76409436	76409436	+	Silent	SNP	A	G	G	rs2273997	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76409436A>G	uc001vjv.2	+	15	3355	c.2595A>G	c.(2593-2595)CTA>CTG	p.L865L	LMO7_uc010thv.1_Silent_p.L816L|LMO7_uc001vjt.1_Silent_p.L764L|LMO7_uc010thw.1_Silent_p.L742L|LMO7_uc001vjw.1_Silent_p.L771L	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	1150						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CTTCAAATCTATCTGTAACAA	0.378													5	121	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96506664	96506664	+	Silent	SNP	A	G	G	rs11070154	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96506664A>G	uc001vmt.2	-	35	4244	c.4074T>C	c.(4072-4074)ACT>ACC	p.T1358T	UGGT2_uc001vms.2_Silent_p.T78T	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1358	Glucosyltransferase.				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						CACAAAATGGAGTATACCCAT	0.383													5	130	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22636784	22636784	+	Intron	SNP	A	C	C	rs11157435	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22636784A>C	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdi.2_Missense_Mutation_p.E79D					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AGGGTCATGAAAAAATATCTG	0.458													4	107	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51223295	51223295	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51223295C>T	uc001wym.2	-	18	4644	c.4453G>A	c.(4453-4455)GGA>AGA	p.G1485R	NIN_uc001wyi.2_Missense_Mutation_p.G1485R|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Missense_Mutation_p.G1491R|NIN_uc001wyo.2_Missense_Mutation_p.G1485R	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1485	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					tccttttctccgtgagaaagt	0.169			T	PDGFRB	MPD								4	59	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70634187	70634187	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70634187C>T	uc001xly.2	-	2	1707	c.953G>A	c.(952-954)CGG>CAG	p.R318Q	SLC8A3_uc001xlw.2_Missense_Mutation_p.R318Q|SLC8A3_uc001xlx.2_Missense_Mutation_p.R318Q|SLC8A3_uc001xlz.2_Missense_Mutation_p.R318Q|SLC8A3_uc010ara.2_RNA	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	318	Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CTTGAGAATCCGGATCATCTC	0.483													6	170	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	103707988	103707988	+	RNA	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103707988G>A	uc001ymo.1	+	1		c.192G>A								full-length cDNA clone CS0DE012YF10 of Placenta of Homo sapiens (human).																		AGGAAGCCCCGCAAGTGTCAC	0.458													3	36	---	---	---	---	PASS
ASPG	374569	broad.mit.edu	37	14	104552115	104552115	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104552115G>A	uc001yoq.1	+	1	68	c.8G>A	c.(7-9)CGC>CAC	p.R3H	ASPG_uc001yoo.1_5'UTR|ASPG_uc001yop.1_Missense_Mutation_p.R3H|ASPG_uc001yor.1_Missense_Mutation_p.R3H	NM_001080464	NP_001073933	Q86U10	LPP60_HUMAN	60 kDa lysophospholipase	3					lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0						GGCATGGCGCGCGCGGTGGGG	0.761													4	2	---	---	---	---	PASS
EXD1	161829	broad.mit.edu	37	15	41483682	41483682	+	Silent	SNP	A	G	G	rs1971131	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41483682A>G	uc001znk.2	-	8	839	c.648T>C	c.(646-648)CCT>CCC	p.P216P	EXD1_uc001znj.2_5'Flank|EXD1_uc010ucv.1_Silent_p.P274P	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	216					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						AGAGATATTTAGGGGCTACTT	0.383													5	144	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41860444	41860444	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41860444G>A	uc001zof.1	+	8	1215	c.991G>A	c.(991-993)GCC>ACC	p.A331T		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	331	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AAACCTCCATGCCATCCGCAC	0.572													17	74	---	---	---	---	PASS
SMAD3	4088	broad.mit.edu	37	15	67477178	67477178	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67477178G>T	uc002aqj.2	+	7	1283	c.985G>T	c.(985-987)GCC>TCC	p.A329S	SMAD3_uc010ujr.1_Missense_Mutation_p.A224S|SMAD3_uc010ujs.1_Missense_Mutation_p.A285S|SMAD3_uc010ujt.1_Missense_Mutation_p.A134S	NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3	329	MH2.				activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CTGGCACCCGGCCACCGTCTG	0.597													7	36	---	---	---	---	PASS
AGPHD1	123688	broad.mit.edu	37	15	78825562	78825562	+	Silent	SNP	C	T	T	rs12906951	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78825562C>T	uc010unc.1	+	5	785	c.672C>T	c.(670-672)CAC>CAT	p.H224H	AGPHD1_uc010ble.2_Intron	NM_001013619	NP_001013641	A2RU49	AGPD1_HUMAN	aminoglycoside phosphotransferase domain	224						cytoplasm	kinase activity				0						GTATCAATCACGGAGATCTTA	0.353													4	107	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93524064	93524064	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93524064G>C	uc002bsp.2	+	23	3471	c.2896G>C	c.(2896-2898)GAA>CAA	p.E966Q	CHD2_uc002bso.1_Missense_Mutation_p.E966Q	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	966	Glu-rich.				regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TTTTAATAAAGAAGAGCTGAC	0.368													12	105	---	---	---	---	PASS
AMFR	267	broad.mit.edu	37	16	56396486	56396486	+	3'UTR	SNP	C	T	T	rs4924	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56396486C>T	uc002eiy.2	-	14					AMFR_uc002eiw.2_RNA|AMFR_uc002eix.2_3'UTR	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						GTGGGACGTACGCATGAGGCA	0.617													4	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161168	90161168	+	Intron	SNP	T	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161168T>G	uc002fqp.2	+						uc002fqq.2_Missense_Mutation_p.L133R					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CCTCCTGTCCTCCGAGTCGAG	0.622													4	1	---	---	---	---	PASS
MYH10	4628	broad.mit.edu	37	17	8416901	8416901	+	Silent	SNP	C	T	T	rs11374	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8416901C>T	uc002gll.2	-	21	2703	c.2607G>A	c.(2605-2607)ACG>ACA	p.T869T	MYH10_uc002glm.2_Silent_p.T900T|MYH10_uc010cnx.2_Silent_p.T878T	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	869	Potential.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						CTTCCACCTTCGTCTGCTTCT	0.507													8	276	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38792754	38792754	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792754T>C	uc002hux.2	-	6	386	c.262A>G	c.(262-264)AAC>GAC	p.N88D	SMARCE1_uc010wff.1_Missense_Mutation_p.N53D|SMARCE1_uc010wfg.1_Missense_Mutation_p.N18D|SMARCE1_uc002huy.2_Missense_Mutation_p.N53D|SMARCE1_uc010wfh.1_Missense_Mutation_p.N18D|SMARCE1_uc010wfi.1_Missense_Mutation_p.N70D|SMARCE1_uc002huz.1_Missense_Mutation_p.N53D|SMARCE1_uc010wfj.1_Missense_Mutation_p.N70D	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	88	HMG box.				chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				AGGTCAGGGTTGGAAGCCTTT	0.348													68	179	---	---	---	---	PASS
NAGS	162417	broad.mit.edu	37	17	42085837	42085837	+	Silent	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42085837C>T	uc002ies.2	+	7	1473	c.1473C>T	c.(1471-1473)GGC>GGT	p.G491G	NAGS_uc010czn.2_Silent_p.G499G|NAGS_uc002iet.2_Silent_p.G115G	NM_153006	NP_694551	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	491	N-acetyltransferase.				arginine biosynthetic process|urea cycle	mitochondrial matrix	acetyl-CoA:L-glutamate N-acetyltransferase activity				0		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)	L-Glutamic Acid(DB00142)	ACAGTGATGGCAGCTTCTCCA	0.498													27	320	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61864525	61864525	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61864525T>C	uc002jbu.2	+	3	373	c.116T>C	c.(115-117)TTT>TCT	p.F39S	DDX42_uc002jbv.2_Missense_Mutation_p.F39S	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein	39					protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						CACAGTGCCTTTGGGGCAACC	0.502													15	222	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73627745	73627745	+	Silent	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73627745G>A	uc010dgl.2	-	9	1389	c.1233C>T	c.(1231-1233)TGC>TGT	p.C411C	RECQL5_uc010dgk.2_Silent_p.C384C|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	411					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CGGCATGGCGGCACCTGGAGC	0.637								Other_identified_genes_with_known_or_suspected_DNA_repair_function					3	38	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21329443	21329443	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21329443T>G	uc002kuq.2	+	4	703	c.617T>G	c.(616-618)GTC>GGC	p.V206G	LAMA3_uc010dlv.1_Missense_Mutation_p.V206G|LAMA3_uc002kur.2_Missense_Mutation_p.V206G	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	206	Laminin N-terminal.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AATATGGCTGTCACCCGGGAT	0.333													13	21	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54591238	54591238	+	Silent	SNP	G	A	A	rs149456946	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54591238G>A	uc002lgk.1	+	22	3823	c.3612G>A	c.(3610-3612)CTG>CTA	p.L1204L	WDR7_uc002lgl.1_Silent_p.L1171L	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	1204										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		CCATTGATCTGATTGGACGTG	0.498													10	122	---	---	---	---	PASS
FECH	2235	broad.mit.edu	37	18	55221648	55221648	+	Silent	SNP	T	C	C	rs536560	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55221648T>C	uc002lgq.3	-	9	1038	c.921A>G	c.(919-921)CCA>CCG	p.P307P	FECH_uc002lgp.3_Silent_p.P313P|FECH_uc002lgr.3_Silent_p.P165P	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	307					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				ACCAGGGCATTGGACCAACCT	0.527													12	198	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72347482	72347482	+	Silent	SNP	T	C	C	rs12327359	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72347482T>C	uc002llw.2	+	1	4564	c.4507T>C	c.(4507-4509)TTA>CTA	p.L1503L	ZNF407_uc010xfc.1_Silent_p.L1503L|ZNF407_uc010dqu.1_Silent_p.L1503L|ZNF407_uc002llu.2_Silent_p.L1502L	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1503	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAATTTATTTTTACATATTAA	0.473													3	25	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056757	9056757	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056757G>T	uc002mkp.2	-	3	30893	c.30689C>A	c.(30688-30690)CCC>CAC	p.P10230H		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10232	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCATTAAAGGGGGTGATTAT	0.448													10	94	---	---	---	---	PASS
PGLYRP2	114770	broad.mit.edu	37	19	15586672	15586672	+	Missense_Mutation	SNP	A	T	T	rs892145	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15586672A>T	uc002nbf.3	-	2	942	c.809T>A	c.(808-810)ATG>AAG	p.M270K	PGLYRP2_uc002nbg.3_Missense_Mutation_p.M270K	NM_052890	NP_443122	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2 precursor	270					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3						GAGGAAGGCCATGGTTAACAG	0.612													4	99	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41386136	41386136	+	Missense_Mutation	SNP	A	C	C	rs4142867	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41386136A>C	uc002opm.2	-	4	1049	c.507T>G	c.(505-507)GAT>GAG	p.D169E	CYP2A7_uc002opo.2_Missense_Mutation_p.D169E|CYP2A7_uc002opn.2_Missense_Mutation_p.D118E	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,	169						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGAAGGTGGGATCGATATTGG	0.547													5	73	---	---	---	---	PASS
CEACAM20	125931	broad.mit.edu	37	19	45016116	45016116	+	Missense_Mutation	SNP	A	G	G	rs8100718	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45016116A>G	uc010ejn.1	-	10	1550	c.1534T>C	c.(1534-1536)TGC>CGC	p.C512R	CEACAM20_uc010ejo.1_Missense_Mutation_p.C512R|CEACAM20_uc010ejp.1_Missense_Mutation_p.C419R|CEACAM20_uc010ejq.1_Missense_Mutation_p.C419R	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	512	Cytoplasmic (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				GATATATTGCAATACTCAGGA	0.507													3	28	---	---	---	---	PASS
FPR1	2357	broad.mit.edu	37	19	52249334	52249334	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52249334C>A	uc002pxq.2	-	2	1009	c.914G>T	c.(913-915)GGC>GTC	p.G305V		NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	305	Helical; Name=7; (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)|lung(1)|skin(1)	3		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	GAAGTCCTGGCCCATGAAGAC	0.547													26	86	---	---	---	---	PASS
MX2	4600	broad.mit.edu	37	21	42762561	42762561	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42762561G>A	uc002yzf.1	+	6	906	c.802G>A	c.(802-804)GTG>ATG	p.V268M	MX2_uc011aer.1_Intron|MX2_uc002yzg.1_Translation_Start_Site	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	268					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TCCCTGTAACGTGGACATTGC	0.507													78	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846113	18846113	+	RNA	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846113C>T	uc002zoe.2	+	5		c.2475C>T			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		ATCTCCTCCACGCACTGGCGC	0.612													4	39	---	---	---	---	PASS
GGTLC2	91227	broad.mit.edu	37	22	22988849	22988849	+	Missense_Mutation	SNP	G	T	T	rs149057858	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22988849G>T	uc010gtt.2	+	1	68	c.34G>T	c.(34-36)GCC>TCC	p.A12S	LOC96610_uc011aim.1_Intron|POM121L1P_uc011ait.1_5'Flank|GGTLC2_uc010gts.2_Missense_Mutation_p.A12S	NM_199127	NP_954578	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase-like 4 isoform 1	12					glutathione biosynthetic process		gamma-glutamyltransferase activity			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		CCAGCTCCGGGCCCAGATCTC	0.632													3	25	---	---	---	---	PASS
GGTLC2	91227	broad.mit.edu	37	22	22988864	22988864	+	Missense_Mutation	SNP	G	C	C	rs143048497	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22988864G>C	uc010gtt.2	+	1	83	c.49G>C	c.(49-51)GAC>CAC	p.D17H	LOC96610_uc011aim.1_Intron|POM121L1P_uc011ait.1_5'Flank|GGTLC2_uc010gts.2_Missense_Mutation_p.D17H	NM_199127	NP_954578	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase-like 4 isoform 1	17					glutathione biosynthetic process		gamma-glutamyltransferase activity			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		GATCTCTGACGACACCACTCA	0.627													3	23	---	---	---	---	PASS
APOBEC3D	140564	broad.mit.edu	37	22	39428522	39428522	+	3'UTR	SNP	C	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39428522C>T	uc011aoe.1	+	7					APOBEC3D_uc011aof.1_3'UTR|APOBEC3D_uc003awu.3_3'UTR|APOBEC3D_uc003awt.3_3'UTR|APOBEC3D_uc010gxu.2_3'UTR	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					TCTCCATCCACCTCCCCAGTC	0.532													2	3	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42523943	42523943	+	Missense_Mutation	SNP	A	G	G	rs16947	byFrequency	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42523943A>G	uc003bce.2	-	6	976	c.886T>C	c.(886-888)TGC>CGC	p.C296R	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Intron|CYP2D6_uc003bcf.2_Missense_Mutation_p.C245R	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	296							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						ACCACTATGCACAGGTTCTCA	0.607													4	98	---	---	---	---	PASS
GAGE12J	729396	broad.mit.edu	37	X	49179755	49179755	+	Missense_Mutation	SNP	G	A	A	rs7064530	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49179755G>A	uc010nit.2	+	2	199	c.83G>A	c.(82-84)CGG>CAG	p.R28Q	GAGE12J_uc004dnl.3_Missense_Mutation_p.R28Q|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Missense_Mutation_p.R28Q	NM_001098406	NP_001091876	A6NER3	GG12J_HUMAN	G antigen 12J	28											0	Ovarian(276;0.236)					GGGCCTATGCGGGTGAGTGCT	0.403													4	7	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135431329	135431329	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135431329C>A	uc004ezu.1	+	6	5755	c.5464C>A	c.(5464-5466)CCA>ACA	p.P1822T	GPR112_uc010nsb.1_Missense_Mutation_p.P1617T|GPR112_uc010nsc.1_Missense_Mutation_p.P1589T	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1822	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TTCATACCCTCCATGGACCCC	0.408													15	143	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11080808	11080808	+	Intron	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11080808delA	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		attaaaatacaaaaaaaaaaa	0.000													6	5	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17299014	17299015	+	3'UTR	INS	-	C	C	rs6661019	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17299014_17299015insC	uc001azt.2	+	37					CROCC_uc001azu.2_3'UTR|CROCC_uc001azv.2_3'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGCCCCCCCACCCAGAGCCCG	0.673													6	3	---	---	---	---	
GPBP1L1	60313	broad.mit.edu	37	1	46105726	46105726	+	Intron	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46105726delA	uc001coq.2	-							NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					aaagaaaaagaaaaaaaaaaa	0.139													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116972907	116972908	+	IGR	INS	-	TTCT	TTCT	rs141121225	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116972907_116972908insTTCT								C1orf203 (11663 upstream) : CD58 (84249 downstream)																							tttctttctccttctttctttc	0.020													4	2	---	---	---	---	
SIX3	6496	broad.mit.edu	37	2	45169041	45169042	+	5'UTR	DEL	GT	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45169041_45169042delGT	uc002run.1	+	1						NM_005413	NP_005404	O95343	SIX3_HUMAN	SIX homeobox 3						visual perception	nucleus					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ggctgcgcgggtgtgtgtgtgt	0.218													4	2	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70070122	70070123	+	Intron	INS	-	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70070122_70070123insA	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						TTGGACTTGTTAAAAAAAAAAA	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112645773	112645774	+	IGR	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112645773_112645774insT								ANAPC1 (4032 upstream) : MERTK (10417 downstream)																							tttttttttagttttttttttt	0.183													4	4	---	---	---	---	
SPATS2L	26010	broad.mit.edu	37	2	201280997	201280997	+	Intron	DEL	A	-	-	rs67907833		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201280997delA	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						TGAAAAAGCCAAAAAAAAAAA	0.274													4	2	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11340707	11340710	+	Intron	DEL	ATAG	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11340707_11340710delATAG	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TCTATGTAGCATAGATAATCAGAA	0.353													30	8	---	---	---	---	
METTL6	131965	broad.mit.edu	37	3	15455865	15455865	+	Intron	DEL	T	-	-	rs72352627		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15455865delT	uc003bzs.1	-						METTL6_uc011avp.1_Intron|METTL6_uc010hen.1_5'Flank	NM_152396	NP_689609	Q8TCB7	METL6_HUMAN	methyltransferase like 6								methyltransferase activity				0						AAGACACttcttttttttttt	0.209													8	5	---	---	---	---	
CCDC66	285331	broad.mit.edu	37	3	56598292	56598292	+	Intron	DEL	A	-	-	rs11285260		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56598292delA	uc003dhz.2	+						CCDC66_uc003dhy.2_Intron|CCDC66_uc003dhu.2_Intron|CCDC66_uc003dhx.2_Intron|CCDC66_uc003dhv.2_Intron|CCDC66_uc003dhw.2_Intron	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1											breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TTGTTCTTTTAGAGGACTTTC	0.264													4	8	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115342811	115342811	+	Intron	DEL	T	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115342811delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		CTAGAAATAATTTTTTTTTTT	0.423													7	7	---	---	---	---	
BANK1	55024	broad.mit.edu	37	4	102681040	102681041	+	Intron	DEL	CA	-	-	rs70964185		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102681040_102681041delCA	uc003hvx.3	+							NM_001083907	NP_001077376	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		tgtgtgtgtgCACACGCACATG	0.396													4	2	---	---	---	---	
TMEM154	201799	broad.mit.edu	37	4	153573516	153573516	+	Intron	DEL	T	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153573516delT	uc003imw.1	-							NM_152680	NP_689893	Q6P9G4	TM154_HUMAN	transmembrane protein 154 precursor							integral to membrane					0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCAATTAAACTTTTTTTTTTT	0.129													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276462	3276462	+	IGR	DEL	G	-	-	rs140838536	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276462delG								C5orf38 (520950 upstream) : IRX1 (319706 downstream)																							ggaggaaggagggaggggagg	0.000													5	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5234982	5234983	+	Intron	INS	-	AGAA	AGAA	rs5865597		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5234982_5234983insAGAA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						gactccatctcaaaaaaaaaaa	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70422906	70422906	+	Intron	DEL	T	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70422906delT	uc010iyn.2	-											Homo sapiens cDNA FLJ78390 complete cds.																		ATTATCTGACttttttttttt	0.189													4	5	---	---	---	---	
ATP10B	23120	broad.mit.edu	37	5	160063990	160063991	+	Intron	INS	-	CCAC	CCAC	rs149045770		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160063990_160063991insCCAC	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron|ATP10B_uc003lyn.2_5'Flank|ATP10B_uc003lyo.2_Intron	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			aatccctccatccacccaccca	0.000													4	4	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176636530	176636530	+	Intron	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176636530delA	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		actctgtctcaaaaaaaaaaa	0.124			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	6	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237526	31237527	+	Intron	INS	-	A	A	rs150596066	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237526_31237527insA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						ATGCTGGAATCAGGACCCCAAC	0.515													6	3	---	---	---	---	
CFB	629	broad.mit.edu	37	6	31907287	31907287	+	Intron	DEL	C	-	-	rs78847027		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31907287delC	uc011dor.1	+						C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron|C2_uc003nyf.2_Intron|C2_uc010jtk.2_Intron|C2_uc011doq.1_Intron|C2_uc003nyg.2_Intron|C2_uc003nyh.1_Intron	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						ACCTTACCttctttttttttt	0.433													6	5	---	---	---	---	
RPS10	6204	broad.mit.edu	37	6	34389797	34389797	+	Intron	DEL	A	-	-	rs34411335		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34389797delA	uc003ojm.2	-						RPS10_uc003ojn.2_Intron	NM_001014	NP_001005	P46783	RS10_HUMAN	ribosomal protein S10						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding				0						TGCAAATCTGAAAAAAAAAAA	0.323													5	3	---	---	---	---	
ZNF318	24149	broad.mit.edu	37	6	43320425	43320428	+	Intron	DEL	TTGT	-	-	rs112135228		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43320425_43320428delTTGT	uc003oux.2	-						ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TCCAGAAAGGTTGTTTGTTTGTTT	0.387													2	4	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	81053717	81053719	+	Intron	DEL	TTG	-	-	rs142572622		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81053717_81053719delTTG	uc003pjd.2	+						BCKDHB_uc003pje.2_3'UTR	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		ATTTACAtttttgttgttgttgt	0.118													6	4	---	---	---	---	
TAGAP	117289	broad.mit.edu	37	6	159459425	159459426	+	Intron	INS	-	TT	TT			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159459425_159459426insTT	uc003qrz.2	-						TAGAP_uc011eft.1_Intron|TAGAP_uc003qsa.2_Intron	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN	T-cell activation Rho GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CAATCAGATACttttttttttt	0.203													4	2	---	---	---	---	
WIPI2	26100	broad.mit.edu	37	7	5269561	5269561	+	Intron	DEL	T	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5269561delT	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron|WIPI2_uc003soa.2_Intron|WIPI2_uc003sob.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		TTTCGTTTCCTTttttttttt	0.249													4	2	---	---	---	---	
SUN3	256979	broad.mit.edu	37	7	48047096	48047096	+	Intron	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48047096delA	uc003tof.2	-						SUN3_uc010kyq.2_Intron|SUN3_uc003tog.2_Intron|SUN3_uc011kcf.1_Intron	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						ACGCTTCACTAAAAAAAAAAC	0.483													4	2	---	---	---	---	
HBP1	26959	broad.mit.edu	37	7	106836195	106836196	+	Intron	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106836195_106836196insT	uc003vdy.2	+						HBP1_uc011klv.1_Intron|HBP1_uc003vdz.2_Intron|HBP1_uc003vea.2_Intron|HBP1_uc003veb.1_Intron	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1						cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						CAGATGTTTTCTTTTTTTTTTT	0.257													6	3	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139826263	139826263	+	Intron	DEL	A	-	-	rs79442932		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139826263delA	uc003vvm.2	-							NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					ATTTGAGATTAAAAAAAAAAA	0.284													5	4	---	---	---	---	
PABPC1	26986	broad.mit.edu	37	8	101716283	101716287	+	Intron	DEL	AAAAA	-	-	rs34116624		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101716283_101716287delAAAAA	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			actccatctcaaaaaaaaaaaaaaa	0.146													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69511231	69511232	+	IGR	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69511231_69511232insT								ANKRD20A4 (86123 upstream) : LOC100133920 (140129 downstream)																							GTGTTTTCATCTTTTTTTTTTT	0.535													6	3	---	---	---	---	
CENPP	401541	broad.mit.edu	37	9	95099602	95099602	+	Intron	DEL	A	-	-	rs78317101		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95099602delA	uc004arz.2	+						CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Intron	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						ctccttctggaaaaaaaaaaa	0.109													4	3	---	---	---	---	
RBM18	92400	broad.mit.edu	37	9	125010064	125010065	+	Intron	INS	-	T	T	rs34974193		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125010064_125010065insT	uc004bma.2	-						RBM18_uc004blz.2_Intron|RBM18_uc010mvy.2_Intron|RBM18_uc011lyp.1_Intron	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18								nucleotide binding|RNA binding				0						tttttttgttgttttttttttt	0.149													4	2	---	---	---	---	
PLAU	5328	broad.mit.edu	37	10	75673298	75673298	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75673298delA	uc001jwa.2	+	7	608	c.462delA	c.(460-462)GGAfs	p.G154fs	C10orf55_uc001jvz.1_Intron|PLAU_uc010qkw.1_Frame_Shift_Del_p.G137fs|PLAU_uc010qkx.1_Frame_Shift_Del_p.G68fs|PLAU_uc001jwb.2_RNA|PLAU_uc001jwc.2_Frame_Shift_Del_p.G154fs|PLAU_uc009xrq.1_Frame_Shift_Del_p.G118fs	NM_002658	NP_002649	P00749	UROK_HUMAN	plasminogen activator, urokinase isoform 1	154	Connecting peptide.				blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(2)|kidney(1)	3	Prostate(51;0.0112)				Amiloride(DB00594)|Urokinase(DB00013)	GTCCTCCAGGAAAAAAGCCCT	0.517													790	7	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80968368	80968368	+	Intron	DEL	C	-	-	rs35380943		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80968368delC	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			TTTGGTGTGTCCCCCACGTGC	0.567													5	3	---	---	---	---	
C10orf4	118924	broad.mit.edu	37	10	95445300	95445300	+	Intron	DEL	A	-	-	rs5787072		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95445300delA	uc001kiz.1	-						C10orf4_uc001kiv.1_Intron|C10orf4_uc001kja.1_Intron	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein							nucleus	protein binding				0		Colorectal(252;0.122)				TACTGTTACCAAAAAAAATCA	0.318													3	3	---	---	---	---	
SLC22A20	440044	broad.mit.edu	37	11	64997532	64997532	+	Intron	DEL	T	-	-	rs150430504	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64997532delT	uc010roc.1	+							NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						ccttccttcctttccttcctt	0.000													6	3	---	---	---	---	
LOC144438	144438	broad.mit.edu	37	12	49086749	49086750	+	5'Flank	INS	-	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49086749_49086750insA	uc001rsd.3	-							NR_024266				Homo sapiens cDNA FLJ11223 fis, clone PLACE1008209.												0						TTTCTTAGTCCAAAAAAAAAAA	0.322													4	2	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64921265	64921265	+	Intron	DEL	T	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64921265delT	uc001xhb.2	+						MTHFD1_uc010aqf.2_Intron|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CCAACAGTTCTTTTTTTTTTT	0.303													5	3	---	---	---	---	
ARHGAP11A	9824	broad.mit.edu	37	15	32920998	32921007	+	Splice_Site	DEL	GAATTGGTAG	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32920998_32921007delGAATTGGTAG	uc001zgy.1	+	7	1659	c.937_splice	c.e7+1	p.A313_splice	ARHGAP11A_uc010ubw.1_Splice_Site_p.A124_splice|ARHGAP11A_uc001zgw.2_Splice_Site_p.A313_splice|ARHGAP11A_uc001zgx.2_Splice_Site_p.A313_splice|ARHGAP11A_uc010ubx.1_Splice_Site_p.A124_splice	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		CAAGAAGAAAGAATTGGTAGGTATTTATTA	0.214													141	13	---	---	---	---	
ATP8B4	79895	broad.mit.edu	37	15	50193367	50193368	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50193367_50193368insT	uc001zxu.2	-	21	2352_2353	c.2210_2211insA	c.(2209-2211)AAGfs	p.K737fs	ATP8B4_uc010ber.2_Frame_Shift_Ins_p.K610fs|ATP8B4_uc010ufd.1_Frame_Shift_Ins_p.K547fs|ATP8B4_uc010ufe.1_Intron|ATP8B4_uc001zxv.1_Frame_Shift_Ins_p.K35fs	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	737	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCAGCTGCTGCTTTTTTTCACA	0.361													178	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56038830	56038833	+	IGR	DEL	AAAG	-	-	rs71110322	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56038830_56038833delAAAG								PRTG (3653 upstream) : NEDD4 (80298 downstream)																							aaaaaaaaaaaaagaaGCTCCTGG	0.275													4	2	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63955042	63955042	+	Intron	DEL	A	-	-	rs67648242		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63955042delA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GTAACCTCATAACTTTAAATC	0.388													3	4	---	---	---	---	
RBPMS2	348093	broad.mit.edu	37	15	65042255	65042256	+	Intron	INS	-	A	A	rs66928243		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65042255_65042256insA	uc002anq.2	-							NM_194272	NP_919248	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2								nucleic acid binding|nucleotide binding				0						aactccatctcaaaaaaaaaaa	0.396													4	2	---	---	---	---	
HERPUD1	9709	broad.mit.edu	37	16	56970952	56970953	+	Intron	INS	-	A	A	rs113309114		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56970952_56970953insA	uc002eke.1	+						HERPUD1_uc010vhj.1_3'UTR|HERPUD1_uc002ekf.1_Intron|HERPUD1_uc002ekg.1_Intron|HERPUD1_uc010cco.1_Intron|HERPUD1_uc010ccp.1_Intron|HERPUD1_uc002ekh.1_Intron	NM_014685	NP_055500	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum							endoplasmic reticulum membrane|integral to membrane	protein binding				0						TGCATATATTGAAAAAAAAAAG	0.332			T	ERG	prostate								4	2	---	---	---	---	
KATNB1	10300	broad.mit.edu	37	16	57778630	57778631	+	Intron	INS	-	GT	GT	rs145456395	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57778630_57778631insGT	uc002eml.1	+							NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1						cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				GGGAtgtgcgggtgtgtgtgtg	0.327													4	3	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77395786	77395787	+	Intron	INS	-	AAAA	AAAA	rs151022467	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77395786_77395787insAAAA	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron|ADAMTS18_uc010vni.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						catctcaaattaaaaaaaatac	0.158													1	5	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10555063	10555064	+	Intron	DEL	TG	-	-	rs113649252		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10555063_10555064delTG	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						ttattattattgtttttttttt	0.193													31	17	---	---	---	---	
CASC3	22794	broad.mit.edu	37	17	38319308	38319309	+	Intron	INS	-	A	A			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38319308_38319309insA	uc010cwt.1	+						CASC3_uc010cws.1_Intron|CASC3_uc002hue.2_Intron	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51						mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						accctgtctccaaaaaaaaaaa	0.059													4	2	---	---	---	---	
MIDN	90007	broad.mit.edu	37	19	1255402	1255402	+	Intron	DEL	C	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1255402delC	uc002lrp.2	+							NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin							nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGCACTCACGGCCACCTCT	0.667													7	5	---	---	---	---	
C19orf59	199675	broad.mit.edu	37	19	7744075	7744075	+	3'UTR	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7744075delA	uc002mhh.1	+	7					TRAPPC5_uc002mhi.1_5'Flank|TRAPPC5_uc002mhj.1_5'Flank|TRAPPC5_uc002mhk.1_5'Flank	NM_174918	NP_777578	Q8IX19	MCEM1_HUMAN	mast cell-expressed membrane protein 1							integral to membrane				skin(1)	1						ACGGGAAATGACCCCCCCCCC	0.527											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ELOF1	84337	broad.mit.edu	37	19	11664398	11664417	+	3'UTR	DEL	ACACACACACACACACACAC	-	-	rs66953353		TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664398_11664417delACACACACACACACACACAC	uc002mse.1	-	4					ELOF1_uc002msd.1_3'UTR	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						cacacccactacacacacacacacacacacacacacacac	0.350													4	2	---	---	---	---	
NFIX	4784	broad.mit.edu	37	19	13105126	13105127	+	5'Flank	INS	-	GT	GT	rs139318180	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13105126_13105127insGT	uc002mwd.2	+							NM_002501	NP_002492	Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			TGGGCAACCCAgtgtgtgtgtg	0.436													2	4	---	---	---	---	
ZNF99	7652	broad.mit.edu	37	19	22940066	22940066	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940066delA	uc010xrh.1	-	6	2265	c.2265delT	c.(2263-2265)TTTfs	p.F755fs		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AGGAATTGTTAAAAGCTTTGC	0.358													156	31	---	---	---	---	
SEMG2	6407	broad.mit.edu	37	20	43837375	43837376	+	Intron	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43837375_43837376insT	uc010ggz.2	+						SEMG1_uc002xni.2_Intron|SEMG1_uc002xnj.2_Intron|SEMG1_uc002xnh.2_Intron	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor						sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				TATCAAGGTAATTTTTTTTTAG	0.381													86	23	---	---	---	---	
PREX1	57580	broad.mit.edu	37	20	47275800	47275801	+	Intron	INS	-	AGGAAGGAAGGG	AGGAAGGAAGGG	rs143111463	by1000genomes	TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47275800_47275801insAGGAAGGAAGGG	uc002xtw.1	-						PREX1_uc002xtv.1_5'Flank	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ggaaggaaggacgggcacgaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756755	44756755	+	IGR	DEL	A	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756755delA								CRYAA (163842 upstream) : SIK1 (77643 downstream)																							caccatcaccaccaccatcac	0.000													8	5	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839641	45839646	+	Intron	DEL	GTGGTG	-	-			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839641_45839646delGTGGTG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gatgatggcagtggtggtggtggtgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34492089	34492090	+	IGR	INS	-	T	T			TCGA-EJ-5524-01	TCGA-EJ-5524-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34492089_34492090insT								LARGE (173505 upstream) : ISX (970039 downstream)																							ctgccttgctgtttTTTTTTGT	0.163													4	2	---	---	---	---	
