Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CAMTA1	23261	broad.mit.edu	37	1	7700505	7700505	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7700505G>A	uc001aoi.2	+	7	763	c.556G>A	c.(556-558)GAG>AAG	p.E186K		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	186	CG-1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCCGGCCATCGAGGACTGCGG	0.612													4	82	---	---	---	---	PASS
GPR157	80045	broad.mit.edu	37	1	9171452	9171452	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9171452G>A	uc001apq.1	-	2	623	c.480C>T	c.(478-480)GAC>GAT	p.D160D	GPR157_uc010oad.1_Silent_p.D160D|GPR157_uc001apr.2_Silent_p.D160D	NM_024980	NP_079256	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	160	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		TGGCCTCCAGGTCGATCCAGC	0.617											OREG0013073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	68	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918727	16918727	+	5'UTR	SNP	G	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918727G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAGGTGCCTGAACTCAGAGC	0.463													3	21	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22214040	22214040	+	Silent	SNP	G	A	A	rs41310388	byFrequency	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22214040G>A	uc001bfj.2	-	8	871	c.831C>T	c.(829-831)CCC>CCT	p.P277P	HSPG2_uc009vqd.2_Silent_p.P277P|HSPG2_uc009vqe.1_Missense_Mutation_p.P176L	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	277					angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGACGGAACCGGGAAGCAGGG	0.647													5	56	---	---	---	---	PASS
TCEB3	6924	broad.mit.edu	37	1	24080617	24080617	+	Missense_Mutation	SNP	A	C	C	rs144826294	byFrequency	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24080617A>C	uc001bho.2	+	6	1703	c.1643A>C	c.(1642-1644)GAA>GCA	p.E548A		NM_003198	NP_003189	Q14241	ELOA1_HUMAN	elongin A	548	Activation domain (By similarity).				positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GAAGAAGAAGAAGCTGGATTT	0.478													5	189	---	---	---	---	PASS
C1orf201	90529	broad.mit.edu	37	1	24706307	24706307	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24706307G>C	uc001bjc.2	-	5	433	c.298C>G	c.(298-300)CGA>GGA	p.R100G	C1orf201_uc001bja.2_Missense_Mutation_p.R53G|C1orf201_uc001bjb.2_Missense_Mutation_p.R8G|C1orf201_uc001bjd.2_Missense_Mutation_p.R100G|C1orf201_uc001bje.1_Missense_Mutation_p.R53G|C1orf201_uc001bjf.2_5'UTR			Q5TH74	CA201_HUMAN	RecName: Full=UPF0490 protein C1orf201;	100										ovary(1)|breast(1)	2		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0191)|all_lung(284;0.0251)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.056)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.48e-25)|Colorectal(126;7.29e-08)|COAD - Colon adenocarcinoma(152;3.85e-06)|GBM - Glioblastoma multiforme(114;0.000399)|BRCA - Breast invasive adenocarcinoma(304;0.00107)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00393)|READ - Rectum adenocarcinoma(331;0.0672)|Lung(427;0.145)		GTGTCCAATCGGGCGCACTGT	0.423													6	89	---	---	---	---	PASS
AKR1A1	10327	broad.mit.edu	37	1	46034256	46034256	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46034256C>G	uc001cod.2	+	7	1116	c.652C>G	c.(652-654)CGT>GGT	p.R218G	AKR1A1_uc001coe.2_Missense_Mutation_p.R218G|AKR1A1_uc001cof.2_Intron|AKR1A1_uc001cog.2_RNA	NM_006066	NP_006057	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1	218	NADP (By similarity).				glucose metabolic process		alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					CTCCTCTGATCGTGCATGGCG	0.542													10	118	---	---	---	---	PASS
KCNA3	3738	broad.mit.edu	37	1	111216034	111216034	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111216034G>A	uc001dzv.1	-	1	1622	c.1398C>T	c.(1396-1398)ATC>ATT	p.I466I		NM_002232	NP_002223	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related	466	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(4)|pancreas(1)	5		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGACACCGGCGATGGCACAGA	0.527													3	96	---	---	---	---	PASS
DRAM2	128338	broad.mit.edu	37	1	111660758	111660758	+	3'UTR	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111660758T>C	uc001ead.3	-	9					DRAM2_uc001eae.3_3'UTR|DRAM2_uc009wfy.2_RNA|DRAM2_uc001eaf.3_3'UTR	NM_178454	NP_848549	Q6UX65	DRAM2_HUMAN	transmembrane protein 77						apoptosis|induction of apoptosis	Golgi apparatus|integral to membrane|lysosomal membrane					0						ATCATAATCATTACAGAAATA	0.373													16	129	---	---	---	---	PASS
ATP5F1	515	broad.mit.edu	37	1	111992477	111992477	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111992477C>T	uc001ebc.2	+	2	480	c.59C>T	c.(58-60)GCA>GTA	p.A20V	WDR77_uc001ebb.2_5'Flank|WDR77_uc010owd.1_5'Flank|WDR77_uc010owe.1_5'Flank|ATP5F1_uc009wgf.1_Missense_Mutation_p.A167V|ATP5F1_uc001ebd.3_RNA	NM_001688	NP_001679	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	20					ATP catabolic process|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding				0		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGAAGAATGCAGCCTTCCTA	0.502													4	218	---	---	---	---	PASS
C1orf56	54964	broad.mit.edu	37	1	151020297	151020297	+	5'UTR	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151020297C>A	uc001ewn.2	+	1						NM_017860	NP_060330	Q9BUN1	CA056_HUMAN	hypothetical protein LOC54964 precursor							extracellular region					0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCACTGGCCACCCTCCCAACC	0.726													4	8	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153313044	153313044	+	Missense_Mutation	SNP	C	T	T	rs12063091	byFrequency	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153313044C>T	uc001fbo.2	-	7	702	c.637G>A	c.(637-639)GTT>ATT	p.V213I	PGLYRP4_uc001fbp.2_Missense_Mutation_p.V209I	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta	213					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGTGGGACAACGCCGGGGCAA	0.592													5	53	---	---	---	---	PASS
RAB13	5872	broad.mit.edu	37	1	153954808	153954808	+	Intron	SNP	C	T	T	rs56853500		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153954808C>T	uc001fdt.1	-						RAB13_uc001fdu.1_3'UTR	NM_002870	NP_002861	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cell adhesion|protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	cytoplasmic vesicle membrane|tight junction	GTP binding|GTPase activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			cacacacacacacatacatac	0.343													8	213	---	---	---	---	PASS
ETV3	2117	broad.mit.edu	37	1	157104014	157104014	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157104014T>C	uc001fqr.2	-	4	579	c.290A>G	c.(289-291)TAT>TGT	p.Y97C	ETV3_uc001fqt.2_Missense_Mutation_p.Y97C	NM_001145312	NP_001138784	P41162	ETV3_HUMAN	ets variant gene 3 isoform 1	97	ETS.						sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CTTGTTGTAATAGTATCTGTA	0.368													9	90	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181727100	181727100	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181727100C>T	uc001gow.2	+	31	4512	c.4347C>T	c.(4345-4347)TTC>TTT	p.F1449F	CACNA1E_uc009wxs.2_Silent_p.F1337F|CACNA1E_uc001gox.1_Silent_p.F675F|CACNA1E_uc009wxt.2_Silent_p.F675F	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1449	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GCATCGACTTCGCCATCAGCG	0.522													14	122	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277277	186277277	+	Missense_Mutation	SNP	G	A	A	rs113308576		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277277G>A	uc001gru.3	+	7	2477	c.2426G>A	c.(2425-2427)GGG>GAG	p.G809E	PRG4_uc001grt.3_Missense_Mutation_p.G768E|PRG4_uc009wyl.2_Missense_Mutation_p.G716E|PRG4_uc009wym.2_Missense_Mutation_p.G675E|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	809	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|54; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACCACCAAGGGGCCCACATCC	0.597													6	238	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230838910	230838910	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230838910C>A	uc001hty.3	-	5	1943	c.1435G>T	c.(1435-1437)GCC>TCC	p.A479S	AGT_uc009xfe.2_3'UTR|AGT_uc009xff.2_Missense_Mutation_p.A451S	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	479					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	AGCGGGTTGGCCACGCGGCCC	0.607													5	101	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241946665	241946665	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241946665C>G	uc001hzf.1	+	12	1469	c.1316C>G	c.(1315-1317)TCC>TGC	p.S439C	WDR64_uc001hzg.1_Missense_Mutation_p.S352C	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	886	WD 12.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CTTACTGCCTCCATCGATGGC	0.393													4	82	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20458017	20458017	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20458017G>T	uc002rds.1	-	15	2494	c.2471C>A	c.(2470-2472)TCT>TAT	p.S824Y	PUM2_uc002rdq.1_Missense_Mutation_p.S201Y|PUM2_uc002rdt.1_Missense_Mutation_p.S824Y|PUM2_uc002rdr.2_Missense_Mutation_p.S684Y|PUM2_uc010yjy.1_Missense_Mutation_p.S745Y|PUM2_uc002rdu.1_Missense_Mutation_p.S824Y|PUM2_uc010yjz.1_Missense_Mutation_p.S763Y	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	824	PUM-HD.|Pumilio 3.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGTCAGAAGAAATAGATTC	0.318													20	57	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31637577	31637577	+	5'UTR	SNP	G	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31637577G>C	uc002rnv.1	-	1						NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	TCACTCCTAAGAGACACTGGC	0.483													8	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89399640	89399640	+	RNA	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89399640T>C	uc010ytr.1	-	46		c.4805A>G			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GGATGTCACATCTGGCACCTG	0.448													6	201	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90008024	90008024	+	RNA	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90008024C>T	uc010fhm.2	+	8		c.1197C>T								Parts of antibodies, mostly variable regions.																		ATGCTGCATCCGCTTTGCAAT	0.517													23	164	---	---	---	---	PASS
RGPD5	84220	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127775G>C	uc002ths.1	-	23	5355	c.5278C>G	c.(5278-5280)CCT>GCT	p.P1760A	RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform	1760					intracellular transport	cytoplasm	binding				0						GAACGGGAAGGATTTTCTTCC	0.308													4	124	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125521376	125521376	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125521376C>T	uc002tno.2	+	15	2723	c.2359C>T	c.(2359-2361)CGA>TGA	p.R787*	CNTNAP5_uc010flu.2_Nonsense_Mutation_p.R788*	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	787	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTATGGTGACCGTGAGTACAA	0.458													11	56	---	---	---	---	PASS
HNMT	3176	broad.mit.edu	37	2	138721979	138721979	+	Intron	SNP	T	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138721979T>G	uc002tvc.2	+						HNMT_uc002tvd.2_5'UTR|HNMT_uc002tve.2_5'UTR|HNMT_uc002tvf.2_5'UTR	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	CTGGTGGGGGTGGGGAAAGAA	0.418													6	89	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179640233	179640233	+	Missense_Mutation	SNP	G	A	A	rs116158152	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179640233G>A	uc010zfg.1	-	28	6582	c.6358C>T	c.(6358-6360)CGG>TGG	p.R2120W	TTN_uc010zfh.1_Missense_Mutation_p.R2074W|TTN_uc010zfi.1_Missense_Mutation_p.R2074W|TTN_uc010zfj.1_Missense_Mutation_p.R2074W|TTN_uc002unb.2_Missense_Mutation_p.R2120W|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2120							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGTCAGACCGTTCAATTTTG	0.493													9	108	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204039932	204039932	+	Nonsense_Mutation	SNP	C	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204039932C>G	uc002uzt.3	+	41	6632	c.6299C>G	c.(6298-6300)TCA>TGA	p.S2100*	NBEAL1_uc002uzs.3_Nonsense_Mutation_p.S810*	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2100	BEACH.						binding			ovary(1)|skin(1)	2						ACTCACTATTCAAATTCTGCG	0.383													7	168	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238277502	238277502	+	Missense_Mutation	SNP	C	T	T	rs115765346	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277502C>T	uc002vwl.2	-	10	4889	c.4604G>A	c.(4603-4605)CGC>CAC	p.R1535H	COL6A3_uc002vwo.2_Missense_Mutation_p.R1329H|COL6A3_uc010znj.1_Missense_Mutation_p.R928H	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1535	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GTCTTCTATGCGACTCCCCGC	0.592													4	184	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242814653	242814653	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242814653G>A	uc010fzu.1	+	2	969	c.946G>A	c.(946-948)GTC>ATC	p.V316I		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	316						integral to membrane				ovary(1)	1						CAATGGCCTCGTCCCTGTGGG	0.657													6	78	---	---	---	---	PASS
IL17RC	84818	broad.mit.edu	37	3	9969889	9969889	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9969889T>A	uc003bua.2	+	10	1311	c.1075T>A	c.(1075-1077)TGC>AGC	p.C359S	CIDEC_uc003bto.2_Intron|IL17RC_uc011ato.1_RNA|IL17RC_uc010hcs.2_Missense_Mutation_p.C263S|IL17RC_uc003btz.2_Missense_Mutation_p.C288S|IL17RC_uc011atp.1_Missense_Mutation_p.C144S|IL17RC_uc003bud.2_5'UTR|IL17RC_uc003bub.2_Missense_Mutation_p.C273S|IL17RC_uc010hct.2_Missense_Mutation_p.C288S|IL17RC_uc010hcu.2_Missense_Mutation_p.C288S|IL17RC_uc010hcv.2_Missense_Mutation_p.C273S|IL17RC_uc011atq.1_Missense_Mutation_p.C273S|IL17RC_uc003buc.2_5'UTR|IL17RC_uc003bue.2_5'Flank	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor	359	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2						GACGAACATCTGCCCCTTCAG	0.637													12	166	---	---	---	---	PASS
C3orf19	51244	broad.mit.edu	37	3	14703060	14703060	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14703060C>T	uc003byw.2	+	5	422	c.331C>T	c.(331-333)CTT>TTT	p.L111F	C3orf19_uc010hei.1_Missense_Mutation_p.L111F|C3orf19_uc010hej.2_Missense_Mutation_p.L16F	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244	111											0						GGATATGTACCTTGTGGATTT	0.408													5	180	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	75986741	75986741	+	IGR	SNP	G	T	T	rs139798507	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75986741G>T								ZNF717 (152071 upstream) : None (None downstream)																							TCAGGGGAATGGACAAGGCCA	0.448													3	44	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105238966	105238966	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105238966C>T	uc003dvx.2	+	2	669	c.129C>T	c.(127-129)TGC>TGT	p.C43C	ALCAM_uc003dvv.2_Silent_p.C43C|ALCAM_uc003dvw.1_Silent_p.C43C|ALCAM_uc003dvy.2_Silent_p.C43C|ALCAM_uc011bhh.1_5'UTR	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	43	Extracellular (Potential).|Ig-like V-type 1.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						TCATACCTTGCCGACTTGACG	0.323													4	203	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108818255	108818255	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108818255T>C	uc003dxl.2	-	6	460	c.373A>G	c.(373-375)ACC>GCC	p.T125A	MORC1_uc011bhn.1_Missense_Mutation_p.T125A	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	125					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						AACACACAGGTCATCGTTTCT	0.343													12	115	---	---	---	---	PASS
IL1RAP	3556	broad.mit.edu	37	3	190347391	190347391	+	Intron	SNP	C	T	T	rs7611887	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190347391C>T	uc003fsm.1	+						IL1RAP_uc003fsk.2_3'UTR|IL1RAP_uc003fsl.2_3'UTR|IL1RAP_uc010hzf.2_3'UTR|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		GCACCTAGCCCGACGGCATCT	0.358													8	10	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192517393	192517393	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192517393G>T	uc011bsp.1	-	2	579	c.258C>A	c.(256-258)TAC>TAA	p.Y86*		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	86											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		AGAGCAACAGGTATTCATTAG	0.453													9	59	---	---	---	---	PASS
SULT1E1	6783	broad.mit.edu	37	4	70715065	70715065	+	Intron	SNP	G	A	A	rs143147676	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70715065G>A	uc003heo.2	-						SULT1E1_uc010ihv.1_3'UTR	NM_005420	NP_005411	P49888	ST1E1_HUMAN	estrogen sulfotransferase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol|nuclear membrane	estrone sulfotransferase activity|flavonol 3-sulfotransferase activity|steroid binding|steroid sulfotransferase activity			ovary(1)	1						GGAAGAAAACGTACCAGAACA	0.383													3	62	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94436522	94436522	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94436522C>T	uc011cdt.1	+	13	2411	c.2153C>T	c.(2152-2154)TCG>TTG	p.S718L	GRID2_uc011cdu.1_Missense_Mutation_p.S623L	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	718	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	AGCAATGGATCGGAGAACAAT	0.468													4	122	---	---	---	---	PASS
DKK2	27123	broad.mit.edu	37	4	107845202	107845202	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107845202C>T	uc003hyi.2	-	4	1394	c.689G>A	c.(688-690)CGT>CAT	p.R230H	DKK2_uc003hyj.1_3'UTR	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	230	DKK-type Cys-2.				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ACAGTCGCAACGCTGGAAAAT	0.488													26	270	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19503127	19503127	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19503127G>A	uc003jgc.2	-	10	1981	c.1604C>T	c.(1603-1605)CCA>CTA	p.P535L	CDH18_uc003jgd.2_Missense_Mutation_p.P535L|CDH18_uc011cnm.1_Missense_Mutation_p.P535L	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	535	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGTGAAGTTTGGATTTACAGG	0.348													13	121	---	---	---	---	PASS
HSPB3	8988	broad.mit.edu	37	5	53752034	53752034	+	Silent	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53752034T>C	uc003jph.1	+	1	590	c.415T>C	c.(415-417)TTG>CTG	p.L139L		NM_006308	NP_006299	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	139					cell death|response to heat|response to unfolded protein	cytoplasm|nucleus					0		Lung NSC(810;0.00104)				TGATGGAATTTTGGTGGTGGA	0.458													5	204	---	---	---	---	PASS
ANKRD55	79722	broad.mit.edu	37	5	55472069	55472069	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55472069C>T	uc003jqu.2	-	4	374	c.222G>A	c.(220-222)GCG>GCA	p.A74A		NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1	73	ANK 2.									skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TCACTGTGTCCGCTTGACGTC	0.493													5	206	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140250899	140250899	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250899G>A	uc003lia.2	+	1	3069	c.2211G>A	c.(2209-2211)ACG>ACA	p.T737T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.T737T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	737	Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAGCCCACGCTGGTGTGCT	0.687													4	29	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476832	140476832	+	3'UTR	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476832G>A	uc003lil.2	+	1					PCDHB2_uc003lim.1_3'UTR	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTTTTTACTGCTTTGCCCAT	0.358													14	185	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140588556	140588556	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140588556C>T	uc003liz.2	+	1	266	c.77C>T	c.(76-78)GCG>GTG	p.A26V	PCDHB12_uc011dak.1_5'UTR	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	26					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGTCTCAGGCGGGCTCTGAA	0.498													4	142	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140794640	140794640	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794640C>T	uc003lkl.1	+	1	1898	c.1898C>T	c.(1897-1899)GCG>GTG	p.A633V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.A633V|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	633	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCGCACGGCGCGAGCCCTG	0.692													29	59	---	---	---	---	PASS
UBTD2	92181	broad.mit.edu	37	5	171639164	171639164	+	Silent	SNP	C	T	T	rs77455843	byFrequency	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171639164C>T	uc003mbp.1	-	3	501	c.375G>A	c.(373-375)CCG>CCA	p.P125P		NM_152277	NP_689490	Q8WUN7	UBTD2_HUMAN	dendritic cell-derived ubiquitin-like protein	125						cytoplasm					0	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGTTGATTGGCGGTGCCAAGC	0.438													4	162	---	---	---	---	PASS
FAM153B	202134	broad.mit.edu	37	5	175528584	175528584	+	Missense_Mutation	SNP	C	T	T	rs150706760	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175528584C>T	uc003mdk.2	+	12	721	c.664C>T	c.(664-666)CTT>TTT	p.L222F		NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134	222										ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		ACTGGCCGAACGTACGTATTC	0.463													5	180	---	---	---	---	PASS
MYLIP	29116	broad.mit.edu	37	6	16130871	16130871	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16130871C>A	uc003nbq.2	+	2	408	c.171C>A	c.(169-171)AAC>AAA	p.N57K	MYLIP_uc003nbr.2_Intron	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	57	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			TATGGCTAAACCTGAGAAACC	0.458													5	117	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25600968	25600968	+	Silent	SNP	G	A	A	rs10456324	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25600968G>A	uc011djw.1	+	33	3922	c.3546G>A	c.(3544-3546)GCG>GCA	p.A1182A	LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Silent_p.A1182A	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1182					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						CTGCGTGTGCGCAGAAGGTAA	0.373													7	10	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32021196	32021196	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32021196G>A	uc003nzl.2	-	25	8956	c.8754C>T	c.(8752-8754)CGC>CGT	p.R2918R		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2967	Fibronectin type-III 21.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						TGGGGCCCACGCGCTGGCCAC	0.632													5	15	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57393160	57393160	+	Silent	SNP	G	A	A	rs76686926		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57393160G>A	uc003pdx.2	+	9	897	c.810G>A	c.(808-810)AAG>AAA	p.K270K		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	270					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATGTTGGGAAGATTTCTTTAG	0.279													4	10	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90382073	90382073	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90382073T>C	uc003pnn.1	-	82	13756	c.13640A>G	c.(13639-13641)GAG>GGG	p.E4547G		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4547					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTGCAGTCTCTCAAAGCCTGC	0.398													3	139	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170597588	170597588	+	Intron	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170597588C>T	uc003qxm.2	-						DLL1_uc011ehc.1_Intron|DLL1_uc003qxn.3_3'UTR	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor						cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GGGTTTTCTACGGGGAGAAGA	0.637													3	70	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23164685	23164685	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23164685C>G	uc003svs.3	+	4	629	c.336C>G	c.(334-336)AAC>AAG	p.N112K	KLHL7_uc003svr.3_Missense_Mutation_p.N90K|KLHL7_uc011jys.1_Missense_Mutation_p.N36K|KLHL7_uc011jyt.1_Intron|KLHL7_uc003svt.2_Missense_Mutation_p.N64K|KLHL7_uc003svp.2_Missense_Mutation_p.N90K|KLHL7_uc003svq.2_Missense_Mutation_p.N112K|KLHL7_uc011jyu.1_Missense_Mutation_p.N90K	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	112						Golgi apparatus|nucleolus|plasma membrane					0						TGAATAGCAACAATGTTCAGT	0.328													8	97	---	---	---	---	PASS
KIAA0895	23366	broad.mit.edu	37	7	36423479	36423479	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36423479A>G	uc003tfd.2	-	2	218	c.167T>C	c.(166-168)TTC>TCC	p.F56S		NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN	hypothetical protein LOC23366 isoform 1	56											0						TGAGGTAGAGAACTTGAGTTT	0.274													6	78	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89912266	89912266	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89912266C>T	uc010lep.2	+	13	1684	c.1433C>T	c.(1432-1434)GCC>GTC	p.A478V	C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.A153V|C7orf63_uc011khj.1_Missense_Mutation_p.A460V|C7orf63_uc011khk.1_Missense_Mutation_p.A40V	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	478							binding			ovary(1)	1						AACAAGTTTGCCCAGATGCGT	0.398													3	94	---	---	---	---	PASS
NKX3-1	4824	broad.mit.edu	37	8	23538928	23538928	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23538928A>G	uc011kzx.1	-	2	559	c.511T>C	c.(511-513)TGG>CGG	p.W171R	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	171	Homeobox.				negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TTCTGGAACCATATCTTCACT	0.562													15	248	---	---	---	---	PASS
INTS9	55756	broad.mit.edu	37	8	28633369	28633369	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28633369G>A	uc003xha.2	-	14	1769	c.1470C>T	c.(1468-1470)ATC>ATT	p.I490I	INTS9_uc011lav.1_Silent_p.I466I|INTS9_uc011law.1_Silent_p.I469I|INTS9_uc011lax.1_Silent_p.I383I|INTS9_uc010lvc.2_RNA	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1	490					snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		GCTGGCAGTCGATCATGAGGT	0.612													4	53	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885073	88885073	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885073C>T	uc003ydz.2	-	1	1224	c.1127G>A	c.(1126-1128)CGA>CAA	p.R376Q		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	376										ovary(1)	1						TGGTGCTCCTCGGAAGCCCCC	0.582													44	57	---	---	---	---	PASS
RAD21	5885	broad.mit.edu	37	8	117878924	117878924	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117878924G>A	uc003yod.2	-	2	333	c.45C>T	c.(43-45)GCC>GCT	p.A15A		NM_006265	NP_006256	O60216	RAD21_HUMAN	RAD21 homolog	15					apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding			lung(1)|skin(1)	2	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					GCCAAATTTTGGCCAGAGGCC	0.433													3	85	---	---	---	---	PASS
RPL8	6132	broad.mit.edu	37	8	146017507	146017507	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146017507C>T	uc003zeb.2	-	2	119	c.8G>A	c.(7-9)CGT>CAT	p.R3H	RPL8_uc003zdz.2_RNA|RPL8_uc003zea.2_Missense_Mutation_p.R3H|RPL8_uc003zec.2_Missense_Mutation_p.R3H|RPL8_uc010mgc.2_Missense_Mutation_p.R3H|RPL8_uc011lll.1_5'Flank	NM_033301	NP_150644	P62917	RL8_HUMAN	ribosomal protein L8	3					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	rRNA binding|structural constituent of ribosome				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		ACGGATCACACGGCCCATGGC	0.736													3	23	---	---	---	---	PASS
FCN1	2219	broad.mit.edu	37	9	137803057	137803057	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137803057T>C	uc004cfi.2	-	8	747	c.655A>G	c.(655-657)AAG>GAG	p.K219E		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	219	Fibrinogen C-terminal.				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GATTTGTACTTAGCAAACTGG	0.527													10	434	---	---	---	---	PASS
LHX3	8022	broad.mit.edu	37	9	139090531	139090531	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139090531C>T	uc004cha.2	-	5	839	c.742G>A	c.(742-744)GGG>AGG	p.G248R	LHX3_uc004cgz.2_Missense_Mutation_p.G253R	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a	248					inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CTGTCCTGCCCCTCCTGAACG	0.711													9	15	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24889811	24889811	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24889811G>A	uc001isb.2	-	14	3383	c.2896C>T	c.(2896-2898)CGG>TGG	p.R966W	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.R966W|ARHGAP21_uc010qdc.1_Missense_Mutation_p.R801W	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	965	Interaction with ARF1 and ARF6.|PH.				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						GAATGACCCCGAAGGACAACA	0.423													14	146	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	62038559	62038559	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62038559A>C	uc001jky.2	-	4	579	c.387T>G	c.(385-387)AAT>AAG	p.N129K	ANK3_uc010qih.1_Missense_Mutation_p.N112K|ANK3_uc001jkz.3_Missense_Mutation_p.N123K|ANK3_uc001jlb.1_5'UTR	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	129	ANK 2.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CATTGGCTCCATTTGTAACCA	0.418													14	181	---	---	---	---	PASS
DUSP13	51207	broad.mit.edu	37	10	76854507	76854507	+	3'UTR	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76854507C>T	uc001jws.2	-	8					DUSP13_uc001jwr.2_Missense_Mutation_p.C175Y|DUSP13_uc001jwu.2_Missense_Mutation_p.C268Y|DUSP13_uc001jww.2_Missense_Mutation_p.C225Y|DUSP13_uc009xrs.2_Missense_Mutation_p.C268Y|DUSP13_uc001jwt.2_Missense_Mutation_p.C268Y|DUSP13_uc001jwv.2_Missense_Mutation_p.C175Y	NM_001007271	NP_001007272	Q6B8I1	MDSP_HUMAN	muscle-restricted dual specificity phosphatase							cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TGAGTTAGGGCAGATATTGCG	0.617													11	31	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91470871	91470871	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91470871G>A	uc001kgs.1	+	6	716	c.644G>A	c.(643-645)AGC>AAC	p.S215N	KIF20B_uc001kgr.1_Missense_Mutation_p.S215N	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	215	Kinesin-motor.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GAAATTGCTAGCAAAAGTGCA	0.313													11	130	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21596534	21596534	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21596534G>T	uc001mqe.2	+	20	2552	c.2399G>T	c.(2398-2400)TGT>TTT	p.C800F	NELL1_uc001mqf.2_Missense_Mutation_p.C753F|NELL1_uc009yid.2_Missense_Mutation_p.C828F|NELL1_uc010rdo.1_Missense_Mutation_p.C743F|NELL1_uc010rdp.1_Missense_Mutation_p.C513F|NELL1_uc001mqh.2_Missense_Mutation_p.C345F	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	800	VWFC 5.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AGAGTCTGTTGTTCTGTGGAT	0.358													3	87	---	---	---	---	PASS
CHST1	8534	broad.mit.edu	37	11	45672090	45672090	+	Silent	SNP	G	A	A	rs143571003	byFrequency	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45672090G>A	uc001mys.1	-	4	1055	c.384C>T	c.(382-384)TAC>TAT	p.Y128Y		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	128	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GGTCGCAGTCGTAGAGGCTCC	0.677													3	35	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401517	46401517	+	3'UTR	SNP	A	G	G	rs61882687	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401517A>G	uc001ncn.1	+	32					DGKZ_uc001nch.1_3'UTR|DGKZ_uc001ncj.1_3'UTR|DGKZ_uc010rgr.1_3'UTR|DGKZ_uc001nck.1_3'UTR|DGKZ_uc001ncl.2_3'UTR|DGKZ_uc001ncm.2_3'UTR|DGKZ_uc009yky.1_3'UTR|DGKZ_uc010rgs.1_3'UTR|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CACGGGCAGCAGGAGGGACAA	0.682													4	7	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47345221	47345221	+	Splice_Site	SNP	G	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47345221G>C	uc001ner.1	+	31	4569	c.4378_splice	c.e31-1	p.V1460_splice	MADD_uc001neq.2_Splice_Site_p.V1401_splice|MADD_uc001nev.1_Splice_Site_p.V1358_splice|MADD_uc001nes.1_Splice_Site_p.V1378_splice|MADD_uc001net.1_Splice_Site_p.V1421_splice|MADD_uc009yln.1_Splice_Site_p.V1354_splice|MADD_uc001neu.1_Splice_Site_p.V1358_splice|MADD_uc001nex.2_Splice_Site_p.V1460_splice|MADD_uc001nez.2_Splice_Site_p.V1357_splice|MADD_uc001new.2_Splice_Site_p.V1400_splice|MADD_uc009ylo.2_Splice_Site_p.V374_splice	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing						activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		CACTTCTCCAGGTGTGCGATG	0.542													3	97	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798258	55798258	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798258C>T	uc010riw.1	+	1	364	c.364C>T	c.(364-366)CGC>TGC	p.R122C		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					GGCTTATGACCGCTATGCAGC	0.458													11	127	---	---	---	---	PASS
SPDYC	387778	broad.mit.edu	37	11	64939787	64939787	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64939787G>A	uc010rnz.1	+	4	329	c.329G>A	c.(328-330)AGC>AAC	p.S110N		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	110	Speedy/Ringo box; Required for CDK- binding (By similarity).				cell cycle	nucleus	protein kinase binding				0						ACCCACAGCAGCCTGTTCTTG	0.612													10	113	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92000	92000	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92000A>T	uc010sdi.1	-	2	338	c.310T>A	c.(310-312)TTG>ATG	p.L104M	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		GGTCCTGGCAACACTCTGGAC	0.572													4	3	---	---	---	---	PASS
KLRK1	22914	broad.mit.edu	37	12	10562330	10562330	+	5'UTR	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10562330G>T	uc009zhk.2	-	1					KLRK1_uc001qyc.2_5'Flank|KLRK1_uc001qyd.2_Intron|KLRC4_uc001qye.2_5'UTR	NM_007360	NP_031386	P26718	NKG2D_HUMAN	NKG2-D type II integral membrane protein						natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding				0						CAATATAAAAGTCTGGTACTA	0.323													8	22	---	---	---	---	PASS
RBMS2	5939	broad.mit.edu	37	12	56963707	56963707	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56963707G>A	uc001sln.2	+	4	516	c.317G>A	c.(316-318)AGC>AAC	p.S106N	RBMS2_uc010sqp.1_5'UTR|RBMS2_uc010sqq.1_5'UTR|RBMS2_uc009zou.2_5'UTR	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting	106	RRM 1.				RNA processing	nucleus	nucleotide binding|RNA binding				0						GATTTTGACAGCCCTTCAGCA	0.512													3	139	---	---	---	---	PASS
B4GALNT1	2583	broad.mit.edu	37	12	58022636	58022636	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58022636G>T	uc001spg.1	-	8	1294	c.862C>A	c.(862-864)CGT>AGT	p.R288S	B4GALNT1_uc010sru.1_Missense_Mutation_p.R233S|B4GALNT1_uc010srv.1_Missense_Mutation_p.R255S	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	288	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CGATCATAACGGAGGAAGGTC	0.582													3	69	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120657110	120657110	+	Intron	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120657110G>A	uc001txt.2	-						PXN_uc001txu.2_5'Flank|PXN_uc001txv.2_Intron|PXN_uc001txx.2_Intron|PXN_uc001txy.2_Intron|PXN_uc001txz.2_RNA|uc001tya.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1						cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCAGCTTCCGTGGTGCCCTC	0.622													4	121	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49776084	49776084	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49776084G>T	uc001vcm.2	+	24	3441	c.3136G>T	c.(3136-3138)GTC>TTC	p.V1046F	FNDC3A_uc001vcn.2_Missense_Mutation_p.V1046F|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcq.2_Missense_Mutation_p.V990F	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1046						Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TCCAAAATCTGTCCCAGCTGC	0.318													7	167	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58299273	58299273	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58299273C>T	uc001vhq.1	+	4	4217	c.3325C>T	c.(3325-3327)CGG>TGG	p.R1109W	PCDH17_uc010aec.1_Missense_Mutation_p.R1108W|PCDH17_uc001vhr.1_Missense_Mutation_p.R198W	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1109	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAGAGCCAGCCGGGATTCCAG	0.522													12	285	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103698541	103698541	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103698541G>A	uc001vpy.3	-	6	1586	c.989C>T	c.(988-990)ACG>ATG	p.T330M		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	330	Cytoplasmic (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CTCTGGCTCCGTTCCATTTTC	0.373													4	106	---	---	---	---	PASS
IRS2	8660	broad.mit.edu	37	13	110434668	110434668	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110434668C>A	uc001vqv.2	-	1	4247	c.3733G>T	c.(3733-3735)GCC>TCC	p.A1245S		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1245					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGGAAGCCGGCAGAGGTCTCT	0.532													5	23	---	---	---	---	PASS
NUBPL	80224	broad.mit.edu	37	14	32295838	32295838	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32295838C>T	uc001wrk.3	+	8	666	c.611C>T	c.(610-612)GCT>GTT	p.A204V	NUBPL_uc010amj.2_RNA|NUBPL_uc010tpl.1_Missense_Mutation_p.A108V	NM_025152	NP_079428	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	204					mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		TGGCTAGGTGCTGTGATTGTC	0.428													24	94	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59113436	59113436	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59113436C>T	uc001xdw.2	+	4	2259	c.2095C>T	c.(2095-2097)CGG>TGG	p.R699W	DACT1_uc010trv.1_Missense_Mutation_p.R418W|DACT1_uc001xdx.2_Missense_Mutation_p.R662W|DACT1_uc010trw.1_Missense_Mutation_p.R418W	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	699					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						GCGCGGTCGCCGGGAGAATGT	0.667													3	53	---	---	---	---	PASS
FNTB	2342	broad.mit.edu	37	14	65494234	65494234	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65494234G>T	uc001xia.2	+	5	603	c.438G>T	c.(436-438)CAG>CAT	p.Q146H	FNTB_uc010tsl.1_Missense_Mutation_p.Q180H|FNTB_uc010tsm.1_Missense_Mutation_p.Q100H|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_5'UTR|FNTB_uc010tso.1_Missense_Mutation_p.Q61H	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	146	PFTB 1.				protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GACCCGGTCAGTATCCACACC	0.517													7	121	---	---	---	---	PASS
AKT1	207	broad.mit.edu	37	14	105246551	105246551	+	Missense_Mutation	SNP	C	T	T	rs34409589		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105246551C>T	uc001ypk.2	-	3	603	c.49G>A	c.(49-51)GAG>AAG	p.E17K	INF2_uc010tyi.1_Intron|AKT1_uc001ypl.2_Missense_Mutation_p.E17K|AKT1_uc010axa.2_Missense_Mutation_p.E17K|AKT1_uc001ypm.2_Missense_Mutation_p.E17K|AKT1_uc001ypn.2_Missense_Mutation_p.E17K|AKT1_uc010tyk.1_5'Flank	NM_005163	NP_005154	P31749	AKT1_HUMAN	AKT1 kinase	17	PH.		E -> K (in breast cancer; also detected in colorectal and ovarian cancer; somatic mutation; alters the PH domain conformation; results in activation of the protein; alters the subcellular location of the protein to the plasma membrane).	E->K: Increase in basal ubiquitination, phosphorylation at T-308 and important increase in membrane recruitment. Decrease in ubiquitination, phosphorylation at T-308 as well as impaired association with the membrane; when associated with R-8.	activation of pro-apoptotic gene products|activation-induced cell death of T cells|endocrine pancreas development|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen biosynthetic process|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|mRNA metabolic process|negative regulation of fatty acid beta-oxidation|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|nitric oxide biosynthetic process|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of blood vessel endothelial cell migration|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of establishment of protein localization in plasma membrane|positive regulation of fat cell differentiation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein autophosphorylation|protein import into nucleus, translocation|regulation of neuron projection development|regulation of translation|response to fluid shear stress|response to heat|response to UV-A|T cell costimulation	cytosol|nucleoplasm|plasma membrane	enzyme binding|identical protein binding|nitric-oxide synthase regulator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein serine/threonine kinase activity	p.E17K(126)		breast(86)|urinary_tract(12)|thyroid(10)|lung(7)|endometrium(5)|large_intestine(4)|skin(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	134		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	TTGATGTACTCCCCTACAGAC	0.612	E17K(KU1919_URINARY_TRACT)	1	Mis		breast|colorectal|ovarian|NSCLC								7	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22466162	22466162	+	5'Flank	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466162G>A	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		CTGCCCTGGAGCTTCTGTGAA	0.527													5	262	---	---	---	---	PASS
C15orf55	256646	broad.mit.edu	37	15	34649647	34649647	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34649647C>T	uc001zif.2	+	7	3509	c.3354C>T	c.(3352-3354)GAC>GAT	p.D1118D	C15orf55_uc010ucc.1_Silent_p.D1146D|C15orf55_uc010ucd.1_Silent_p.D1136D	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	1118						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		GGCGGTGTGACAGTTTTGTCA	0.582			T	BRD3|BRD4	lethal midline carcinoma								65	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	83395340	83395340	+	Missense_Mutation	SNP	T	C	C	rs11633991	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83395340T>C	uc002bjb.2	-	3	962	c.493A>G	c.(493-495)ATG>GTG	p.M165V						Homo sapiens actin, gamma pseudogene, mRNA (cDNA clone IMAGE:4866674), with apparent retained intron.																		TCACACTTCATGATGGAGGTC	0.527													8	5	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85410592	85410592	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85410592C>T	uc002ble.2	+	13	5541	c.5374C>T	c.(5374-5376)CGA>TGA	p.R1792*	ALPK3_uc010upc.1_Nonsense_Mutation_p.R93*	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1792	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TACCAAACTCCGAGGGTGAGT	0.542													5	82	---	---	---	---	PASS
ALDH1A3	220	broad.mit.edu	37	15	101425511	101425511	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101425511A>G	uc002bwn.3	+	2	243	c.139A>G	c.(139-141)AAA>GAA	p.K47E	ALDH1A3_uc010bpb.2_Missense_Mutation_p.K47E|ALDH1A3_uc010bpa.1_Missense_Mutation_p.K47E	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3	47					retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)	CAAGAGTGGGAAAAAGTTTGC	0.333													33	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102292837	102292837	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292837G>A	uc010usj.1	+	4	484	c.425G>A	c.(424-426)AGG>AAG	p.R142K	uc002bxo.2_5'Flank|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		CACTCGTGGAGGCGTCGGCAG	0.602													4	9	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	830489	830489	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:830489C>T	uc002cjz.1	-	3	512	c.512G>A	c.(511-513)CGC>CAC	p.R171H		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	Error:Variant_position_missing_in_Q96KJ4_after_alignment					cell adhesion	integral to membrane				breast(3)|ovary(1)	4						TGGATGCGTGCGGGCACGCAT	0.552													13	156	---	---	---	---	PASS
A2BP1	54715	broad.mit.edu	37	16	7568237	7568237	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7568237C>T	uc002cys.2	+	5	1104	c.116C>T	c.(115-117)GCG>GTG	p.A39V	A2BP1_uc010buf.1_Missense_Mutation_p.A39V|A2BP1_uc002cyr.1_Missense_Mutation_p.A39V|A2BP1_uc002cyt.2_Missense_Mutation_p.A39V|A2BP1_uc010uxz.1_Missense_Mutation_p.A82V|A2BP1_uc010uya.1_Missense_Mutation_p.A75V|A2BP1_uc002cyv.1_Missense_Mutation_p.A39V|A2BP1_uc010uyb.1_Missense_Mutation_p.A39V|A2BP1_uc002cyw.2_Missense_Mutation_p.A59V|A2BP1_uc002cyy.2_Missense_Mutation_p.A59V|A2BP1_uc002cyx.2_Missense_Mutation_p.A59V|A2BP1_uc010uyc.1_Missense_Mutation_p.A59V	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	39					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		GGTATCCCCGCGGAATACACG	0.612													22	199	---	---	---	---	PASS
IGSF6	10261	broad.mit.edu	37	16	21658345	21658345	+	Intron	SNP	T	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21658345T>G	uc002djg.1	-						uc002diq.3_Intron|METTL9_uc002dje.2_Intron|METTL9_uc002djf.2_Intron|IGSF6_uc010vbi.1_3'UTR	NM_005849	NP_005840	O95976	IGSF6_HUMAN	immunoglobulin superfamily, member 6 precursor						cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0				GBM - Glioblastoma multiforme(48;0.066)		CTGGCTAGGGTATTAACTTAG	0.348													10	26	---	---	---	---	PASS
HERC2P4	440362	broad.mit.edu	37	16	32163607	32163607	+	RNA	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32163607G>A	uc002ecx.2	-	2		c.164C>T				NR_002827				Homo sapiens hect domain and RLD 2 pseudogene 4, mRNA (cDNA clone IMAGE:5416019).												0						AGCCAGGACCGCCATGAGGCC	0.602													4	7	---	---	---	---	PASS
SETD6	79918	broad.mit.edu	37	16	58550873	58550873	+	Intron	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58550873C>A	uc002ens.2	+						SETD6_uc010cdl.2_Nonsense_Mutation_p.S278*|SETD6_uc002enr.2_Intron|SETD6_uc010cdm.2_Intron	NM_001160305	NP_001153777	Q8TBK2	SETD6_HUMAN	SET domain containing 6 isoform a						negative regulation of NF-kappaB transcription factor activity|peptidyl-lysine monomethylation|regulation of inflammatory response	nucleus	NF-kappaB binding|protein-lysine N-methyltransferase activity			ovary(1)	1						GAGCATGATTCAAGCCATTGT	0.428													7	66	---	---	---	---	PASS
CALB2	794	broad.mit.edu	37	16	71419500	71419500	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71419500C>T	uc002faa.3	+	10	718	c.648C>T	c.(646-648)GAC>GAT	p.D216D	CALB2_uc010vme.1_RNA|CALB2_uc002fac.3_Missense_Mutation_p.T185M	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1	216	5 (Probable).|EF-hand 5.						calcium ion binding				0		Ovarian(137;0.125)				GCTACATTGACGAGCATGAGC	0.567													11	32	---	---	---	---	PASS
ATMIN	23300	broad.mit.edu	37	16	81078505	81078505	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81078505C>G	uc002ffz.1	+	4	2420	c.2402C>G	c.(2401-2403)ACG>AGG	p.T801R	ATMIN_uc002fga.2_Missense_Mutation_p.T643R|ATMIN_uc010vnn.1_Missense_Mutation_p.T572R|ATMIN_uc002fgb.1_Missense_Mutation_p.T643R	NM_015251	NP_056066	O43313	ATMIN_HUMAN	ATM interactor	801					response to DNA damage stimulus	nucleus	zinc ion binding				0						GCCTGGAACACGATGGAGTCT	0.488													5	136	---	---	---	---	PASS
FAM18B2	201158	broad.mit.edu	37	17	15441443	15441443	+	Intron	SNP	A	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15441443A>G	uc002goq.2	-						CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron|FAM18B2_uc010cor.2_3'UTR	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		TTCTCTATTCAGGAAGTCTGA	0.418													9	120	---	---	---	---	PASS
CCDC144NL	339184	broad.mit.edu	37	17	20768608	20768608	+	3'UTR	SNP	G	A	A	rs4347684	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768608G>A	uc002gyf.2	-	4						NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						AACCTCTAGAGTGATCAGTTT	0.318													4	19	---	---	---	---	PASS
KSR1	8844	broad.mit.edu	37	17	25931720	25931720	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25931720C>T	uc010crg.2	+	14	1680	c.1235C>T	c.(1234-1236)CCG>CTG	p.P412L	KSR1_uc002gzj.1_RNA|KSR1_uc002gzm.2_Missense_Mutation_p.P191L	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	547					Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GATGACCAGCCGAAAGCAGAT	0.552													14	81	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630695	44630695	+	3'UTR	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630695G>T	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						ATGAATAAAAGGAATCAATAC	0.333													6	256	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630848	44630848	+	3'UTR	SNP	C	T	T	rs139733485	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630848C>T	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						tttttttcttctcttttgaga	0.154													5	276	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630855	44630855	+	3'UTR	SNP	G	C	C	rs144516284	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630855G>C	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						cttctcttttgagacggagtt	0.139													5	256	---	---	---	---	PASS
SAP30BP	29115	broad.mit.edu	37	17	73663474	73663474	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73663474C>T	uc002jpe.2	+	1	76	c.22C>T	c.(22-24)CTG>TTG	p.L8L	RECQL5_uc010dgk.2_5'Flank|RECQL5_uc010dgl.2_5'Flank|RECQL5_uc002jpb.1_5'Flank|RECQL5_uc002joz.3_5'Flank|RECQL5_uc002jpa.3_5'Flank|SAP30BP_uc010dgm.1_Silent_p.L8L|SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Silent_p.L8L	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	transcriptional regulator protein	8					apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAAGAATGTTCTGTCGTCTCT	0.607													5	53	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76755287	76755287	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76755287C>A	uc002lmt.2	+	2	3296	c.3296C>A	c.(3295-3297)GCG>GAG	p.A1099E	SALL3_uc010dra.2_Missense_Mutation_p.A634E	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1099					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCGGGCCTGGCGCCCATGCTG	0.736													2	5	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070399	9070399	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070399C>T	uc002mkp.2	-	3	17251	c.17047G>A	c.(17047-17049)GTA>ATA	p.V5683I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5685	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAACTCGTTACGGGCTCTGGG	0.512													7	73	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15132481	15132481	+	Silent	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15132481G>A	uc002nae.2	+	5	1194	c.1095G>A	c.(1093-1095)ACG>ACA	p.T365T		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	365					microtubule cytoskeleton organization	microtubule				ovary(1)	1						TCCGGTGTACGAAATATAACC	0.592													9	63	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21990989	21990989	+	Missense_Mutation	SNP	G	C	C	rs150351501		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21990989G>C	uc002nqj.2	-	4	1980	c.1850C>G	c.(1849-1851)ACT>AGT	p.T617S	ZNF43_uc010ecv.2_Missense_Mutation_p.T611S|ZNF43_uc002nql.2_Missense_Mutation_p.T611S|ZNF43_uc002nqm.2_Missense_Mutation_p.T611S|ZNF43_uc002nqk.2_Missense_Mutation_p.T547S	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	617					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTTTCCTCCAGTATGAATTTT	0.343													8	116	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22157070	22157070	+	Missense_Mutation	SNP	A	G	G	rs61739967		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157070A>G	uc002nqp.2	-	4	915	c.766T>C	c.(766-768)TCC>CCC	p.S256P	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATTTGTAGGATTTCTCTCCA	0.358													4	89	---	---	---	---	PASS
LRFN3	79414	broad.mit.edu	37	19	36430885	36430885	+	Silent	SNP	C	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36430885C>A	uc002oco.2	+	2	1010	c.558C>A	c.(556-558)GGC>GGA	p.G186G		NM_024509	NP_078785	Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III	186	Extracellular (Potential).|LRR 6.				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ACACGTTGGGCCTCGACCACA	0.647													6	136	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54646887	54646887	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54646887G>A	uc002qdj.1	+	3	369	c.58G>A	c.(58-60)GAG>AAG	p.E20K	CNOT3_uc010yel.1_Missense_Mutation_p.E20K|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Missense_Mutation_p.E20K|CNOT3_uc010ere.1_5'Flank	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	20					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	p.E20K(1)		ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAAGGTGTCCGAGGGCGTGGA	0.557													19	241	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56572913	56572913	+	3'UTR	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56572913C>T	uc002qmj.2	+	15					NLRP5_uc002qmi.2_3'UTR	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AAACCTGCCCCACTCACACCC	0.468													6	110	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													3	19	---	---	---	---	PASS
SEC23B	10483	broad.mit.edu	37	20	18505662	18505662	+	Silent	SNP	C	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18505662C>T	uc002wqz.1	+	6	1130	c.687C>T	c.(685-687)AGC>AGT	p.S229S	SEC23B_uc002wra.1_Silent_p.S229S|SEC23B_uc002wrb.1_Silent_p.S229S|SEC23B_uc010zsb.1_Silent_p.S211S|SEC23B_uc002wrc.1_Silent_p.S229S	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	229					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TTGCTTCAAGCAGGTGAGAGC	0.358													3	49	---	---	---	---	PASS
KRTAP19-5	337972	broad.mit.edu	37	21	31874243	31874243	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31874243G>A	uc011ada.1	-	1	166	c.166C>T	c.(166-168)CGC>TGC	p.R56C		NM_181611	NP_853642	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	56						intermediate filament	protein binding				0						CGGCAGCTGCGGTATCCATAG	0.532													4	91	---	---	---	---	PASS
AIFM3	150209	broad.mit.edu	37	22	21330001	21330001	+	Missense_Mutation	SNP	G	T	T	rs143272206		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21330001G>T	uc002ztj.2	+	9	959	c.741G>T	c.(739-741)GAG>GAT	p.E247D	AIFM3_uc002ztk.2_Missense_Mutation_p.E247D|AIFM3_uc002ztl.2_Missense_Mutation_p.E253D|AIFM3_uc011ahx.1_Missense_Mutation_p.E235D|AIFM3_uc002ztm.1_Missense_Mutation_p.E59D	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	247					activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACAGCCTGAGCAGCTGGCCC	0.463													11	129	---	---	---	---	PASS
PACSIN2	11252	broad.mit.edu	37	22	43289513	43289513	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43289513G>A	uc010gzg.2	-	3	389	c.167C>T	c.(166-168)GCG>GTG	p.A56V	PACSIN2_uc003bdg.3_Missense_Mutation_p.A56V|PACSIN2_uc003bde.3_Missense_Mutation_p.A56V|PACSIN2_uc003bdf.3_Missense_Mutation_p.A56V	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	56	FCH.				actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				GAGCTGCTGCGCATACGCCTT	0.652													7	63	---	---	---	---	PASS
ARSE	415	broad.mit.edu	37	X	2867523	2867523	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2867523G>A	uc004crc.3	-	6	926	c.676C>T	c.(676-678)CCG>TCG	p.P226S	ARSE_uc011mhi.1_Missense_Mutation_p.P172S|ARSE_uc011mhh.1_Missense_Mutation_p.P251S	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	226					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGATGACCGGCATCCACGAG	0.542													3	47	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83411185	83411185	+	Silent	SNP	A	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83411185A>T	uc004eej.1	-	3	233	c.156T>A	c.(154-156)GTT>GTA	p.V52V	RPS6KA6_uc011mqt.1_Silent_p.V52V|RPS6KA6_uc011mqu.1_5'UTR|RPS6KA6_uc010nmo.1_RNA	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	52					axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						GGATTTCTTTAACAACTCCTT	0.353													5	39	---	---	---	---	PASS
MST4	51765	broad.mit.edu	37	X	131207114	131207114	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131207114T>A	uc004ewk.1	+	11	1520	c.1219T>A	c.(1219-1221)TTT>ATT	p.F407I	MST4_uc004ewl.1_Missense_Mutation_p.F330I|MST4_uc011mux.1_Missense_Mutation_p.F429I|MST4_uc010nrj.1_Missense_Mutation_p.F383I|MST4_uc004ewm.1_Missense_Mutation_p.F345I	NM_016542	NP_057626	Q9P289	MST4_HUMAN	serine/threonine protein kinase MST4 isoform 1	407					cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(192;0.000127)					AATTGAAAAATTTCAAAAGTA	0.343													3	66	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148037365	148037365	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148037365G>A	uc004fcp.2	+	11	2269	c.1790G>A	c.(1789-1791)CGT>CAT	p.R597H	AFF2_uc004fcq.2_Missense_Mutation_p.R587H|AFF2_uc004fcr.2_Missense_Mutation_p.R558H|AFF2_uc011mxb.1_Missense_Mutation_p.R562H|AFF2_uc004fcs.2_Missense_Mutation_p.R564H|AFF2_uc011mxc.1_Missense_Mutation_p.R238H	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	597					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	p.R597C(1)		ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAAAGCCCGTCCACGGCCC	0.468													27	113	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150911712	150911712	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150911712G>A	uc004fey.1	+	7	961	c.737G>A	c.(736-738)CGC>CAC	p.R246H		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	246	Extracellular (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGAGGTGCGCTTCAACCGC	0.532													4	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11775	11775	+	RNA	SNP	G	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11775G>A	uc004cov.3	+	1		c.1198G>A			uc004cow.1_5'Flank|uc004cox.3_5'Flank|uc004coy.2_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		ACGCACTCACAGTCGCATCAT	0.493													3	5	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32687990	32687990	+	5'UTR	DEL	G	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32687990delG	uc001bur.3	+	2					C1orf91_uc001buo.3_5'Flank|C1orf91_uc001bup.3_5'Flank|C1orf91_uc009vub.1_5'Flank|C1orf91_uc010oha.1_5'Flank|C1orf91_uc001buq.3_5'Flank|EIF3I_uc009vuc.2_5'UTR|EIF3I_uc001bus.2_5'Flank	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				AAGTGACCTCGAAACCTTTTC	0.612													120	13	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487408	67487409	+	Intron	DEL	AC	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487408_67487409delAC	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acagacacagacacacacacac	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98913980	98913983	+	IGR	DEL	TCTT	-	-	rs71840822		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98913980_98913983delTCTT								MIR137 (402253 upstream) : SNX7 (213253 downstream)																							tttctctctctctttctttctttc	0.078													4	2	---	---	---	---	
DCST2	127579	broad.mit.edu	37	1	155005742	155005743	+	Splice_Site	INS	-	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155005742_155005743insG	uc001fgm.2	-	2	349	c.269_splice	c.e2-1	p.R90_splice	DCST2_uc009wpb.2_Splice_Site|DCST1_uc010per.1_5'Flank|DCST1_uc001fgn.1_5'Flank|DCST1_uc010pes.1_5'Flank	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGCCCTGCCCTGGGGGCGACAG	0.569													46	25	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169551549	169551550	+	Intron	INS	-	A	A	rs139372356	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169551549_169551550insA	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	cagtactTCTTAAAAAAAAAAC	0.119													5	4	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202194839	202194841	+	Intron	DEL	TCC	-	-	rs6143572		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202194839_202194841delTCC	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						TAGCTTTCATTCCTCTTTGAAAC	0.369													2	5	---	---	---	---	
IL10	3586	broad.mit.edu	37	1	206944846	206944846	+	Intron	DEL	T	-	-	rs76688129		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206944846delT	uc001hen.1	-							NM_000572	NP_000563	P22301	IL10_HUMAN	interleukin 10 precursor						anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			CATTTAGAGattttttttttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242084560	242084561	+	IGR	INS	-	AAGGAAAGGAAAGAAAAG	AAGGAAAGGAAAGAAAAG	rs149406591	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242084560_242084561insAAGGAAAGGAAAGAAAAG								EXO1 (31513 upstream) : MAP1LC3C (74231 downstream)																							gaaggaaagaaaaggaaaggaa	0.188													3	3	---	---	---	---	
STAC	6769	broad.mit.edu	37	3	36484666	36484667	+	Intron	INS	-	G	G			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36484666_36484667insG	uc003cgh.1	+						STAC_uc010hgd.1_Intron|STAC_uc011aya.1_Intron	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain						intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4						GCTTAGTGGCAGGGGCGGGGGA	0.550													6	3	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49318011	49318012	+	Intron	DEL	AG	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49318011_49318012delAG	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		aaaaaaaaaaagaattaaaaaa	0.208													4	3	---	---	---	---	
PIK3CA	5290	broad.mit.edu	37	3	178937631	178937631	+	Intron	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178937631delA	uc003fjk.2	+							NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TTTTATGCTTAAAAAAAAAAA	0.234		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			47	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53614272	53614272	+	Intron	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53614272delA	uc003gzr.2	-						uc003gzs.2_Intron					RecName: Full=Uncharacterized protein LP9056; Flags: Precursor;																		CAAACCCTGTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	68311853	68311855	+	Intron	DEL	GAG	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68311853_68311855delGAG	uc003hdc.1	-											Homo sapiens cDNA FLJ35884 fis, clone TESTI2008960.																		TCTCTATGGCGAGGAGGAGGAGG	0.360													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99996377	99996377	+	Intron	DEL	T	-	-	rs112636325		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99996377delT	uc003hui.2	-						ADH5_uc003huk.1_3'UTR|ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	ttttttgttgttttttttttt	0.119													9	5	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143066776	143066777	+	Intron	INS	-	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143066776_143066777insA	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					GGTAAGATAAGAAAAAAAAAAG	0.347													4	2	---	---	---	---	
ITGA1	3672	broad.mit.edu	37	5	52161834	52161835	+	Intron	INS	-	TTTTTTC	TTTTTTC	rs143046695	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52161834_52161835insTTTTTTC	uc003jou.2	+						ITGA1_uc003jov.2_Intron	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor						axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTATTTTCTATttttttctttt	0.114													6	4	---	---	---	---	
SKIV2L2	23517	broad.mit.edu	37	5	54647037	54647037	+	Intron	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54647037delA	uc003jpy.3	+						SKIV2L2_uc011cqi.1_Intron	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2						maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				AAGTGTAGGTAAAAAAAAAAC	0.169													4	2	---	---	---	---	
NME5	8382	broad.mit.edu	37	5	137474285	137474285	+	Intron	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137474285delT	uc003lce.2	-						BRD8_uc003lcc.1_Intron	NM_003551	NP_003542	P56597	NDK5_HUMAN	non-metastatic cells 5, protein expressed in						anti-apoptosis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatid development|UTP biosynthetic process		ATP binding|nucleoside diphosphate kinase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TACATAAGCATTTTTTTTTTA	0.303													66	7	---	---	---	---	
RAET1E	135250	broad.mit.edu	37	6	150209850	150209850	+	Intron	DEL	A	-	-	rs11316635		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150209850delA	uc003qnl.1	-						uc003qni.1_Intron|RAET1E_uc003qnj.2_Intron|RAET1E_uc003qnk.1_Intron|RAET1E_uc010kih.1_Intron	NM_139165	NP_631904	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E precursor						antigen processing and presentation|immune response|regulation of immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		CCTGTCACATAAAAAAAAAAA	0.338													46	7	---	---	---	---	
LAMB1	3912	broad.mit.edu	37	7	107603153	107603154	+	Intron	DEL	AA	-	-	rs10712981		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107603153_107603154delAA	uc003vew.2	-						LAMB1_uc003vev.2_Intron|LAMB1_uc003vex.2_Intron	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	agcgagactcaaaaaaaaaaaa	0.139													6	3	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													6	6	---	---	---	---	
PIWIL2	55124	broad.mit.edu	37	8	22165711	22165711	+	Intron	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22165711delT	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TTTTTCTAAGTTTTTTTTTTT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30778986	30778986	+	IGR	DEL	C	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30778986delC								TEX15 (32764 upstream) : PURG (74335 downstream)																							TTGATTTCTACAAAAAAAAAA	0.159													4	2	---	---	---	---	
CPA6	57094	broad.mit.edu	37	8	68396310	68396310	+	Intron	DEL	T	-	-	rs71554608		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68396310delT	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ttgccttctcttttttttttt	0.055													4	2	---	---	---	---	
RRM2B	50484	broad.mit.edu	37	8	103231227	103231228	+	Intron	DEL	AT	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103231227_103231228delAT	uc003ykn.2	-						RRM2B_uc003yko.2_Intron|RRM2B_uc010mbv.1_Intron|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)						deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)			AAACATTTGCATATATATATAT	0.351								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					118	7	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460747	110460747	+	Intron	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460747delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			gtttgtttggttttttttttt	0.090										HNSCC(38;0.096)			5	6	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127360949	127360949	+	Intron	DEL	C	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127360949delC	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						aaaaaaaaaacaaggaaggga	0.274													4	3	---	---	---	---	
AIF1L	83543	broad.mit.edu	37	9	133987249	133987254	+	Intron	DEL	CTGCGG	-	-	rs145131993		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133987249_133987254delCTGCGG	uc004cab.1	+						AIF1L_uc004cad.1_Intron|AIF1L_uc004cae.1_Intron|AIF1L_uc004cac.1_Intron|AIF1L_uc011mce.1_Intron	NM_031426	NP_113614	Q9BQI0	AIF1L_HUMAN	ionized calcium binding adapter molecule 2							actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding				0						CTCCCTGCCCCTGCGGGCCCCGTCAC	0.704													10	6	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1046882	1046884	+	Intron	DEL	GCC	-	-	rs41294954		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1046882_1046884delGCC	uc001ift.2	+						GTPBP4_uc010qac.1_Intron|GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		TTTCTTCCTTGCCTAGCCTCTCA	0.360													116	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38981839	38981842	+	IGR	DEL	AGAG	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38981839_38981842delAGAG								LOC399744 (240759 upstream) : None (None downstream)																							ATATGTAGACAGAGAGAGAAATAA	0.275													4	3	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105159974	105159975	+	Intron	INS	-	C	C	rs146704197	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105159974_105159975insC	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AACATTGGCGGCCCCCCCCCTT	0.480													4	3	---	---	---	---	
PSMA1	5682	broad.mit.edu	37	11	14539533	14539534	+	Intron	INS	-	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14539533_14539534insA	uc001mlk.2	-						PSMA1_uc001mll.2_Intron|PSMA1_uc010rcp.1_Intron|PSMA1_uc001mlj.2_Intron|PSMA1_uc010rcq.1_Intron	NM_002786	NP_002777	P25786	PSA1_HUMAN	proteasome alpha 1 subunit isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity			upper_aerodigestive_tract(1)|skin(1)	2						CTGCCCTAAAGAAAAAAAAAAC	0.317													80	7	---	---	---	---	
ARHGDIB	397	broad.mit.edu	37	12	15095806	15095807	+	Intron	INS	-	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15095806_15095807insT	uc001rcq.1	-						ARHGDIB_uc001rcp.1_Intron	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta						actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0						CCTGAGGCATCttttttttttt	0.198													4	2	---	---	---	---	
C12orf71	728858	broad.mit.edu	37	12	27235547	27235548	+	5'Flank	INS	-	T	T	rs138774709		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27235547_27235548insT	uc001rhq.2	-							NM_001080406	NP_001073875	A8MTZ7	CL071_HUMAN	hypothetical protein LOC728858												0						tctcttttttcttttttttttt	0.149													4	2	---	---	---	---	
PUS7L	83448	broad.mit.edu	37	12	44130668	44130669	+	Intron	INS	-	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44130668_44130669insA	uc001rnq.3	-						PUS7L_uc001rnr.3_Intron|PUS7L_uc001rns.3_Intron|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TCCCTGCTATTAAAAAAAAAAA	0.307													4	2	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													3	4	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104661634	104661634	+	Intron	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104661634delT	uc010swk.1	+							NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						cctCTCTCTCttttttttttt	0.020													3	3	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						CACCTTTGCAtttctttctttctt	0.221													5	3	---	---	---	---	
RSRC2	65117	broad.mit.edu	37	12	123003139	123003140	+	Intron	INS	-	A	A	rs139622590		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123003139_123003140insA	uc001ucr.2	-						RSRC2_uc001uco.2_Intron|RSRC2_uc001ucp.2_Intron|RSRC2_uc001ucq.2_Intron|RSRC2_uc001ucs.2_Intron|RSRC2_uc001uct.2_Intron|RSRC2_uc001ucu.2_Intron	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a											ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		gactccgtgtcaaaaaaaaaaa	0.163													7	4	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422613	55422614	+	Intron	INS	-	T	T	rs146484878		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422613_55422614insT	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						CCATGttttccttttttttttt	0.153													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71840028	71840028	+	IGR	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71840028delA								PCNX (257929 upstream) : SNORD56B (25026 downstream)																							actccgtctcaaaaaaaaaaa	0.020													5	3	---	---	---	---	
CCDC78	124093	broad.mit.edu	37	16	773313	773314	+	Intron	INS	-	C	C	rs142788906	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773313_773314insC	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				CTCCTGTGGCGCCCCCCCCAGG	0.693													3	3	---	---	---	---	
ST3GAL2	6483	broad.mit.edu	37	16	70422017	70422017	+	Intron	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70422017delA	uc002eyw.2	-						ST3GAL2_uc002eyx.2_Intron	NM_006927	NP_008858	Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						amino sugar metabolic process	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity			ovary(1)	1		Ovarian(137;0.0694)				ttctgtctccaaaaaaaaaaa	0.189													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20679724	20679724	+	IGR	DEL	G	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20679724delG								LGALS9B (308876 upstream) : CCDC144NL (86986 downstream)																							aaaaaaaaaagaaagaaagaa	0.124													9	4	---	---	---	---	
KRTAP9-9	81870	broad.mit.edu	37	17	39412339	39412340	+	3'UTR	INS	-	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39412339_39412340insC	uc010wfq.1	+	3						NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ATTCTCTTTTTCTTATACCTTG	0.371													1	6	---	---	---	---	
EXOC7	23265	broad.mit.edu	37	17	74099830	74099831	+	5'UTR	INS	-	C	C			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74099830_74099831insC	uc002jqs.2	-	1					EXOC7_uc010dgv.1_5'Flank|EXOC7_uc002jqq.2_5'UTR|EXOC7_uc010wsw.1_5'UTR|EXOC7_uc010wsx.1_5'UTR|EXOC7_uc002jqr.2_5'UTR|EXOC7_uc010wsv.1_5'Flank|EXOC7_uc002jqu.2_5'UTR|EXOC7_uc002jqv.2_5'UTR	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			GGCCCACCGGGCCCCCGTCCCC	0.698													4	2	---	---	---	---	
WDR7	23335	broad.mit.edu	37	18	54398481	54398482	+	Intron	INS	-	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54398481_54398482insA	uc002lgk.1	+						WDR7_uc010dpk.1_Intron|WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		GAAGGAAGTACAAAAAAAAATT	0.327													4	2	---	---	---	---	
MAN2B1	4125	broad.mit.edu	37	19	12767171	12767171	+	Intron	DEL	A	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12767171delA	uc002mub.2	-						MAN2B1_uc010dyv.1_Intron	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1						protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						actccgtctcaaaaaaaaaaa	0.289													4	2	---	---	---	---	
HAPLN4	404037	broad.mit.edu	37	19	19379010	19379010	+	Intron	DEL	C	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19379010delC	uc002nmc.2	-						TM6SF2_uc002nmd.1_Intron	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			tcttttttttcttttttcttt	0.174													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32479566	32479566	+	IGR	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32479566delT								CHMP4B (37397 upstream) : RALY (102166 downstream)																							tctatctttcttttttctttc	0.000													4	2	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37182420	37182421	+	Intron	INS	-	AA	AA	rs11472819		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37182420_37182421insAA	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						agcccagtctcaaaaaaaaaaa	0.104													4	4	---	---	---	---	
PCIF1	63935	broad.mit.edu	37	20	44575249	44575252	+	Intron	DEL	AGTG	-	-	rs72434642		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44575249_44575252delAGTG	uc002xqs.2	+						PCIF1_uc002xqt.2_Intron|PCIF1_uc002xqu.2_5'Flank	NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1							nucleus				skin(1)	1						TGGGTTTCTCAGTGAGTCAGTTCA	0.441													4	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074452	62074453	+	Intron	INS	-	CAC	CAC	rs139636562	by1000genomes	TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074452_62074453insCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	atcaccaccatcaccatcacca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9766012	9766013	+	RNA	INS	-	A	A			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9766012_9766013insA	uc011abu.1	+	8		c.509_510insA								Homo sapiens, clone IMAGE:4720764, mRNA.																		ACAACTATCAGAAAATGTATGT	0.262													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9769306	9769307	+	IGR	INS	-	AAGAT	AAGAT			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9769306_9769307insAAGAT								None (None upstream) : None (None downstream)																							TTCCGAAGTAGAAGAATGAGTT	0.317													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20975867	20975870	+	RNA	DEL	AATA	-	-	rs111319236		TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20975867_20975870delAATA	uc002zsv.2	-	8		c.1854_1857delTATT								Homo sapiens, clone IMAGE:5171202, mRNA.																		AAGCATATGTAATACTCGAACGGA	0.559													8	7	---	---	---	---	
PTCHD1	139411	broad.mit.edu	37	X	23412419	23412420	+	3'UTR	INS	-	AA	AA			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23412419_23412420insAA	uc004dal.3	+	3						NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1						cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						CAGGCATTGCCaaaaaaaaaaa	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	2765368	2765369	+	IGR	INS	-	T	T			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2765368_2765369insT								RPS4Y1 (30373 upstream) : ZFY (37743 downstream)																							AGCAAAATTAGTTTTTTTTTTG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13524407	13524407	+	IGR	DEL	T	-	-			TCGA-EJ-5530-01	TCGA-EJ-5530-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13524407delT								None (None upstream) : None (None downstream)																							TGGAATGAGCTTTCTATGGAG	0.313													5	6	---	---	---	---	
