Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTHFR	4524	broad.mit.edu	37	1	11855381	11855381	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11855381C>T	uc001atc.1	-	6	989	c.805G>A	c.(805-807)GTG>ATG	p.V269M	MTHFR_uc001atb.1_Missense_Mutation_p.V292M	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	269					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	GACAGCTTCACAAGCTGCCGA	0.582													19	44	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918727	16918727	+	5'UTR	SNP	G	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918727G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAGGTGCCTGAACTCAGAGC	0.463													3	21	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918734	16918734	+	5'UTR	SNP	G	C	C	rs3928093	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918734G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CCTGAACTCAGAGCTGAAAGC	0.453													5	15	---	---	---	---	PASS
C1orf109	54955	broad.mit.edu	37	1	38155401	38155401	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38155401G>T	uc001cbp.2	-	2	342	c.152C>A	c.(151-153)GCC>GAC	p.A51D	C1orf109_uc010oig.1_Missense_Mutation_p.A114D|C1orf109_uc001cbo.2_Missense_Mutation_p.A113D|C1orf109_uc001cbq.1_Missense_Mutation_p.A51D|CDCA8_uc001cbr.2_5'Flank|CDCA8_uc001cbs.2_5'Flank	NM_017850	NP_060320	Q9NX04	CA109_HUMAN	hypothetical protein LOC54955	51											0		Myeloproliferative disorder(586;0.0393)				GTTCTGTGCGGCCTGCAGCTG	0.647													7	112	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157765730	157765730	+	3'UTR	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157765730G>A	uc001frg.2	-	11					FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_3'UTR|FCRL1_uc001fri.2_3'UTR|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCAGGGCTGCGCCAACTTCAC	0.468													4	16	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214171237	214171237	+	Silent	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214171237C>T	uc001hkh.2	+	2	1631	c.1359C>T	c.(1357-1359)TCC>TCT	p.S453S	PROX1_uc001hkg.1_Silent_p.S453S	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	453					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGTCTGCCTCCGGCCCTGCCG	0.647													27	85	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848631	215848631	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848631C>T	uc001hku.1	-	63	13009	c.12622G>A	c.(12622-12624)GAC>AAC	p.D4208N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4208	Extracellular (Potential).|Fibronectin type-III 27.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTTTCTCGTCGGCCTGGATT	0.393										HNSCC(13;0.011)			44	126	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71913885	71913885	+	3'UTR	SNP	G	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71913885G>T	uc002sie.2	+	55					DYSF_uc010feg.2_3'UTR|DYSF_uc010feh.2_3'UTR|DYSF_uc002sig.3_3'UTR|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_3'UTR|DYSF_uc010fef.2_3'UTR|DYSF_uc010fei.2_3'UTR|DYSF_uc010fek.2_3'UTR|DYSF_uc010fej.2_3'UTR|DYSF_uc010fel.2_3'UTR|DYSF_uc010feo.2_3'UTR|DYSF_uc010fem.2_3'UTR|DYSF_uc010fen.2_3'UTR|DYSF_uc002sif.2_3'UTR|DYSF_uc010yqy.1_3'UTR|DYSF_uc010yqz.1_3'UTR	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						TAAAACAGTTGGAACCACACA	0.512													2	2	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	76975914	76975914	+	Silent	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76975914G>A	uc002snr.2	-	4	2095	c.1680C>T	c.(1678-1680)AGC>AGT	p.S560S	LRRTM4_uc002snq.2_Silent_p.S560S	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	560	Cytoplasmic (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		CCAGGCCGGGGCTTTCGTCCT	0.587													54	165	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86360495	86360495	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86360495G>A	uc002sqw.2	+	19	1545	c.1479G>A	c.(1477-1479)ATG>ATA	p.M493I	PTCD3_uc002sqx.1_Missense_Mutation_p.M83I|SNORD94_uc010fgr.1_5'Flank	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor	493	PPR 9.					mitochondrion	protein binding			ovary(1)	1						CCCAAACAATGATACATCTTC	0.373													16	309	---	---	---	---	PASS
EFHB	151651	broad.mit.edu	37	3	19924217	19924217	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19924217G>C	uc003cbl.3	-	12	2349	c.2153C>G	c.(2152-2154)CCC>CGC	p.P718R	EFHB_uc003cbm.2_Missense_Mutation_p.P588R	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	718					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						ACCACAAATGGGGTAACCTAG	0.313													11	31	---	---	---	---	PASS
ACVR2B	93	broad.mit.edu	37	3	38519825	38519825	+	Intron	SNP	G	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38519825G>T	uc003cif.2	+						ACVR2B_uc003cig.2_5'UTR	NM_001106	NP_001097	Q13705	AVR2B_HUMAN	activin A receptor, type IIB precursor						activin receptor signaling pathway|anterior/posterior pattern formation|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|regulation of transcription, DNA-dependent	cell surface|cytoplasm|integral to plasma membrane	activin receptor activity|ATP binding|growth factor binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		ATAGAGGTGGGGAGGACAGGC	0.622													3	38	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49698154	49698154	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49698154G>A	uc003cxe.3	+	6	8990	c.8876G>A	c.(8875-8877)CGC>CAC	p.R2959H		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2959	Potential.				synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		ACCAAACTGCGCAAGAAGCAG	0.602													4	31	---	---	---	---	PASS
SSR3	6747	broad.mit.edu	37	3	156266713	156266713	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156266713G>A	uc003fau.2	-	3	397	c.340C>T	c.(340-342)CGG>TGG	p.R114W	SSR3_uc011bop.1_Missense_Mutation_p.R114W	NM_007107	NP_009038	Q9UNL2	SSRG_HUMAN	signal sequence receptor gamma subunit	114	Lumenal (Potential).				cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTCTCCTTCCGAGACATCTTT	0.363													24	82	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	C	C	rs121913272		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178927980T>C	uc003fjk.2	+	8	1415	c.1258T>C	c.(1258-1260)TGT>CGT	p.C420R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	420	C2 PI3K-type.		C -> R (in cancer; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.C420R(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TAAGGAACACTGTCCATTGGC	0.328	C420R(EFM192A_BREAST)|C420R(OVISE_OVARY)|C420R(HEC151_ENDOMETRIUM)|C420R(CCK81_LARGE_INTESTINE)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			5	205	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1746844	1746844	+	3'UTR	SNP	A	T	T	rs8389	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1746844A>T	uc003gdo.2	+	16					TACC3_uc003gdp.2_3'UTR|TACC3_uc010ica.2_3'UTR	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing							centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CAACTTTTTTAAAAACTAGAT	0.443													4	0	---	---	---	---	PASS
TMEM128	85013	broad.mit.edu	37	4	4249484	4249484	+	Intron	SNP	A	C	C	rs2916465	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4249484A>C	uc003ghr.1	-						TMEM128_uc003ghq.1_5'UTR|TMEM128_uc003ghs.2_Intron|TMEM128_uc011bvv.1_Intron|TMEM128_uc011bvw.1_Intron	NM_032927	NP_116316	Q5BJH2	TM128_HUMAN	transmembrane protein 128							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		agatatttccagtaattcgct	0.100													3	28	---	---	---	---	PASS
C1QTNF7	114905	broad.mit.edu	37	4	15444073	15444073	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15444073G>A	uc011bxb.1	+	3	747	c.520G>A	c.(520-522)GAG>AAG	p.E174K	C1QTNF7_uc003gno.2_Missense_Mutation_p.E181K|C1QTNF7_uc003gnp.2_Missense_Mutation_p.E174K	NM_001135171	NP_001128643	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	174	C1q.					collagen					0						CCTCTTCAACGAGGGAGAGCA	0.443													15	486	---	---	---	---	PASS
PIK3R1	5295	broad.mit.edu	37	5	67522457	67522457	+	5'UTR	SNP	C	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67522457C>A	uc003jva.2	+	2					PIK3R1_uc003jvb.2_5'Flank	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding			endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AATCAGACTGCTCTGTACAAC	0.408			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			8	60	---	---	---	---	PASS
LOC100133050	100133050	broad.mit.edu	37	5	99715528	99715528	+	RNA	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99715528C>T	uc011cuw.1	-	4		c.382G>A				NR_027503				Homo sapiens glucuronidase, beta pseudogene (LOC100133050), non-coding RNA.												0						AGCGGACAGTCGAAGCCCTTC	0.607													5	13	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7230059	7230059	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7230059G>A	uc003mxc.2	+	10	2117	c.1727G>A	c.(1726-1728)CGG>CAG	p.R576Q	RREB1_uc003mxb.2_Missense_Mutation_p.R576Q|RREB1_uc010jnx.2_Missense_Mutation_p.R576Q	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	576					multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GCGGCCACGCGGCTCTCCCTG	0.711													4	13	---	---	---	---	PASS
RBM24	221662	broad.mit.edu	37	6	17292224	17292224	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17292224C>A	uc003nbz.3	+	4	589	c.585C>A	c.(583-585)TAC>TAA	p.Y195*	RBM24_uc003nby.3_3'UTR|RBM24_uc011dix.1_Nonsense_Mutation_p.Y137*|RBM24_uc003nca.2_Nonsense_Mutation_p.Y150*|RBM24_uc011diy.1_Missense_Mutation_p.T109K|RBM24_uc011diz.1_Missense_Mutation_p.T94K	NM_001143942	NP_001137414	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24 isoform 1	195	Ala-rich.				cell differentiation|regulation of mRNA stability|regulation of myotube differentiation	cytoplasm|nucleus	mRNA 3'-UTR binding|nucleotide binding			ovary(1)|skin(1)	2	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			GCTATGGCTACGCAGTCCAGC	0.393													4	32	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55924962	55924962	+	Missense_Mutation	SNP	A	G	G	rs12209452	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55924962A>G	uc003pcs.2	-	28	2694	c.2462T>C	c.(2461-2463)CTG>CCG	p.L821P	COL21A1_uc010jzz.2_Missense_Mutation_p.L206P|COL21A1_uc011dxg.1_Missense_Mutation_p.L194P|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Missense_Mutation_p.L178P	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	821					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATGTTGGGACAGGCAATGATC	0.493													3	61	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85473758	85473758	+	Missense_Mutation	SNP	C	T	T	rs172562	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85473758C>T	uc003pkl.1	-	1	142	c.142G>A	c.(142-144)GGG>AGG	p.G48R	TBX18_uc010kbq.1_5'Flank	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	48					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		tccacggcccccgccgccTCT	0.478													4	1	---	---	---	---	PASS
URGCP	55665	broad.mit.edu	37	7	43918497	43918497	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43918497C>A	uc003tiw.2	-	6	622	c.565G>T	c.(565-567)GCC>TCC	p.A189S	URGCP_uc003tiu.2_Missense_Mutation_p.A146S|URGCP_uc003tiv.2_Missense_Mutation_p.A114S|URGCP_uc003tix.2_Missense_Mutation_p.A180S|URGCP_uc003tiy.2_Missense_Mutation_p.A146S|URGCP_uc003tiz.2_Missense_Mutation_p.A146S|URGCP_uc011kbj.1_Missense_Mutation_p.A146S	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	189					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						AGCAGCAGGGCACAGAGAAGG	0.532													21	54	---	---	---	---	PASS
ZNF680	340252	broad.mit.edu	37	7	63981563	63981563	+	Silent	SNP	A	G	G	rs10243954	byFrequency	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63981563A>G	uc003tta.2	-	4	1742	c.1569T>C	c.(1567-1569)TGT>TGC	p.C523C	ZNF680_uc010kzr.2_Silent_p.C450C	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	523					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				AATTATTGTCACATTTTTCAG	0.338													4	165	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068103	38068103	+	3'UTR	SNP	G	T	T	rs111385150	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068103G>T	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GCCTGTTGATGACAAGAAGCA	0.338													5	37	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068124	38068124	+	3'UTR	SNP	G	A	A	rs80041165	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068124G>A	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				ATACATTCCAGCTTTCCTTTG	0.338													5	31	---	---	---	---	PASS
RORB	6096	broad.mit.edu	37	9	77280437	77280437	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77280437G>A	uc004aji.2	+	7	1008	c.959G>A	c.(958-960)CGT>CAT	p.R320H	RORB_uc004ajh.2_Missense_Mutation_p.R309H	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	320	Ligand-binding (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						AGAATGTGCCGTGCCTTCAAC	0.313													54	130	---	---	---	---	PASS
LCN2	3934	broad.mit.edu	37	9	130914560	130914560	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130914560A>G	uc004bto.1	+	5	647	c.574A>G	c.(574-576)ATC>GTC	p.I192V	LCN2_uc011map.1_Missense_Mutation_p.I192V	NM_005564	NP_005555	P80188	NGAL_HUMAN	lipocalin 2 precursor	192					apoptosis|innate immune response|regulation of apoptosis|siderophore transport		iron ion binding|transporter activity				0						CCCTGTCCCAATCGGTAATGG	0.562													23	48	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135771424	135771424	+	3'UTR	SNP	A	G	G	rs7037703		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135771424A>G	uc004cca.2	-	23					TSC1_uc004ccb.3_3'UTR|TSC1_uc011mcq.1_3'UTR	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGGCGGGTGGAGGGGAAGGTC	0.512			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				3	20	---	---	---	---	PASS
TMEM141	85014	broad.mit.edu	37	9	139686405	139686405	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139686405G>A	uc004cje.3	+	3	174	c.128G>A	c.(127-129)GGC>GAC	p.G43D	TMEM141_uc011meg.1_Missense_Mutation_p.G43D	NM_032928	NP_116317	Q96I45	TM141_HUMAN	transmembrane protein 141	43	Helical; (Potential).					integral to membrane					0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.67e-06)|Epithelial(140;0.000112)		GCAGGCACCGGCATGGCCTTT	0.637											OREG0019622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	272	---	---	---	---	PASS
CCDC3	83643	broad.mit.edu	37	10	12940424	12940424	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12940424G>A	uc001ilq.1	-	3	939	c.805C>T	c.(805-807)CGG>TGG	p.R269W	CCDC3_uc009xjb.1_RNA|CCDC3_uc001ilr.2_RNA|CCDC3_uc009xjc.1_RNA	NM_031455	NP_113643	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3 precursor	269						endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			CGTTACCCCCGCAGGTAGGGG	0.637													10	54	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64927823	64927823	+	Missense_Mutation	SNP	C	G	G	rs1935	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64927823C>G	uc001jmn.2	-	26	7905	c.7605G>C	c.(7603-7605)GAG>GAC	p.E2535D	JMJD1C_uc001jml.2_Missense_Mutation_p.E2298D|JMJD1C_uc001jmm.2_Missense_Mutation_p.E2247D|JMJD1C_uc010qiq.1_Missense_Mutation_p.E2353D|JMJD1C_uc009xpi.2_Missense_Mutation_p.E2353D|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmk.2_RNA	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2535					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTTCCATATCCTCTACTTCAT	0.333													7	301	---	---	---	---	PASS
OR52A1	23538	broad.mit.edu	37	11	5172911	5172911	+	Missense_Mutation	SNP	C	T	T	rs149615083		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5172911C>T	uc010qyy.1	-	1	689	c.689G>A	c.(688-690)CGT>CAT	p.R230H		NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGGGCAAACGAAAAACTGT	0.428													30	121	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57068002	57068002	+	3'UTR	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57068002C>T	uc001njr.2	-	10					TNKS1BP1_uc001njp.2_3'UTR|TNKS1BP1_uc001njq.2_3'UTR|TNKS1BP1_uc001njs.2_3'UTR	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1						nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				CTGTCCTCACCTCAGTGACTT	0.577													18	66	---	---	---	---	PASS
ACER3	55331	broad.mit.edu	37	11	76730798	76730798	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76730798T>G	uc009yum.1	+	10	832	c.728T>G	c.(727-729)CTG>CGG	p.L243R	ACER3_uc001oxu.2_RNA|ACER3_uc009yun.1_Missense_Mutation_p.L201R|ACER3_uc009yuo.1_Missense_Mutation_p.L148R|ACER3_uc010rsh.1_Missense_Mutation_p.L206R|ACER3_uc010rsi.1_Missense_Mutation_p.L148R|ACER3_uc010rsj.1_Missense_Mutation_p.L148R	NM_018367	NP_060837	Q9NUN7	ACER3_HUMAN	phytoceramidase, alkaline	243					ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0						ACACTTTACCTGAGATATAGG	0.423													35	193	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92533734	92533734	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92533734C>G	uc001pdj.3	+	9	7572	c.7555C>G	c.(7555-7557)CGA>GGA	p.R2519G		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2519	Cadherin 23.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AATTCATGTTCGAGCCACAGA	0.493										TCGA Ovarian(4;0.039)			4	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92920	92920	+	Missense_Mutation	SNP	C	G	G	rs145563795	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92920C>G	uc010sdi.1	-	1	99	c.71G>C	c.(70-72)AGT>ACT	p.S24T	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		ACTCACAAGACTGTGATCCAA	0.622													2	3	---	---	---	---	PASS
PTGER2	5732	broad.mit.edu	37	14	52781424	52781424	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52781424A>G	uc001wzr.2	+	1	409	c.158A>G	c.(157-159)GAC>GGC	p.D53G		NM_000956	NP_000947	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	53	Cytoplasmic (Potential).					integral to plasma membrane	prostaglandin E receptor activity			lung(1)|breast(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Iloprost(DB01088)	TGGCGGGGGGACGTGGGGTGC	0.697													4	25	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68053040	68053040	+	Intron	SNP	T	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68053040T>C	uc001xjl.1	+						PLEKHH1_uc010tsw.1_Intron|PLEKHH1_uc001xjn.1_Intron|PLEKHH1_uc010tsx.1_Intron|PLEKHH1_uc001xjo.1_3'UTR|PLEKHH1_uc001xjp.1_Intron	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H							cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AACTCTGGCCTAGCTACTATT	0.433													2	10	---	---	---	---	PASS
RBPMS2	348093	broad.mit.edu	37	15	65041630	65041630	+	Silent	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65041630G>A	uc002anq.2	-	4	519	c.267C>T	c.(265-267)AAC>AAT	p.N89N		NM_194272	NP_919248	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2	89	RRM.						nucleic acid binding|nucleotide binding				0						ACCTACTCACGTTCAGCGCAT	0.512													30	113	---	---	---	---	PASS
ULK3	25989	broad.mit.edu	37	15	75131661	75131661	+	Silent	SNP	A	G	G	rs4886615	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75131661A>G	uc010bkf.1	-	8	1012	c.906T>C	c.(904-906)GCT>GCC	p.A302A	ULK3_uc010ulp.1_Silent_p.A212A|ULK3_uc010ulq.1_Silent_p.A313A|ULK3_uc010ulr.1_Silent_p.A185A|ULK3_uc002ayv.2_Silent_p.A302A|ULK3_uc010uls.1_Silent_p.A185A	NM_001099436	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51-like kinase 3	302	MIT 1.					cytoplasm	ATP binding|protein serine/threonine kinase activity			breast(2)	2						GTGATAAGGCAGCTGCTGAAT	0.612													3	5	---	---	---	---	PASS
GLIS2	84662	broad.mit.edu	37	16	4384871	4384871	+	Missense_Mutation	SNP	G	A	A	rs147175353	byFrequency	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4384871G>A	uc002cwc.1	+	3	472	c.415G>A	c.(415-417)GGG>AGG	p.G139R		NM_032575	NP_115964	Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	139	Interaction with CTNND1 (By similarity).				cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development	cytoplasm|nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|transcription regulatory region DNA binding|zinc ion binding				0						CCTCGGCTCCGGGGGGGCCCT	0.657													21	87	---	---	---	---	PASS
OSGIN1	29948	broad.mit.edu	37	16	83999180	83999180	+	Silent	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83999180C>T	uc002fha.2	+	7	1634	c.1251C>T	c.(1249-1251)TAC>TAT	p.Y417Y	OSGIN1_uc002fhb.2_Silent_p.Y334Y|OSGIN1_uc002fhc.2_Silent_p.Y334Y	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	417					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						AGATGCTGTACCCCGAGTACC	0.637													22	62	---	---	---	---	PASS
BANP	54971	broad.mit.edu	37	16	88061088	88061088	+	Splice_Site	SNP	G	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88061088G>C	uc002fkr.2	+	8	1093	c.869_splice	c.e8-1	p.C290_splice	BANP_uc002fkp.2_Splice_Site_p.C260_splice|BANP_uc002fkq.2_Splice_Site_p.C260_splice|BANP_uc010vow.1_Splice_Site_p.C298_splice|BANP_uc002fks.3_Splice_Site_p.C259_splice|BANP_uc002fko.1_Splice_Site_p.C196_splice|BANP_uc010vov.1_Splice_Site_p.C265_splice	NM_079837	NP_524576	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein isoform b						cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0				BRCA - Breast invasive adenocarcinoma(80;0.00551)		TGTCCTTCCAGGTCACCTTTT	0.612													10	111	---	---	---	---	PASS
CBFA2T3	863	broad.mit.edu	37	16	88967911	88967911	+	Splice_Site	SNP	C	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88967911C>A	uc002fmm.1	-	2	490	c.304_splice	c.e2+1	p.H102_splice	CBFA2T3_uc002fml.1_Splice_Site_p.L41_splice|CBFA2T3_uc010cif.1_Splice_Site_p.H41_splice|CBFA2T3_uc002fmn.1_Splice_Site_p.L102_splice	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16						cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		GGGCTACTTACGTGTGTGTGG	0.677			T	RUNX1	AML								10	40	---	---	---	---	PASS
PPP4R1	9989	broad.mit.edu	37	18	9547949	9547949	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9547949G>C	uc002koe.1	-	20	2809	c.2691C>G	c.(2689-2691)GAC>GAG	p.D897E	PPP4R1_uc002kof.2_Missense_Mutation_p.D314E|PPP4R1_uc010wzo.1_Missense_Mutation_p.D743E|PPP4R1_uc002kod.1_Missense_Mutation_p.D880E	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	897	HEAT 14.				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						CCAAGAAATAGTCTGGAAATG	0.478													24	41	---	---	---	---	PASS
FAM38B	63895	broad.mit.edu	37	18	10671739	10671739	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10671739C>T	uc002kor.3	-	14	2055	c.1915G>A	c.(1915-1917)GGG>AGG	p.G639R	FAM38B_uc002koq.2_Missense_Mutation_p.G474R	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B	2682	Helical; (Potential).					integral to membrane	ion channel activity			ovary(1)	1						ACAAATTTCCCAATCACAAGG	0.333													42	132	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47352677	47352677	+	3'UTR	SNP	A	C	C	rs3208550		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352677A>C	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AAAAATAATGACATAGTTGTG	0.323													3	8	---	---	---	---	PASS
COMP	1311	broad.mit.edu	37	19	18898325	18898325	+	Silent	SNP	C	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18898325C>G	uc002nke.2	-	10	1146	c.1110G>C	c.(1108-1110)GCG>GCC	p.A370A	COMP_uc002nkd.2_Silent_p.A337A|COMP_uc010xqj.1_Silent_p.A317A	NM_000095	NP_000086	P49747	COMP_HUMAN	cartilage oligomeric matrix protein precursor	370	TSP type-3 4.				anti-apoptosis|apoptosis|cell adhesion|limb development	extracellular space|proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent|heparan sulfate proteoglycan binding|heparin binding				0						CGTCGTCGCACGCATCGCCCC	0.697													39	149	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41354198	41354198	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41354198T>C	uc002opl.3	-	4	601	c.580A>G	c.(580-582)AAG>GAG	p.K194E	CYP2A6_uc010ehe.1_Translation_Start_Site|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	194			K -> E (in allele CYP2A6*15).		coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	TCTTTGTCCTTATAGTCAAAG	0.557													45	189	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16347999	16347999	+	Intron	SNP	A	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16347999A>C	uc002wpg.1	-						KIF16B_uc002wpe.1_Intron|KIF16B_uc002wpf.1_Intron|KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Missense_Mutation_p.V1324G	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						GACTAGTTCTACTGTTGACAC	0.433													47	295	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42788455	42788455	+	Silent	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788455G>A	uc002xli.1	-	2	1845	c.972C>T	c.(970-972)CAC>CAT	p.H324H		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	324	MORN 8.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AGCCATAGCCGTGGCGCAGGT	0.662													4	13	---	---	---	---	PASS
SAMSN1	64092	broad.mit.edu	37	21	15884893	15884893	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15884893T>A	uc002yju.1	-	4	363	c.281A>T	c.(280-282)GAT>GTT	p.D94V	SAMSN1_uc010gky.1_Intron|SAMSN1_uc002yjv.1_Missense_Mutation_p.D162V	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	94					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		ATCTTCCTCATCCTTCAGAAA	0.413													55	146	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641251	33641251	+	3'UTR	SNP	C	T	T	rs11557587		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641251C>T	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						ttttttttttctttttttttt	0.154													4	31	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641252	33641252	+	3'UTR	SNP	T	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641252T>C	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						tttttttttcttttttttttt	0.159													3	32	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26299697	26299697	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26299697G>A	uc003abz.1	+	31	5297	c.5047G>A	c.(5047-5049)GTT>ATT	p.V1683I	MYO18B_uc003aca.1_Missense_Mutation_p.V1564I|MYO18B_uc010guy.1_Missense_Mutation_p.V1565I|MYO18B_uc010guz.1_Missense_Mutation_p.V1563I|MYO18B_uc011aka.1_Missense_Mutation_p.V837I|MYO18B_uc011akb.1_Missense_Mutation_p.V1196I	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1683	Potential.|Tail.|Gln-rich.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						GGAAAATTGCGTTGCTGGCTT	0.552													11	13	---	---	---	---	PASS
FAM47B	170062	broad.mit.edu	37	X	34961794	34961794	+	Silent	SNP	T	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34961794T>C	uc004ddi.1	+	1	864	c.846T>C	c.(844-846)CAT>CAC	p.H282H		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	282	Pro-rich.									ovary(3)|breast(1)	4						GAGCGTCCCATCTCTGCCCGG	0.622													32	25	---	---	---	---	PASS
XK	7504	broad.mit.edu	37	X	37553558	37553558	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37553558A>G	uc004ddq.2	+	2	347	c.265A>G	c.(265-267)ATC>GTC	p.I89V		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	89	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				AGTCTTCTGCATCTACTTTCA	0.408													19	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13711	13711	+	RNA	SNP	G	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13711G>A	uc004cox.3	+	1		c.1375G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		AACGCCTGGCAGCCGGAAGCC	0.483													3	3	---	---	---	---	PASS
KIAA1751	85452	broad.mit.edu	37	1	1900380	1900380	+	Intron	DEL	G	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1900380delG	uc001aim.1	-						KIAA1751_uc009vkz.1_Intron	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452											pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TGGGGGCTCCGGTCCTGCCCA	0.692													4	2	---	---	---	---	
MEGF6	1953	broad.mit.edu	37	1	3418648	3418648	+	Intron	DEL	C	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3418648delC	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GGCGAGTGTGCCCCCCCGCGC	0.721													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39898479	39898480	+	Intron	INS	-	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39898479_39898480insT	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGAGGAAGAATTTTTTTTTTT	0.302													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	76084764	76084765	+	Intron	INS	-	G	G	rs141643516	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76084764_76084765insG	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron	NM_001130058	NP_001123530	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						tcaaaaaaaaagggggggggga	0.000													6	4	---	---	---	---	
EVI5	7813	broad.mit.edu	37	1	93163554	93163555	+	Intron	INS	-	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93163554_93163555insA	uc001dox.2	-						EVI5_uc010otf.1_Intron	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TACATTGGAAGAAAAAAAAACA	0.297													196	7	---	---	---	---	
FOXN2	3344	broad.mit.edu	37	2	48586020	48586023	+	Intron	DEL	ATCC	-	-	rs138339553		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48586020_48586023delATCC	uc002rwh.1	+							NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CATAGGATGAATCCCTTTTAGTCA	0.333													6	5	---	---	---	---	
ZC3H6	376940	broad.mit.edu	37	2	113043537	113043538	+	Intron	INS	-	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113043537_113043538insA	uc002thq.1	+							NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6								nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4						gtctccgtctcaaaaaaaaaaa	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132586331	132586332	+	IGR	INS	-	C	C			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132586331_132586332insC								C2orf27B (27097 upstream) : NCRNA00164 (318832 downstream)																							CGCACCTCGCGCCCAGCAGGTT	0.698													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132890386	132890391	+	IGR	DEL	GTTGTT	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132890386_132890391delGTTGTT								C2orf27B (331152 upstream) : NCRNA00164 (14773 downstream)																							ATGAAATAAAGTTGTTGTTAGAAATA	0.214													4	2	---	---	---	---	
CCDC108	255101	broad.mit.edu	37	2	219874324	219874325	+	Intron	INS	-	GGATA	GGATA			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219874324_219874325insGGATA	uc002vjl.1	-							NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		aagatgggatgggatgggacaa	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	84741480	84741480	+	Intron	DEL	A	-	-	rs140144338		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84741480delA	uc003dqi.2	-											Homo sapiens cDNA clone IMAGE:4824471.																		CCTGTCCCAGAAAAAAAAAAA	0.388													6	5	---	---	---	---	
ZIC1	7545	broad.mit.edu	37	3	147129058	147129059	+	Intron	DEL	AC	-	-	rs111509390		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147129058_147129059delAC	uc003ewe.2	+							NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1						behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						ATTATGGAAAACACACACACAC	0.505													2	6	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180372413	180372413	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180372413delA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAGAGACATTaaaaaaaaaaa	0.264													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186038536	186038536	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186038536delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGAGAATGTTAAAAAAAAAAG	0.398													4	2	---	---	---	---	
NOP14	8602	broad.mit.edu	37	4	2947924	2947925	+	Intron	INS	-	CTCA	CTCA	rs143257718		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2947924_2947925insCTCA	uc003ggj.1	-						C4orf10_uc003gge.1_Intron|C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						TGCCGTGCACTCTCCAGATCAC	0.614													0	6	---	---	---	---	
SH3TC1	54436	broad.mit.edu	37	4	8219843	8219844	+	Intron	DEL	AT	-	-	rs1281137	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8219843_8219844delAT	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						CTGGGCAGGCAtgtgtgtgtgt	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12185378	12185381	+	IGR	DEL	GGAA	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12185378_12185381delGGAA								HS3ST1 (754841 upstream) : None (None downstream)																							aggaaagaagggaaggaaggaagg	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12637717	12637717	+	IGR	DEL	T	-	-	rs142332040		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12637717delT								None (None upstream) : HSP90AB2P (697320 downstream)																							ATAGGCTAGCTTTTTTTTTTT	0.209													3	3	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54953319	54953325	+	Intron	DEL	AACAAAC	-	-	rs11942907	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54953319_54953325delAACAAAC	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GACCAGAAAGAACAAACAGAGGACTCC	0.522			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			29	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185899235	185899236	+	IGR	DEL	TA	-	-	rs10545309		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185899235_185899236delTA								ACSL1 (152020 upstream) : HELT (40759 downstream)																							tcacaaagtgtatatatatata	0.035													5	3	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186244502	186244502	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186244502delT	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAAGAATTAGTTTTTTTTTTT	0.343													4	2	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7896958	7896958	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7896958delT	uc003jed.2	+						MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACACCTAAACTTTTTTTTTTT	0.363													111	8	---	---	---	---	
IL6ST	3572	broad.mit.edu	37	5	55250760	55250772	+	Frame_Shift_Del	DEL	CATTCCACCCAAA	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55250760_55250772delCATTCCACCCAAA	uc003jqq.2	-	11	1571_1583	c.1316_1328delTTTGGGTGGAATG	c.(1315-1329)CTTTGGGTGGAATGGfs	p.L439fs	IL6ST_uc010iwb.2_Intron|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Frame_Shift_Del_p.L150fs|IL6ST_uc003jqr.2_3'UTR	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1	439_443	Extracellular (Potential).|Fibronectin type-III 4.				interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TGGAGTAGTCCATTCCACCCAAAGCATGTTATC	0.347			O		hepatocellular ca								290	45	---	---	---	---	
SLC30A5	64924	broad.mit.edu	37	5	68414628	68414628	+	Intron	DEL	C	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68414628delC	uc003jvh.2	+						SLC30A5_uc003jvj.2_Intron|SLC30A5_uc003jvk.2_Intron|SLC30A5_uc003jvi.2_Intron	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),						cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TAGAAAttctctttttttttt	0.144													9	4	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70900409	70900410	+	Intron	INS	-	T	T	rs35873168		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70900409_70900410insT	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron|MCCC2_uc003kbu.1_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AAAATCTAAtcttttttttttt	0.153													7	5	---	---	---	---	
DMXL1	1657	broad.mit.edu	37	5	118487583	118487583	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118487583delT	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTGCTTACAATTTTTTTTTTA	0.323													114	7	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7565382	7565382	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7565382delA	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		agtccgtctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
BAT2	7916	broad.mit.edu	37	6	31590596	31590598	+	In_Frame_Del	DEL	GGG	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31590596_31590598delGGG	uc003nvb.3	+	2	279_281	c.30_32delGGG	c.(28-33)AAGGGA>AAA	p.G11del	BAT2_uc011dnv.1_RNA|BAT2_uc003nvc.3_In_Frame_Del_p.G11del|SNORA38_uc003nvd.2_5'Flank|BAT2_uc003nve.2_5'Flank	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	11						cytoplasm|nucleus	protein binding				0						CGACTGCCAAGGGAAAGGATGGA	0.547													298	46	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44056857	44056858	+	IGR	INS	-	TTTG	TTTG	rs143182535	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44056857_44056858insTTTG								C6orf223 (83971 upstream) : MRPL14 (24516 downstream)																							ttgcttttttttttgttttCCT	0.257													4	4	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84417256	84417257	+	Intron	DEL	GT	-	-	rs111588453		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84417256_84417257delGT	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		atacatatgcgtgtgtgtgtgt	0.238													3	3	---	---	---	---	
LAMA2	3908	broad.mit.edu	37	6	129468410	129468410	+	Intron	DEL	T	-	-	rs66939550		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129468410delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TAGTTTTTCCTTTTTTTTTTT	0.373													3	3	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152949179	152949180	+	Intron	INS	-	AAAAA	AAAAA	rs114934585	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152949179_152949180insAAAAA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACAAAATTACAAAAAAAAAAA	0.322										HNSCC(10;0.0054)			8	4	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141386265	141386265	+	Intron	DEL	C	-	-	rs35707772		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141386265delC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					acacacAGCACACGAAGACCT	0.249													11	8	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38793568	38793569	+	Splice_Site	DEL	GG	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38793568_38793569delGG	uc003xmi.3	+	3	432	c.198_splice	c.e3+1	p.K66_splice	PLEKHA2_uc011lce.1_Splice_Site_p.K16_splice	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			ACATCTCGAAGGTAATGTTGAC	0.426													203	24	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110454524	110454525	+	Intron	DEL	AT	-	-	rs10586369		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110454524_110454525delAT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TACATAAATAATATACACAAAT	0.277										HNSCC(38;0.096)			6	4	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				5	3	---	---	---	---	
TLN1	7094	broad.mit.edu	37	9	35716188	35716188	+	Intron	DEL	A	-	-	rs72424171		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35716188delA	uc003zxt.2	-							NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1						axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ccacatctttaaaaaaaaaaa	0.204													3	3	---	---	---	---	
PAX5	5079	broad.mit.edu	37	9	36923304	36923305	+	Intron	DEL	TC	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36923304_36923305delTC	uc003zzo.1	-						PAX5_uc011lpt.1_Intron|PAX5_uc011lpu.1_Intron|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(20)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		CACACTCCTATCTCTCTCTCTC	0.554			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								198	10	---	---	---	---	
SCAI	286205	broad.mit.edu	37	9	127765212	127765212	+	Intron	DEL	A	-	-	rs79884030		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127765212delA	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						CCAGGAGTACaaaaaaaaaaa	0.254													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94985788	94985789	+	IGR	INS	-	T	T	rs140557797	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94985788_94985789insT								CYP26A1 (148147 upstream) : MYOF (80398 downstream)																							cccagagggagtgttacagtgc	0.000													4	6	---	---	---	---	
ENTPD1	953	broad.mit.edu	37	10	97602452	97602452	+	Intron	DEL	A	-	-	rs113144749		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97602452delA	uc001klh.3	+						ENTPD1_uc001kle.1_Intron|ENTPD1_uc001kli.3_Intron|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Intron|ENTPD1_uc010qok.1_Intron|ENTPD1_uc010qol.1_Intron|ENTPD1_uc010qom.1_Intron|ENTPD1_uc010qon.1_Intron|ENTPD1_uc009xva.2_Intron|ENTPD1_uc009xuz.2_Intron	NM_001776	NP_001767	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		TATGTATGTTAAAAAAAAAAG	0.418													4	2	---	---	---	---	
PNLIPRP2	5408	broad.mit.edu	37	10	118383815	118383816	+	Intron	INS	-	CA	CA	rs144051797	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118383815_118383816insCA	uc001lcq.2	+						PNLIPRP2_uc009xyu.1_Intron|PNLIPRP2_uc009xyv.1_Intron	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		acttacacattcacacacactg	0.282													4	3	---	---	---	---	
CKAP5	9793	broad.mit.edu	37	11	46837626	46837626	+	Intron	DEL	C	-	-	rs66794555		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46837626delC	uc001ndi.1	-						CKAP5_uc009ylg.1_Intron|CKAP5_uc001ndj.1_Intron	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein						cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						ctcaaaacgacccccccattc	0.015													4	2	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	70028923	70028923	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70028923delA	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						AAGAAGAAGGAAAAAAAAAAA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269189	31269190	+	Intron	INS	-	ATCAT	ATCAT	rs25559		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269189_31269190insATCAT	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CATGAGAACTCATTACCATGAT	0.351													18	12	---	---	---	---	
FGD4	121512	broad.mit.edu	37	12	32778204	32778204	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32778204delT	uc001rkz.2	+						FGD4_uc001rlc.2_Intron|FGD4_uc001rky.2_Intron|FGD4_uc001rla.2_Intron|FGD4_uc010ske.1_Intron|FGD4_uc001rlb.1_Intron	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					tttcttattcttttttttttt	0.154													7	4	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50291547	50291548	+	Intron	INS	-	C	C	rs144837790	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50291547_50291548insC	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						AGCCAAGCGCACCCCCCCCCAG	0.564													4	3	---	---	---	---	
CNOT2	4848	broad.mit.edu	37	12	70732795	70732798	+	Intron	DEL	TGTG	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70732795_70732798delTGTG	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron|CNOT2_uc001svw.1_Intron	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			tggcattttatgtgtgtgtgtgtg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74669120	74669120	+	Intron	DEL	T	-	-	rs113849001		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74669120delT	uc009zrx.1	-						uc001sxc.2_Intron					Homo sapiens cDNA clone IMAGE:3926153, partial cds.																		TTTTTTGGGGTTTTTTTTTTT	0.303													4	2	---	---	---	---	
MYBPC1	4604	broad.mit.edu	37	12	102008320	102008321	+	Intron	DEL	AC	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102008320_102008321delAC	uc001tii.2	+						MYBPC1_uc001tif.1_Intron|MYBPC1_uc001tig.2_Intron|MYBPC1_uc010svq.1_Intron|MYBPC1_uc001tih.2_Intron|MYBPC1_uc001tij.2_Intron|MYBPC1_uc010svr.1_Intron|MYBPC1_uc010svs.1_Intron|MYBPC1_uc010svt.1_Intron|MYBPC1_uc010svu.1_Intron|MYBPC1_uc001tik.2_Intron	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						GTGAGTAAAAACACTCACTCAC	0.495													32	20	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114377554	114377555	+	Intron	INS	-	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114377554_114377555insA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					gactctgtctcaaaaaaaaaaa	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19422542	19422542	+	IGR	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19422542delT								OR11H12 (43970 upstream) : POTEG (130823 downstream)																							CAACCTGATGTTTTTTTTTTT	0.418													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	24974452	24974459	+	IGR	DEL	ACACACAA	-	-	rs34375143		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24974452_24974459delACACACAA								SDR39U1 (62388 upstream) : CMA1 (253 downstream)																							acacacacacacacacaAACCCCTTCCA	0.308													3	8	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47314874	47314874	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47314874delT	uc001wwj.3	-						MDGA2_uc001wwh.3_Intron|MDGA2_uc001wwi.3_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CAACTAAAAATAACTCCGttt	0.219													4	3	---	---	---	---	
MAP4K5	11183	broad.mit.edu	37	14	50895476	50895476	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50895476delA	uc001wya.2	-						MAP4K5_uc001wyb.2_Intron	NM_006575	NP_006566	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(1)	1	all_epithelial(31;0.000415)|Breast(41;0.0102)					ACAAATTCTTAAAAAAAAAAA	0.264													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347468	+	Intron	DEL	ACAC	-	-	rs140834248	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347468delACAC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacacac	0.201													7	4	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43677789	43677790	+	Intron	INS	-	T	T	rs147353830	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43677789_43677790insT	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		TTAAGCCACTCTTATTTCCACC	0.455													4	3	---	---	---	---	
CCNB2	9133	broad.mit.edu	37	15	59415935	59415936	+	Intron	DEL	AT	-	-	rs148206919		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59415935_59415936delAT	uc002afz.2	+						CCNB2_uc010bge.2_Intron	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2						cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						TATTAATAACATGTGGGAGTTT	0.396													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79033150	79033151	+	IGR	INS	-	AC	AC	rs145055364	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79033150_79033151insAC								CHRNB4 (80276 upstream) : ADAMTS7 (18395 downstream)																							GGGGTTGGGGGACACACACACA	0.579													5	4	---	---	---	---	
TPSAB1	7177	broad.mit.edu	37	16	1291717	1291718	+	Intron	INS	-	G	G			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1291717_1291718insG	uc002ckz.2	+						TPSAB1_uc010uux.1_Intron	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor						defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				CTGGGGACAGTGGAGGTGGGGC	0.703													6	3	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													4	2	---	---	---	---	
ITGAL	3683	broad.mit.edu	37	16	30510984	30510985	+	Intron	INS	-	TA	TA	rs148911316	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30510984_30510985insTA	uc002dyi.3	+						ITGAL_uc002dyj.3_Intron|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor						blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	tttttttaaattatatatatat	0.045													4	2	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56904752	56904753	+	Intron	INS	-	T	T	rs71882529		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904752_56904753insT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	tttttcttttcttttttttttt	0.292													5	4	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													4	3	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49231520	49231520	+	Intron	DEL	C	-	-	rs60023424	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49231520delC	uc002itk.2	+						NME1_uc010dbx.1_Intron|NME1_uc002ith.1_Intron|NME1_uc002iti.1_Intron|NME1-NME2_uc002itj.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GTCTCTCTCTCTTTTTTTTTT	0.303													4	5	---	---	---	---	
PLIN3	10226	broad.mit.edu	37	19	4847750	4847750	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4847750delG	uc002mbj.2	-	6	964	c.787delC	c.(787-789)CAGfs	p.Q263fs	PLIN3_uc002mbk.2_Frame_Shift_Del_p.Q251fs|PLIN3_uc002mbl.3_Frame_Shift_Del_p.Q263fs	NM_005817	NP_005808	O60664	PLIN3_HUMAN	mannose 6 phosphate receptor binding protein 1	263					vesicle-mediated transport	endosome membrane|Golgi apparatus|lipid particle	protein binding				0					Galsulfase(DB01279)|Idursulfase(DB01271)	TGTGCCCTCTGCTTGGTGGCT	0.662													16	9	---	---	---	---	
GMIP	51291	broad.mit.edu	37	19	19749400	19749401	+	Intron	INS	-	T	T			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19749400_19749401insT	uc002nnd.2	-						GMIP_uc010xrb.1_Intron|GMIP_uc010xrc.1_Intron	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein						negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						TCTGGACTCTAttttttttttt	0.302													8	4	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3298752	3298752	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3298752delT	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						AATGtttctcttttttttttt	0.055													2	4	---	---	---	---	
ADNP	23394	broad.mit.edu	37	20	49541800	49541801	+	Intron	INS	-	AC	AC	rs143159876	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49541800_49541801insAC	uc002xvt.1	-						ADNP_uc002xvu.1_Intron	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGACTTCCTATacacacacaca	0.302													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	32114331	32114360	+	IGR	DEL	AGCCAGTTCCATATCCACAGCCATAGCCAG	-	-	rs146812899	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32114331_32114360delAGCCAGTTCCATATCCACAGCCATAGCCAG								KRTAP20-3 (98876 upstream) : KRTAP21-2 (4911 downstream)																							CCATAGCCACAGCCAGTTCCATATCCACAGCCATAGCCAGAGCCAGAGCC	0.535													43	14	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133212	34133213	+	Intron	DEL	GC	-	-	rs8133271		TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133212_34133213delGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						gtgcgtgcgtgcgtgtgtgtgt	0.277													12	7	---	---	---	---	
GAS2L1	10634	broad.mit.edu	37	22	29706258	29706259	+	Intron	INS	-	A	A	rs138333337	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29706258_29706259insA	uc003afa.1	+						GAS2L1_uc010gvm.1_Intron|GAS2L1_uc003afb.1_Intron|GAS2L1_uc003afc.1_Intron|GAS2L1_uc003afd.1_Intron|GAS2L1_uc003afe.1_Intron	NM_152236	NP_689422	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1 isoform a						cell cycle arrest	cytoplasm|cytoskeleton					0						taaaaaaaaataaaaaaaataa	0.257													4	2	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378792	50378792	+	Intron	DEL	G	-	-	rs5915290	by1000genomes	TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378792delG	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AAAAAAAAAAGGGGGAAGAAA	0.483													3	3	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70639873	70639873	+	Intron	DEL	T	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70639873delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				tttttaattcttttttttttt	0.234													5	4	---	---	---	---	
TKTL1	8277	broad.mit.edu	37	X	153551818	153551819	+	Intron	INS	-	A	A			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153551818_153551819insA	uc004fkg.2	+						TKTL1_uc011mzl.1_Intron|TKTL1_uc011mzm.1_Intron|TKTL1_uc004fkh.2_Intron	NM_012253	NP_036385	P51854	TKTL1_HUMAN	transketolase-like 1 isoform a						glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GAATTCTTTACAAAAAAAACAG	0.312													9	7	---	---	---	---	
FLNA	2316	broad.mit.edu	37	X	153589564	153589564	+	Intron	DEL	A	-	-			TCGA-EJ-5526-01	TCGA-EJ-5526-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153589564delA	uc004fkk.2	-						FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Intron	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2						actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGTCTCAGGAAAAAAAAAAA	0.453													8	5	---	---	---	---	
